GET /api/v1/activities/?format=api&page=1219
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "count": 221272,
    "next": "https://panelapp-aus.org/api/v1/activities/?format=api&page=1220",
    "previous": "https://panelapp-aus.org/api/v1/activities/?format=api&page=1218",
    "results": [
        {
            "created": "2021-09-06T11:48:03.689465+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.133",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Str: nipa1 has been classified as Red List (Low Evidence).",
            "entity_name": "NIPA1",
            "entity_type": "str"
        },
        {
            "created": "2021-09-06T11:45:39.858389+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.132",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Deleted their comment",
            "entity_name": "NIPA1",
            "entity_type": "str"
        },
        {
            "created": "2021-09-06T11:37:21.233507+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.132",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Classified STR: NIPA1 as Red List (low evidence)",
            "entity_name": "NIPA1",
            "entity_type": "str"
        },
        {
            "created": "2021-09-06T11:37:21.229207+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.132",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Added comment: Comment on list classification: The odds ratio associated with the expansion of this repeat is not high-risk or high-penetrance, and not useful in the clinical diagnostic setting.",
            "entity_name": "NIPA1",
            "entity_type": "str"
        },
        {
            "created": "2021-09-06T11:37:21.207077+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.132",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Str: nipa1 has been classified as Red List (Low Evidence).",
            "entity_name": "NIPA1",
            "entity_type": "str"
        },
        {
            "created": "2021-09-06T11:35:20.664672+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.131",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "STR: NIPA1 was added\nSTR: NIPA1 was added to Repeat Disorders. Sources: Literature\nMode of inheritance for STR: NIPA1 was set to Unknown\nPublications for STR: NIPA1 were set to 30342764; 22378146\nPhenotypes for STR: NIPA1 were set to Amyotrophic lateral sclerosis\nReview for STR: NIPA1 was set to GREEN\nAdded comment: Meta-analysis on a total of 6245 patients with ALS and 5051 controls showed an overall increased risk of ALS in those with expanded (>8) GCG repeat length, odds ratio = 1.50, p = 3.8×10-5. \nSources: Literature",
            "entity_name": "NIPA1",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T20:06:31.399140+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.42",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: CUBN as ready",
            "entity_name": "CUBN",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T20:06:31.388384+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.42",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: cubn has been classified as Green List (High Evidence).",
            "entity_name": "CUBN",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T20:06:26.610285+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.42",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: CUBN were changed from Megaloblastic anemia-1, Finnish type, 261100; Megaloblastic Anemia; 261100 Megaloblastic anemia-1, Finnish type to Imerslund-Grasbeck syndrome 1, MIM# 261100",
            "entity_name": "CUBN",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T20:06:13.917162+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.41",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: CUBN were set to 17285242; 15024727",
            "entity_name": "CUBN",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T20:05:56.924250+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.40",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: CUBN: Rating: GREEN; Mode of pathogenicity: None; Publications: 10080186, 21208123, 17668238]; Phenotypes: Imerslund-Grasbeck syndrome 1, MIM# 261100; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "CUBN",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:35:41.647690+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.40",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "changed review comment from: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs).; to: Missense variant reported in 4 affected individuals from 2 consanguineous families however the variant is also found in the gnomAD database (186 hets; 3 homs). Note no other variants reported in this gene since original report in 2009. All variants submitted to ClinVar are VOUS/LB/B.",
            "entity_name": "COX4I2",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:34:36.042238+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.40",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: COX4I2 as ready",
            "entity_name": "COX4I2",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:34:36.031066+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.40",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: cox4i2 has been classified as Red List (Low Evidence).",
            "entity_name": "COX4I2",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:34:34.212024+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.40",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: COX4I2 were changed from Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, 612714; 612714 Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, and Calvarial Hyperostosis; Exocrine Pancreatic Insufficiency, Dyserythropoietic Anemia, andCalvarial Hyperostosis; 612714 Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis; Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis to Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714",
            "entity_name": "COX4I2",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:34:21.589765+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.39",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: COX4I2 were set to 19268275",
            "entity_name": "COX4I2",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:34:07.613020+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.38",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Classified gene: COX4I2 as Red List (low evidence)",
            "entity_name": "COX4I2",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:34:07.603303+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.38",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: cox4i2 has been classified as Red List (Low Evidence).",
            "entity_name": "COX4I2",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:33:59.427082+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.37",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: COX4I2: Rating: RED; Mode of pathogenicity: None; Publications: 19268275, 22730437; Phenotypes: Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "COX4I2",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:28:03.150422+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.37",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: CDAN1 as ready",
            "entity_name": "CDAN1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:28:03.140484+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.37",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: cdan1 has been classified as Green List (High Evidence).",
            "entity_name": "CDAN1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:28:00.949591+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.37",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: CDAN1 were changed from 224120 Dyserythropoietic anemia, congenital, type Ia; 224120 Congenital dyserythropoietic anaemia type 1a; Dyserythropoietic anemia, congenital, type Ia, 224120 to Dyserythropoietic anaemia, congenital, type Ia, 224120",
            "entity_name": "CDAN1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:27:47.608114+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.36",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: CDAN1 were set to 16098079; 12434312",
            "entity_name": "CDAN1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:27:34.218840+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.35",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "edited their review of gene: CDAN1: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ia, 224120",
            "entity_name": "CDAN1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:26:59.349408+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.35",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: ALDOA as ready",
            "entity_name": "ALDOA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:26:59.337850+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.35",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: aldoa has been classified as Green List (High Evidence).",
            "entity_name": "ALDOA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:26:56.459198+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.35",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: ALDOA were changed from Enzyme Disorder; Glycogen storage disease; Aldolase A deficiency; 611881 Aldolase A deficiency; 611881 Glycogen storage disease XII; Glycogen storage disease XII, 611881; Glycogen storage disease due to aldolase A deficiency to Glycogen storage disease XII , MIM#611881",
            "entity_name": "ALDOA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:26:45.424361+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.34",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: ALDOA were set to 8598869; 7331996",
            "entity_name": "ALDOA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:26:32.138184+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.33",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: ALDOA: Rating: GREEN; Mode of pathogenicity: None; Publications: 7331996, 8598869, 25392908; Phenotypes: Glycogen storage disease XII , MIM#611881; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "ALDOA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:25:21.079021+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9048",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: CD59 as ready",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:25:21.068710+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9048",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: cd59 has been classified as Green List (High Evidence).",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:25:14.836494+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9048",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: CD59 were changed from  to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:24:59.179122+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9047",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: CD59 were set to ",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:24:39.673480+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9046",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: CD59 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:24:25.462312+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.33",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "changed review comment from: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.; to: Infantile onset of a relapsing-remitting polyneuropathy, often exacerbated by infection, and manifest as hypotonia, limb muscle weakness, and hyporeflexia. Intermittent episodes of haemolysis.\r\n\r\nMore than 5 unrelated families reported.",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:24:10.953543+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9045",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:23:06.493097+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.33",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: CD59 as ready",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:23:06.479190+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.33",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: cd59 has been classified as Green List (High Evidence).",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:23:04.503399+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.33",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: CD59 were changed from Dyskeratosis congenita, X-linked, 305000; 305000 Dyskeratosis congenita, X-linked to Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy, MIM# 612300",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:22:41.503840+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.32",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: CD59: Rating: GREEN; Mode of pathogenicity: None; Publications: 24382084, 23149847; Phenotypes: Haemolytic anaemia, CD59-mediated, with or without immune-mediated polyneuropathy 612300; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "CD59",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:20:15.156757+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.32",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: C15orf41 as ready",
            "entity_name": "C15orf41",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:20:15.145466+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.32",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: c15orf41 has been classified as Green List (High Evidence).",
            "entity_name": "C15orf41",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:20:12.977792+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.32",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: C15orf41 were changed from 615631 Congenital dyserythropoietic anaemia type 1b; Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib; 615631 Congenital Dyserythropoietic Anemia; Dyserythropoietic anemia, congenital, type Ib, 615631 to Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631",
            "entity_name": "C15orf41",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:20:02.792926+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.31",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: C15orf41 were set to 29031773; 23716552; 29885034",
            "entity_name": "C15orf41",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:19:42.478604+10:00",
            "panel_name": "Red cell disorders",
            "panel_id": 3366,
            "panel_version": "0.30",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "edited their review of gene: C15orf41: Changed phenotypes: Dyserythropoietic anaemia, congenital, type Ib, MIM# 615631",
            "entity_name": "C15orf41",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T18:05:34.247979+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.130",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Marked STR: HSAN8 as ready",
            "entity_name": "HSAN8",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T18:05:34.238048+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.130",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Str: hsan8 has been classified as Green List (High Evidence).",
            "entity_name": "HSAN8",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T18:05:30.696662+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.130",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Classified STR: HSAN8 as Green List (high evidence)",
            "entity_name": "HSAN8",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T18:05:30.685135+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.130",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Str: hsan8 has been classified as Green List (High Evidence).",
            "entity_name": "HSAN8",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T18:03:54.015227+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.129",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "STR: HSAN8 was added\nSTR: HSAN8 was added to Repeat Disorders. Sources: Literature\nMode of inheritance for STR: HSAN8 was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: HSAN8 were set to 26005867\nPhenotypes for STR: HSAN8 were set to Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488\nReview for STR: HSAN8 was set to GREEN\nSTR: HSAN8 was marked as clinically relevant\nAdded comment: NM_021619.3(PRDM12):c.1041CGC[X]\r\nPoly-Ala repeat, with 7-14 repeats identified in controls. A large consanguineous Pakastani family with HSAN segregating a homozygous expansion from 12 to 19 residues, and an Irish family with HSAN segregating a expansion from 12 to 18 residues. In vitro functional expression studies in COS-7 cells showed that the polyalanine expansions resulted in reduced protein expression and caused discrete, concentrated foci to form in the nucleus and cytoplasm. SNVs also cause disease. \nSources: Literature",
            "entity_name": "HSAN8",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T16:03:36.187225+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.128",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "changed review comment from: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. \nSources: Literature; to: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X] \r\nComplex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. \r\nSources: Literature",
            "entity_name": "RCPS",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T16:01:23.097048+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.128",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Marked STR: RCPS as ready",
            "entity_name": "RCPS",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T16:01:23.083538+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.128",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Str: rcps has been classified as Green List (High Evidence).",
            "entity_name": "RCPS",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T16:01:03.944811+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.128",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Classified STR: RCPS as Green List (high evidence)",
            "entity_name": "RCPS",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T16:01:03.931014+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.128",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Str: rcps has been classified as Green List (High Evidence).",
            "entity_name": "RCPS",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T16:00:54.742615+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.127",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "STR: RCPS was added\nSTR: RCPS was added to Repeat Disorders. Sources: Literature\nMode of inheritance for STR: RCPS was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: RCPS were set to 24360810; 29112243\nPhenotypes for STR: RCPS were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome\nReview for STR: RCPS was set to GREEN\nSTR: RCPS was marked as clinically relevant\nAdded comment: Complex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. \nSources: Literature",
            "entity_name": "RCPS",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T13:19:07.279157+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "1.0",
            "user_name": "Zornitza Stark",
            "item_type": "panel",
            "text": "promoted panel to version 1.0",
            "entity_name": null,
            "entity_type": null
        },
        {
            "created": "2021-09-05T13:17:46.711496+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.30",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: SYNCRIP as ready",
            "entity_name": "SYNCRIP",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:17:46.702225+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.30",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: syncrip has been classified as Red List (Low Evidence).",
            "entity_name": "SYNCRIP",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:16:29.310373+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.30",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "gene: SYNCRIP was added\ngene: SYNCRIP was added to Periventricular Grey Matter Heterotopia. Sources: Literature\nMode of inheritance for gene: SYNCRIP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for gene: SYNCRIP were set to 34157790\nPhenotypes for gene: SYNCRIP were set to SYNCRIP-related neurodevelopmental disorder\nReview for gene: SYNCRIP was set to RED\nAdded comment: One of 8 individuals reported so far had PVNH. \nSources: Literature",
            "entity_name": "SYNCRIP",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:14:08.848582+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9045",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: NEDD4L as ready",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:14:08.839251+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9045",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: nedd4l has been classified as Green List (High Evidence).",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:13:58.011871+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9045",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: NEDD4L were changed from  to Periventricular nodular heterotopia 7, MIM# 617201",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:13:18.199930+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9044",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: NEDD4L were set to ",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:12:56.292537+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9043",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:12:37.347515+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.9042",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:11:24.330328+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.29",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: NEDD4L as ready",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:11:24.320115+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.29",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: nedd4l has been classified as Green List (High Evidence).",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:11:14.859421+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.29",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: NEDD4L were changed from  to Periventricular nodular heterotopia 7, MIM# 617201",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:10:50.647114+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.28",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: NEDD4L were set to ",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:09:42.713731+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.27",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: NEDD4L was changed from MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:09:28.066949+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.27",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: NEDD4L was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:08:58.278285+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.26",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: NEDD4L: Rating: GREEN; Mode of pathogenicity: None; Publications: 34087865, 27694961, 32117442; Phenotypes: Periventricular nodular heterotopia 7, MIM# 617201; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "NEDD4L",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T13:08:29.043729+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.126",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Marked STR: MEDPSACH as ready",
            "entity_name": "MEDPSACH",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T13:08:29.032771+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.126",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Str: medpsach has been classified as Green List (High Evidence).",
            "entity_name": "MEDPSACH",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T13:08:25.598346+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.126",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Classified STR: MEDPSACH as Green List (high evidence)",
            "entity_name": "MEDPSACH",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T13:08:25.587412+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.126",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Str: medpsach has been classified as Green List (High Evidence).",
            "entity_name": "MEDPSACH",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T13:08:13.794925+10:00",
            "panel_name": "Repeat Disorders",
            "panel_id": 3597,
            "panel_version": "0.125",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "STR: MEDPSACH was added\nSTR: MEDPSACH was added to Repeat Disorders. Sources: Literature\nMode of inheritance for STR: MEDPSACH was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: MEDPSACH were set to 9887340; 17133256; 21922596\nPhenotypes for STR: MEDPSACH were set to Epiphyseal dysplasia, multiple, 1 MIM#132400; Pseudoachondroplasia MIM#177170\nReview for STR: MEDPSACH was set to GREEN\nSTR: MEDPSACH was marked as clinically relevant\nSTR: MEDPSACH was marked as current diagnostic\nAdded comment: At least 5 cases reported with 6 or 7 GAC repeats. 5 repeats is normal. Deletion/contraction of the repeat is also reported. Other SNV and small indels are reported as disease-causing in this gene. \nSources: Literature",
            "entity_name": "MEDPSACH",
            "entity_type": "str"
        },
        {
            "created": "2021-09-05T12:55:10.774057+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.26",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: FLNA as ready",
            "entity_name": "FLNA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:55:10.758832+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.26",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: flna has been classified as Green List (High Evidence).",
            "entity_name": "FLNA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:55:03.713412+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.26",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: FLNA were changed from  to Heterotopia, periventricular, 1 , MIM#300049",
            "entity_name": "FLNA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:54:36.742814+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.25",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: FLNA were set to ",
            "entity_name": "FLNA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:54:02.049521+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.24",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: FLNA was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "entity_name": "FLNA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:53:36.360315+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.23",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: FLNA: Rating: GREEN; Mode of pathogenicity: None; Publications: 9883725, 15668422, 15994863; Phenotypes: Heterotopia, periventricular, 1 , MIM#300049; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "entity_name": "FLNA",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:48:39.072110+10:00",
            "panel_name": "Genetic Epilepsy",
            "panel_id": 202,
            "panel_version": "0.1185",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: ARF1 as ready",
            "entity_name": "ARF1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:48:39.061471+10:00",
            "panel_name": "Genetic Epilepsy",
            "panel_id": 202,
            "panel_version": "0.1185",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: arf1 has been classified as Green List (High Evidence).",
            "entity_name": "ARF1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:47:05.327611+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.22",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: DCHS1 as ready",
            "entity_name": "DCHS1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:47:05.316901+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.22",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: dchs1 has been classified as Green List (High Evidence).",
            "entity_name": "DCHS1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:47:03.020589+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.22",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: DCHS1 were changed from  to Van Maldergem syndrome 1, MIM# 601390",
            "entity_name": "DCHS1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:46:34.026393+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.21",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: DCHS1 were set to ",
            "entity_name": "DCHS1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:45:50.145513+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.20",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: DCHS1 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "DCHS1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:45:23.580403+10:00",
            "panel_name": "Periventricular Grey Matter Heterotopia",
            "panel_id": 19,
            "panel_version": "0.19",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: DCHS1: Rating: GREEN; Mode of pathogenicity: None; Publications: 24056717, 29046692; Phenotypes: Van Maldergem syndrome 1, MIM# 601390; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "DCHS1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:41:24.641885+10:00",
            "panel_name": "Genetic Epilepsy",
            "panel_id": 202,
            "panel_version": "0.1185",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Classified gene: ARF1 as Green List (high evidence)",
            "entity_name": "ARF1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:41:24.632401+10:00",
            "panel_name": "Genetic Epilepsy",
            "panel_id": 202,
            "panel_version": "0.1185",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: arf1 has been classified as Green List (High Evidence).",
            "entity_name": "ARF1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:40:55.158240+10:00",
            "panel_name": "Genetic Epilepsy",
            "panel_id": 202,
            "panel_version": "0.1184",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "gene: ARF1 was added\ngene: ARF1 was added to Genetic Epilepsy. Sources: Literature\nMode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for gene: ARF1 were set to 28868155; 34353862\nPhenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185\nReview for gene: ARF1 was set to GREEN\nAdded comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID). \nSources: Literature",
            "entity_name": "ARF1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:39:34.037194+10:00",
            "panel_name": "Intellectual disability syndromic and non-syndromic",
            "panel_id": 250,
            "panel_version": "0.4098",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: ARF1 as ready",
            "entity_name": "ARF1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:39:34.026921+10:00",
            "panel_name": "Intellectual disability syndromic and non-syndromic",
            "panel_id": 250,
            "panel_version": "0.4098",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: arf1 has been classified as Green List (High Evidence).",
            "entity_name": "ARF1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:39:28.307370+10:00",
            "panel_name": "Intellectual disability syndromic and non-syndromic",
            "panel_id": 250,
            "panel_version": "0.4098",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Classified gene: ARF1 as Green List (high evidence)",
            "entity_name": "ARF1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:39:28.297645+10:00",
            "panel_name": "Intellectual disability syndromic and non-syndromic",
            "panel_id": 250,
            "panel_version": "0.4098",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: arf1 has been classified as Green List (High Evidence).",
            "entity_name": "ARF1",
            "entity_type": "gene"
        },
        {
            "created": "2021-09-05T12:38:53.095089+10:00",
            "panel_name": "Intellectual disability syndromic and non-syndromic",
            "panel_id": 250,
            "panel_version": "0.4097",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "gene: ARF1 was added\ngene: ARF1 was added to Intellectual disability syndromic and non-syndromic. Sources: Literature\nMode of inheritance for gene: ARF1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for gene: ARF1 were set to 28868155; 34353862\nPhenotypes for gene: ARF1 were set to Periventricular nodular heterotopia 8, MIM# 618185\nReview for gene: ARF1 was set to GREEN\nAdded comment: 5 individuals from 4 untreated families reported. 3/5 individuals presented with seizures and all had developmental delays, especially in speech (one patient had a diagnosis of moderate ID). \nSources: Literature",
            "entity_name": "ARF1",
            "entity_type": "gene"
        }
    ]
}