HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"count": 220966,
"next": "https://panelapp-aus.org/api/v1/activities/?format=api&page=1222",
"previous": "https://panelapp-aus.org/api/v1/activities/?format=api&page=1220",
"results": [
{
"created": "2021-08-31T12:44:59.463202+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8994",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Phenotypes for gene: POU1F1 were changed from to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:44:42.219118+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8993",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Publications for gene: POU1F1 were set to ",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:44:22.363585+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8992",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Mode of inheritance for gene: POU1F1 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:44:02.534905+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8991",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:43:19.888101+10:00",
"panel_name": "Early-onset Dementia",
"panel_id": 24,
"panel_version": "0.146",
"user_name": "Bryony Thompson",
"item_type": "panel",
"text": "removed STR:PRNP from the panel",
"entity_name": null,
"entity_type": null
},
{
"created": "2021-08-31T12:42:30.332198+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.123",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: CJD as ready",
"entity_name": "CJD",
"entity_type": "str"
},
{
"created": "2021-08-31T12:42:30.322598+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.123",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: cjd has been classified as Green List (High Evidence).",
"entity_name": "CJD",
"entity_type": "str"
},
{
"created": "2021-08-31T12:42:26.261677+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.123",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: CJD as Green List (high evidence)",
"entity_name": "CJD",
"entity_type": "str"
},
{
"created": "2021-08-31T12:42:26.252277+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.123",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: cjd has been classified as Green List (High Evidence).",
"entity_name": "CJD",
"entity_type": "str"
},
{
"created": "2021-08-31T12:42:17.901755+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.122",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: CJD was added\nSTR: CJD was added to Repeat Disorders. Sources: Expert list\nMode of inheritance for STR: CJD was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: CJD were set to 2159587; 20301407\nPhenotypes for STR: CJD were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440\nReview for STR: CJD was set to GREEN\nSTR: CJD was marked as clinically relevant\nAdded comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]\r\nNormal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.\r\nPathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. \nSources: Expert list",
"entity_name": "CJD",
"entity_type": "str"
},
{
"created": "2021-08-31T12:38:52.288975+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8991",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: OPDM2 as ready",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:38:52.280076+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8991",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: opdm2 has been classified as Green List (High Evidence).",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:38:27.407782+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.365",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Marked gene: POU1F1 as ready",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:38:27.398432+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.365",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Gene: pou1f1 has been classified as Green List (High Evidence).",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:38:24.253062+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.365",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Phenotypes for gene: POU1F1 were changed from GH, PRL deficiencies; variable degree of TSH deficiency to Pituitary hormone deficiency, combined, 1 MIM# 613038; pituitary hypoplasia; severe growth failure; combined GH, PRL and TSH deficiency; distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils)",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:38:13.986754+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.364",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Publications for gene: POU1F1 were set to ",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:38:04.508465+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.363",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Classified gene: POU1F1 as Green List (high evidence)",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:38:04.497440+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.363",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Gene: pou1f1 has been classified as Green List (High Evidence).",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:37:59.318679+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8991",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: OPDM2 as Green List (high evidence)",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:37:59.309446+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8991",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: opdm2 has been classified as Green List (High Evidence).",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:37:28.959238+10:00",
"panel_name": "Regression",
"panel_id": 206,
"panel_version": "0.364",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: SCA36 as ready",
"entity_name": "SCA36",
"entity_type": "str"
},
{
"created": "2021-08-31T12:37:28.949522+10:00",
"panel_name": "Regression",
"panel_id": 206,
"panel_version": "0.364",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: sca36 has been classified as Green List (High Evidence).",
"entity_name": "SCA36",
"entity_type": "str"
},
{
"created": "2021-08-31T12:37:22.614416+10:00",
"panel_name": "Regression",
"panel_id": 206,
"panel_version": "0.364",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: SCA36 as Green List (high evidence)",
"entity_name": "SCA36",
"entity_type": "str"
},
{
"created": "2021-08-31T12:37:22.604406+10:00",
"panel_name": "Regression",
"panel_id": 206,
"panel_version": "0.364",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: sca36 has been classified as Green List (High Evidence).",
"entity_name": "SCA36",
"entity_type": "str"
},
{
"created": "2021-08-31T12:36:51.523080+10:00",
"panel_name": "Regression",
"panel_id": 206,
"panel_version": "0.363",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: SCA36 was added\nSTR: SCA36 was added to Regression. Sources: Expert list\nMode of inheritance for STR: SCA36 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: SCA36 were set to 21683323\nPhenotypes for STR: SCA36 were set to Spinocerebellar ataxia 36 MIM#614153\nReview for STR: SCA36 was set to GREEN\nSTR: SCA36 was marked as clinically relevant\nAdded comment: NM_006392.3:c.3+71GGCCTG[X]\r\nToxic RNA effect is suggested mechanism of disease\r\nNormal: 3-14 repeats\r\nUncertain significance: 15-650 repeats\r\nPathogenic: ≥650 repeats \nSources: Expert list",
"entity_name": "SCA36",
"entity_type": "str"
},
{
"created": "2021-08-31T12:36:29.416940+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.362",
"user_name": "Danielle Ariti",
"item_type": "entity",
"text": "reviewed gene: POU1F1: Rating: GREEN; Mode of pathogenicity: None; Publications: 1302000, 1472057, 9392392, 15928241, 7833912, 12773133; Phenotypes: Pituitary hormone deficiency, combined, 1 MIM# 613038, pituitary hypoplasia, severe growth failure, combined GH, PRL and TSH deficiency, distinct facial features (prominent forehead, mid-facial hypoplasia, depressed nasal bridge, deep-set eyes and a short nose with anteverted nostrils); Mode of inheritance: BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
"entity_name": "POU1F1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:34:21.819748+10:00",
"panel_name": "Regression",
"panel_id": 206,
"panel_version": "0.362",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified gene: NOP56 as No list",
"entity_name": "NOP56",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:34:21.814316+10:00",
"panel_name": "Regression",
"panel_id": 206,
"panel_version": "0.362",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Added comment: Comment on list classification: STR expansion is the only reported cause of disease for this gene. An STR has been added to this panel under SCA36",
"entity_name": "NOP56",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:34:21.772893+10:00",
"panel_name": "Regression",
"panel_id": 206,
"panel_version": "0.362",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Gene: nop56 has been removed from the panel.",
"entity_name": "NOP56",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:20:18.883867+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8990",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: OPDM2 was added\nSTR: OPDM2 was added to Mendeliome. Sources: Literature\nMode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: OPDM2 were set to 32413282; 33374016\nPhenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940\nReview for STR: OPDM2 was set to GREEN\nSTR: OPDM2 was marked as clinically relevant\nAdded comment: NM_005716.4:c.-211GGC[X]\r\n>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32. \nSources: Literature",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:14:12.298698+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.121",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: OPDM2 as ready",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:14:12.289776+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.121",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: opdm2 has been classified as Green List (High Evidence).",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:13:43.500618+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.121",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: OPDM2 as Green List (high evidence)",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:13:43.490772+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.121",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: opdm2 has been classified as Green List (High Evidence).",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:13:35.720869+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.120",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: OPDM2 was added\nSTR: OPDM2 was added to Repeat Disorders. Sources: Expert list\nMode of inheritance for STR: OPDM2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: OPDM2 were set to 32413282; 33374016\nPhenotypes for STR: OPDM2 were set to Oculopharyngodistal myopathy 2 MIM#618940\nReview for STR: OPDM2 was set to GREEN\nSTR: OPDM2 was marked as clinically relevant\nAdded comment: NM_005716.4:c.-211GGC[X]\r\n>15 Chinese families/probands with a heterozygous trinucleotide repeat expansion (CGG(n)) in 5'UTR exon 1 of the GIPC1 gene. The expansion was found by a combination of linkage analysis, whole-exome sequencing, long-range sequencing, and PCR analysis, and segregated with the disorder in the family. Repeat lengths in the patients ranged from 70 to 138. Normal repeat lengths ranged from 12 to 32. \nSources: Expert list",
"entity_name": "OPDM2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:04:31.687252+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8989",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FAME2 as ready",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:04:31.677737+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8989",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fame2 has been classified as Green List (High Evidence).",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T12:03:04.756312+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8989",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified gene: GIPC1 as No list",
"entity_name": "GIPC1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:03:04.751748+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8989",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Added comment: Comment on list classification: Added to panel as an STR under OPDM2",
"entity_name": "GIPC1",
"entity_type": "gene"
},
{
"created": "2021-08-31T12:03:04.716841+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8989",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Gene: gipc1 has been removed from the panel.",
"entity_name": "GIPC1",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:53:09.330038+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8988",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: FAME2 as Green List (high evidence)",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T11:53:09.319744+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8988",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fame2 has been classified as Green List (High Evidence).",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T11:52:36.277668+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.119",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FAME3 as ready",
"entity_name": "FAME3",
"entity_type": "str"
},
{
"created": "2021-08-31T11:52:36.269030+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.119",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fame3 has been classified as Green List (High Evidence).",
"entity_name": "FAME3",
"entity_type": "str"
},
{
"created": "2021-08-31T11:52:29.291663+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.119",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: FAME3 as Green List (high evidence)",
"entity_name": "FAME3",
"entity_type": "str"
},
{
"created": "2021-08-31T11:52:29.281067+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.119",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fame3 has been classified as Green List (High Evidence).",
"entity_name": "FAME3",
"entity_type": "str"
},
{
"created": "2021-08-31T11:52:20.636900+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.118",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FAME3 was added\nSTR: FAME3 was added to Repeat Disorders. Sources: Literature\nMode of inheritance for STR: FAME3 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: FAME3 were set to 31664039\nPhenotypes for STR: FAME3 were set to Epilepsy, familial adult myoclonic, 3 MIM#613608\nReview for STR: FAME3 was set to GREEN\nSTR: FAME3 was marked as clinically relevant\nAdded comment: 4 unrelated European families with a heterozygous TTTCA(n) repeat expansion in intron 1 of the MARCHF6 gene. (TTTTA)n repeat is a polymorphic microsatellite with the number of TTTTA repeats ranging from 9 to 20; repeats containing TTTCA motifs were never observed in controls, indicating that the TTTCA repeats are the pathogenic part of the expansion similar to other FAMEs. Patient cells did not show any difference in MARCHF6 RNA or protein expression compared to controls, and there was no difference in the level of intron 1-containing RNA, thus excluding a massive accumulation of abnormally spliced mRNA carrying the expansion in these cells. \nSources: Literature",
"entity_name": "FAME3",
"entity_type": "str"
},
{
"created": "2021-08-31T11:10:10.270458+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8987",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FAME2 was added\nSTR: FAME2 was added to Mendeliome. Sources: Literature\nMode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: FAME2 were set to 11701600; 24114805; 31664034\nPhenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876\nReview for STR: FAME2 was set to GREEN\nSTR: FAME2 was marked as clinically relevant\nAdded comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]\r\n158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved. \nSources: Literature",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T11:08:05.295319+10:00",
"panel_name": "Macrocephaly_Megalencephaly",
"panel_id": 135,
"panel_version": "0.85",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "Classified gene: BRWD3 as Green List (high evidence)",
"entity_name": "BRWD3",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:08:05.284145+10:00",
"panel_name": "Macrocephaly_Megalencephaly",
"panel_id": 135,
"panel_version": "0.85",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "Gene: brwd3 has been classified as Green List (High Evidence).",
"entity_name": "BRWD3",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:07:40.964522+10:00",
"panel_name": "Macrocephaly_Megalencephaly",
"panel_id": 135,
"panel_version": "0.84",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "gene: BRWD3 was added\ngene: BRWD3 was added to Macrocephaly_Megalencephaly. Sources: Literature\nMode of inheritance for gene: BRWD3 was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)\nPublications for gene: BRWD3 were set to PMID: 30628072, 24462886\nPhenotypes for gene: BRWD3 were set to Intellectual developmental disorder, X-linked 93; OMIM # 300659\nReview for gene: BRWD3 was set to GREEN\nAdded comment: 10 patients (from 6 unrelated families) with ID, macrocephaly and dysmorphic facial features. \nSources: Literature",
"entity_name": "BRWD3",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:06:53.245005+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8986",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified gene: STARD7 as No list",
"entity_name": "STARD7",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:06:53.240251+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8986",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Added comment: Comment on list classification: Added to panel as an STR under FAME2",
"entity_name": "STARD7",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:06:53.206374+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8986",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Gene: stard7 has been removed from the panel.",
"entity_name": "STARD7",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:06:20.251458+10:00",
"panel_name": "Overgrowth",
"panel_id": 151,
"panel_version": "1.4",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "Classified gene: BRWD3 as Green List (high evidence)",
"entity_name": "BRWD3",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:06:20.242687+10:00",
"panel_name": "Overgrowth",
"panel_id": 151,
"panel_version": "1.4",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "Gene: brwd3 has been classified as Green List (High Evidence).",
"entity_name": "BRWD3",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:05:48.738750+10:00",
"panel_name": "Overgrowth",
"panel_id": 151,
"panel_version": "1.3",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "reviewed gene: BRWD3: Rating: GREEN; Mode of pathogenicity: None; Publications: PMID: 30628072, 24462886; Phenotypes: Intellectual developmental disorder, X-linked 93, OMIM # 300659; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
"entity_name": "BRWD3",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:05:29.099329+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "0.1180",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FAME2 as ready",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T11:05:29.089989+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "0.1180",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fame2 has been classified as Green List (High Evidence).",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T11:05:22.648583+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "0.1180",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: FAME2 as Green List (high evidence)",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T11:05:22.637996+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "0.1180",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fame2 has been classified as Green List (High Evidence).",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T11:04:49.984809+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "0.1179",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FAME2 was added\nSTR: FAME2 was added to Genetic Epilepsy. Sources: Literature\nMode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: FAME2 were set to 11701600; 24114805; 31664034\nPhenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876\nReview for STR: FAME2 was set to GREEN\nSTR: FAME2 was marked as clinically relevant\nAdded comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]\r\n158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved. \nSources: Literature",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T11:02:03.164724+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "0.1178",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified gene: STARD7 as No list",
"entity_name": "STARD7",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:02:03.159729+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "0.1178",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Added comment: Comment on list classification: Added to panel as an STR under FAME2",
"entity_name": "STARD7",
"entity_type": "gene"
},
{
"created": "2021-08-31T11:02:03.125956+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "0.1178",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Gene: stard7 has been removed from the panel.",
"entity_name": "STARD7",
"entity_type": "gene"
},
{
"created": "2021-08-31T10:59:58.051843+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.117",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FAME2 as ready",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T10:59:58.040883+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.117",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fame2 has been classified as Green List (High Evidence).",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T10:59:54.701855+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.117",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: FAME2 as Green List (high evidence)",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T10:59:54.688362+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.117",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fame2 has been classified as Green List (High Evidence).",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T10:59:45.655130+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.116",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FAME2 was added\nSTR: FAME2 was added to Repeat Disorders. Sources: Literature\nMode of inheritance for STR: FAME2 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: FAME2 were set to 31664034\nPhenotypes for STR: FAME2 were set to Epilepsy, familial adult myoclonic, 2 MIM#607876\nReview for STR: FAME2 was set to GREEN\nSTR: FAME2 was marked as clinically relevant\nAdded comment: NM_020151.3(STARD7):c.291-1572ATTTT[X]ATTTC[X]\r\n158 affected individuals from 22 unrelated families with familial adult myoclonic epilepsy with a heterozygous 5-bp repeat expansion (ATTTC)n in intron 1. Affected individuals had variable expansion of an endogenous (ATTTT)n repeat in addition to the insertion of an abnormal (ATTTC)n repeat, similar molecular finding in other forms of FAME. RNA sequencing from patient derived fibroblasts shows no accumulation of the AUUUU or AUUUC repeat sequences and no effect on STARD7 gene expression, suggesting ATTTC expansions may cause FAME irrespective of the genomic locus involved. \nSources: Literature",
"entity_name": "FAME2",
"entity_type": "str"
},
{
"created": "2021-08-31T10:58:46.639359+10:00",
"panel_name": "Macrocephaly_Megalencephaly",
"panel_id": 135,
"panel_version": "0.83",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "Classified gene: PPP2R5D as Green List (high evidence)",
"entity_name": "PPP2R5D",
"entity_type": "gene"
},
{
"created": "2021-08-31T10:58:46.630428+10:00",
"panel_name": "Macrocephaly_Megalencephaly",
"panel_id": 135,
"panel_version": "0.83",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "Gene: ppp2r5d has been classified as Green List (High Evidence).",
"entity_name": "PPP2R5D",
"entity_type": "gene"
},
{
"created": "2021-08-31T10:58:31.587956+10:00",
"panel_name": "Overgrowth",
"panel_id": 151,
"panel_version": "1.3",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "Classified gene: PPP2R5D as Green List (high evidence)",
"entity_name": "PPP2R5D",
"entity_type": "gene"
},
{
"created": "2021-08-31T10:58:31.577824+10:00",
"panel_name": "Overgrowth",
"panel_id": 151,
"panel_version": "1.3",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "Gene: ppp2r5d has been classified as Green List (High Evidence).",
"entity_name": "PPP2R5D",
"entity_type": "gene"
},
{
"created": "2021-08-31T10:58:15.602752+10:00",
"panel_name": "Macrocephaly_Megalencephaly",
"panel_id": 135,
"panel_version": "0.82",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "gene: PPP2R5D was added\ngene: PPP2R5D was added to Macrocephaly_Megalencephaly. Sources: Literature\nMode of inheritance for gene: PPP2R5D was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for gene: PPP2R5D were set to PMID: 26168268, 25972378, 25533962; 34448180\nPhenotypes for gene: PPP2R5D were set to Mental retardation, autosomal dominant 35, MIM# 616355\nReview for gene: PPP2R5D was set to GREEN\nAdded comment: Phenotype of macrocephaly is consistent, and multiple patients reported \nSources: Literature",
"entity_name": "PPP2R5D",
"entity_type": "gene"
},
{
"created": "2021-08-31T10:54:53.471988+10:00",
"panel_name": "Overgrowth",
"panel_id": 151,
"panel_version": "1.2",
"user_name": "Chirag Patel",
"item_type": "entity",
"text": "reviewed gene: PPP2R5D: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: ; Mode of inheritance: None",
"entity_name": "PPP2R5D",
"entity_type": "gene"
},
{
"created": "2021-08-31T10:40:48.849816+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.115",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FAME4 as ready",
"entity_name": "FAME4",
"entity_type": "str"
},
{
"created": "2021-08-31T10:40:48.839862+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.115",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fame4 has been classified as Red List (Low Evidence).",
"entity_name": "FAME4",
"entity_type": "str"
},
{
"created": "2021-08-31T10:40:36.294290+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.115",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FAME4 was added\nSTR: FAME4 was added to Repeat Disorders. Sources: Literature\nMode of inheritance for STR: FAME4 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: FAME4 were set to 31539032\nPhenotypes for STR: FAME4 were set to Epilepsy, myoclonic, familial adult, 4 MIM#615127\nReview for STR: FAME4 was set to RED\nAdded comment: 13 affected members of a single Thai family with familial adult myoclonic epilepsy-4 with a heterozygous (TTTTA)n/TTTCA(n) repeat expansion in intron 1 of the YEATS2 gene. 1 affected family member was estimated to be (TTTTA)819/(TTTCA)221, whereas a control had (TTTTA)7/(TTTTA)8. No functional analysis, but RNA toxicity is expected to be the mechanism of disease. \nSources: Literature",
"entity_name": "FAME4",
"entity_type": "str"
},
{
"created": "2021-08-31T10:16:04.339598+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.114",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: OPML1 as ready",
"entity_name": "OPML1",
"entity_type": "str"
},
{
"created": "2021-08-31T10:16:04.328744+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.114",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: opml1 has been classified as Red List (Low Evidence).",
"entity_name": "OPML1",
"entity_type": "str"
},
{
"created": "2021-08-31T10:15:42.492271+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.114",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: OPML1 was added\nSTR: OPML1 was added to Repeat Disorders. Sources: Literature\nMode of inheritance for STR: OPML1 was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: OPML1 were set to 31332380\nPhenotypes for STR: OPML1 were set to Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637\nReview for STR: OPML1 was set to RED\nAdded comment: NR_120611.1:n.192CCG[X]\r\n4 affected members of a single Japanese family with oculopharyngeal myopathy with leukoencephalopathy, with a heterozygous trinucleotide (CCG)n repeat expansion in the bidirectionally transcribed long noncoding RNA LOC642361 gene (in the CGG direction). RNA toxicity is postulated as the mechanism of disease. CGG repeats in controls ranged from 3 to 16. Repeats in affected family members ranged from 35-60. \nSources: Literature",
"entity_name": "OPML1",
"entity_type": "str"
},
{
"created": "2021-08-31T09:30:43.435168+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8985",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Publications for gene: PNPLA6 were set to 25480986; 24355708",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T09:30:16.741695+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8984",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "changed review comment from: Ataxia is part of the phenotype. \nSources: Expert list; to: Variants in this gene are associated with multiple phenotypes.\r\n\r\nOliver-McFarlane syndrome is a rare congenital disorder characterized by trichomegaly, severe chorioretinal atrophy and multiple pituitary hormone deficiencies, including growth hormone. At least 10 families reported. \r\n\r\nLaurence-Moon syndrome has a clinical presentation similar to that of Oliver-McFarlane syndrome, including chorioretinopathy and pituitary dysfunction, but with childhood onset of ataxia, peripheral neuropathy, and spastic paraplegia and without trichomegaly. Single family reported.\r\n",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T09:29:40.736116+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8984",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "edited their review of gene: PNPLA6: Changed publications: 25480986, 33818269, 32758583, 30097146; Changed phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T09:28:50.542428+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.362",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Marked gene: PNPLA6 as ready",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T09:28:50.532174+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.362",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Gene: pnpla6 has been classified as Green List (High Evidence).",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T09:28:47.632689+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.362",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Phenotypes for gene: PNPLA6 were changed from Oliver-Mcfarlane syndrome, Trichomegaly, GH deficiency, retinal dystrophy, hypogonadotrophic hypogonadism to Oliver-McFarlane syndrome, MIM# 275400; Laurence-Moon syndrome, MIM# 245800",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T09:28:35.801318+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.361",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Publications for gene: PNPLA6 were set to 25480986",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T09:28:25.801281+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.360",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Classified gene: PNPLA6 as Green List (high evidence)",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T09:28:25.791062+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.360",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Gene: pnpla6 has been classified as Green List (High Evidence).",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T09:28:12.307364+10:00",
"panel_name": "Growth failure in early childhood",
"panel_id": 3631,
"panel_version": "0.359",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "reviewed gene: PNPLA6: Rating: GREEN; Mode of pathogenicity: None; Publications: 25480986, 33818269, 32758583, 30097146; Phenotypes: Oliver-McFarlane syndrome, MIM# 275400, Laurence-Moon syndrome, MIM# 245800; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
"entity_name": "PNPLA6",
"entity_type": "gene"
},
{
"created": "2021-08-31T08:56:05.805935+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8984",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Phenotypes for gene: PI4KA were changed from Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531 to Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531; Neurodevelopmental syndrome with hypomyelinating leukodystrophy",
"entity_name": "PI4KA",
"entity_type": "gene"
},
{
"created": "2021-08-31T08:55:01.894498+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8983",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Publications for gene: PI4KA were set to 25855803",
"entity_name": "PI4KA",
"entity_type": "gene"
},
{
"created": "2021-08-31T08:54:27.212307+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8982",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Classified gene: PI4KA as Green List (high evidence)",
"entity_name": "PI4KA",
"entity_type": "gene"
},
{
"created": "2021-08-31T08:54:27.203453+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8982",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Gene: pi4ka has been classified as Green List (High Evidence).",
"entity_name": "PI4KA",
"entity_type": "gene"
},
{
"created": "2021-08-31T08:54:09.189301+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8981",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "changed review comment from: Single family reported, aware of at least one other yet to be published family identified internally.; to: PMG: Single family reported, aware of at least one other yet to be published family identified internally.",
"entity_name": "PI4KA",
"entity_type": "gene"
},
{
"created": "2021-08-31T08:53:53.015388+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "0.8981",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "edited their review of gene: PI4KA: Added comment: Neurodevelopmental syndrome with hypomyelinating leukodystrophy: 10 unrelated patients harbouring biallelic variants in PI4KA reported with a spectrum of severe global neurodevelopmental delay, hypomyelination, and developmental brain abnormalities, and pure spastic paraplegia. Some patients presented immunological deficits or genito-urinary abnormalities. Western blotting and immunofluorescence showed decreased PI4KA levels in the patients' fibroblasts. Immunofluorescence and targeted lipidomics indicated that PI4KA activity was diminished in fibroblasts and peripheral blood mononuclear cells.; Changed rating: GREEN; Changed publications: 25855803, 34415322; Changed phenotypes: Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531, Neurodevelopmental syndrome with hypomyelinating leukodystrophy",
"entity_name": "PI4KA",
"entity_type": "gene"
},
{
"created": "2021-08-31T08:52:12.357846+10:00",
"panel_name": "Hereditary Spastic Paraplegia - paediatric",
"panel_id": 317,
"panel_version": "1.17",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Marked gene: PI4KA as ready",
"entity_name": "PI4KA",
"entity_type": "gene"
},
{
"created": "2021-08-31T08:52:12.347934+10:00",
"panel_name": "Hereditary Spastic Paraplegia - paediatric",
"panel_id": 317,
"panel_version": "1.17",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Gene: pi4ka has been classified as Green List (High Evidence).",
"entity_name": "PI4KA",
"entity_type": "gene"
}
]
}