GET /api/v1/activities/?format=api&page=1631
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "count": 221272,
    "next": "https://panelapp-aus.org/api/v1/activities/?format=api&page=1632",
    "previous": "https://panelapp-aus.org/api/v1/activities/?format=api&page=1630",
    "results": [
        {
            "created": "2020-08-29T11:23:37.292373+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3976",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: ispd has been classified as Green List (High Evidence).",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:23:30.706298+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3976",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: ISPD were changed from  to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:23:13.121968+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3975",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: ISPD were set to ",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:22:56.335753+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3974",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:22:44.671780+10:00",
            "panel_name": "Muscular dystrophy_Paediatric",
            "panel_id": 141,
            "panel_version": "0.69",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: ISPD were set to ",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:22:17.998322+10:00",
            "panel_name": "Muscular dystrophy_Paediatric",
            "panel_id": 141,
            "panel_version": "0.68",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:21:50.866172+10:00",
            "panel_name": "Muscular dystrophy_Paediatric",
            "panel_id": 141,
            "panel_version": "0.67",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:20:37.623658+10:00",
            "panel_name": "Muscular dystrophy_Paediatric",
            "panel_id": 141,
            "panel_version": "0.67",
            "user_name": "Zornitza Stark",
            "item_type": "panel",
            "text": "Panel name changed from Muscular dystrophy to Muscular dystrophy_Paediatric",
            "entity_name": null,
            "entity_type": null
        },
        {
            "created": "2020-08-29T11:18:46.993544+10:00",
            "panel_name": "Hydrocephalus_Ventriculomegaly",
            "panel_id": 115,
            "panel_version": "0.53",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: ISPD as ready",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:18:46.983675+10:00",
            "panel_name": "Hydrocephalus_Ventriculomegaly",
            "panel_id": 115,
            "panel_version": "0.53",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: ispd has been classified as Green List (High Evidence).",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:18:42.456849+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3973",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329, 23390185, 30060766, 28688748, 26404900; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643, Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:13:45.286842+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.87",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "edited their review of gene: ISPD: Changed publications: 22522421, 23217329",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:12:50.166811+10:00",
            "panel_name": "Hydrocephalus_Ventriculomegaly",
            "panel_id": 115,
            "panel_version": "0.53",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: ISPD were set to ",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:12:25.215451+10:00",
            "panel_name": "Hydrocephalus_Ventriculomegaly",
            "panel_id": 115,
            "panel_version": "0.52",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:11:26.971995+10:00",
            "panel_name": "Hydrocephalus_Ventriculomegaly",
            "panel_id": 115,
            "panel_version": "0.51",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421, 23217329; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:10:25.314995+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.87",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: ISPD were set to 22522421",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:08:35.269936+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.86",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: ISPD as ready",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:08:35.254108+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.86",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: ispd has been classified as Green List (High Evidence).",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:08:18.589257+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.86",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: ISPD were changed from  to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:07:48.795855+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.85",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: ISPD were set to ",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:07:27.894369+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.84",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: ISPD was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-29T11:07:01.430022+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.83",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: ISPD: Rating: GREEN; Mode of pathogenicity: None; Publications: 22522421; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "ISPD",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:46:15.289532+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.83",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: DYNC1H1 as ready",
            "entity_name": "DYNC1H1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:46:15.281244+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.83",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: dync1h1 has been classified as Green List (High Evidence).",
            "entity_name": "DYNC1H1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:46:12.441755+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.83",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: DYNC1H1 were changed from  to Mental retardation, autosomal dominant 13, MIM# 614563",
            "entity_name": "DYNC1H1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:45:36.844268+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.82",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: DYNC1H1 were set to ",
            "entity_name": "DYNC1H1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:45:11.902229+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.81",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: DYNC1H1 was changed from Unknown to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "DYNC1H1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:44:48.867088+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.80",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "changed review comment from: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, nodular heterotopias, and PMG.; to: Variable neuronal migration defects resulting in cortical malformations, including pachygyria, lissencephaly, nodular heterotopias, and PMG.",
            "entity_name": "DYNC1H1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:44:37.973308+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.80",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "edited their review of gene: DYNC1H1: Changed publications: 23603762, 29671837, 32570172, 27331017",
            "entity_name": "DYNC1H1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:43:20.408965+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.80",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "edited their review of gene: DYNC1H1: Changed publications: 23603762",
            "entity_name": "DYNC1H1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:42:48.895396+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.80",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: DYNC1H1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Mental retardation, autosomal dominant 13, MIM# 614563; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "DYNC1H1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:38:41.102310+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3973",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: DCX as ready",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:38:41.092258+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3973",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: dcx has been classified as Green List (High Evidence).",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:38:32.681246+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3973",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: DCX were changed from  to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:38:17.363795+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3972",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: DCX were set to ",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:37:59.371714+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3971",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:37:43.174393+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.80",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: DCX were changed from  to Lissencephaly, X-linked, MIM# 300067; Subcortical laminal heterotopia, X-linked 300067",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:37:33.920998+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3970",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:37:21.670166+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.79",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: DCX were set to ",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:36:38.066119+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.78",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: DCX was changed from Unknown to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:36:09.324763+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.77",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: DCX: Rating: GREEN; Mode of pathogenicity: None; Publications: 10915612, 9489699, 12552055; Phenotypes: Lissencephaly, X-linked, MIM# 300067, Subcortical laminal heterotopia, X-linked 300067; Mode of inheritance: X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "entity_name": "DCX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:32:53.898678+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.77",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: B3GALNT2 as ready",
            "entity_name": "B3GALNT2",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:32:53.890080+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.77",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: b3galnt2 has been classified as Green List (High Evidence).",
            "entity_name": "B3GALNT2",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:32:44.316897+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.77",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: B3GALNT2 were changed from  to Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181",
            "entity_name": "B3GALNT2",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:32:17.352497+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.76",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: B3GALNT2 were set to ",
            "entity_name": "B3GALNT2",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:31:42.355179+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.75",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: B3GALNT2 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "B3GALNT2",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:31:18.739775+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.74",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: B3GALNT2: Rating: GREEN; Mode of pathogenicity: None; Publications: 23453667; Phenotypes: Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "B3GALNT2",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:29:02.978926+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.74",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: ARX as ready",
            "entity_name": "ARX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:29:02.970679+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.74",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: arx has been classified as Green List (High Evidence).",
            "entity_name": "ARX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:29:00.777590+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.74",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: ARX were changed from  to Lissencephaly, X-linked 2, MIM# 300215",
            "entity_name": "ARX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:28:34.365492+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.73",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: ARX were set to ",
            "entity_name": "ARX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:27:55.053196+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.72",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: ARX was changed from Unknown to X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "entity_name": "ARX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:27:30.578056+10:00",
            "panel_name": "Lissencephaly and Band Heterotopia",
            "panel_id": 15,
            "panel_version": "0.71",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: ARX: Rating: GREEN; Mode of pathogenicity: None; Publications: 14722918; Phenotypes: Lissencephaly, X-linked 2, MIM# 300215; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "entity_name": "ARX",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:21:02.949402+10:00",
            "panel_name": "Intellectual disability syndromic and non-syndromic",
            "panel_id": 250,
            "panel_version": "0.2888",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "edited their review of gene: DPM3: Changed phenotypes: Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 612937, Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992",
            "entity_name": "DPM3",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:19:00.241902+10:00",
            "panel_name": "Susceptibility to Viral Infections",
            "panel_id": 237,
            "panel_version": "0.65",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: TLR7 as ready",
            "entity_name": "TLR7",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:19:00.233278+10:00",
            "panel_name": "Susceptibility to Viral Infections",
            "panel_id": 237,
            "panel_version": "0.65",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: tlr7 has been classified as Green List (High Evidence).",
            "entity_name": "TLR7",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:18:51.918463+10:00",
            "panel_name": "Susceptibility to Viral Infections",
            "panel_id": 237,
            "panel_version": "0.65",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Classified gene: TLR7 as Green List (high evidence)",
            "entity_name": "TLR7",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:18:51.910588+10:00",
            "panel_name": "Susceptibility to Viral Infections",
            "panel_id": 237,
            "panel_version": "0.65",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: tlr7 has been classified as Green List (High Evidence).",
            "entity_name": "TLR7",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:18:05.306648+10:00",
            "panel_name": "Susceptibility to Viral Infections",
            "panel_id": 237,
            "panel_version": "0.64",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "gene: TLR7 was added\ngene: TLR7 was added to Susceptibility to Viral Infections. Sources: Expert list\nMode of inheritance for gene: TLR7 was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for gene: TLR7 were set to 32706371\nPhenotypes for gene: TLR7 were set to Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051\nReview for gene: TLR7 was set to GREEN\nAdded comment: Four affected individuals from two unrelated families and some functional data. \nSources: Expert list",
            "entity_name": "TLR7",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:16:42.975037+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3970",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: TLR7: Rating: GREEN; Mode of pathogenicity: None; Publications: 32706371; Phenotypes: Immunodeficiency 74, COVID19-related, X-linked, MIM# 301051; Mode of inheritance: X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "entity_name": "TLR7",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:12:50.999750+10:00",
            "panel_name": "Palmoplantar Keratoderma and Erythrokeratoderma",
            "panel_id": 153,
            "panel_version": "0.94",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis",
            "entity_name": "ASPRV1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:12:21.887351+10:00",
            "panel_name": "Palmoplantar Keratoderma and Erythrokeratoderma",
            "panel_id": 153,
            "panel_version": "0.93",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "ASPRV1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:11:58.049751+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3970",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis",
            "entity_name": "ASPRV1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:11:17.885483+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3969",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: ASPRV1: Rating: GREEN; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "ASPRV1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:10:55.194662+10:00",
            "panel_name": "Ichthyosis",
            "panel_id": 124,
            "panel_version": "0.97",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: ASPRV1 were changed from palmoplantar keratoderma; lamellar ichthyosis to Ichthyosis, lamellar, autosomal dominant, MIM# 146750; palmoplantar keratoderma; lamellar ichthyosis",
            "entity_name": "ASPRV1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:10:21.531809+10:00",
            "panel_name": "Ichthyosis",
            "panel_id": 124,
            "panel_version": "0.96",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "edited their review of gene: ASPRV1: Changed rating: GREEN; Changed phenotypes: Ichthyosis, lamellar, autosomal dominant, MIM# 146750; Changed mode of inheritance: MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "entity_name": "ASPRV1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T20:10:00.190156+10:00",
            "panel_name": "Ichthyosis",
            "panel_id": 124,
            "panel_version": "0.96",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: ASPRV1: Rating: ; Mode of pathogenicity: None; Publications: ; Phenotypes: Ichthyosis, lamellar, autosomal dominant, M 146750; Mode of inheritance: None",
            "entity_name": "ASPRV1",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:28:50.776837+10:00",
            "panel_name": "Cardiomyopathy_Paediatric",
            "panel_id": 3270,
            "panel_version": "0.7",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: MRPL44 as ready",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:28:50.766403+10:00",
            "panel_name": "Cardiomyopathy_Paediatric",
            "panel_id": 3270,
            "panel_version": "0.7",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: mrpl44 has been classified as Green List (High Evidence).",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:28:47.574274+10:00",
            "panel_name": "Cardiomyopathy_Paediatric",
            "panel_id": 3270,
            "panel_version": "0.7",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: MRPL44 were changed from Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:28:38.118999+10:00",
            "panel_name": "Cardiomyopathy_Paediatric",
            "panel_id": 3270,
            "panel_version": "0.6",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: MRPL44 were changed from ?Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis) to Combined oxidative phosphorylation deficiency 16, 615395; Multiple respiratory chain complex deficiencies (disorders of protein synthesis)",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:28:32.249343+10:00",
            "panel_name": "Cardiomyopathy_Paediatric",
            "panel_id": 3270,
            "panel_version": "0.5",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: MRPL44 were set to ",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:28:18.376364+10:00",
            "panel_name": "Cardiomyopathy_Paediatric",
            "panel_id": 3270,
            "panel_version": "0.4",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:27:21.846850+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3969",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: MRPL44 as ready",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:27:21.836719+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3969",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: mrpl44 has been classified as Green List (High Evidence).",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:26:43.400411+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3969",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: MRPL44 were changed from  to Combined oxidative phosphorylation deficiency 16, MIM# 615395",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:25:51.757081+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3968",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: MRPL44 were set to ",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:25:32.746795+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3967",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:25:14.195692+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3966",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: MRPL44: Rating: GREEN; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:24:18.224407+10:00",
            "panel_name": "Mitochondrial disease",
            "panel_id": 203,
            "panel_version": "0.468",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: MRPL44 as ready",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:24:18.213447+10:00",
            "panel_name": "Mitochondrial disease",
            "panel_id": 203,
            "panel_version": "0.468",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: mrpl44 has been classified as Green List (High Evidence).",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:24:14.156432+10:00",
            "panel_name": "Mitochondrial disease",
            "panel_id": 203,
            "panel_version": "0.468",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: MRPL44 were changed from  to Combined oxidative phosphorylation deficiency 16, MIM# 615395",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:23:51.160581+10:00",
            "panel_name": "Mitochondrial disease",
            "panel_id": 203,
            "panel_version": "0.467",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: MRPL44 were set to ",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:23:26.133580+10:00",
            "panel_name": "Mitochondrial disease",
            "panel_id": 203,
            "panel_version": "0.466",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: MRPL44 was changed from Unknown to BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:23:02.196048+10:00",
            "panel_name": "Mitochondrial disease",
            "panel_id": 203,
            "panel_version": "0.465",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "edited their review of gene: MRPL44: Changed rating: GREEN",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T16:22:56.416367+10:00",
            "panel_name": "Mitochondrial disease",
            "panel_id": 203,
            "panel_version": "0.465",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: MRPL44: Rating: ; Mode of pathogenicity: None; Publications: 23315540, 25797485; Phenotypes: Combined oxidative phosphorylation deficiency 16, MIM# 615395; Mode of inheritance: BIALLELIC, autosomal or pseudoautosomal",
            "entity_name": "MRPL44",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T14:42:58.917366+10:00",
            "panel_name": "Amenorrhoea",
            "panel_id": 3166,
            "panel_version": "0.32",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Marked gene: FANCL as ready",
            "entity_name": "FANCL",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T14:42:58.906895+10:00",
            "panel_name": "Amenorrhoea",
            "panel_id": 3166,
            "panel_version": "0.32",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Gene: fancl has been classified as Red List (Low Evidence).",
            "entity_name": "FANCL",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T14:42:51.202098+10:00",
            "panel_name": "Amenorrhoea",
            "panel_id": 3166,
            "panel_version": "0.32",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "gene: FANCL was added\ngene: FANCL was added to Amenorrhoea. Sources: Literature\nMode of inheritance for gene: FANCL was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for gene: FANCL were set to 32048394; 32851770; 11823446\nPhenotypes for gene: FANCL were set to Primary ovarian insufficiency\nReview for gene: FANCL was set to AMBER\nAdded comment: 2 independent cases reported with heterozygous loss of function variants and primary ovarian insufficiency. However, there is no reported evidence of POI in female carriers of FANCL pathogenic variants for fanconi anemia. Null mouse model is less fertile and has defective proliferation of germ cells. \nSources: Literature",
            "entity_name": "FANCL",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T13:57:32.789963+10:00",
            "panel_name": "Early-onset Dementia",
            "panel_id": 24,
            "panel_version": "0.72",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Classified STR: PRNP as Green List (high evidence)",
            "entity_name": "PRNP",
            "entity_type": "str"
        },
        {
            "created": "2020-08-28T13:57:32.780969+10:00",
            "panel_name": "Early-onset Dementia",
            "panel_id": 24,
            "panel_version": "0.72",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "Str: prnp has been classified as Green List (High Evidence).",
            "entity_name": "PRNP",
            "entity_type": "str"
        },
        {
            "created": "2020-08-28T13:57:04.709258+10:00",
            "panel_name": "Early-onset Dementia",
            "panel_id": 24,
            "panel_version": "0.71",
            "user_name": "Bryony Thompson",
            "item_type": "entity",
            "text": "STR: PRNP was added\nSTR: PRNP was added to Early-onset Dementia. Sources: Expert list\nSTR tags were added to STR: PRNP.\nMode of inheritance for STR: PRNP was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: PRNP were set to 20301407\nPhenotypes for STR: PRNP were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440\nReview for STR: PRNP was set to GREEN\nSTR: PRNP was marked as clinically relevant\nAdded comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]\r\nNormal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.\r\nPathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. \nSources: Expert list",
            "entity_name": "PRNP",
            "entity_type": "str"
        },
        {
            "created": "2020-08-28T13:17:20.575102+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3966",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Marked gene: KBTBD13 as ready",
            "entity_name": "KBTBD13",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T13:17:20.564700+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3966",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Gene: kbtbd13 has been classified as Green List (High Evidence).",
            "entity_name": "KBTBD13",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T13:17:14.863330+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3966",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Phenotypes for gene: KBTBD13 were changed from  to Nemaline myopathy 6, autosomal dominant, MIM# 609273; Hereditary motor neuropathy; late-onset limb girdle muscular dystrophy",
            "entity_name": "KBTBD13",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T13:16:56.190026+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3965",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: KBTBD13 were set to ",
            "entity_name": "KBTBD13",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T13:16:32.173417+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3964",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Mode of inheritance for gene: KBTBD13 was changed from Unknown to BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "entity_name": "KBTBD13",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T13:16:13.208404+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3963",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "edited their review of gene: KBTBD13: Changed rating: GREEN",
            "entity_name": "KBTBD13",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T13:16:04.821123+10:00",
            "panel_name": "Mendeliome",
            "panel_id": 137,
            "panel_version": "0.3963",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "reviewed gene: KBTBD13: Rating: ; Mode of pathogenicity: None; Publications: 11731279, 21104864; Phenotypes: Nemaline myopathy 6, autosomal dominant, MIM# 609273, Hereditary motor neuropathy, late-onset limb girdle muscular dystrophy; Mode of inheritance: None",
            "entity_name": "KBTBD13",
            "entity_type": "gene"
        },
        {
            "created": "2020-08-28T13:09:07.166763+10:00",
            "panel_name": "Mitochondrial disease",
            "panel_id": 203,
            "panel_version": "0.465",
            "user_name": "Zornitza Stark",
            "item_type": "entity",
            "text": "Publications for gene: NDUFA13 were set to 25901006",
            "entity_name": "NDUFA13",
            "entity_type": "gene"
        }
    ]
}