HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"count": 221304,
"next": "https://panelapp-aus.org/api/v1/activities/?format=api&page=249",
"previous": "https://panelapp-aus.org/api/v1/activities/?format=api&page=247",
"results": [
{
"created": "2025-04-27T09:27:26.991745+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "1.138",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: GLS_GDPAG_GCA as Green List (high evidence)",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:27:26.983932+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "1.138",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: gls_gdpag_gca has been classified as Green List (High Evidence).",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:27:19.471307+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.114",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: GLS_GDPAG_GCA as ready",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:27:19.463434+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.114",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: gls_gdpag_gca has been classified as Green List (High Evidence).",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:27:14.235423+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.114",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: GLS_GDPAG_GCA as Green List (high evidence)",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:27:14.225898+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.114",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: gls_gdpag_gca has been classified as Green List (High Evidence).",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:27:13.088582+10:00",
"panel_name": "Aminoacidopathy",
"panel_id": 3929,
"panel_version": "1.135",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: GLS_GDPAG_GCA as ready",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:27:13.080386+10:00",
"panel_name": "Aminoacidopathy",
"panel_id": 3929,
"panel_version": "1.135",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: gls_gdpag_gca has been classified as Green List (High Evidence).",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:27:00.378435+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "1.137",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: GLS_GDPAG_GCA was added\nSTR: GLS_GDPAG_GCA was added to Genetic Epilepsy. Sources: Expert list\nMode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: GLS_GDPAG_GCA were set to 30970188\nPhenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412\nReview for STR: GLS_GDPAG_GCA was set to GREEN\nSTR: GLS_GDPAG_GCA was marked as clinically relevant\nSTR: GLS_GDPAG_GCA was marked as current diagnostic\nAdded comment: NM_014905.5(GLS):c.-212_-210GCA[X]\r\n3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. \nSources: Expert list",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:26:51.947761+10:00",
"panel_name": "Aminoacidopathy",
"panel_id": 3929,
"panel_version": "1.135",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: GLS_GDPAG_GCA as Green List (high evidence)",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:26:51.940491+10:00",
"panel_name": "Aminoacidopathy",
"panel_id": 3929,
"panel_version": "1.135",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: gls_gdpag_gca has been classified as Green List (High Evidence).",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:26:49.227298+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.113",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: GLS_GDPAG_GCA was added\nSTR: GLS_GDPAG_GCA was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list\nMode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: GLS_GDPAG_GCA were set to 30970188\nPhenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412\nReview for STR: GLS_GDPAG_GCA was set to GREEN\nSTR: GLS_GDPAG_GCA was marked as clinically relevant\nSTR: GLS_GDPAG_GCA was marked as current diagnostic\nAdded comment: NM_014905.5(GLS):c.-212_-210GCA[X]\r\n3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. \nSources: Expert list",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:26:26.068330+10:00",
"panel_name": "Aminoacidopathy",
"panel_id": 3929,
"panel_version": "1.134",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: GLS_GDPAG_GCA was added\nSTR: GLS_GDPAG_GCA was added to Aminoacidopathy. Sources: Expert list\nMode of inheritance for STR: GLS_GDPAG_GCA was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: GLS_GDPAG_GCA were set to 30970188\nPhenotypes for STR: GLS_GDPAG_GCA were set to Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412\nReview for STR: GLS_GDPAG_GCA was set to GREEN\nSTR: GLS_GDPAG_GCA was marked as clinically relevant\nSTR: GLS_GDPAG_GCA was marked as current diagnostic\nAdded comment: NM_014905.5(GLS):c.-212_-210GCA[X]\r\n3 unrelated cases with glutaminase deficiency were compound heterozygous (2) or homozygous for expansion of the repeat, 680-900 repeats in blood samples and 400-110 repeats in fibroblasts. In an analysis of 8295 genomes the median size of the repeat was 14 repeats (8-16 repeats range). There was 1 heterozygous allele with 90 repeats. Functional assays suggest the predominant effect of the repeats is at the level of histone modifications. Epigenetic gene silencing is the mechanism of disease of the repeat. Other variant types are also reported with disease. \nSources: Expert list",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:20:41.398349+10:00",
"panel_name": "Miscellaneous Metabolic Disorders",
"panel_id": 3468,
"panel_version": "1.49",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "GDPAG was changed to GLS_GDPAG_GCA",
"entity_name": "GLS_GDPAG_GCA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:18:36.010034+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2500",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPDM2 was changed to GIPC1_OPDM2_CGG",
"entity_name": "GIPC1_OPDM2_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T09:18:09.950228+10:00",
"panel_name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy",
"panel_id": 3071,
"panel_version": "1.50",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPDM2 was changed to GIPC1_OPDM2_CGG",
"entity_name": "GIPC1_OPDM2_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T09:17:21.095207+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.25",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FXN_FRDA_GAA as ready",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:17:21.089892+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.25",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fxn_frda_gaa has been classified as Green List (High Evidence).",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:17:11.636562+10:00",
"panel_name": "Mitochondrial disease",
"panel_id": 203,
"panel_version": "0.973",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FXN_FRDA_GAA as ready",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:17:11.631074+10:00",
"panel_name": "Mitochondrial disease",
"panel_id": 203,
"panel_version": "0.973",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fxn_frda_gaa has been classified as Green List (High Evidence).",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:17:04.211296+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.25",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: FXN_FRDA_GAA as Green List (high evidence)",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:17:04.205250+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.25",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fxn_frda_gaa has been classified as Green List (High Evidence).",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:17:02.278432+10:00",
"panel_name": "Mitochondrial disease",
"panel_id": 203,
"panel_version": "0.973",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: FXN_FRDA_GAA as Green List (high evidence)",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:17:02.270894+10:00",
"panel_name": "Mitochondrial disease",
"panel_id": 203,
"panel_version": "0.973",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fxn_frda_gaa has been classified as Green List (High Evidence).",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:16:39.355072+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.24",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FXN_FRDA_GAA was added\nSTR: FXN_FRDA_GAA was added to Hereditary Neuropathy - complex. Sources: Expert list\nMode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: FXN_FRDA_GAA were set to 20301458; 8596916\nPhenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300\nReview for STR: FXN_FRDA_GAA was set to GREEN\nSTR: FXN_FRDA_GAA was marked as clinically relevant\nSTR: FXN_FRDA_GAA was marked as current diagnostic\nAdded comment: NM_000144.4:c.165+1340GAA[X]\r\nLoss of function is the mechanism of disease\r\nNormal: 5-33 repeats\r\nMutable normal (premutation): 34-65 repeats\r\nBorderline: 44-66 repeats\r\nFull-penetrance: ≥66 repeats \nSources: Expert list",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:16:36.812251+10:00",
"panel_name": "Mitochondrial disease",
"panel_id": 203,
"panel_version": "0.972",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FXN_FRDA_GAA was added\nSTR: FXN_FRDA_GAA was added to Mitochondrial disease. Sources: Expert list\nMode of inheritance for STR: FXN_FRDA_GAA was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: FXN_FRDA_GAA were set to 20301458; 8596916\nPhenotypes for STR: FXN_FRDA_GAA were set to Friedreich ataxia MIM#229300\nReview for STR: FXN_FRDA_GAA was set to GREEN\nSTR: FXN_FRDA_GAA was marked as clinically relevant\nSTR: FXN_FRDA_GAA was marked as current diagnostic\nAdded comment: NM_000144.4:c.165+1340GAA[X]\r\nLoss of function is the mechanism of disease\r\nNormal: 5-33 repeats\r\nMutable normal (premutation): 34-65 repeats\r\nBorderline: 44-66 repeats\r\nFull-penetrance: ≥66 repeats \nSources: Expert list",
"entity_name": "FXN_FRDA_GAA",
"entity_type": "str"
},
{
"created": "2025-04-27T09:11:26.326340+10:00",
"panel_name": "Ataxia - paediatric",
"panel_id": 271,
"panel_version": "1.34",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked gene: CAPRIN1 as ready",
"entity_name": "CAPRIN1",
"entity_type": "gene"
},
{
"created": "2025-04-27T09:11:26.318743+10:00",
"panel_name": "Ataxia - paediatric",
"panel_id": 271,
"panel_version": "1.34",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Gene: caprin1 has been classified as Green List (High Evidence).",
"entity_name": "CAPRIN1",
"entity_type": "gene"
},
{
"created": "2025-04-27T09:11:22.618783+10:00",
"panel_name": "Ataxia - paediatric",
"panel_id": 271,
"panel_version": "1.34",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified gene: CAPRIN1 as Green List (high evidence)",
"entity_name": "CAPRIN1",
"entity_type": "gene"
},
{
"created": "2025-04-27T09:11:22.612072+10:00",
"panel_name": "Ataxia - paediatric",
"panel_id": 271,
"panel_version": "1.34",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Gene: caprin1 has been classified as Green List (High Evidence).",
"entity_name": "CAPRIN1",
"entity_type": "gene"
},
{
"created": "2025-04-27T09:10:48.300896+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.23",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked gene: CAPRIN1 as ready",
"entity_name": "CAPRIN1",
"entity_type": "gene"
},
{
"created": "2025-04-27T09:10:48.294330+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.23",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Gene: caprin1 has been classified as Green List (High Evidence).",
"entity_name": "CAPRIN1",
"entity_type": "gene"
},
{
"created": "2025-04-27T09:10:40.736787+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.23",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified gene: CAPRIN1 as Green List (high evidence)",
"entity_name": "CAPRIN1",
"entity_type": "gene"
},
{
"created": "2025-04-27T09:10:40.728224+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.23",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Gene: caprin1 has been classified as Green List (High Evidence).",
"entity_name": "CAPRIN1",
"entity_type": "gene"
},
{
"created": "2025-04-27T09:05:05.547784+10:00",
"panel_name": "Blepharophimosis",
"panel_id": 55,
"panel_version": "1.3",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FOXL2_BPES_GCN as ready",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T09:05:05.542032+10:00",
"panel_name": "Blepharophimosis",
"panel_id": 55,
"panel_version": "1.3",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T09:05:04.890866+10:00",
"panel_name": "Blepharophimosis",
"panel_id": 55,
"panel_version": "1.3",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: FOXL2_BPES_GCN as Green List (high evidence)",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T09:05:04.884588+10:00",
"panel_name": "Blepharophimosis",
"panel_id": 55,
"panel_version": "1.3",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T09:04:39.622548+10:00",
"panel_name": "Primary Ovarian Insufficiency_Premature Ovarian Failure",
"panel_id": 3166,
"panel_version": "0.347",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FOXL2_BPES_GCN as ready",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T09:04:39.616425+10:00",
"panel_name": "Primary Ovarian Insufficiency_Premature Ovarian Failure",
"panel_id": 3166,
"panel_version": "0.347",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T09:04:34.701642+10:00",
"panel_name": "Primary Ovarian Insufficiency_Premature Ovarian Failure",
"panel_id": 3166,
"panel_version": "0.347",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: FOXL2_BPES_GCN as Green List (high evidence)",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T09:04:34.692186+10:00",
"panel_name": "Primary Ovarian Insufficiency_Premature Ovarian Failure",
"panel_id": 3166,
"panel_version": "0.347",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: foxl2_bpes_gcn has been classified as Green List (High Evidence).",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T09:04:34.376137+10:00",
"panel_name": "Blepharophimosis",
"panel_id": 55,
"panel_version": "1.2",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FOXL2_BPES_GCN was added\nSTR: FOXL2_BPES_GCN was added to Blepharophimosis. Sources: Literature\nMode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808\nPhenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996\nReview for STR: FOXL2_BPES_GCN was set to GREEN\nSTR: FOXL2_BPES_GCN was marked as clinically relevant\nSTR: FOXL2_BPES_GCN was marked as current diagnostic\nAdded comment: NM_023067.2:c.661_702[X]\r\nMechanism of disease is polyAlanine tract leading to a loss of function of the protein\r\nNormal repeat number: 14\r\nPathogenic repeat number: 19-24 \nSources: Literature",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T09:04:26.512326+10:00",
"panel_name": "Primary Ovarian Insufficiency_Premature Ovarian Failure",
"panel_id": 3166,
"panel_version": "0.346",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FOXL2_BPES_GCN was added\nSTR: FOXL2_BPES_GCN was added to Primary Ovarian Insufficiency_Premature Ovarian Failure. Sources: Literature\nMode of inheritance for STR: FOXL2_BPES_GCN was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: FOXL2_BPES_GCN were set to 11468277; 33811808\nPhenotypes for STR: FOXL2_BPES_GCN were set to Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100; Premature ovarian failure 3 MIM#608996\nReview for STR: FOXL2_BPES_GCN was set to GREEN\nSTR: FOXL2_BPES_GCN was marked as clinically relevant\nSTR: FOXL2_BPES_GCN was marked as current diagnostic\nAdded comment: NM_023067.2:c.661_702[X]\r\nMechanism of disease is polyAlanine tract leading to a loss of function of the protein\r\nNormal repeat number: 14\r\nPathogenic repeat number: 19-24 \nSources: Literature",
"entity_name": "FOXL2_BPES_GCN",
"entity_type": "str"
},
{
"created": "2025-04-27T08:54:48.923310+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.112",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FMR1_FXS_CGG as ready",
"entity_name": "FMR1_FXS_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T08:54:48.915325+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.112",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).",
"entity_name": "FMR1_FXS_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T08:54:30.940336+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.112",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: FMR1_FXS_CGG as Green List (high evidence)",
"entity_name": "FMR1_FXS_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T08:54:30.930491+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.112",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fmr1_fxs_cgg has been classified as Green List (High Evidence).",
"entity_name": "FMR1_FXS_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T08:54:10.731441+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.24",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FXTAS was changed to FMR1_FXTAS_CGG",
"entity_name": "FMR1_FXTAS_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T08:53:09.794625+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.111",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: FMR1_FXS_CGG was added\nSTR: FMR1_FXS_CGG was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list\nMode of inheritance for STR: FMR1_FXS_CGG was set to X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)\nPublications for STR: FMR1_FXS_CGG were set to 33795824; 25227148; 1710175; 2031184\nPhenotypes for STR: FMR1_FXS_CGG were set to Fragile X syndrome\tMIM#300624\nReview for STR: FMR1_FXS_CGG was set to GREEN\nSTR: FMR1_FXS_CGG was marked as clinically relevant\nSTR: FMR1_FXS_CGG was marked as current diagnostic\nAdded comment: HGVS nomenclature - NM_002024.5:c.-129_-127CGG[X]\r\nLoss of function through methylation silencing of FMR1 is associated with the FXS phenotype. Intermediate (gray zone, inconclusive, borderline): ~45 to ~54 repeats\r\nPremutation - risk of FXTAS: ~55 to ~200 repeats\r\nFull mutation - fragile X syndrome (FXS): >200 \nSources: Expert list",
"entity_name": "FMR1_FXS_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T08:47:54.573921+10:00",
"panel_name": "Primary Ovarian Insufficiency_Premature Ovarian Failure",
"panel_id": 3166,
"panel_version": "0.345",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: FMR1_FXPOI_CGG as ready",
"entity_name": "FMR1_FXPOI_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T08:47:54.568158+10:00",
"panel_name": "Primary Ovarian Insufficiency_Premature Ovarian Failure",
"panel_id": 3166,
"panel_version": "0.345",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: fmr1_fxpoi_cgg has been classified as Green List (High Evidence).",
"entity_name": "FMR1_FXPOI_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T08:47:48.537103+10:00",
"panel_name": "Primary Ovarian Insufficiency_Premature Ovarian Failure",
"panel_id": 3166,
"panel_version": "0.345",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FXPOI was changed to FMR1_FXPOI_CGG",
"entity_name": "FMR1_FXPOI_CGG",
"entity_type": "str"
},
{
"created": "2025-04-27T08:44:16.327023+10:00",
"panel_name": "Clefting disorders",
"panel_id": 3368,
"panel_version": "0.264",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: EIF4A3_RCPS_complex as ready",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:44:16.320037+10:00",
"panel_name": "Clefting disorders",
"panel_id": 3368,
"panel_version": "0.264",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:44:10.150536+10:00",
"panel_name": "Pierre Robin Sequence",
"panel_id": 160,
"panel_version": "0.49",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: EIF4A3_RCPS_complex as ready",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:44:10.145264+10:00",
"panel_name": "Pierre Robin Sequence",
"panel_id": 160,
"panel_version": "0.49",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:44:06.174616+10:00",
"panel_name": "Mandibulofacial Acrofacial dysostosis",
"panel_id": 136,
"panel_version": "1.14",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: EIF4A3_RCPS_complex as ready",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:44:06.168443+10:00",
"panel_name": "Mandibulofacial Acrofacial dysostosis",
"panel_id": 136,
"panel_version": "1.14",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:56.342059+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.110",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: EIF4A3_RCPS_complex as ready",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:56.332805+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.110",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:53.944023+10:00",
"panel_name": "Pierre Robin Sequence",
"panel_id": 160,
"panel_version": "0.49",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:53.937655+10:00",
"panel_name": "Pierre Robin Sequence",
"panel_id": 160,
"panel_version": "0.49",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:50.479407+10:00",
"panel_name": "Clefting disorders",
"panel_id": 3368,
"panel_version": "0.264",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:50.471204+10:00",
"panel_name": "Clefting disorders",
"panel_id": 3368,
"panel_version": "0.264",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:44.240687+10:00",
"panel_name": "Mandibulofacial Acrofacial dysostosis",
"panel_id": 136,
"panel_version": "1.14",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:44.229759+10:00",
"panel_name": "Mandibulofacial Acrofacial dysostosis",
"panel_id": 136,
"panel_version": "1.14",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:35.885895+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.110",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: EIF4A3_RCPS_complex as Green List (high evidence)",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:35.878522+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.110",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: eif4a3_rcps_complex has been classified as Green List (High Evidence).",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:13.832228+10:00",
"panel_name": "Pierre Robin Sequence",
"panel_id": 160,
"panel_version": "0.48",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: EIF4A3_RCPS_complex was added\nSTR: EIF4A3_RCPS_complex was added to Pierre Robin Sequence. Sources: Literature\nMode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243\nPhenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome\nReview for STR: EIF4A3_RCPS_complex was set to GREEN\nSTR: EIF4A3_RCPS_complex was marked as clinically relevant\nSTR: EIF4A3_RCPS_complex was marked as current diagnostic\nAdded comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]\r\nComplex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. \nSources: Literature",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:12.624589+10:00",
"panel_name": "Clefting disorders",
"panel_id": 3368,
"panel_version": "0.263",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: EIF4A3_RCPS_complex was added\nSTR: EIF4A3_RCPS_complex was added to Clefting disorders. Sources: Expert list\nMode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243\nPhenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome\nReview for STR: EIF4A3_RCPS_complex was set to GREEN\nSTR: EIF4A3_RCPS_complex was marked as clinically relevant\nSTR: EIF4A3_RCPS_complex was marked as current diagnostic\nAdded comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]\r\nComplex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. \nSources: Expert list",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:43:02.719842+10:00",
"panel_name": "Mandibulofacial Acrofacial dysostosis",
"panel_id": 136,
"panel_version": "1.13",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: EIF4A3_RCPS_complex was added\nSTR: EIF4A3_RCPS_complex was added to Mandibulofacial Acrofacial dysostosis. Sources: Expert list\nMode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243\nPhenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome\nReview for STR: EIF4A3_RCPS_complex was set to GREEN\nSTR: EIF4A3_RCPS_complex was marked as clinically relevant\nSTR: EIF4A3_RCPS_complex was marked as current diagnostic\nAdded comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]\r\nComplex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. \nSources: Expert list",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-27T08:42:52.785967+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.109",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: EIF4A3_RCPS_complex was added\nSTR: EIF4A3_RCPS_complex was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list\nMode of inheritance for STR: EIF4A3_RCPS_complex was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: EIF4A3_RCPS_complex were set to 24360810; 29112243\nPhenotypes for STR: EIF4A3_RCPS_complex were set to Robin sequence with cleft mandible and limb anomalies MIM#268305; Richieri-Costa-Pereira syndrome\nReview for STR: EIF4A3_RCPS_complex was set to GREEN\nSTR: EIF4A3_RCPS_complex was marked as clinically relevant\nSTR: EIF4A3_RCPS_complex was marked as current diagnostic\nAdded comment: NM_014740.4(EIF4A3):c.-98_-81del18insTCGGCAGCGGCACAGCGAGG[X]\r\nComplex repeat motifs containing 18 or 20 nt, divided in three types: (1) a 20-nt motif, TCGGCAGCGGCACAGCGAGG; (2) a 18-nt motif, TCGGCAGCGGCAGCGAGG; and (3) another 20-nt motif that possessed a G instead of an A, TCGGCAGCGGCGCAGCGAGG. The most prevalent (97%) allelic pattern among controls is an initial CACA-20-nt repeated between 2 and 9 times, followed by one CA-18-nt, another CACA-20-nt, and one final CA-18-nt (total repeats = 5 to 12). Affected individuals exhibited the following pattern: an initial CACA-20-nt, followed by 12 to 13 repeats of CGCA-20-nt, one CACA-20-nt, and one final CA-18-nt. At least 5 Brazilian families homozygous or compound heterozygous for 14-16 total repeats or compound het with a missense variant. \nSources: Expert list",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-26T16:27:52.219316+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.142",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Marked gene: CAPN3 as ready",
"entity_name": "CAPN3",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:27:52.212317+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.142",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Gene: capn3 has been classified as Green List (High Evidence).",
"entity_name": "CAPN3",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:27:50.041013+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.142",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Phenotypes for gene: CAPN3 were changed from Muscular dystrophy, limb-girdle, type 2A, 253600 (3) to Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM#253600",
"entity_name": "CAPN3",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:27:41.716442+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.141",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Publications for gene: CAPN3 were set to ",
"entity_name": "CAPN3",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:27:26.496565+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.140",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Marked gene: CANT1 as ready",
"entity_name": "CANT1",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:27:26.489435+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.140",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Gene: cant1 has been classified as Green List (High Evidence).",
"entity_name": "CANT1",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:27:24.514578+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.140",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Phenotypes for gene: CANT1 were changed from Desbuquois dysplasia, 251450 (3) to Desbuquois dysplasia 1, MIM# 251450; Epiphyseal dysplasia, multiple, 7, MIM# 617719",
"entity_name": "CANT1",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:27:12.146391+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.139",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Publications for gene: CANT1 were set to ",
"entity_name": "CANT1",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:26:56.502513+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.138",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Marked gene: C5orf42 as ready",
"entity_name": "C5orf42",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:26:56.492838+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.138",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Gene: c5orf42 has been classified as Green List (High Evidence).",
"entity_name": "C5orf42",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:26:54.290912+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.138",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Phenotypes for gene: C5orf42 were changed from Joubert syndrome 17, 614615 (3) to Joubert syndrome 17, MIM# 614615; Orofaciodigital syndrome VI, MIM# 277170",
"entity_name": "C5orf42",
"entity_type": "gene"
},
{
"created": "2025-04-26T16:26:46.030148+10:00",
"panel_name": "Prepair 500+",
"panel_id": 4225,
"panel_version": "1.137",
"user_name": "Zornitza Stark",
"item_type": "entity",
"text": "Publications for gene: C5orf42 were set to ",
"entity_name": "C5orf42",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:48:46.019811+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "gene: MEIOB was added\ngene: MEIOB was added to Infertility and Pregnancy Loss. Sources: Literature\nMode of inheritance for gene: MEIOB was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for gene: MEIOB were set to 28206990; 34392356; 35991565; 37715646; 31000419; 39545410; 30838384\nPhenotypes for gene: MEIOB were set to Premature ovarian failure 23, MIM# 620686; Spermatogenic failure 22, MIM# 617706\nReview for gene: MEIOB was set to GREEN\nAdded comment: Literature in OMIM- PMID: 28206990; 34392356; 35991565; 37715646; 31000419- multiple unrelated infertile males due to spermatogenic failure and females due to premature ovarian failure carrying biallelic variants, supported by functional evidence.\r\n\r\nNew papers:\r\ni) PMID: 39545410- previously reported homozygous nonsense p.(Arg272*) in proband 2136 (Egyptian), with a history of 6 early miscarriages, 3 failed intracytoplasmic sperm injection cycles, 1 HM, and low anti-Müllerian hormone (AMH) (2 times ≤0.2 ng/mL). \r\n\r\nii) PMID: 30838384- A novel homozygous frameshift variant in two brothers of Arab ethnicity. This frame-shift is predicted to result in a truncated MEIOB protein, which lacks the conserved C-terminal DNA binding domain. \nSources: Literature",
"entity_name": "MEIOB",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:40:45.511962+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "changed review comment from: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants.\r\n\r\nNew papers (monoallelic and biallelic variants for male infertility):\r\ni) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia. \r\n\r\nii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11).\r\n\r\niii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA. \r\n\r\nNew paper (biallelic variant for Hydatidiform mole):\r\ni) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure. \nSources: Literature; to: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants.\r\n\r\nNew papers (monoallelic and biallelic variants for male infertility):\r\ni) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia. \r\n\r\nii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11).\r\n\r\niii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA. \r\n\r\nNew paper (biallelic variant for hydatidiform mole):\r\ni) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure. \r\nSources: Literature",
"entity_name": "SYCP2",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:40:31.679911+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "gene: SYCP2 was added\ngene: SYCP2 was added to Infertility and Pregnancy Loss. Sources: Literature\nMode of inheritance for gene: SYCP2 was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for gene: SYCP2 were set to 31866047; 39202451; 38511217; 37337432; 39545410\nPhenotypes for gene: SYCP2 were set to Spermatogenic failure 1, MIM# 258150; Hydatidiform mole\nReview for gene: SYCP2 was set to GREEN\nAdded comment: Literature in OMIM- PMID: 31866047- Three men with oligo- or azoospermia with heterozygous truncating variants.\r\n\r\nNew papers (monoallelic and biallelic variants for male infertility):\r\ni) PMID: 39202451- Novel heterozygous loss-of-function (LOF) variants (c.89dup, c.946_947del, and c.4378_4379del) reported in three unrelated Chinese patients with oligoasthenozoospermia. \r\n\r\nii) PMID: 38511217- Heterozygous p.I63S and p.R509del in two unrelated NOA-affected males (Case 10 and 11).\r\n\r\niii) PMID: 37337432- Homozygous loss-of-function variant (c.2689_2690insT) in an NOA-affected patient. HE, IF, and meiotic chromosomal spread analyses demonstrated that spermatogenesis was arrested at the zygotene stage in the proband with NOA. \r\n\r\nNew paper (biallelic variant for Hydatidiform mole):\r\ni) PMID: 39545410- A homozygous splice variant at acceptor site c.2530-2A>G in patient 1954 (Egyptian), with 4 CHMs and 2 years of primary and secondary infertility (before the first and after the third HM). In silico analysis of the effect of this variant on SYCP2 splicing using Human Splicing Finder (21) predicted that the c.2530-2A>G variant abolishes the splice acceptor site of exon 27 and impairs normal splicing. SYCP2 codes for an axial/lateral element of the synaptonemal complex that is essential for meiotic homologous chromosome synapsis. Male Sycp2-null mice are infertile, while the females have reduced litter sizes (PMID: 16717126). In humans, SYCP2 P/LP variants have been reported in a heterozygous state in infertile males but not in women with reproductive failure. \nSources: Literature",
"entity_name": "SYCP2",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:32:15.604162+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "changed review comment from: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125)\r\n\r\nLiterature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants\r\n\r\nNew paper:\r\ni) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). \r\nSources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125)\r\n\r\nLiterature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants\r\n\r\nNew paper:\r\ni) PMID: 39545410- Compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). \r\nSources: Literature",
"entity_name": "CCDC155",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:31:52.274449+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "changed review comment from: Note- HGNC Approved Gene Symbol: KASH5\r\n\r\nLiterature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants\r\n\r\nNew paper:\r\ni) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). \nSources: Literature; to: Note- HGNC Approved Gene Symbol: KASH5 (MIM #618125)\r\n\r\nLiterature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants\r\n\r\nNew paper:\r\ni) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). \r\nSources: Literature",
"entity_name": "CCDC155",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:31:20.913108+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "gene: CCDC155 was added\ngene: CCDC155 was added to Infertility and Pregnancy Loss. Sources: Literature\nMode of inheritance for gene: CCDC155 was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for gene: CCDC155 were set to 29790874; 35674372; 36864840; 35708642; 39545410\nPhenotypes for gene: CCDC155 were set to Premature ovarian failure 22, MIM# 620548; Spermatogenic failure 88, MIM# 620547\nReview for gene: CCDC155 was set to GREEN\nAdded comment: Note- HGNC Approved Gene Symbol: KASH5\r\n\r\nLiterature in OMIM- PMID: 29790874; 35674372; 36864840;35708642- multiple unrelated infertile females (diminished ovarian reserve, recurrent miscarriage) and males (NOA) with different biallelic variants\r\n\r\nNew paper:\r\ni) PMID: 39545410-compound heterozygous variants pArg519* and p.Leu535Gln in patient 439 (Jordanian), with 3 HMs and 2 miscarriages. The L535Q variant was previously reported in a homozygous state by Fakhro et al. in 2 infertile Qatari brothers with azoospermia (PMID: 29790874). In mice, both male and female null mutants of Kash5 are infertile (PMID: 24062341). \nSources: Literature",
"entity_name": "CCDC155",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:22:42.493639+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "edited their review of gene: C11orf80: Changed publications: 30388401, 36732965",
"entity_name": "C11orf80",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:22:04.986877+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "gene: MAJIN was added\ngene: MAJIN was added to Infertility and Pregnancy Loss. Sources: Literature\nMode of inheritance for gene: MAJIN was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for gene: MAJIN were set to 39545410; 33211200\nPhenotypes for gene: MAJIN were set to Recurrent hydatidiform mole, non-obstructive azoospermia\nReview for gene: MAJIN was set to AMBER\nAdded comment: New papers (biallelic variant for HM/male infertility):\r\ni) PMID: 39545410- Novel homozygous splice donor site variant c.349+1G>T in patient 1824 (Italian) with 2 HMs followed by secondary infertility and substantially reduced bilateral ovarian volumes. MAJIN codes for a junction protein that forms a complex with TERB1 and TERB2, which together bind to telomeres and anchor them to the inner nuclear membrane components KASH5 and SUN1. This attachment of chromosomes to the nuclear envelope is essential for homologous chromosome movement and synapsis. In mice, both male and female null mutants Majin are infertile (PMID: 26548954). In humans, biallelic mutations in MAJIN have been reported in infertile males.\r\n\r\nii) PMID: 33211200- A homozygous p.Arg53His in NOA-affected male (Individual 4- M1646) with high CADD scores and low gnomad freq. Mice disrupted for either Majin or Terb2 display impaired synapsis, zygotene arrest, a lack of postmeiotic cells and infertility (Shibuya et al. 2015; Zhang et al. 2017). \nSources: Literature",
"entity_name": "MAJIN",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:17:34.108908+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "gene: C11orf80 was added\ngene: C11orf80 was added to Infertility and Pregnancy Loss. Sources: Literature\nMode of inheritance for gene: C11orf80 was set to BIALLELIC, autosomal or pseudoautosomal\nPhenotypes for gene: C11orf80 were set to Recurrent hydatidiform mole 4, MIM # 618432\nReview for gene: C11orf80 was set to AMBER\nAdded comment: Note: HGNC Approved Gene Symbol- TOP6BL \r\n\r\nLiterature in OMIM- PubMed: 30388401- Two unrelated females with RHMs carrying a homozygous p.Glu262∗ and p.Ser501Pro, respectively.\r\n\r\nNew paper (biallelic variants for OZEMA/NOA)\r\ni) PMID: 36732965- A homozygous LOF p.E162* in four infertile siblings born to a consanguineous marriage, with three brothers suffering from non-obstructive azoospermia and one sister suffering from unexplained infertility. Mouse models carrying similar mutations to that in patients recapitulated the spermatogenic abnormalities of the patient. \nSources: Literature",
"entity_name": "C11orf80",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:05:56.753282+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "gene: DNAAF4 was added\ngene: DNAAF4 was added to Infertility and Pregnancy Loss. Sources: Literature\nMode of inheritance for gene: DNAAF4 was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for gene: DNAAF4 were set to 23872636; 37674365; 37147940; 36583018; 35903363\nPhenotypes for gene: DNAAF4 were set to Primary ciliary dyskinesia 25, MIM# 615482\nReview for gene: DNAAF4 was set to GREEN\nAdded comment: Literature in OMIM- PMID: 23872636- biallelic variants reported for PCD, and reduced fertility was observed.\r\n\r\nNew papers (biallelic variants reported for PCD/ infertility):\r\ni) PMID: 37674365- A novel homozygous splice acceptor site variant in DNAAF4 in two brother with asthenozoospermia. Functional assay revealed the absence of any exon 7-containing DNAAF4 transcripts in the sperm from P1, unlike in a normal control sample, consistent with the dysfunction or loss of DNAAF4 protein expression that may explain the abnormal sperm phenotypes in this patient.\r\n\r\nii) PMID: 37147940- Novel compound heterozygous splice site c.784-1G>A and 20.1 Kb deletion in a male with PCD and asthenoteratozoospermia, resulting in a truncated and functionless DNAAF4 protein. mmunofluorescence analysis indicated that the inner dynein arm was not present in the sperm flagellum, and sperm morphological analysis revealed small sperm with twisted and curved flagella or lacking flagella. \r\n\r\niii) PMID: 36583018- A novel homozygous p. G373E variant in a female patient with PCD who was born in a consanguineous family. Functional assays showed that the variant lead to PCD by reducing the stability of DNAAF4 protein.\r\n\r\niv) PMID: 35903363- Two homozygous variants, Arg330Trp and p.Arg245*, identified in two unrelated male and female with PCD. The affected male had asthenoteratozoospermia while female with primary infertility. \nSources: Literature",
"entity_name": "DNAAF4",
"entity_type": "gene"
},
{
"created": "2025-04-25T22:00:07.223665+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "gene: TBPL2 was added\ngene: TBPL2 was added to Infertility and Pregnancy Loss. Sources: Literature\nMode of inheritance for gene: TBPL2 was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for gene: TBPL2 were set to 37804378; 33966269; 33893736; 33541821\nPhenotypes for gene: TBPL2 were set to Oocyte maturation arrest\nReview for gene: TBPL2 was set to GREEN\nAdded comment: New papers reporting biallelic variants in infertile women:\r\ni) PMID: 37804378- Compound heterozygous novel p.Arg268Ter and recurrent p.Arg233Ter in a female with impaired ovarian folliculogenesis. Structure prediction by molecular modeling demonstrated that three-dimensional structure of TBPL2 was destabilized in mutant proteins.\r\n\r\nii) PMID: 33966269- Homozygous missense mutation p.C299R in two infertile sisters with oocyte maturation arrest and degeneration from a consanguineous family. Functional assays showed that the transcriptional level of ZP3 was not completely blocked but severely reduced by the regulation of the mutant TBPL2, while the transcriptional level of H2Bc was significantly reduced but to a less severe extent compared with that of ZP3, suggesting that the missense had a damage to the transcription initiation function of TBPL2 and its downstream targeted genes got involved in different degrees. The mutant protein also has less stability, which contributes to the lower activity of transcription initiation in the mutant form.\r\n\r\niii) PMID: 33893736- Homozygous splicing variant (c.788 + 3A>G) in two unrelated families characterized by oocyte maturation defects. Functional assays showed that the variant disrupted the integrity of TBPL2 mRNA and affected oocytes showed that vital genes for oocyte maturation and fertilization were widely and markedly downregulated, suggesting that a mutation in TBPL2, led to global gene alterations in oocytes; the same variant reported before in PMID: 33541821 in three affected females with diminished ovarian reserve from 3 independent families. \nSources: Literature",
"entity_name": "TBPL2",
"entity_type": "gene"
},
{
"created": "2025-04-25T21:56:23.276590+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "changed review comment from: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA)\r\n\r\nNew papers (biallelic variants for OZEMA):\r\ni) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles. \r\n\r\nii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1.\r\n\r\nNew papers (biallelic variants for NOA):\r\ni) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro.\r\n- others- PMID: 32741963, PMID: 36017582\r\n\r\nNote: Moderate evidence for OZEMA and HM in FeRGI database \nSources: Literature; to: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA)\r\n\r\nNew papers (biallelic variants for OZEMA):\r\ni) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles. \r\n\r\nii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1.\r\n\r\nNew papers (biallelic variants for NOA):\r\ni) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro.\r\n- others: PMID: 32741963;36017582\r\n\r\nNote: Moderate evidence for OZEMA and HM in FeRGI database \r\nSources: Literature",
"entity_name": "MEI1",
"entity_type": "gene"
},
{
"created": "2025-04-25T21:55:55.927131+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "edited their review of gene: MEI1: Changed publications: 30388401, 38416203, 34037756, 36759719, 32741963, 36017582",
"entity_name": "MEI1",
"entity_type": "gene"
},
{
"created": "2025-04-25T21:54:59.496534+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "gene: MEI1 was added\ngene: MEI1 was added to Infertility and Pregnancy Loss. Sources: Literature\nMode of inheritance for gene: MEI1 was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for gene: MEI1 were set to 30388401\nPhenotypes for gene: MEI1 were set to Recurrent hydatidiform mole 3, MIM# 618431; Non-obstructive azoospermia\nReview for gene: MEI1 was set to GREEN\nAdded comment: Literature in OMIM- PubMed: 30388401- biallelic variants in two women with history of RPL and HM (probands 1333 and 880) and affected family members (females with similar phenotypes and also male with NOA)\r\n\r\nNew papers (biallelic variants for OZEMA):\r\ni) PMID: 38416203- novel compound heterozygous frameshift variants (c.3002delC and c.2264_2268 + 11delGTGAGGTATGGACCAC) in a case of a female infertile patient suffering from embryonic arrest and recurrent implantation failure. Her arrested embryos from MEI1-affected oocytes exhibited abnormalities in copy number variation and DNA methylation following CMA, which contrasts with the proliferating embryos secondary to the loss of maternal chromosomes in hydatidiform moles. \r\n\r\nii)PMID: 34037756- five novel mutations in MEI1 in nine patients with similar infertile phenotypes of recurrent hydatidiform moles, embryonic arrest, recurrent implantation failure, and recurrent pregnancy loss from seven independent families. In vitro studies also demonstrated that protein-truncating and missense mutations reduced the protein level of MEI1, while the splicing mutations caused abnormal alternative splicing of MEI1.\r\n\r\nNew papers (biallelic variants for NOA):\r\ni) PMID: 36759719- Biallelic deleterious variants in four Chinese patients with NOA. Testicular pathologic analysis and immunohistochemical staining revealed that spermatogenesis is arrested at spermatocyte stage, with defective programmed DNA double-strand breaks (DSBs) homoeostasis and meiotic chromosome synapsis in patients carrying the variants. In addition, our results showed that one missense variant (c.G186C) reduced the expression of MEI1 and one frameshift variant (c.251delT) led to truncated proteins of MEI1 in in vitro.\r\n- others- PMID: 32741963, PMID: 36017582\r\n\r\nNote: Moderate evidence for OZEMA and HM in FeRGI database \nSources: Literature",
"entity_name": "MEI1",
"entity_type": "gene"
},
{
"created": "2025-04-25T21:45:59.019665+10:00",
"panel_name": "Infertility and Pregnancy Loss",
"panel_id": 4455,
"panel_version": "0.77",
"user_name": "Jasmine Chew",
"item_type": "entity",
"text": "gene: FOXL2 was added\ngene: FOXL2 was added to Infertility and Pregnancy Loss. Sources: Literature\nMode of inheritance for gene: FOXL2 was set to BOTH monoallelic and biallelic, autosomal or pseudoautosomal\nPublications for gene: FOXL2 were set to 12149404; 19429596; 38558253; 36793102; 39545410\nPhenotypes for gene: FOXL2 were set to Premature ovarian failure 3, #MIM 608996\nAdded comment: Literature in OMIM- PubMed: 12149404; 19429596- multiple patients with isolated POF carrying monoallelic variants\r\n\r\nNew papers (monoallelic variants for POI):\r\ni) PMID: 38558253- One in-frame deletion and 13 missense variants, including two recurrent ones (p.(Pro212Ala) and p.(Arg349Gly) in 14 patients with POI/DOR. Two variants, (p.(Gly187Asp) and p.(Arg349Gly) have been previously identified in patients with non-syndromic POI (PMID: 19429596 and PMID: 36793102).\r\n\r\nii) PMID: 36793102- Sixteen POI patients carrying four different heterozygous variants, including the recurrent p.(Arg349Gly). Functional assay on the recurrent variant showed that the mutant FOXL2 did not present with the transcriptional repressive effect on CYP17A1 expression as shown by wild-type protein.\r\n\r\nNew paper (biallelic variants for HM):\r\ni) PMID: 39545410- A novel homozygous missense p.(Phe167Ser) in patient 1690 (South Asian) with 5 CHMs, 3 miscarriages, 1 stillbirth, and 1 live birth. FOXL2 is essential for granulosa cell differentiation and proliferation, as well as ovarian maintenance and function.Therefore, its impairment may affect indirectly the meiotic maturation of oocytes, and may consequently lead to molar pregnancies. \nSources: Literature",
"entity_name": "FOXL2",
"entity_type": "gene"
}
]
}