HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept
{
"count": 221304,
"next": "https://panelapp-aus.org/api/v1/activities/?format=api&page=252",
"previous": "https://panelapp-aus.org/api/v1/activities/?format=api&page=250",
"results": [
{
"created": "2025-04-25T15:08:09.381641+10:00",
"panel_name": "Dystonia - complex",
"panel_id": 290,
"panel_version": "0.274",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: ARX_EIEE1_GCN1 as Green List (high evidence)",
"entity_name": "ARX_EIEE1_GCN1",
"entity_type": "str"
},
{
"created": "2025-04-25T15:08:09.374991+10:00",
"panel_name": "Dystonia - complex",
"panel_id": 290,
"panel_version": "0.274",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: arx_eiee1_gcn1 has been classified as Green List (High Evidence).",
"entity_name": "ARX_EIEE1_GCN1",
"entity_type": "str"
},
{
"created": "2025-04-25T15:08:05.205090+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.104",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: ARX_EIEE1_GCN1 was added\nSTR: ARX_EIEE1_GCN1 was added to Intellectual disability syndromic and non-syndromic. Sources: Expert list\nMode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females\nPublications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808\nPhenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510\nReview for STR: ARX_EIEE1_GCN1 was set to GREEN\nSTR: ARX_EIEE1_GCN1 was marked as clinically relevant\nSTR: ARX_EIEE1_GCN1 was marked as current diagnostic\nAdded comment: NM_139058.3(ARX):c.306GGC[X]\r\nMechanism of disease is polyAlanine tract associated with dominant-negative effect\r\nPolyAla tract 1 of 2 polyAla tracts associated with disease\r\nNormal repeat number: 16\r\nPathogenic repeat number: 23 \nSources: Expert list",
"entity_name": "ARX_EIEE1_GCN1",
"entity_type": "str"
},
{
"created": "2025-04-25T15:08:00.477940+10:00",
"panel_name": "Genetic Epilepsy",
"panel_id": 202,
"panel_version": "1.128",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: ARX_EIEE1_GCN1 was added\nSTR: ARX_EIEE1_GCN1 was added to Genetic Epilepsy. Sources: Expert list\nMode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females\nPublications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808\nPhenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510\nReview for STR: ARX_EIEE1_GCN1 was set to GREEN\nSTR: ARX_EIEE1_GCN1 was marked as clinically relevant\nSTR: ARX_EIEE1_GCN1 was marked as current diagnostic\nAdded comment: NM_139058.3(ARX):c.306GGC[X]\r\nMechanism of disease is polyAlanine tract associated with dominant-negative effect\r\nPolyAla tract 1 of 2 polyAla tracts associated with disease\r\nNormal repeat number: 16\r\nPathogenic repeat number: 23 \nSources: Expert list",
"entity_name": "ARX_EIEE1_GCN1",
"entity_type": "str"
},
{
"created": "2025-04-25T15:07:38.037923+10:00",
"panel_name": "Dystonia - complex",
"panel_id": 290,
"panel_version": "0.273",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: ARX_EIEE1_GCN1 was added\nSTR: ARX_EIEE1_GCN1 was added to Dystonia - complex. Sources: Expert Review\nMode of inheritance for STR: ARX_EIEE1_GCN1 was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females\nPublications for STR: ARX_EIEE1_GCN1 were set to 11889467; 33811808\nPhenotypes for STR: ARX_EIEE1_GCN1 were set to Developmental and epileptic encephalopathy 1 MIM#308350; Intellectual disability, X-linked 29 and others MIM#300419; Partington syndrome MIM#309510\nReview for STR: ARX_EIEE1_GCN1 was set to GREEN\nSTR: ARX_EIEE1_GCN1 was marked as clinically relevant\nSTR: ARX_EIEE1_GCN1 was marked as current diagnostic\nAdded comment: NM_139058.3(ARX):c.306GGC[X]\r\nMechanism of disease is polyAlanine tract associated with dominant-negative effect\r\nPolyAla tract 1 of 2 polyAla tracts associated with disease\r\nNormal repeat number: 16\r\nPathogenic repeat number: 23 \nSources: Expert Review",
"entity_name": "ARX_EIEE1_GCN1",
"entity_type": "str"
},
{
"created": "2025-04-25T15:01:19.667376+10:00",
"panel_name": "Dystonia - complex",
"panel_id": 290,
"panel_version": "0.272",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Tag STR tag was added to gene: ARX.",
"entity_name": "ARX",
"entity_type": "gene"
},
{
"created": "2025-04-25T14:56:40.550054+10:00",
"panel_name": "Motor Neurone Disease",
"panel_id": 25,
"panel_version": "1.30",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SBMA was changed to AR_SBMA_CAG",
"entity_name": "AR_SBMA_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T14:55:06.514433+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2490",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: AFF2_FRAXE_GCC as ready",
"entity_name": "AFF2_FRAXE_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T14:55:06.508160+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2490",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: aff2_fraxe_gcc has been classified as Green List (High Evidence).",
"entity_name": "AFF2_FRAXE_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T14:54:45.241540+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2490",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: AFF2_FRAXE_GCC as Green List (high evidence)",
"entity_name": "AFF2_FRAXE_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T14:54:45.225287+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2490",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: aff2_fraxe_gcc has been classified as Green List (High Evidence).",
"entity_name": "AFF2_FRAXE_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T14:54:26.159344+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2489",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: AFF2_FRAXE_GCC was added\nSTR: AFF2_FRAXE_GCC was added to Mendeliome. Sources: Expert list\nMode of inheritance for STR: AFF2_FRAXE_GCC was set to X-LINKED: hemizygous mutation in males, biallelic mutations in females\nPublications for STR: AFF2_FRAXE_GCC were set to 8334699; 8673085; 11388762\nPhenotypes for STR: AFF2_FRAXE_GCC were set to Intellectual developmental disorder, X-linked 109 MIM#309548\nReview for STR: AFF2_FRAXE_GCC was set to GREEN\nSTR: AFF2_FRAXE_GCC was marked as clinically relevant\nSTR: AFF2_FRAXE_GCC was marked as current diagnostic\nAdded comment: NM_001169122.1(AFF2):c.-460_-458GCC(6_25)\r\nLoss of function through methylation silencing is the mechanism of disease\r\nNormal - 5-44 repeats\r\nInconclusive - 45-54 repeats\r\nPremutation - 55-200 repeats\r\nAbnormal - >200 or >230 repeats \nSources: Expert list",
"entity_name": "AFF2_FRAXE_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T14:51:25.650100+10:00",
"panel_name": "Intellectual disability syndromic and non-syndromic",
"panel_id": 250,
"panel_version": "1.103",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FRAXE was changed to AFF2_FRAXE_GCC",
"entity_name": "AFF2_FRAXE_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T14:48:52.511180+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2488",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC",
"entity_name": "ABCD3_OPDM_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T14:48:11.611178+10:00",
"panel_name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy",
"panel_id": 3071,
"panel_version": "1.46",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC",
"entity_name": "ABCD3_OPDM_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T13:30:39.141618+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.16",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: PRNP_CJD_octapeptide as ready",
"entity_name": "PRNP_CJD_octapeptide",
"entity_type": "str"
},
{
"created": "2025-04-25T13:30:39.132076+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.16",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).",
"entity_name": "PRNP_CJD_octapeptide",
"entity_type": "str"
},
{
"created": "2025-04-25T13:25:21.838443+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.16",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: PRNP_CJD_octapeptide as Green List (high evidence)",
"entity_name": "PRNP_CJD_octapeptide",
"entity_type": "str"
},
{
"created": "2025-04-25T13:25:21.829116+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.16",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: prnp_cjd_octapeptide has been classified as Green List (High Evidence).",
"entity_name": "PRNP_CJD_octapeptide",
"entity_type": "str"
},
{
"created": "2025-04-25T13:17:20.777371+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.15",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: PRNP_CJD_octapeptide was added\nSTR: PRNP_CJD_octapeptide was added to Early-onset Parkinson disease. Sources: Literature\nMode of inheritance for STR: PRNP_CJD_octapeptide was set to MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted\nPublications for STR: PRNP_CJD_octapeptide were set to 2159587; 20301407\nPhenotypes for STR: PRNP_CJD_octapeptide were set to Creutzfeldt-Jakob disease MIM#123400; Gerstmann-Straussler disease MIM#137440\nReview for STR: PRNP_CJD_octapeptide was set to GREEN\nSTR: PRNP_CJD_octapeptide was marked as clinically relevant\nSTR: PRNP_CJD_octapeptide was marked as current diagnostic\nAdded comment: NM_000311.4(PRNP):c.160GGTGGTGGCTGGGGGCAGCCTCAT[X]\r\nNormal PRNP alleles: 4 octapeptide repeat sequences each of which comprises the following amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln. Because the nucleotide sequence encoding the octapeptide may vary, the repeat is described typically as an octapeptide rather than as a 24-nucleotide repeat.\r\nPathogenic: ≥5 octapeptide repeat segments (1 additional), 2-7 additional repeats are typically associated with the fCJD pathologic phenotype, and 8-9 extra repeats are associated with the GSS pathologic phenotype. \nSources: Literature",
"entity_name": "PRNP_CJD_octapeptide",
"entity_type": "str"
},
{
"created": "2025-04-25T13:09:25.018778+10:00",
"panel_name": "Early-onset Dementia",
"panel_id": 24,
"panel_version": "1.33",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "CJD was changed to PRNP_CJD_octapeptide",
"entity_name": "PRNP_CJD_octapeptide",
"entity_type": "str"
},
{
"created": "2025-04-25T13:04:27.314642+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.255",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "VACTERLX was changed to ZIC3_VACTERLX_GCC",
"entity_name": "ZIC3_VACTERLX_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T13:03:51.684361+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.254",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "NUTM2B-AS1_OPML1_CCG was changed to NUTM2B-AS1_OPDM_CCG",
"entity_name": "NUTM2B-AS1_OPDM_CCG",
"entity_type": "str"
},
{
"created": "2025-04-25T13:03:32.442633+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.253",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: NUTM2B-AS1_OPML1_CCG as Green List (high evidence)",
"entity_name": "NUTM2B-AS1_OPML1_CCG",
"entity_type": "str"
},
{
"created": "2025-04-25T13:03:32.436057+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.253",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: nutm2b-as1_opml1_ccg has been classified as Green List (High Evidence).",
"entity_name": "NUTM2B-AS1_OPML1_CCG",
"entity_type": "str"
},
{
"created": "2025-04-25T13:03:23.260897+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.252",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "edited their review of STR: NUTM2B-AS1_OPML1_CCG: Added comment: At least 10 new families/probands have been reported with the repeat expansion. These individuals had an OPDM phenotype, mostly without white matter changes.; Changed rating: GREEN; Changed publications: 31332380, 37923380, 39308795, 38159879; Changed phenotypes: Oculopharyngodistal myopathy MONDO:0025193; Set clinically relevant: yes",
"entity_name": "NUTM2B-AS1_OPML1_CCG",
"entity_type": "str"
},
{
"created": "2025-04-25T12:35:26.107350+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.252",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPML1 was changed to NUTM2B-AS1_OPML1_CCG",
"entity_name": "NUTM2B-AS1_OPML1_CCG",
"entity_type": "str"
},
{
"created": "2025-04-25T12:33:50.599694+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.251",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "NIPA1 was changed to NIPA1_ALS_GCG",
"entity_name": "NIPA1_ALS_GCG",
"entity_type": "str"
},
{
"created": "2025-04-25T12:33:14.201272+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.250",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FRAXF was changed to TMEM185A_FRAXF_GCC",
"entity_name": "TMEM185A_FRAXF_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T12:32:42.339363+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.249",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FRA11B was changed to CBL_FRA11B_CCG",
"entity_name": "CBL_FRA11B_CCG",
"entity_type": "str"
},
{
"created": "2025-04-25T12:32:17.230661+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.248",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FRA11A was changed to C11orf80_FRA11A_CGG",
"entity_name": "C11orf80_FRA11A_CGG",
"entity_type": "str"
},
{
"created": "2025-04-25T12:31:43.675634+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.247",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FAME6 was changed to TNRC6A_FAME6_TTTCA",
"entity_name": "TNRC6A_FAME6_TTTCA",
"entity_type": "str"
},
{
"created": "2025-04-25T12:27:52.372431+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.246",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FAME4 was changed to YEATS2_FAME4_TTTCA",
"entity_name": "YEATS2_FAME4_TTTCA",
"entity_type": "str"
},
{
"created": "2025-04-25T12:24:30.069963+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.245",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FAME1_TTTGA was changed to SAMD12_FAME1_TTTGA",
"entity_name": "SAMD12_FAME1_TTTGA",
"entity_type": "str"
},
{
"created": "2025-04-25T12:23:28.715534+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.244",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA_THAP11_CAG was changed to THAP11_SCA_CAG",
"entity_name": "THAP11_SCA_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T12:20:55.444767+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.243",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FRA7A was changed to ZNF713_FRA7A_CGG",
"entity_name": "ZNF713_FRA7A_CGG",
"entity_type": "str"
},
{
"created": "2025-04-25T12:20:16.005995+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.242",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FRA2A was changed to AFF3_FRA2A_CGG",
"entity_name": "AFF3_FRA2A_CGG",
"entity_type": "str"
},
{
"created": "2025-04-25T12:19:46.152828+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.241",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FRA12A was changed to DIP2B_FRA12A_CGG",
"entity_name": "DIP2B_FRA12A_CGG",
"entity_type": "str"
},
{
"created": "2025-04-25T12:15:52.354711+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.240",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "FAME7 was changed to RAPGEF2_FAME7_TTTCA",
"entity_name": "RAPGEF2_FAME7_TTTCA",
"entity_type": "str"
},
{
"created": "2025-04-25T12:14:48.463684+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.239",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "DMD was changed to DMD_DMD_GAA",
"entity_name": "DMD_DMD_GAA",
"entity_type": "str"
},
{
"created": "2025-04-25T12:14:02.960190+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.238",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "CCD was changed to RUNX2_CCD_GCN",
"entity_name": "RUNX2_CCD_GCN",
"entity_type": "str"
},
{
"created": "2025-04-25T12:05:23.269681+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.14",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: RFC1_CANVAS_ANNGN as ready",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T12:05:23.261991+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.14",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T12:05:09.621464+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.14",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: RFC1_CANVAS_ANNGN as Green List (high evidence)",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T12:05:09.614238+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.14",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T12:04:43.001818+10:00",
"panel_name": "Early-onset Parkinson disease",
"panel_id": 26,
"panel_version": "2.13",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "STR: RFC1_CANVAS_ANNGN was added\nSTR: RFC1_CANVAS_ANNGN was added to Early-onset Parkinson disease. Sources: Literature\nMode of inheritance for STR: RFC1_CANVAS_ANNGN was set to BIALLELIC, autosomal or pseudoautosomal\nPublications for STR: RFC1_CANVAS_ANNGN were set to 39833204; 39152783; 38789445; 36705320; 35013364\nPhenotypes for STR: RFC1_CANVAS_ANNGN were set to Parkinson disease MONDO:0005180\nReview for STR: RFC1_CANVAS_ANNGN was set to GREEN\nSTR: RFC1_CANVAS_ANNGN was marked as clinically relevant\nSTR: RFC1_CANVAS_ANNGN was marked as current diagnostic\nAdded comment: Biallelic RFC1 expansions have been identified as a rare cause of Parkinson's disease, without ataxia or neuropathy. \nSources: Literature",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:41:42.832133+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2487",
"user_name": "Bryony Thompson",
"item_type": "panel",
"text": "removed STR:CANVAS_ACAGG from the panel",
"entity_name": null,
"entity_type": null
},
{
"created": "2025-04-25T11:40:46.264163+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2486",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: CANVAS_ACAGG as No list",
"entity_name": "CANVAS_ACAGG",
"entity_type": "str"
},
{
"created": "2025-04-25T11:40:46.254304+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2486",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: canvas_acagg has been removed from the panel.",
"entity_name": "CANVAS_ACAGG",
"entity_type": "str"
},
{
"created": "2025-04-25T11:39:30.498578+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.22",
"user_name": "Bryony Thompson",
"item_type": "panel",
"text": "removed STR:CANVAS_ACAGG from the panel",
"entity_name": null,
"entity_type": null
},
{
"created": "2025-04-25T11:30:40.847963+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.21",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Repeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN.",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:28:37.537530+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.20",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Marked STR: RFC1_CANVAS_ANNGN as ready",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:28:37.531387+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.20",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: rfc1_canvas_anngn has been classified as Green List (High Evidence).",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:28:25.906773+10:00",
"panel_name": "Hereditary Neuropathy - complex",
"panel_id": 3070,
"panel_version": "1.20",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "CANVAS was changed to RFC1_CANVAS_ANNGN",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:25:28.193610+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.237",
"user_name": "Bryony Thompson",
"item_type": "panel",
"text": "removed STR:RFC1_CANVAS_ACAGG from the panel",
"entity_name": null,
"entity_type": null
},
{
"created": "2025-04-25T11:24:29.118646+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.236",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "edited their review of STR: RFC1_CANVAS_ANNGN: Changed publications: 30926972, 32851396, 33237689, 31230722, 33237689, 32694621, 33103729, 35355059; Set clinically relevant: no",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:24:19.940155+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.236",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Publications for STR: RFC1_CANVAS_ANNGN were set to 30926972; 32851396; 33237689; 31230722; 33237689; 32694621; 33103729; 35355059",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:24:07.218469+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.235",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "commented on STR: RFC1_CANVAS_ANNGN: Multiple apparently pathogenic expansions now reported (AGGGC, AAGGC, AGAGG, AAAGG, ACAGG) other than the common AAGGG expansion",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:22:00.319048+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.235",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "RFC1_CANVAS_AAGGG was changed to RFC1_CANVAS_ANNGN\nRepeated Sequence for RFC1_CANVAS_ANNGN was changed from AAGGG to ANNGN.",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:21:17.108368+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.234",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Publications for STR: RFC1_CANVAS_AAGGG were set to 30926972; 32851396; 33237689; 31230722",
"entity_name": "RFC1_CANVAS_AAGGG",
"entity_type": "str"
},
{
"created": "2025-04-25T11:19:04.714700+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2485",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "RFC1_CANVAS_ANNGG was changed to RFC1_CANVAS_ANNGN\nRepeated Sequence for RFC1_CANVAS_ANNGN was changed from ANNGG to ANNGN.\nPublications for STR: RFC1_CANVAS_ANNGN were changed from 33237689; 32694621; 33103729; 35355059 to 33237689; 32694621; 33103729; 35355059; 37450567",
"entity_name": "RFC1_CANVAS_ANNGN",
"entity_type": "str"
},
{
"created": "2025-04-25T11:11:26.620502+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2484",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "RFC1_CANVAS_AMRGG was changed to RFC1_CANVAS_ANNGG",
"entity_name": "RFC1_CANVAS_ANNGG",
"entity_type": "str"
},
{
"created": "2025-04-25T11:11:04.996846+10:00",
"panel_name": "Mendeliome",
"panel_id": 137,
"panel_version": "1.2483",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "CANVAS was changed to RFC1_CANVAS_AMRGG\nRepeated Sequence for RFC1_CANVAS_AMRGG was changed from AAGGG to ANNGG.\nPublications for STR: RFC1_CANVAS_AMRGG were changed from 30926972; 32851396 to 33237689; 32694621; 33103729; 35355059",
"entity_name": "RFC1_CANVAS_AMRGG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:57:00.067953+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.233",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Publications for STR: RFC1_CANVAS_ACAGG were set to 33237689; 32694621; 33103729",
"entity_name": "RFC1_CANVAS_ACAGG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:56:27.584459+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.232",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Classified STR: RFC1_CANVAS_ACAGG as Green List (high evidence)",
"entity_name": "RFC1_CANVAS_ACAGG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:56:27.578133+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.232",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "Str: rfc1_canvas_acagg has been classified as Green List (High Evidence).",
"entity_name": "RFC1_CANVAS_ACAGG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:56:16.012844+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.231",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "edited their review of STR: RFC1_CANVAS_ACAGG: Added comment: Greater than 10 families reported now. Also compound heterozygote (ACAGG)exp/(AAGGG)exp cases reported.; Changed rating: GREEN; Changed publications: 33237689, 32694621, 33103729, 35355059",
"entity_name": "RFC1_CANVAS_ACAGG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:08:19.133843+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.231",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "CANVAS_ACAGG was changed to RFC1_CANVAS_ACAGG",
"entity_name": "RFC1_CANVAS_ACAGG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:07:11.935892+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.230",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "XDP was changed to TAF1_XDP_CCCTCT",
"entity_name": "TAF1_XDP_CCCTCT",
"entity_type": "str"
},
{
"created": "2025-04-25T10:06:38.544202+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.229",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "TOF was changed to TBX1_TOF_GCN",
"entity_name": "TBX1_TOF_GCN",
"entity_type": "str"
},
{
"created": "2025-04-25T10:06:05.431464+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.228",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SPD1 was changed to HOXD13_SPD1_GCG",
"entity_name": "HOXD13_SPD1_GCG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:04:40.028061+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.227",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA8 was changed to ATXN8OS_SCA8_CTG",
"entity_name": "ATXN8OS_SCA8_CTG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:04:07.913934+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.226",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA7 was changed to ATXN7_SCA7_CAG",
"entity_name": "ATXN7_SCA7_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:03:43.615707+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.225",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA6 was changed to CACNA1A_SCA6_CAG",
"entity_name": "CACNA1A_SCA6_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:03:13.631675+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.224",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA4_ZFHX3_GGC was changed to ZFHX3_SCA4_GGC",
"entity_name": "ZFHX3_SCA4_GGC",
"entity_type": "str"
},
{
"created": "2025-04-25T10:02:47.154977+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.223",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA37 was changed to DAB1_SCA37_ATTTC",
"entity_name": "DAB1_SCA37_ATTTC",
"entity_type": "str"
},
{
"created": "2025-04-25T10:02:14.408045+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.222",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA36 was changed to NOP56_SCA36_GGCCTG",
"entity_name": "NOP56_SCA36_GGCCTG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:01:48.913905+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.221",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA31 was changed to BEAN1_SCA31_TGGAA",
"entity_name": "BEAN1_SCA31_TGGAA",
"entity_type": "str"
},
{
"created": "2025-04-25T10:01:18.314589+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.220",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA3 was changed to ATXN3_SCA3_CAG",
"entity_name": "ATXN3_SCA3_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T10:00:37.416124+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.219",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA27B was changed to FGF14_SCA27B_GAA",
"entity_name": "FGF14_SCA27B_GAA",
"entity_type": "str"
},
{
"created": "2025-04-25T10:00:11.585260+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.218",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA2 was changed to ATXN2_SCA2_CAG",
"entity_name": "ATXN2_SCA2_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T09:59:39.055063+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.217",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA17 was changed to TBP_SCA17_CAG",
"entity_name": "TBP_SCA17_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T09:59:07.890580+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.216",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA12 was changed to PPP2R2B_SCA12_CAG",
"entity_name": "PPP2R2B_SCA12_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T09:58:40.669334+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.215",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA10 was changed to ATXN10_SCA10_ATTCT",
"entity_name": "ATXN10_SCA10_ATTCT",
"entity_type": "str"
},
{
"created": "2025-04-25T09:58:03.445755+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.214",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SCA1 was changed to ATXN1_SCA1_CAG",
"entity_name": "ATXN1_SCA1_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T09:57:16.593031+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.213",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "SBMA was changed to AR_SBMA_CAG",
"entity_name": "AR_SBMA_CAG",
"entity_type": "str"
},
{
"created": "2025-04-25T09:56:37.229839+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.212",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "RCPS was changed to EIF4A3_RCPS_complex",
"entity_name": "EIF4A3_RCPS_complex",
"entity_type": "str"
},
{
"created": "2025-04-25T09:54:04.930324+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.211",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "PHPX was changed to SOX3_PHPX_GCN",
"entity_name": "SOX3_PHPX_GCN",
"entity_type": "str"
},
{
"created": "2025-04-25T09:52:28.600678+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.210",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPDM_ABCD3_GCC was changed to ABCD3_OPDM_GCC",
"entity_name": "ABCD3_OPDM_GCC",
"entity_type": "str"
},
{
"created": "2025-04-25T09:50:13.462521+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.209",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPMD was changed to PABPN1_OPMD_GCN",
"entity_name": "PABPN1_OPMD_GCN",
"entity_type": "str"
},
{
"created": "2025-04-25T09:49:43.303833+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.208",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPDM4 was changed to RILPL1_OPDM4_CGG",
"entity_name": "RILPL1_OPDM4_CGG",
"entity_type": "str"
},
{
"created": "2025-04-25T09:49:13.184378+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.207",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPDM2 was changed to GIPC1_OPDM2_CGG",
"entity_name": "GIPC1_OPDM2_CGG",
"entity_type": "str"
},
{
"created": "2025-04-25T09:48:41.794071+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.206",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "OPDM1 was changed to LRP12_OPDM1_CGG",
"entity_name": "LRP12_OPDM1_CGG",
"entity_type": "str"
},
{
"created": "2025-04-25T09:48:00.525898+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.205",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "NIID was changed to NOTCH2NLC_NIID_GGC",
"entity_name": "NOTCH2NLC_NIID_GGC",
"entity_type": "str"
},
{
"created": "2025-04-25T09:47:17.363748+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.204",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "MRUPAV was changed to PLIN4_MRUPAV_33-mer",
"entity_name": "PLIN4_MRUPAV_33-mer",
"entity_type": "str"
},
{
"created": "2025-04-25T07:59:50.312902+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.203",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "RFC1_CANVAS_ AAGGG was changed to RFC1_CANVAS_AAGGG",
"entity_name": "RFC1_CANVAS_AAGGG",
"entity_type": "str"
},
{
"created": "2025-04-25T07:59:15.120512+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.202",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "MEDPSACH was changed to COMP_MEDPSACH_GAC",
"entity_name": "COMP_MEDPSACH_GAC",
"entity_type": "str"
},
{
"created": "2025-04-24T21:25:40.588183+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.201",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "HSAN8 was changed to PRDM12_HSAN8_GCC",
"entity_name": "PRDM12_HSAN8_GCC",
"entity_type": "str"
},
{
"created": "2025-04-24T21:25:07.933753+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.200",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "HPE5 was changed to ZIC2_HPE5_GCN",
"entity_name": "ZIC2_HPE5_GCN",
"entity_type": "str"
},
{
"created": "2025-04-24T21:24:23.187610+10:00",
"panel_name": "Repeat Disorders",
"panel_id": 3597,
"panel_version": "0.199",
"user_name": "Bryony Thompson",
"item_type": "entity",
"text": "HMNMYO was changed to VWA1_HMNMYO_GCGCGGAGCG",
"entity_name": "VWA1_HMNMYO_GCGCGGAGCG",
"entity_type": "str"
}
]
}