Search Entities

GET /api/v1/entities/?format=api&page=135
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "count": 36124,
    "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=136",
    "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=134",
    "results": [
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10852",
                "gene_name": "serine hydroxymethyltransferase 2",
                "omim_gene": [
                    "138450"
                ],
                "alias_name": null,
                "gene_symbol": "SHMT2",
                "hgnc_symbol": "SHMT2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:57623110-57628718",
                            "ensembl_id": "ENSG00000182199"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:57229327-57234935",
                            "ensembl_id": "ENSG00000182199"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1986-01-01"
            },
            "entity_type": "gene",
            "entity_name": "SHMT2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "33015733"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121",
                "Congenital microcephaly",
                "Infantile axial hypotonia",
                "Spastic paraparesis",
                "Global developmental delay",
                "Intellectual disability",
                "Abnormality of the corpus callosum",
                "Abnormal cortical gyration",
                "Hypertrophic cardiomyopathy",
                "Abnormality of the face",
                "Proximal placement of thumb",
                "2-3 toe syndactyly"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 18,
                "hash_id": null,
                "name": "Polymicrogyria and Schizencephaly",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and used by the Australian Genomics Brain Malformations Flagship. It is maintained by VCGS.\r\n\r\nPlease consider the broader 'Malformations of cortical development' superpanel, particularly in the presence of complex or atypical imaging findings.",
                "status": "public",
                "version": "0.207",
                "version_created": "2026-04-23T11:38:11.019015+10:00",
                "relevant_disorders": [
                    "Polymicrogyria",
                    "HP:0002126;Schizencephaly",
                    "HP:0010636"
                ],
                "stats": {
                    "number_of_genes": 88,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "Cernunnos",
                    "XLF",
                    "FLJ12610"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25737",
                "gene_name": "non-homologous end joining factor 1",
                "omim_gene": [
                    "611290"
                ],
                "alias_name": [
                    "XRCC4-like factor"
                ],
                "gene_symbol": "NHEJ1",
                "hgnc_symbol": "NHEJ1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:219940039-220025587",
                            "ensembl_id": "ENSG00000187736"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:219075317-219160865",
                            "ensembl_id": "ENSG00000187736"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-03-30"
            },
            "entity_type": "gene",
            "entity_name": "NHEJ1",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "17191205"
            ],
            "evidence": [
                "Expert Review Amber",
                "Victorian Clinical Genetics Services",
                "Australian Genomics Health Alliance Brain Malformations Flagship"
            ],
            "phenotypes": [
                "Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation (MIM# 611291)"
            ],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 18,
                "hash_id": null,
                "name": "Polymicrogyria and Schizencephaly",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and used by the Australian Genomics Brain Malformations Flagship. It is maintained by VCGS.\r\n\r\nPlease consider the broader 'Malformations of cortical development' superpanel, particularly in the presence of complex or atypical imaging findings.",
                "status": "public",
                "version": "0.207",
                "version_created": "2026-04-23T11:38:11.019015+10:00",
                "relevant_disorders": [
                    "Polymicrogyria",
                    "HP:0002126;Schizencephaly",
                    "HP:0010636"
                ],
                "stats": {
                    "number_of_genes": 88,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:15672",
                "gene_name": "ALG9, alpha-1,2-mannosyltransferase",
                "omim_gene": [
                    "606941"
                ],
                "alias_name": [
                    "dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase",
                    "dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase",
                    "dol-P-Man dependent alpha-1,2-mannosyltransferase"
                ],
                "gene_symbol": "ALG9",
                "hgnc_symbol": "ALG9",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "11:111652919-111742305",
                            "ensembl_id": "ENSG00000086848"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "11:111782195-111871581",
                            "ensembl_id": "ENSG00000086848"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-08-26"
            },
            "entity_type": "gene",
            "entity_name": "ALG9",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "28932688",
                "25966638",
                "26453364"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list",
                "Literature"
            ],
            "phenotypes": [
                "Congenital disorder of glycosylation, type Il, MIM#608776",
                "Gillessen-Kaesbach-Nishimura syndrome, MIM# 263210"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 28,
                "hash_id": null,
                "name": "Skeletal Dysplasia_Fetal",
                "disease_group": "Skeletal disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and used by the Melbourne Genomics Perinatal Autopsy Flagship. It is maintained by VCGS.\r\n\r\nIt contains genes associated with conditions primarily affecting bone and cartilage that present prenatally.\r\n\r\nPlease consider the larger Fetal Anomalies and Skeletal Dysplasia panels, or other specific panels such as Growth Failure, Craniosynostosis, Radial ray abnormalities, Polydactyly or Limb and Digital Malformations depending on the clinical presentation.",
                "status": "public",
                "version": "0.250",
                "version_created": "2026-04-28T10:59:42.452256+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 158,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:2978",
                "gene_name": "DNA methyltransferase 3 alpha",
                "omim_gene": [
                    "602769"
                ],
                "alias_name": null,
                "gene_symbol": "DNMT3A",
                "hgnc_symbol": "DNMT3A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:25455845-25565459",
                            "ensembl_id": "ENSG00000119772"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:25227855-25342590",
                            "ensembl_id": "ENSG00000119772"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-07-15"
            },
            "entity_type": "gene",
            "entity_name": "DNMT3A",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "30478443"
            ],
            "evidence": [
                "Expert Review Amber",
                "Literature"
            ],
            "phenotypes": [
                "Heyn-Sproul-Jackson syndrome, MIM# 618724"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 28,
                "hash_id": null,
                "name": "Skeletal Dysplasia_Fetal",
                "disease_group": "Skeletal disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and used by the Melbourne Genomics Perinatal Autopsy Flagship. It is maintained by VCGS.\r\n\r\nIt contains genes associated with conditions primarily affecting bone and cartilage that present prenatally.\r\n\r\nPlease consider the larger Fetal Anomalies and Skeletal Dysplasia panels, or other specific panels such as Growth Failure, Craniosynostosis, Radial ray abnormalities, Polydactyly or Limb and Digital Malformations depending on the clinical presentation.",
                "status": "public",
                "version": "0.250",
                "version_created": "2026-04-28T10:59:42.452256+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 158,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:1071",
                "gene_name": "bone morphogenetic protein 4",
                "omim_gene": [
                    "112262"
                ],
                "alias_name": null,
                "gene_symbol": "BMP4",
                "hgnc_symbol": "BMP4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "14:54416454-54425479",
                            "ensembl_id": "ENSG00000125378"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "14:53949736-53958761",
                            "ensembl_id": "ENSG00000125378"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1990-06-11"
            },
            "entity_type": "gene",
            "entity_name": "BMP4",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "21340693",
                "31053785"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Microphthalmia, syndromic 6, MIM# 607932"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 42,
                "hash_id": null,
                "name": "Anophthalmia_Microphthalmia_Coloboma",
                "disease_group": "Ophthalmological disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS, and contains genes associated with isolated and syndromic anophthalmia, microphthalmia and coloboma.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Anophthalmia or Microphthalmia' v1.31 and 'Ocular coloboma' v1.38 panels, with discrepancies reviewed and reciprocal feedback provided to Genomics England.",
                "status": "public",
                "version": "1.57",
                "version_created": "2026-03-03T11:23:37.804849+11:00",
                "relevant_disorders": [
                    "Anophthalmia",
                    "HP:0000528;Microphthalmia",
                    "HP:0000568;Coloboma",
                    "HP:0000589"
                ],
                "stats": {
                    "number_of_genes": 101,
                    "number_of_strs": 0,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "HSPOX2",
                    "PRODH1",
                    "PIG6",
                    "PRODH2",
                    "TP53I6"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:9453",
                "gene_name": "proline dehydrogenase 1",
                "omim_gene": [
                    "606810"
                ],
                "alias_name": [
                    "proline oxidase"
                ],
                "gene_symbol": "PRODH",
                "hgnc_symbol": "PRODH",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "22:18900294-18924066",
                            "ensembl_id": "ENSG00000100033"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "22:18912777-18936553",
                            "ensembl_id": "ENSG00000100033"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1996-12-12"
            },
            "entity_type": "gene",
            "entity_name": "PRODH",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Amber",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "hyperprolinemia type 1 - MONDO:0009400"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 51,
                "hash_id": null,
                "name": "Autism",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.250",
                "version_created": "2026-04-29T19:13:12.780175+10:00",
                "relevant_disorders": [
                    "Autism",
                    "HP:0000717"
                ],
                "stats": {
                    "number_of_genes": 158,
                    "number_of_strs": 0,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:11590",
                "gene_name": "T-box, brain 1",
                "omim_gene": [
                    "604616"
                ],
                "alias_name": null,
                "gene_symbol": "TBR1",
                "hgnc_symbol": "TBR1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:162272605-162282381",
                            "ensembl_id": "ENSG00000136535"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:161416094-161425870",
                            "ensembl_id": "ENSG00000136535"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-12-14"
            },
            "entity_type": "gene",
            "entity_name": "TBR1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "25232744",
                "30250039"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Intellectual developmental disorder with autism and speech delay, MIM# 606053"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 51,
                "hash_id": null,
                "name": "Autism",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.250",
                "version_created": "2026-04-29T19:13:12.780175+10:00",
                "relevant_disorders": [
                    "Autism",
                    "HP:0000717"
                ],
                "stats": {
                    "number_of_genes": 158,
                    "number_of_strs": 0,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "Zfp291"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:13081",
                "gene_name": "S-phase cyclin A associated protein in the ER",
                "omim_gene": [
                    "611611"
                ],
                "alias_name": null,
                "gene_symbol": "SCAPER",
                "hgnc_symbol": "SCAPER",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "15:76640526-77197785",
                            "ensembl_id": "ENSG00000140386"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "15:76347904-76905444",
                            "ensembl_id": "ENSG00000140386"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2007-08-20"
            },
            "entity_type": "gene",
            "entity_name": "SCAPER",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "30723319",
                "28794130",
                "31069901",
                "31192531",
                "30723319"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Intellectual developmental disorder and retinitis pigmentosa, OMIM #618195",
                "Bardet-Biedl syndrome"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 53,
                "hash_id": null,
                "name": "Bardet Biedl syndrome",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS and is a consensus panel used by RMH.\r\n\r\nBardet Biedl syndrome is a multisystem ciliopathy characterised by a combination of obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities.\r\n\r\nMany ciliopathies present with overlapping features, please refer to the Ciliopathy panel if broader spectrum of conditions are being considered.",
                "status": "public",
                "version": "1.14",
                "version_created": "2025-05-21T20:50:29.131780+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 27,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3542",
                "gene_name": "coagulation factor V",
                "omim_gene": [
                    "612309"
                ],
                "alias_name": null,
                "gene_symbol": "F5",
                "hgnc_symbol": "F5",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:169483404-169555826",
                            "ensembl_id": "ENSG00000198734"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:169514166-169586588",
                            "ensembl_id": "ENSG00000198734"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "F5",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Factor V deficiency, MIM# 227400",
                "MONDO:0009210",
                "Thrombophilia due to activated protein C resistance, MIM# 188055",
                "MONDO:0008560",
                "{Thrombophilia, susceptibility to, due to factor V Leiden}, MIM# 188055"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 54,
                "hash_id": null,
                "name": "Bleeding and Platelet Disorders",
                "disease_group": "Haematological disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with coagulation, platelet and blood vessel disorders that predispose to bleeding and to thrombosis.",
                "status": "public",
                "version": "1.78",
                "version_created": "2026-04-28T15:02:15.205532+10:00",
                "relevant_disorders": [
                    "Abnormal bleeding",
                    "HP:0001892;Abnormal thrombosis",
                    "HP:0001977"
                ],
                "stats": {
                    "number_of_genes": 140,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MOCOD"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7190",
                "gene_name": "molybdenum cofactor synthesis 1",
                "omim_gene": [
                    "603707"
                ],
                "alias_name": null,
                "gene_symbol": "MOCS1",
                "hgnc_symbol": "MOCS1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:39867354-39902290",
                            "ensembl_id": "ENSG00000124615"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:39899578-39934551",
                            "ensembl_id": "ENSG00000124615"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-07-23"
            },
            "entity_type": "gene",
            "entity_name": "MOCS1",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "27289259"
            ],
            "evidence": [
                "Expert Review Amber",
                "Expert list"
            ],
            "phenotypes": [
                "Molybdenum cofactor deficiency A, MIM# 252150"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 58,
                "hash_id": null,
                "name": "Brain Calcification",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "Primary brain calcification disorders are characterised by abnormal deposits of calcium in blood vessels within the brain, particularly the basal ganglia. They typically present with movement disorders and psychiatric or behavioural problems. This panel also contains other multi-system conditions where brain calcification can occur as part of the phenotype.\r\n\r\nThis panel was developed and is maintained by VCGS.\r\n\r\nThe panel has been compared against the Genomics England PanelApp Intracerebral Calcifications panel V1.27 with all discrepancies resolved and reciprocal feedback provided to Genomics England.\r\n\r\nUpdated December 2025 following literature review.",
                "status": "public",
                "version": "2.9",
                "version_created": "2026-04-27T16:21:49.971882+10:00",
                "relevant_disorders": [
                    "Cerebral calcification",
                    "HP:0002514"
                ],
                "stats": {
                    "number_of_genes": 96,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "hGCMb"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:4198",
                "gene_name": "glial cells missing homolog 2",
                "omim_gene": [
                    "603716"
                ],
                "alias_name": null,
                "gene_symbol": "GCM2",
                "hgnc_symbol": "GCM2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:10873456-10882174",
                            "ensembl_id": "ENSG00000124827"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:10873223-10881941",
                            "ensembl_id": "ENSG00000124827"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-09-27"
            },
            "entity_type": "gene",
            "entity_name": "GCM2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "32642802",
                "19940031",
                "36405867",
                "18583467"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Hypoparathyroidism, familial isolated 2, MIM# 618883"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 58,
                "hash_id": null,
                "name": "Brain Calcification",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "Primary brain calcification disorders are characterised by abnormal deposits of calcium in blood vessels within the brain, particularly the basal ganglia. They typically present with movement disorders and psychiatric or behavioural problems. This panel also contains other multi-system conditions where brain calcification can occur as part of the phenotype.\r\n\r\nThis panel was developed and is maintained by VCGS.\r\n\r\nThe panel has been compared against the Genomics England PanelApp Intracerebral Calcifications panel V1.27 with all discrepancies resolved and reciprocal feedback provided to Genomics England.\r\n\r\nUpdated December 2025 following literature review.",
                "status": "public",
                "version": "2.9",
                "version_created": "2026-04-27T16:21:49.971882+10:00",
                "relevant_disorders": [
                    "Cerebral calcification",
                    "HP:0002514"
                ],
                "stats": {
                    "number_of_genes": 96,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "PiT-2",
                    "Glvr-2",
                    "Ram-1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10947",
                "gene_name": "solute carrier family 20 member 2",
                "omim_gene": [
                    "158378"
                ],
                "alias_name": null,
                "gene_symbol": "SLC20A2",
                "hgnc_symbol": "SLC20A2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "8:42273993-42397069",
                            "ensembl_id": "ENSG00000168575"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "8:42416475-42541926",
                            "ensembl_id": "ENSG00000168575"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1993-06-18"
            },
            "entity_type": "gene",
            "entity_name": "SLC20A2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "22327515",
                "23334463",
                "28162874",
                "31267306",
                "35850697",
                "34025715"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Basal ganglia calcification, idiopathic, 1, MIM# 213600"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 58,
                "hash_id": null,
                "name": "Brain Calcification",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "Primary brain calcification disorders are characterised by abnormal deposits of calcium in blood vessels within the brain, particularly the basal ganglia. They typically present with movement disorders and psychiatric or behavioural problems. This panel also contains other multi-system conditions where brain calcification can occur as part of the phenotype.\r\n\r\nThis panel was developed and is maintained by VCGS.\r\n\r\nThe panel has been compared against the Genomics England PanelApp Intracerebral Calcifications panel V1.27 with all discrepancies resolved and reciprocal feedback provided to Genomics England.\r\n\r\nUpdated December 2025 following literature review.",
                "status": "public",
                "version": "2.9",
                "version_created": "2026-04-27T16:21:49.971882+10:00",
                "relevant_disorders": [
                    "Cerebral calcification",
                    "HP:0002514"
                ],
                "stats": {
                    "number_of_genes": 96,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:333",
                "gene_name": "angiotensinogen",
                "omim_gene": [
                    "106150"
                ],
                "alias_name": [
                    "alpha-1 antiproteinase, antitrypsin"
                ],
                "gene_symbol": "AGT",
                "hgnc_symbol": "AGT",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:230838269-230850043",
                            "ensembl_id": "ENSG00000135744"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:230702523-230714297",
                            "ensembl_id": "ENSG00000135744"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-29"
            },
            "entity_type": "gene",
            "entity_name": "AGT",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID: 16116425, 34234805, 33163725"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list",
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Renal tubular dysgenesis, MIM# 267430"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 63,
                "hash_id": null,
                "name": "Congenital anomalies of the kidney and urinary tract (CAKUT)",
                "disease_group": "Renal and urinary tract disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with nonsyndromic and syndromic congenital anomalies of the kidney and urinary tract (CAKUT).",
                "status": "public",
                "version": "0.207",
                "version_created": "2026-04-15T16:43:07.852176+10:00",
                "relevant_disorders": [
                    "Abnormality of the urinary system HP:0000079"
                ],
                "stats": {
                    "number_of_genes": 124,
                    "number_of_strs": 1,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "OSC"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6708",
                "gene_name": "lanosterol synthase",
                "omim_gene": [
                    "600909"
                ],
                "alias_name": [
                    "Oxidosqualene-lanosterol cyclase"
                ],
                "gene_symbol": "LSS",
                "hgnc_symbol": "LSS",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "21:47608055-47648738",
                            "ensembl_id": "ENSG00000160285"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "21:46188141-46228824",
                            "ensembl_id": "ENSG00000160285"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-05-07"
            },
            "entity_type": "gene",
            "entity_name": "LSS",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "26200341",
                "29016354"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Cataract 44 MIM#616509"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 66,
                "hash_id": null,
                "name": "Cataract",
                "disease_group": "Ophthalmological disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.",
                "status": "public",
                "version": "1.3",
                "version_created": "2026-03-31T18:43:23.306556+11:00",
                "relevant_disorders": [
                    "Cataract",
                    "HP:0000518"
                ],
                "stats": {
                    "number_of_genes": 258,
                    "number_of_strs": 2,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "AC5"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:236",
                "gene_name": "adenylate cyclase 5",
                "omim_gene": [
                    "600293"
                ],
                "alias_name": null,
                "gene_symbol": "ADCY5",
                "hgnc_symbol": "ADCY5",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "3:123001143-123168605",
                            "ensembl_id": "ENSG00000173175"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "3:123282296-123449758",
                            "ensembl_id": "ENSG00000173175"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1994-07-22"
            },
            "entity_type": "gene",
            "entity_name": "ADCY5",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "Other",
            "publications": [
                "33528536",
                "33098801"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Dyskinesia with orofacial involvement MIM#606703"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 73,
                "hash_id": null,
                "name": "Cerebral Palsy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "Cerebral palsy (CP) is a non-progressive neurodevelopmental disorder characterized by motor impairments, often accompanied by intellectual disability, epilepsy, visual and hearing impairment and speech and language deficits.\r\n\r\nPMID 33528536 reported a cohort of 1345 individuals undergoing genomic testing. Diagnostic yield ranged between 10-30% depending on presence of additional characteristics such as ID/epilepsy/ASD.\r\n\r\nThe aetiology of cerebral palsy is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia, Ataxia, Malformations of Cortical Development, Mitochondrial Disorders and the Bleeding and Platelet Disorders panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Jozef Gecz, Clare van Eyk, Luisa Weiss and team for their contribution to the development of this panel.",
                "status": "public",
                "version": "1.412",
                "version_created": "2026-04-29T13:55:13.542887+10:00",
                "relevant_disorders": [
                    "Cerebral palsy HP:0100021"
                ],
                "stats": {
                    "number_of_genes": 364,
                    "number_of_strs": 0,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MEK2"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6842",
                "gene_name": "mitogen-activated protein kinase kinase 2",
                "omim_gene": [
                    "601263"
                ],
                "alias_name": null,
                "gene_symbol": "MAP2K2",
                "hgnc_symbol": "MAP2K2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:4090319-4124126",
                            "ensembl_id": "ENSG00000126934"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:4090321-4124129",
                            "ensembl_id": "ENSG00000126934"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1993-11-05"
            },
            "entity_type": "gene",
            "entity_name": "MAP2K2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Victorian Clinical Genetics Services",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 76,
                "hash_id": null,
                "name": "Congenital Heart Defect",
                "disease_group": "Cardiovascular disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.",
                "status": "public",
                "version": "0.540",
                "version_created": "2026-04-29T17:20:21.794068+10:00",
                "relevant_disorders": [
                    "Abnormal heart morphology HP:0001627"
                ],
                "stats": {
                    "number_of_genes": 254,
                    "number_of_strs": 1,
                    "number_of_regions": 10
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:11195",
                "gene_name": "SRY-box 2",
                "omim_gene": [
                    "184429"
                ],
                "alias_name": null,
                "gene_symbol": "SOX2",
                "hgnc_symbol": "SOX2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "3:181429714-181432221",
                            "ensembl_id": "ENSG00000181449"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "3:181711924-181714436",
                            "ensembl_id": "ENSG00000181449"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1993-11-30"
            },
            "entity_type": "gene",
            "entity_name": "SOX2",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "35885948"
            ],
            "evidence": [
                "Expert Review Amber",
                "Literature"
            ],
            "phenotypes": [
                "Optic nerve hypoplasia and abnormalities of the central nervous system #206900",
                "Microphthalmia, syndromic 3 #206900"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 112,
                "hash_id": null,
                "name": "Holoprosencephaly and septo-optic dysplasia",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "1.24",
                "version_created": "2026-03-03T11:24:20.637349+11:00",
                "relevant_disorders": [
                    "Holoprosencephaly",
                    "HP:0001360; Septo-optic dysplasia",
                    "HP:0100842"
                ],
                "stats": {
                    "number_of_genes": 31,
                    "number_of_strs": 1,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "PXAAA1",
                    "PAF-2"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:8859",
                "gene_name": "peroxisomal biogenesis factor 6",
                "omim_gene": [
                    "601498"
                ],
                "alias_name": null,
                "gene_symbol": "PEX6",
                "hgnc_symbol": "PEX6",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:42931608-42946958",
                            "ensembl_id": "ENSG00000124587"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:42963870-42979220",
                            "ensembl_id": "ENSG00000124587"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1997-05-22"
            },
            "entity_type": "gene",
            "entity_name": "PEX6",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Victorian Clinical Genetics Services",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 116,
                "hash_id": null,
                "name": "Hydrops fetalis",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared with the Genomics England 100K Genomes Fetal Hydrops panel. All discrepancies have been resolved by George McGillivray and Zornitza Stark (30/12/2019), with reciprocal reviews provided to Genomics England PanelApp.",
                "status": "public",
                "version": "0.328",
                "version_created": "2025-07-08T23:27:02.854141+10:00",
                "relevant_disorders": [
                    "Hydrops fetalis",
                    "HP:0001789"
                ],
                "stats": {
                    "number_of_genes": 169,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MiRP1",
                    "LQT6"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6242",
                "gene_name": "potassium voltage-gated channel subfamily E regulatory subunit 2",
                "omim_gene": [
                    "603796"
                ],
                "alias_name": null,
                "gene_symbol": "KCNE2",
                "hgnc_symbol": "KCNE2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "21:35736323-35743688",
                            "ensembl_id": "ENSG00000159197"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "21:34364024-34371389",
                            "ensembl_id": "ENSG00000159197"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-05-11"
            },
            "entity_type": "gene",
            "entity_name": "KCNE2",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "31983240",
                "28794082"
            ],
            "evidence": [
                "Expert Review Red",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Long QT syndrome"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [
                "disputed"
            ],
            "panel": {
                "id": 131,
                "hash_id": null,
                "name": "Long QT Syndrome",
                "disease_group": "Cardiovascular disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS. It has been compared against the ClinGen Long QT working group and the Genomics England PanelApp Long QT panel gene-disease associations, with all differences reconciled, with thanks to Ivan Macciocca.",
                "status": "public",
                "version": "0.63",
                "version_created": "2026-02-06T09:22:25.758996+11:00",
                "relevant_disorders": [
                    "Prolonged QT interval",
                    "HP:0001657"
                ],
                "stats": {
                    "number_of_genes": 18,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "S7"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10440",
                "gene_name": "ribosomal protein S7",
                "omim_gene": [
                    "603658"
                ],
                "alias_name": null,
                "gene_symbol": "RPS7",
                "hgnc_symbol": "RPS7",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:3622795-3628509",
                            "ensembl_id": "ENSG00000171863"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:3575205-3580919",
                            "ensembl_id": "ENSG00000171863"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1997-07-07"
            },
            "entity_type": "gene",
            "entity_name": "RPS7",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "19061985",
                "23718193",
                "27882484",
                "32772263"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Diamond-Blackfan anemia 8, MIM# 612563",
                "MONDO:0012939"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:1527",
                "gene_name": "caveolin 1",
                "omim_gene": [
                    "601047"
                ],
                "alias_name": null,
                "gene_symbol": "CAV1",
                "hgnc_symbol": "CAV1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "7:116164839-116201233",
                            "ensembl_id": "ENSG00000105974"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "7:116524785-116561184",
                            "ensembl_id": "ENSG00000105974"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1993-11-02"
            },
            "entity_type": "gene",
            "entity_name": "CAV1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "18237401",
                "25898808",
                "11739396",
                "18211975",
                "27717241",
                "26176221",
                "33836561",
                "33776068",
                "32502478",
                "22474227",
                "28768485",
                "18541701",
                "34643546",
                "12660144"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Lipodystrophy, familial partial, type 7, autosomal dominant MIM# 606721",
                "Lipodystrophy, congenital generalized, type 3, autosomal recessive, MIM# 612526"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:1961",
                "gene_name": "cholinergic receptor nicotinic beta 1 subunit",
                "omim_gene": [
                    "100710"
                ],
                "alias_name": [
                    "acetylcholine receptor, nicotinic, beta 1 (muscle)"
                ],
                "gene_symbol": "CHRNB1",
                "hgnc_symbol": "CHRNB1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:7348380-7361026",
                            "ensembl_id": "ENSG00000170175"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:7445061-7457707",
                            "ensembl_id": "ENSG00000170175"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1989-05-25"
            },
            "entity_type": "gene",
            "entity_name": "CHRNB1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "8872460",
                "8651643",
                "27375219",
                "32504635",
                "10562302"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Myasthenic syndrome, slow-channel congenital, 601462 Myasthenic syndrome, congenital, 2A, slow-channel, 616313",
                "Myasthenic syndrome, congenital, 2C, associated with acetylcholine receptor deficiency, 616314"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:4173",
                "gene_name": "GATA binding protein 4",
                "omim_gene": [
                    "600576"
                ],
                "alias_name": null,
                "gene_symbol": "GATA4",
                "hgnc_symbol": "GATA4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "8:11534468-11617511",
                            "ensembl_id": "ENSG00000136574"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "8:11676959-11760002",
                            "ensembl_id": "ENSG00000136574"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1994-11-30"
            },
            "entity_type": "gene",
            "entity_name": "GATA4",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "12845333",
                "18055909",
                "15689439",
                "33413087",
                "30455927"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Structural congenital heart disease, multiple types - GATA4 MONDO:0100009"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:4455",
                "gene_name": "glycerol-3-phosphate dehydrogenase 1",
                "omim_gene": [
                    "138420"
                ],
                "alias_name": null,
                "gene_symbol": "GPD1",
                "hgnc_symbol": "GPD1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:50497602-50505102",
                            "ensembl_id": "ENSG00000167588"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:50103819-50111319",
                            "ensembl_id": "ENSG00000167588"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "GPD1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "32591995",
                "22226083",
                "33447932",
                "24549054",
                "35365473",
                "34484308"
            ],
            "evidence": [
                "Expert Review Green",
                "NHS GMS",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Hypertriglyceridemia, transient infantile MIM#614480",
                "glycerol-3-phosphate dehydrogenase deficiency"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "SARCOSIN",
                    "Krp1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:16905",
                "gene_name": "kelch like family member 41",
                "omim_gene": [
                    "607701"
                ],
                "alias_name": [
                    "sarcomeric muscle protein"
                ],
                "gene_symbol": "KLHL41",
                "hgnc_symbol": "KLHL41",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:170366212-170382772",
                            "ensembl_id": "ENSG00000239474"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:169509702-169526262",
                            "ensembl_id": "ENSG00000239474"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2013-01-08"
            },
            "entity_type": "gene",
            "entity_name": "KLHL41",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "24268659",
                "30986853",
                "28939701",
                "28826497"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Nemaline myopathy 9, MIM# 615731"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MGC15875"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:28249",
                "gene_name": "5-phosphohydroxy-L-lysine phospho-lyase",
                "omim_gene": [
                    "614683"
                ],
                "alias_name": [
                    "5-phosphonooxy-L-lysine phospho-lyase"
                ],
                "gene_symbol": "PHYKPL",
                "hgnc_symbol": "PHYKPL",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "5:177635498-177659792",
                            "ensembl_id": "ENSG00000175309"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "5:178208497-178232791",
                            "ensembl_id": "ENSG00000175309"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2013-06-12"
            },
            "entity_type": "gene",
            "entity_name": "PHYKPL",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "23242558"
            ],
            "evidence": [
                "Expert Review Red",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "[?Phosphohydroxylysinuria] 615011"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "NY-BR-85"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25088",
                "gene_name": "shugoshin 1",
                "omim_gene": [
                    "609168"
                ],
                "alias_name": null,
                "gene_symbol": "SGO1",
                "hgnc_symbol": "SGO1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "3:20202085-20227784",
                            "ensembl_id": "ENSG00000129810"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "3:20160593-20186292",
                            "ensembl_id": "ENSG00000129810"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2016-03-18"
            },
            "entity_type": "gene",
            "entity_name": "SGO1",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "25282101"
            ],
            "evidence": [
                "Expert Review Amber",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Chronic atrial and intestinal dysrhythmia, MIM# 616201"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "CTTNBP1",
                    "ProSAP1",
                    "SHANK",
                    "SPANK-3"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:14295",
                "gene_name": "SH3 and multiple ankyrin repeat domains 2",
                "omim_gene": [
                    "603290"
                ],
                "alias_name": null,
                "gene_symbol": "SHANK2",
                "hgnc_symbol": "SHANK2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "11:70313961-70963623",
                            "ensembl_id": "ENSG00000162105"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "11:70467856-71252577",
                            "ensembl_id": "ENSG00000162105"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-02-22"
            },
            "entity_type": "gene",
            "entity_name": "SHANK2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "30072871",
                "30911184",
                "20473310"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "{Autism susceptibility 17}",
                "Autism spectrum disorder with or without intellectual disability"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25198",
                "gene_name": "solute carrier family 25 member 46",
                "omim_gene": [
                    "610826"
                ],
                "alias_name": null,
                "gene_symbol": "SLC25A46",
                "hgnc_symbol": "SLC25A46",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "5:110073837-110100857",
                            "ensembl_id": "ENSG00000164209"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "5:110738136-110765161",
                            "ensembl_id": "ENSG00000164209"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-09-21"
            },
            "entity_type": "gene",
            "entity_name": "SLC25A46",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "30178502",
                "26168012",
                "27543974",
                "27430653",
                "27390132",
                "28934388",
                "28558379"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Neuropathy, hereditary motor and sensory, type VIB, MIM# 616505",
                "Pontocerebellar hypoplasia, type 1E, MIM# 619303"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "UBOX1",
                    "CHIP",
                    "SDCCAG7",
                    "HSPABP2",
                    "NY-CO-7"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:11427",
                "gene_name": "STIP1 homology and U-box containing protein 1",
                "omim_gene": [
                    "607207"
                ],
                "alias_name": null,
                "gene_symbol": "STUB1",
                "hgnc_symbol": "STUB1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "16:730224-732870",
                            "ensembl_id": "ENSG00000103266"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "16:680224-682870",
                            "ensembl_id": "ENSG00000103266"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-11-25"
            },
            "entity_type": "gene",
            "entity_name": "STUB1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "25258038",
                "24742043",
                "32337344",
                "30381368",
                "31126790"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768",
                "Spinocerebellar ataxia 48, MIM#618093"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:11448",
                "gene_name": "succinate-CoA ligase ADP-forming beta subunit",
                "omim_gene": [
                    "603921"
                ],
                "alias_name": [
                    "succinate--CoA ligase (ADP-forming)"
                ],
                "gene_symbol": "SUCLA2",
                "hgnc_symbol": "SUCLA2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "13:48510622-48612125",
                            "ensembl_id": "ENSG00000136143"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "13:47936491-48001354",
                            "ensembl_id": "ENSG00000136143"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-11-11"
            },
            "entity_type": "gene",
            "entity_name": "SUCLA2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "15877282",
                "17287286",
                "17301081",
                "23759946",
                "33231368",
                "33230181",
                "28243576",
                "27913098",
                "27651038"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria), MIM# 612073, MONDO:0012791"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DIDMOAD",
                    "WFS"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:12762",
                "gene_name": "wolframin ER transmembrane glycoprotein",
                "omim_gene": [
                    "606201"
                ],
                "alias_name": null,
                "gene_symbol": "WFS1",
                "hgnc_symbol": "WFS1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "4:6271576-6304992",
                            "ensembl_id": "ENSG00000109501"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "4:6269849-6303265",
                            "ensembl_id": "ENSG00000109501"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1995-01-30"
            },
            "entity_type": "gene",
            "entity_name": "WFS1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "25211237",
                "33693650"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "?Cataract 41",
                "Deafness, autosomal dominant 6/14/38",
                "Wolfram syndrome, autosomal recessive 1",
                "Wolfram-like syndrome, autosomal dominant",
                "{Diabetes mellitus, noninsulin-dependent, association with}"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "ADAR2",
                    "DRADA2",
                    "ADAR2g",
                    "DRABA2",
                    "RED1",
                    "hRED1",
                    "ADAR2a-L1",
                    "ADAR2a-L2",
                    "ADAR2a-L3",
                    "ADAR2a",
                    "ADAR2b",
                    "ADAR2c",
                    "ADAR2d"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:226",
                "gene_name": "adenosine deaminase, RNA specific B1",
                "omim_gene": [
                    "601218"
                ],
                "alias_name": [
                    "RED1 homolog (rat)"
                ],
                "gene_symbol": "ADARB1",
                "hgnc_symbol": "ADARB1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "21:46493768-46646478",
                            "ensembl_id": "ENSG00000197381"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "21:45073853-45226560",
                            "ensembl_id": "ENSG00000197381"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1996-10-02"
            },
            "entity_type": "gene",
            "entity_name": "ADARB1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "32220291",
                "32719099"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862",
                "Intellectual disability",
                "microcephaly",
                "seizures"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6598",
                "gene_name": "DNA ligase 1",
                "omim_gene": [
                    "126391"
                ],
                "alias_name": null,
                "gene_symbol": "LIG1",
                "hgnc_symbol": "LIG1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:48618702-48673860",
                            "ensembl_id": "ENSG00000105486"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:48115445-48170603",
                            "ensembl_id": "ENSG00000105486"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1991-05-09"
            },
            "entity_type": "gene",
            "entity_name": "LIG1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "30395541"
            ],
            "evidence": [
                "Literature",
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Immunodeficiency 96, MIM# 619774",
                "Lymphopaenia",
                "Hypogammaglobulinaemia",
                "Recurrent bacterial and viral infections",
                "Growth retardation",
                "Sun sensitivity, radiation sensitivity",
                "Macrocytosis"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "BLP2",
                    "FLJ22604"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:24128",
                "gene_name": "TM2 domain containing 3",
                "omim_gene": [
                    "610014"
                ],
                "alias_name": null,
                "gene_symbol": "TM2D3",
                "hgnc_symbol": "TM2D3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "15:102161847-102192594",
                            "ensembl_id": "ENSG00000184277"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "15:101621444-101652391",
                            "ensembl_id": "ENSG00000184277"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-05-19"
            },
            "entity_type": "gene",
            "entity_name": "TM2D3",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "40449487"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Neurocardiorenal malformation syndrome, MIM# 621379"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ23119",
                    "KIAA1790",
                    "Roco1",
                    "RIPK6"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:18608",
                "gene_name": "leucine rich repeat kinase 1",
                "omim_gene": [
                    "610986"
                ],
                "alias_name": null,
                "gene_symbol": "LRRK1",
                "hgnc_symbol": "LRRK1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "15:101459420-101610317",
                            "ensembl_id": "ENSG00000154237"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "15:100919215-101078254",
                            "ensembl_id": "ENSG00000154237"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-01-22"
            },
            "entity_type": "gene",
            "entity_name": "LRRK1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "27829680",
                "27055475",
                "31571209",
                "32119750"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert Review"
            ],
            "phenotypes": [
                "Osteosclerotic metaphyseal dysplasia (OSMD) (OMIM: 615198)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ11767"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25678",
                "gene_name": "EF-hand calcium binding domain 1",
                "omim_gene": null,
                "alias_name": null,
                "gene_symbol": "EFCAB1",
                "hgnc_symbol": "EFCAB1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "8:49623348-49647870",
                            "ensembl_id": "ENSG00000034239"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "8:48710789-48735311",
                            "ensembl_id": "ENSG00000034239"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-07-25"
            },
            "entity_type": "gene",
            "entity_name": "EFCAB1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID: 36727596"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Ciliary dyskinesia, primary, 53, MIM# 620642"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [
                "new gene name"
            ],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "DLNB11"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:23688",
                "gene_name": "B-cell CLL/lymphoma 9 like",
                "omim_gene": [
                    "609004"
                ],
                "alias_name": null,
                "gene_symbol": "BCL9L",
                "hgnc_symbol": "BCL9L",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "11:118764584-118796317",
                            "ensembl_id": "ENSG00000186174"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "11:118893875-118925608",
                            "ensembl_id": "ENSG00000186174"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-12-09"
            },
            "entity_type": "gene",
            "entity_name": "BCL9L",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "23035047",
                "8757136",
                "30366904"
            ],
            "evidence": [
                "Expert Review Amber",
                "Other",
                "Expert list",
                "Literature"
            ],
            "phenotypes": [
                "Heterotaxy syndrome, MONDO:0018677, BCL9L-related"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4851",
                "version_created": "2026-04-30T15:45:56.907744+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6024,
                    "number_of_strs": 43,
                    "number_of_regions": 9
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "GCP6",
                    "KIAA1669",
                    "DJ402G11.6"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:18127",
                "gene_name": "tubulin gamma complex associated protein 6",
                "omim_gene": [
                    "610053"
                ],
                "alias_name": [
                    "gamma-tubulin complex component 6"
                ],
                "gene_symbol": "TUBGCP6",
                "hgnc_symbol": "TUBGCP6",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "22:50656118-50683421",
                            "ensembl_id": "ENSG00000128159"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "22:50217689-50244992",
                            "ensembl_id": "ENSG00000128159"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-08-14"
            },
            "entity_type": "gene",
            "entity_name": "TUBGCP6",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "25344692"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Microcephaly and chorioretinopathy, autosomal recessive, 1, MIM#251270"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 138,
                "hash_id": null,
                "name": "Microcephaly",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.",
                "status": "public",
                "version": "1.434",
                "version_created": "2026-04-30T15:02:27.868954+10:00",
                "relevant_disorders": [
                    "Microcephaly",
                    "HP:0000252"
                ],
                "stats": {
                    "number_of_genes": 384,
                    "number_of_strs": 0,
                    "number_of_regions": 8
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "COX1",
                    "COI"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7419",
                "gene_name": "mitochondrially encoded cytochrome c oxidase I",
                "omim_gene": [
                    "516030"
                ],
                "alias_name": null,
                "gene_symbol": "MT-CO1",
                "hgnc_symbol": "MT-CO1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "MT:5904-7445",
                            "ensembl_id": "ENSG00000198804"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "MT:5904-7445",
                            "ensembl_id": "ENSG00000198804"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-02-16"
            },
            "entity_type": "gene",
            "entity_name": "MT-CO1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "30743023",
                "39460813",
                "24956508",
                "10441567",
                "10980727",
                "15751226",
                "16284789",
                "18977334",
                "22832341",
                "18276892",
                "30030519"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list",
                "Expert list"
            ],
            "phenotypes": [
                "Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related"
            ],
            "mode_of_inheritance": "MITOCHONDRIAL",
            "tags": [
                "mtDNA"
            ],
            "panel": {
                "id": 149,
                "hash_id": null,
                "name": "Optic Atrophy",
                "disease_group": "Ophthalmological disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS and RMH and contains genes associated with isolated and complex optic atrophy.",
                "status": "public",
                "version": "1.72",
                "version_created": "2026-03-31T18:57:17.873049+11:00",
                "relevant_disorders": [
                    "Optic atrophy",
                    "HP:0000648"
                ],
                "stats": {
                    "number_of_genes": 80,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA1023"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29171",
                "gene_name": "IQ motif containing E",
                "omim_gene": [
                    "617631"
                ],
                "alias_name": null,
                "gene_symbol": "IQCE",
                "hgnc_symbol": "IQCE",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "7:2598632-2654368",
                            "ensembl_id": "ENSG00000106012"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "7:2558972-2614734",
                            "ensembl_id": "ENSG00000106012"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-09-02"
            },
            "entity_type": "gene",
            "entity_name": "IQCE",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "31549751",
                "28488682"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Polydactyly, postaxial, type A7 MIM#617642"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 159,
                "hash_id": null,
                "name": "Polydactyly",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS. It contains genes that cause syndromic and non-syndromic polydactyly.",
                "status": "public",
                "version": "0.303",
                "version_created": "2026-04-23T20:20:44.540776+10:00",
                "relevant_disorders": [
                    "Polydactyly",
                    "HP:0010442"
                ],
                "stats": {
                    "number_of_genes": 141,
                    "number_of_strs": 2,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "CDV-1R",
                    "MGC4027"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:14313",
                "gene_name": "intraflagellar transport 81",
                "omim_gene": [
                    "605489"
                ],
                "alias_name": null,
                "gene_symbol": "IFT81",
                "hgnc_symbol": "IFT81",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:110562140-110656602",
                            "ensembl_id": "ENSG00000122970"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:110124335-110218797",
                            "ensembl_id": "ENSG00000122970"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-11-02"
            },
            "entity_type": "gene",
            "entity_name": "IFT81",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "26275418"
            ],
            "evidence": [
                "Expert Review Red",
                "KidGen_CilioNephronop v38.1.0"
            ],
            "phenotypes": [
                "Short-rib thoracic dysplasia 19 with or without polydactyly",
                "OMIM #617895"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 193,
                "hash_id": null,
                "name": "Renal Ciliopathies and Nephronophthisis",
                "disease_group": "Renal and urinary tract disorders",
                "disease_sub_group": "",
                "description": "This panel was created by the KidGen consortium and is a consensus panel used by VCGS and KidGen",
                "status": "public",
                "version": "1.53",
                "version_created": "2026-03-19T17:14:29.802874+11:00",
                "relevant_disorders": [
                    "Abnormality of renal medullary morphology",
                    "HP:0025361; Renal cyst",
                    "HP:0000107"
                ],
                "stats": {
                    "number_of_genes": 101,
                    "number_of_strs": 0,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "KidGen",
                        "slug": "kidgen",
                        "description": "Panel used by the KidGen Collaborative."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "CI-75k"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7707",
                "gene_name": "NADH:ubiquinone oxidoreductase core subunit S1",
                "omim_gene": [
                    "157655"
                ],
                "alias_name": [
                    "complex I 75kDa subunit",
                    "NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"
                ],
                "gene_symbol": "NDUFS1",
                "hgnc_symbol": "NDUFS1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:206979541-207024327",
                            "ensembl_id": "ENSG00000023228"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:206114817-206159603",
                            "ensembl_id": "ENSG00000023228"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1992-04-03"
            },
            "entity_type": "gene",
            "entity_name": "NDUFS1",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Amber",
                "Victorian Clinical Genetics Services",
                "Australian Genomics Health Alliance Epilepsy Flagship"
            ],
            "phenotypes": [
                "Mitochondrial complex I deficiency, MIM#252010"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 202,
                "hash_id": null,
                "name": "Genetic Epilepsy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.",
                "status": "public",
                "version": "1.414",
                "version_created": "2026-04-29T19:08:58.015652+10:00",
                "relevant_disorders": [
                    "Seizure",
                    "HP:0001250; Epileptic encephalopathy",
                    "HP:0200134; EEG abnormality",
                    "HP:0002353"
                ],
                "stats": {
                    "number_of_genes": 1157,
                    "number_of_strs": 9,
                    "number_of_regions": 13
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:4455",
                "gene_name": "glycerol-3-phosphate dehydrogenase 1",
                "omim_gene": [
                    "138420"
                ],
                "alias_name": null,
                "gene_symbol": "GPD1",
                "hgnc_symbol": "GPD1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:50497602-50505102",
                            "ensembl_id": "ENSG00000167588"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:50103819-50111319",
                            "ensembl_id": "ENSG00000167588"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "GPD1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "29884839",
                "35988808",
                "24549054"
            ],
            "evidence": [
                "Expert Review Green"
            ],
            "phenotypes": [
                "Disorders of mitochondrial shuttles and carriers",
                "transient infantile hypertriglyceridemia and hepatosteatosis MONDO:0013771"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 203,
                "hash_id": null,
                "name": "Mitochondrial disease",
                "disease_group": "Metabolic disorders",
                "disease_sub_group": "",
                "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.",
                "status": "public",
                "version": "1.23",
                "version_created": "2026-04-30T15:32:02.669324+10:00",
                "relevant_disorders": [
                    "Increased serum lactate",
                    "HP:0002151; Abnormality of mitochondrial metabolism",
                    "HP:0003287"
                ],
                "stats": {
                    "number_of_genes": 439,
                    "number_of_strs": 1,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "Mi-2b",
                    "Mi2-BETA"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:1919",
                "gene_name": "chromodomain helicase DNA binding protein 4",
                "omim_gene": [
                    "603277"
                ],
                "alias_name": null,
                "gene_symbol": "CHD4",
                "hgnc_symbol": "CHD4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:6679249-6716642",
                            "ensembl_id": "ENSG00000111642"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:6570083-6607476",
                            "ensembl_id": "ENSG00000111642"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-03-20"
            },
            "entity_type": "gene",
            "entity_name": "CHD4",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Victorian Clinical Genetics Services",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 205,
                "hash_id": null,
                "name": "Callosome",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.593",
                "version_created": "2026-04-02T11:47:10.809612+11:00",
                "relevant_disorders": [
                    "Abnormal corpus callosum morphology",
                    "HP:0001273"
                ],
                "stats": {
                    "number_of_genes": 459,
                    "number_of_strs": 2,
                    "number_of_regions": 3
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "PIG2",
                    "TP53I2"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:4136",
                "gene_name": "guanidinoacetate N-methyltransferase",
                "omim_gene": [
                    "601240"
                ],
                "alias_name": null,
                "gene_symbol": "GAMT",
                "hgnc_symbol": "GAMT",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:1397091-1401569",
                            "ensembl_id": "ENSG00000130005"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:1397026-1401570",
                            "ensembl_id": "ENSG00000130005"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1996-07-19"
            },
            "entity_type": "gene",
            "entity_name": "GAMT",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Victorian Clinical Genetics Services",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [
                "treatable"
            ],
            "panel": {
                "id": 206,
                "hash_id": null,
                "name": "Regression",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.611",
                "version_created": "2026-04-07T13:48:08.700916+10:00",
                "relevant_disorders": [
                    "Developmental regression",
                    "HP:0002376"
                ],
                "stats": {
                    "number_of_genes": 442,
                    "number_of_strs": 3,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA0404"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29028",
                "gene_name": "autophagy related 2A",
                "omim_gene": [
                    "616225"
                ],
                "alias_name": null,
                "gene_symbol": "ATG2A",
                "hgnc_symbol": "ATG2A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "11:64662007-64684722",
                            "ensembl_id": "ENSG00000110046"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "11:64894546-64917248",
                            "ensembl_id": "ENSG00000110046"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2007-07-31"
            },
            "entity_type": "gene",
            "entity_name": "ATG2A",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "40631414"
            ],
            "evidence": [
                "Expert Review Red",
                "Literature"
            ],
            "phenotypes": [
                "complex neurodevelopmental disorder, ATG2A-related - MONDO:0100038"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 206,
                "hash_id": null,
                "name": "Regression",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.611",
                "version_created": "2026-04-07T13:48:08.700916+10:00",
                "relevant_disorders": [
                    "Developmental regression",
                    "HP:0002376"
                ],
                "stats": {
                    "number_of_genes": 442,
                    "number_of_strs": 3,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "NSRD2"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7606",
                "gene_name": "myosin VIIA",
                "omim_gene": [
                    "276903"
                ],
                "alias_name": null,
                "gene_symbol": "MYO7A",
                "hgnc_symbol": "MYO7A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "11:76839310-76926284",
                            "ensembl_id": "ENSG00000137474"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "11:77128264-77215239",
                            "ensembl_id": "ENSG00000137474"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1992-06-08"
            },
            "entity_type": "gene",
            "entity_name": "MYO7A",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "9354784",
                "15300860",
                "15121790",
                "15221449",
                "16449806",
                "21150918",
                "23451214",
                "23383098",
                "28802369",
                "29400105",
                "23559863",
                "18181211",
                "25211151"
            ],
            "evidence": [
                "Expert Review Green",
                "Melbourne Genomics Health Alliance Deafness Flagship",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Deafness, autosomal dominant 11, MIM# 601317",
                "Deafness, autosomal recessive 2, 600060",
                "Usher syndrome, type 1B, MIM# 276900"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 209,
                "hash_id": null,
                "name": "Deafness_IsolatedAndComplex",
                "disease_group": "Hearing and ear disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).",
                "status": "public",
                "version": "1.361",
                "version_created": "2026-04-11T11:20:22.713350+10:00",
                "relevant_disorders": [
                    "Hearing impairment",
                    "HP:0000365"
                ],
                "stats": {
                    "number_of_genes": 348,
                    "number_of_strs": 1,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "hILP"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:592",
                "gene_name": "X-linked inhibitor of apoptosis",
                "omim_gene": [
                    "300079"
                ],
                "alias_name": null,
                "gene_symbol": "XIAP",
                "hgnc_symbol": "XIAP",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:122993574-123047829",
                            "ensembl_id": "ENSG00000101966"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:123859724-123913979",
                            "ensembl_id": "ENSG00000101966"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2008-03-04"
            },
            "entity_type": "gene",
            "entity_name": "XIAP",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "17080092"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Lymphoproliferative syndrome, X-linked, 2\t300635",
                "Host response to EBV"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "tags": [],
            "panel": {
                "id": 237,
                "hash_id": null,
                "name": "Susceptibility to Viral Infections",
                "disease_group": "Immunological disorders",
                "disease_sub_group": "",
                "description": "This panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital). It is currently maintained by VCGS.\r\n\r\nUpdated with the 2019 International Union of Immunological Societies Committee classification, Tangye et al. 2019 and the COVID Human Genetic Effort list, Casanova et al 2020.",
                "status": "public",
                "version": "1.10",
                "version_created": "2026-03-26T15:17:02.053015+11:00",
                "relevant_disorders": [
                    "Recurrent viral infections",
                    "HP:0004429; Severe viral infection",
                    "HP:0031691"
                ],
                "stats": {
                    "number_of_genes": 54,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ10587",
                    "FLJ23205"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25551",
                "gene_name": "SMG8, nonsense mediated mRNA decay factor",
                "omim_gene": [
                    "613175"
                ],
                "alias_name": null,
                "gene_symbol": "SMG8",
                "hgnc_symbol": "SMG8",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:57286761-57292608",
                            "ensembl_id": "ENSG00000167447"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:59209400-59215247",
                            "ensembl_id": "ENSG00000167447"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2011-06-21"
            },
            "entity_type": "gene",
            "entity_name": "SMG8",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "31130284",
                "33242396"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Alzahrani-Kuwahara syndrome, MIM#\t619268",
                "Intellectual disability"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 250,
                "hash_id": null,
                "name": "Intellectual disability syndromic and non-syndromic",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.",
                "status": "public",
                "version": "1.780",
                "version_created": "2026-04-30T15:03:16.542762+10:00",
                "relevant_disorders": [
                    "Intellectual disability",
                    "HP:0001249; Neurodevelopmental delay",
                    "HP:0012758"
                ],
                "stats": {
                    "number_of_genes": 2529,
                    "number_of_strs": 10,
                    "number_of_regions": 57
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "OST",
                    "KIAA0115",
                    "OST48",
                    "WBP1",
                    "GATD6"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:2728",
                "gene_name": "dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit",
                "omim_gene": [
                    "602202"
                ],
                "alias_name": [
                    "oligosaccharyltransferase subunit 48",
                    "advanced glycation end-product receptor 1"
                ],
                "gene_symbol": "DDOST",
                "hgnc_symbol": "DDOST",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:20978270-20988000",
                            "ensembl_id": "ENSG00000244038"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:20651767-20661544",
                            "ensembl_id": "ENSG00000244038"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1997-12-23"
            },
            "entity_type": "gene",
            "entity_name": "DDOST",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "22305527",
                "34462534",
                "36214423",
                "37848450",
                "33413482",
                "36631682"
            ],
            "evidence": [
                "Expert Review Green",
                "Genetic Health Queensland"
            ],
            "phenotypes": [
                "DDOST-congenital disorder of glycosylation MONDO:0013789"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 250,
                "hash_id": null,
                "name": "Intellectual disability syndromic and non-syndromic",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.",
                "status": "public",
                "version": "1.780",
                "version_created": "2026-04-30T15:03:16.542762+10:00",
                "relevant_disorders": [
                    "Intellectual disability",
                    "HP:0001249; Neurodevelopmental delay",
                    "HP:0012758"
                ],
                "stats": {
                    "number_of_genes": 2529,
                    "number_of_strs": 10,
                    "number_of_regions": 57
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6817",
                "gene_name": "mal, T-cell differentiation protein",
                "omim_gene": [
                    "188860"
                ],
                "alias_name": [
                    "MyD88-adapter-like"
                ],
                "gene_symbol": "MAL",
                "hgnc_symbol": "MAL",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:95691422-95719737",
                            "ensembl_id": "ENSG00000172005"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:95025677-95053996",
                            "ensembl_id": "ENSG00000172005"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1986-01-01"
            },
            "entity_type": "gene",
            "entity_name": "MAL",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "35217805"
            ],
            "evidence": [
                "Expert Review Amber",
                "Literature"
            ],
            "phenotypes": [
                "Leukodystrophy, hypomyelinating, 28, MIM#  620978"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 250,
                "hash_id": null,
                "name": "Intellectual disability syndromic and non-syndromic",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.",
                "status": "public",
                "version": "1.780",
                "version_created": "2026-04-30T15:03:16.542762+10:00",
                "relevant_disorders": [
                    "Intellectual disability",
                    "HP:0001249; Neurodevelopmental delay",
                    "HP:0012758"
                ],
                "stats": {
                    "number_of_genes": 2529,
                    "number_of_strs": 10,
                    "number_of_regions": 57
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ20069",
                    "ORF1",
                    "JBTS3"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:21575",
                "gene_name": "Abelson helper integration site 1",
                "omim_gene": [
                    "608894"
                ],
                "alias_name": [
                    "Jouberin"
                ],
                "gene_symbol": "AHI1",
                "hgnc_symbol": "AHI1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:135604670-135818914",
                            "ensembl_id": "ENSG00000135541"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:135283532-135497776",
                            "ensembl_id": "ENSG00000135541"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-08-22"
            },
            "entity_type": "gene",
            "entity_name": "AHI1",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Expert Review Green",
                "Emory Genetics Laboratory",
                "Victorian Clinical Genetics Services",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "",
            "tags": [],
            "panel": {
                "id": 258,
                "hash_id": null,
                "name": "Skeletal dysplasia",
                "disease_group": "Skeletal disorders",
                "disease_sub_group": "Skeletal dysplasias",
                "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.",
                "status": "public",
                "version": "0.444",
                "version_created": "2026-04-30T17:18:26.299482+10:00",
                "relevant_disorders": [
                    "Skeletal dysplasia",
                    "HP:0002652"
                ],
                "stats": {
                    "number_of_genes": 639,
                    "number_of_strs": 4,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DKFZP586M0122",
                    "FLJ21915",
                    "RPO1-4",
                    "RPA1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:17264",
                "gene_name": "RNA polymerase I subunit A",
                "omim_gene": [
                    "616404"
                ],
                "alias_name": null,
                "gene_symbol": "POLR1A",
                "hgnc_symbol": "POLR1A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:86247339-86333278",
                            "ensembl_id": "ENSG00000068654"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:86020216-86106155",
                            "ensembl_id": "ENSG00000068654"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-04-01"
            },
            "entity_type": "gene",
            "entity_name": "POLR1A",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "25913037"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert Review Green",
                "Expert list",
                "NHS GMS",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Acrofacial dysostosis, Cincinnati type 616462"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 258,
                "hash_id": null,
                "name": "Skeletal dysplasia",
                "disease_group": "Skeletal disorders",
                "disease_sub_group": "Skeletal dysplasias",
                "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.",
                "status": "public",
                "version": "0.444",
                "version_created": "2026-04-30T17:18:26.299482+10:00",
                "relevant_disorders": [
                    "Skeletal dysplasia",
                    "HP:0002652"
                ],
                "stats": {
                    "number_of_genes": 639,
                    "number_of_strs": 4,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "querkopf",
                    "qkf",
                    "Morf",
                    "MOZ2",
                    "ZC2HC6B"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:17582",
                "gene_name": "lysine acetyltransferase 6B",
                "omim_gene": [
                    "605880"
                ],
                "alias_name": [
                    "MOZ-related factor"
                ],
                "gene_symbol": "KAT6B",
                "hgnc_symbol": "KAT6B",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "10:76585340-76792380",
                            "ensembl_id": "ENSG00000156650"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "10:74825582-75032622",
                            "ensembl_id": "ENSG00000156650"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2011-07-21"
            },
            "entity_type": "gene",
            "entity_name": "KAT6B",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "NHS GMS"
            ],
            "phenotypes": [
                "SBBYSS syndrome 603736",
                "GTPTS,Ohdo",
                "Genitopatellar syndrome 606170"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown",
            "tags": [],
            "panel": {
                "id": 258,
                "hash_id": null,
                "name": "Skeletal dysplasia",
                "disease_group": "Skeletal disorders",
                "disease_sub_group": "Skeletal dysplasias",
                "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.",
                "status": "public",
                "version": "0.444",
                "version_created": "2026-04-30T17:18:26.299482+10:00",
                "relevant_disorders": [
                    "Skeletal dysplasia",
                    "HP:0002652"
                ],
                "stats": {
                    "number_of_genes": 639,
                    "number_of_strs": 4,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MSAP",
                    "c86fus"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7413",
                "gene_name": "methylthioadenosine phosphorylase",
                "omim_gene": [
                    "156540"
                ],
                "alias_name": [
                    "S-methyl-5'-thioadenosine phosphorylase"
                ],
                "gene_symbol": "MTAP",
                "hgnc_symbol": "MTAP",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:21802542-21931646",
                            "ensembl_id": "ENSG00000099810"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:21802543-21937651",
                            "ensembl_id": "ENSG00000099810"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "MTAP",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "22464254"
            ],
            "evidence": [
                "Expert Review Amber",
                "Radboud University Medical Center, Nijmegen",
                "Illumina TruGenome Clinical Sequencing Services",
                "Expert list"
            ],
            "phenotypes": [
                "Diaphyseal medullary stenosis with malignant fibrous histiocytoma, MIM# 112250"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 258,
                "hash_id": null,
                "name": "Skeletal dysplasia",
                "disease_group": "Skeletal disorders",
                "disease_sub_group": "Skeletal dysplasias",
                "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.",
                "status": "public",
                "version": "0.444",
                "version_created": "2026-04-30T17:18:26.299482+10:00",
                "relevant_disorders": [
                    "Skeletal dysplasia",
                    "HP:0002652"
                ],
                "stats": {
                    "number_of_genes": 639,
                    "number_of_strs": 4,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "TEL1",
                    "TELO1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:795",
                "gene_name": "ATM serine/threonine kinase",
                "omim_gene": [
                    "607585"
                ],
                "alias_name": [
                    "TEL1, telomere maintenance 1, homolog (S. cerevisiae)"
                ],
                "gene_symbol": "ATM",
                "hgnc_symbol": "ATM",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "11:108093211-108239829",
                            "ensembl_id": "ENSG00000149311"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "11:108222484-108369102",
                            "ensembl_id": "ENSG00000149311"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1995-07-07"
            },
            "entity_type": "gene",
            "entity_name": "ATM",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Ataxia-telangiectasia, MIM#\t208900"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 300,
                "hash_id": null,
                "name": "Vascular Malformations_Germline",
                "disease_group": "Cardiovascular disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause Mendelian vascular malformation disorders, particularly those presenting with skin lesions. Genes causing sporadic and congenital vascular malformations through somatic activating mutations are rated Red and labelled 'somatic'. This gene panel is maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nIf a sample of affected tissue is being tested, please use the Vascular Malformations_Somatic panel.",
                "status": "public",
                "version": "1.13",
                "version_created": "2026-01-24T18:03:26.952041+11:00",
                "relevant_disorders": [
                    "Abnormal vascular morphology HP:0025015"
                ],
                "stats": {
                    "number_of_genes": 42,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:9788",
                "gene_name": "RAB7A, member RAS oncogene family",
                "omim_gene": [
                    "602298"
                ],
                "alias_name": null,
                "gene_symbol": "RAB7A",
                "hgnc_symbol": "RAB7A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "3:128444965-128533639",
                            "ensembl_id": "ENSG00000075785"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "3:128726122-128814796",
                            "ensembl_id": "ENSG00000075785"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2007-01-15"
            },
            "entity_type": "gene",
            "entity_name": "RAB7A",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "12545426",
                "17060578",
                "32326241",
                "29130394",
                "25614874"
            ],
            "evidence": [
                "Royal Melbourne Hospital",
                "Expert Review Green",
                "Expert Review Green"
            ],
            "phenotypes": [
                "Charcot-Marie-Tooth disease, type 2B, MIM# 600882",
                "MONDO:0010949"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3070,
                "hash_id": null,
                "name": "Hereditary Neuropathy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),",
                "status": "public",
                "version": "1.190",
                "version_created": "2026-03-31T19:04:58.660686+11:00",
                "relevant_disorders": [
                    "Peripheral neuropathy",
                    "HP:0009830"
                ],
                "stats": {
                    "number_of_genes": 277,
                    "number_of_strs": 6,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ10407",
                    "NET3"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25525",
                "gene_name": "NDC1 transmembrane nucleoporin",
                "omim_gene": [
                    "610115"
                ],
                "alias_name": [
                    "nuclear division cycle 1 homolog (S. cerevisiae)"
                ],
                "gene_symbol": "NDC1",
                "hgnc_symbol": "NDC1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:54231133-54304533",
                            "ensembl_id": "ENSG00000058804"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:53765460-53838860",
                            "ensembl_id": "ENSG00000058804"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2013-05-23"
            },
            "entity_type": "gene",
            "entity_name": "NDC1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "39003500",
                "19782045"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3070,
                "hash_id": null,
                "name": "Hereditary Neuropathy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),",
                "status": "public",
                "version": "1.190",
                "version_created": "2026-03-31T19:04:58.660686+11:00",
                "relevant_disorders": [
                    "Peripheral neuropathy",
                    "HP:0009830"
                ],
                "stats": {
                    "number_of_genes": 277,
                    "number_of_strs": 6,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "RC3",
                    "KIAA0856",
                    "DFNA71"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:2938",
                "gene_name": "Dmx like 2",
                "omim_gene": [
                    "612186"
                ],
                "alias_name": [
                    "rabconnectin 3"
                ],
                "gene_symbol": "DMXL2",
                "hgnc_symbol": "DMXL2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "15:51739908-51915030",
                            "ensembl_id": "ENSG00000104093"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "15:51447711-51622833",
                            "ensembl_id": "ENSG00000104093"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-04-27"
            },
            "entity_type": "gene",
            "entity_name": "DMXL2",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "30237576",
                "31688942",
                "27657680",
                "25248098"
            ],
            "evidence": [
                "Expert Review Red",
                "Other"
            ],
            "phenotypes": [
                "Polyendocrine-polyneuropathy syndrome , MIM#\t616113"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3093,
                "hash_id": null,
                "name": "Monogenic Diabetes",
                "disease_group": "Endocrine disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with monogenic diabetes, including: \r\n-familial diabetes\r\n-neonatal diabetes\r\n-maturity onset diabetes of the young\r\n-insulin resistance (including lipodystrophy)\r\n\r\nIt has been compared against the following Genomics England PanelApp panels with all discrepancies reviewed and resolved (February 2026) : monogenic diabetes (V3.8), familial diabetes (V1.68), neonatal diabetes (V5.14), multi-organ autoimmune diabetes (V1.12), diabetes with additional phenotypes suggestive of a monogenic aetiology (V1.68), and insulin resistance (including lipodystrophy)(V1.18). \r\n\r\nFor a high suspicion of a mitochondrial DNA disorder: \r\nrequest a specific assay for mitochondrially encoded genes (such as mitochondrial genome sequencing or whole genome sequencing).",
                "status": "public",
                "version": "0.224",
                "version_created": "2026-04-06T18:03:06.439122+10:00",
                "relevant_disorders": [
                    "Diabetes mellitus",
                    "HP:0000819"
                ],
                "stats": {
                    "number_of_genes": 109,
                    "number_of_strs": 0,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "JM2",
                    "XPID",
                    "AIID",
                    "PIDX",
                    "DIETER",
                    "SCURFIN"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6106",
                "gene_name": "forkhead box P3",
                "omim_gene": [
                    "300292"
                ],
                "alias_name": null,
                "gene_symbol": "FOXP3",
                "hgnc_symbol": "FOXP3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:49106897-49121288",
                            "ensembl_id": "ENSG00000049768"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:49250436-49264826",
                            "ensembl_id": "ENSG00000049768"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-09-20"
            },
            "entity_type": "gene",
            "entity_name": "FOXP3",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Immunodysregulation, polyendocrinopathy, and enteropathy, X-linked, 304790 (3)"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "tags": [],
            "panel": {
                "id": 3139,
                "hash_id": null,
                "name": "Mackenzie's Mission_Reproductive Carrier Screening",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.",
                "status": "public",
                "version": "0.111",
                "version_created": "2025-11-21T16:50:54.555702+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1335,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "New South Wales Health Pathology",
                        "slug": "new-south-wales-health-pathology",
                        "description": "New South Wales Health Pathology"
                    },
                    {
                        "name": "PathWest",
                        "slug": "pathwest",
                        "description": "PathWest"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ38464",
                    "FLJ16786"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:18688",
                "gene_name": "crumbs 2, cell polarity complex component",
                "omim_gene": [
                    "609720"
                ],
                "alias_name": null,
                "gene_symbol": "CRB2",
                "hgnc_symbol": "CRB2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:126118449-126142603",
                            "ensembl_id": "ENSG00000148204"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:123356170-123380324",
                            "ensembl_id": "ENSG00000148204"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-03-19"
            },
            "entity_type": "gene",
            "entity_name": "CRB2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Ventriculomegaly with cystic kidney disease, 219730 (3)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3139,
                "hash_id": null,
                "name": "Mackenzie's Mission_Reproductive Carrier Screening",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.",
                "status": "public",
                "version": "0.111",
                "version_created": "2025-11-21T16:50:54.555702+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1335,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "New South Wales Health Pathology",
                        "slug": "new-south-wales-health-pathology",
                        "description": "New South Wales Health Pathology"
                    },
                    {
                        "name": "PathWest",
                        "slug": "pathwest",
                        "description": "PathWest"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "UGT1A"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:12530",
                "gene_name": "UDP glucuronosyltransferase family 1 member A1",
                "omim_gene": [
                    "191740"
                ],
                "alias_name": null,
                "gene_symbol": "UGT1A1",
                "hgnc_symbol": "UGT1A1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:234526291-234681956",
                            "ensembl_id": "ENSG00000241635"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:233760248-233773299",
                            "ensembl_id": "ENSG00000241635"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1989-02-13"
            },
            "entity_type": "gene",
            "entity_name": "UGT1A1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "BabySeq Category A gene",
                "Expert Review Green"
            ],
            "phenotypes": [
                "Crigler-Najjar syndrome"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3302,
                "hash_id": null,
                "name": "Additional findings_Paediatric",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).",
                "status": "public",
                "version": "0.280",
                "version_created": "2026-01-16T11:59:53.863455+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1425,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:8864",
                "gene_name": "complement factor properdin",
                "omim_gene": [
                    "300383"
                ],
                "alias_name": null,
                "gene_symbol": "CFP",
                "hgnc_symbol": "CFP",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:47483612-47489704",
                            "ensembl_id": "ENSG00000126759"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:47623172-47630305",
                            "ensembl_id": "ENSG00000126759"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-03-02"
            },
            "entity_type": "gene",
            "entity_name": "CFP",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "BabySeq Category A gene",
                "Expert Review Green"
            ],
            "phenotypes": [
                "Properdin deficiency, X-linked"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "tags": [],
            "panel": {
                "id": 3302,
                "hash_id": null,
                "name": "Additional findings_Paediatric",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).",
                "status": "public",
                "version": "0.280",
                "version_created": "2026-01-16T11:59:53.863455+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1425,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "CD104"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6158",
                "gene_name": "integrin subunit beta 4",
                "omim_gene": [
                    "147557"
                ],
                "alias_name": null,
                "gene_symbol": "ITGB4",
                "hgnc_symbol": "ITGB4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:73717408-73753899",
                            "ensembl_id": "ENSG00000132470"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:75721328-75757818",
                            "ensembl_id": "ENSG00000132470"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1991-08-06"
            },
            "entity_type": "gene",
            "entity_name": "ITGB4",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "BabySeq Category A gene",
                "Expert Review Green"
            ],
            "phenotypes": [
                "Epidermolysis bullosa, junctional, with pyloric atresia"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3302,
                "hash_id": null,
                "name": "Additional findings_Paediatric",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).",
                "status": "public",
                "version": "0.280",
                "version_created": "2026-01-16T11:59:53.863455+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1425,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "RP30",
                    "RFSN"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3960",
                "gene_name": "fascin actin-bundling protein 2, retinal",
                "omim_gene": [
                    "607643"
                ],
                "alias_name": null,
                "gene_symbol": "FSCN2",
                "hgnc_symbol": "FSCN2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:79495422-79504156",
                            "ensembl_id": "ENSG00000186765"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:81528396-81537130",
                            "ensembl_id": "ENSG00000186765"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2000-02-29"
            },
            "entity_type": "gene",
            "entity_name": "FSCN2",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Red",
                "BabySeq Category C gene"
            ],
            "phenotypes": [
                "Retinitis pigmentosa"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3302,
                "hash_id": null,
                "name": "Additional findings_Paediatric",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).",
                "status": "public",
                "version": "0.280",
                "version_created": "2026-01-16T11:59:53.863455+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1425,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA1025",
                    "TRAP240L"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:22962",
                "gene_name": "mediator complex subunit 13 like",
                "omim_gene": [
                    "608771"
                ],
                "alias_name": null,
                "gene_symbol": "MED13L",
                "hgnc_symbol": "MED13L",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:116395711-116715143",
                            "ensembl_id": "ENSG00000123066"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:115953872-116277338",
                            "ensembl_id": "ENSG00000123066"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2007-07-30"
            },
            "entity_type": "gene",
            "entity_name": "MED13L",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "25712080",
                "25137640"
            ],
            "evidence": [
                "Expert Review Amber",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Mental retardation and distinctive facial features with or without cardiac defects, 616789",
                "Cleft palate",
                "MRFACD"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown",
            "tags": [],
            "panel": {
                "id": 3368,
                "hash_id": null,
                "name": "Clefting disorders",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "Dysmorphic disorders",
                "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.",
                "status": "public",
                "version": "0.318",
                "version_created": "2026-04-27T11:53:17.890231+10:00",
                "relevant_disorders": [
                    "Oral cleft HP:0000202"
                ],
                "stats": {
                    "number_of_genes": 314,
                    "number_of_strs": 2,
                    "number_of_regions": 5
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "RhoGAP2",
                    "ARHGAP2",
                    "n-chimerin"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:1943",
                "gene_name": "chimerin 1",
                "omim_gene": [
                    "118423"
                ],
                "alias_name": [
                    "Chimerin 1 (GTPase-activating protein, rho, 2)",
                    "chimaerin 1"
                ],
                "gene_symbol": "CHN1",
                "hgnc_symbol": "CHN1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:175664091-175870097",
                            "ensembl_id": "ENSG00000128656"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:174799363-175005369",
                            "ensembl_id": "ENSG00000128656"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1991-07-12"
            },
            "entity_type": "gene",
            "entity_name": "CHN1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID 33004823",
                "18653847",
                "21555619"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Duane retraction syndrome 2, 604356"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3379,
                "hash_id": null,
                "name": "Congenital ophthalmoplegia",
                "disease_group": "Ophthalmological disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with congenital ophthalmoplegia including those associated with congenital fibrosis of the extra-ocular muscles (CFEOM), Duane anomaly, Moebius syndrome, and gaze palsies.\r\n\r\nIn addition, it includes genes associated with conditions where ophthalmoplegia can occur in infancy/early childhood as a common/prominent feature of a more complex syndromic, metabolic or neuromuscular condition.",
                "status": "public",
                "version": "1.14",
                "version_created": "2025-12-14T20:52:23.588623+11:00",
                "relevant_disorders": [
                    "Abnormality of eye movement",
                    "HP:0000496"
                ],
                "stats": {
                    "number_of_genes": 55,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "ATPIC",
                    "PFIC"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3706",
                "gene_name": "ATPase phospholipid transporting 8B1",
                "omim_gene": [
                    "602397"
                ],
                "alias_name": null,
                "gene_symbol": "ATP8B1",
                "hgnc_symbol": "ATP8B1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "18:55313658-55470333",
                            "ensembl_id": "ENSG00000081923"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "18:57646426-57803101",
                            "ensembl_id": "ENSG00000081923"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1996-12-17"
            },
            "entity_type": "gene",
            "entity_name": "ATP8B1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "15239083"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Cholestasis, progressive familial intrahepatic 1, MIM#\t211600"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3400,
                "hash_id": null,
                "name": "Liver Failure_Paediatric",
                "disease_group": "Gastroenterological disorders",
                "disease_sub_group": "",
                "description": "This panel includes primary liver disorders as well as metabolic and other multi-system disorders that have been reported to cause liver failure in children.\r\n\r\nPlease also consider using the Cholestasis panel if clinically indicated.",
                "status": "public",
                "version": "1.33",
                "version_created": "2026-01-08T17:48:33.703909+11:00",
                "relevant_disorders": [
                    "Liver failure",
                    "HP:0001399"
                ],
                "stats": {
                    "number_of_genes": 68,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "CDHF5"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3049",
                "gene_name": "desmoglein 2",
                "omim_gene": [
                    "125671"
                ],
                "alias_name": null,
                "gene_symbol": "DSG2",
                "hgnc_symbol": "DSG2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "18:29078006-29128971",
                            "ensembl_id": "ENSG00000046604"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "18:31498043-31549008",
                            "ensembl_id": "ENSG00000046604"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1991-11-15"
            },
            "entity_type": "gene",
            "entity_name": "DSG2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "NSW Health Pathology",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 3437,
                "hash_id": null,
                "name": "Incidentalome_PREGEN_DRAFT",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "Imported to facilitate update work. Do not use while labeled as DRAFT",
                "status": "public",
                "version": "0.43",
                "version_created": "2021-01-20T16:42:09.286633+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 173,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "New South Wales Health Pathology",
                        "slug": "new-south-wales-health-pathology",
                        "description": "New South Wales Health Pathology"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MGC71996",
                    "NBIA3"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3999",
                "gene_name": "ferritin light chain",
                "omim_gene": [
                    "134790"
                ],
                "alias_name": [
                    "ferritin light polypeptide-like 3",
                    "L apoferritin",
                    "ferritin L subunit",
                    "ferritin light chain",
                    "ferritin L-chain",
                    "neurodegeneration with brain iron accumulation 3"
                ],
                "gene_symbol": "FTL",
                "hgnc_symbol": "FTL",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:49468558-49470135",
                            "ensembl_id": "ENSG00000087086"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:48965301-48966878",
                            "ensembl_id": "ENSG00000087086"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "FTL",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "23940258",
                "18413574",
                "23421845",
                "19176363"
            ],
            "evidence": [
                "Expert Review Green",
                "NHS Genomic Medicine Service",
                "Genomics England PanelApp"
            ],
            "phenotypes": [
                "606159 NEURODEGENERATION WITH BRAIN IRON ACCUMULATION 3",
                "LFTD",
                "NBIA3",
                "615604 L-FERRITIN DEFICIENCY",
                "HRFTC",
                "606159 Neurodegeneration with brain iron accumulation 3",
                "600886 HYPERFERRITINEMIA WITH OR WITHOUT CATARACT",
                "600886 Hyperferritinemia-cataract syndrome",
                "615604 L-ferritin deficiency, dominant and recessive"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown",
            "tags": [],
            "panel": {
                "id": 3469,
                "hash_id": null,
                "name": "Metal Metabolism Disorders",
                "disease_group": "Metabolic disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause inborn errors of molybdenum, copper, iron, manganese, zinc, selenium, and magnesium metabolism.  \r\nThis panel was based on the Genomics England/NHS Genomics Medicine Service 'Iron metabolism disorders' panel. It is part of the Metabolic Disorders Superpanel.",
                "status": "public",
                "version": "0.54",
                "version_created": "2026-02-17T14:35:14.331246+11:00",
                "relevant_disorders": [
                    "Abnormality of iron homeostasis",
                    "HP:0011031;Abnormal blood transition element cation concentration",
                    "HP:0011030"
                ],
                "stats": {
                    "number_of_genes": 51,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "SPL"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10817",
                "gene_name": "sphingosine-1-phosphate lyase 1",
                "omim_gene": [
                    "603729"
                ],
                "alias_name": null,
                "gene_symbol": "SGPL1",
                "hgnc_symbol": "SGPL1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "10:72575717-72640930",
                            "ensembl_id": "ENSG00000166224"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "10:70815961-70881173",
                            "ensembl_id": "ENSG00000166224"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-02-03"
            },
            "entity_type": "gene",
            "entity_name": "SGPL1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "33074640",
                "35904228",
                "35748945",
                "32322566",
                "28165343",
                "38204317"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "RENI syndrome (MIM#617575)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3471,
                "hash_id": null,
                "name": "Congenital hypothyroidism",
                "disease_group": "Endocrine disorders",
                "disease_sub_group": "Thyroid disorders",
                "description": "This panel contains genes associated with congenital hypothyroidism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'congenital hypothyroidism' panel V3.1, with all discrepancies reviewed and resolved (November 2025).",
                "status": "public",
                "version": "0.120",
                "version_created": "2026-04-02T11:51:29.895216+11:00",
                "relevant_disorders": [
                    "Hypothyroidism HP:0000821"
                ],
                "stats": {
                    "number_of_genes": 63,
                    "number_of_strs": 1,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "XPB",
                    "BTF2",
                    "RAD25",
                    "TFIIH",
                    "GTF2H"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3435",
                "gene_name": "ERCC excision repair 3, TFIIH core complex helicase subunit",
                "omim_gene": [
                    "133510"
                ],
                "alias_name": [
                    "xeroderma pigmentosum group B complementing"
                ],
                "gene_symbol": "ERCC3",
                "hgnc_symbol": "ERCC3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:128014866-128051752",
                            "ensembl_id": "ENSG00000163161"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:127257290-127294176",
                            "ensembl_id": "ENSG00000163161"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "ERCC3",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "2167179",
                "10447254",
                "16947863",
                "9012405",
                "32557569",
                "27004399"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert Review"
            ],
            "phenotypes": [
                "Trichothiodystrophy 2, photosensitive, MIM# 616390",
                "Xeroderma pigmentosum, group B 61, MIM#0651"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3631,
                "hash_id": null,
                "name": "Growth failure",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with growth failure in infancy/early childhood, either isolated or as part of another disorder.\r\n\r\nConsider applying this panel in individuals with:\r\n -Height Standard Deviation Score (SDS) <-3 (very significant short stature - well below the 0.4th centile)\r\nAND at least one of:\r\n- History of small for gestational age (birth weight and/or length <-2SDS)\r\n- Body disproportion, e.g. discrepancy between stature and head size\r\n- Dysmorphic features and congenital anomalies\r\n- Abnormalities in the GH-IGF axis (evidence of GH insensitivity or deficiency) and/or other pituitary hormonal deficiencies\r\n- Family history of significant short stature (1st and 2nd degree relatives) and/or consanguinity\r\n\r\nPrior to genomic testing consider:\r\n-Chromosomal microarray analysis (e.g. Turner syndrome)\r\n-Methylation analysis for Russell-Silver syndrome and Temple syndrome\r\n-Skeletal survey\r\n\r\nAcquired causes of short stature are relatively common.\r\n\r\nDepending on the specific clinical features present, consider applying the Skeletal dysplasia, Intellectual Disability, and/or Pituitary Hormone deficiency panels.\r\n\r\nWith thanks to Genomics England for the original design of this panel.",
                "status": "public",
                "version": "1.107",
                "version_created": "2026-04-30T15:03:50.139368+10:00",
                "relevant_disorders": [
                    "Failure to thrive",
                    "HP:0001508; Growth delay",
                    "HP:0001510"
                ],
                "stats": {
                    "number_of_genes": 204,
                    "number_of_strs": 0,
                    "number_of_regions": 5
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "MDS031",
                    "YGL047W",
                    "FLJ23018",
                    "TDRD13",
                    "CDG1S"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:30881",
                "gene_name": "ALG13, UDP-N-acetylglucosaminyltransferase subunit",
                "omim_gene": [
                    "300776"
                ],
                "alias_name": [
                    "tudor domain containing 13",
                    "N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"
                ],
                "gene_symbol": "ALG13",
                "hgnc_symbol": "ALG13",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:110909043-111003877",
                            "ensembl_id": "ENSG00000101901"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:111665811-111760649",
                            "ensembl_id": "ENSG00000101901"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-11-07"
            },
            "entity_type": "gene",
            "entity_name": "ALG13",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "23033978",
                "23934111",
                "24781210",
                "24896178",
                "25732998",
                "26138355",
                "26482601",
                "28940310",
                "32238909"
            ],
            "evidence": [
                "Expert Review Amber",
                "Genomics England PanelApp",
                "Genetic Health Queensland"
            ],
            "phenotypes": [
                "Congenital disorder of glycosylation, type Is (MIM# 300884)",
                "Developmental and epileptic encephalopathy."
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.576",
                "version_created": "2026-04-29T19:01:52.053429+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2208,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ45476"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29368",
                "gene_name": "cilia and flagella associated protein 74",
                "omim_gene": null,
                "alias_name": null,
                "gene_symbol": "CFAP74",
                "hgnc_symbol": "CFAP74",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:1853396-1935276",
                            "ensembl_id": "ENSG00000142609"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:1921951-2003837",
                            "ensembl_id": "ENSG00000142609"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2014-09-04"
            },
            "entity_type": "gene",
            "entity_name": "CFAP74",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "32555313"
            ],
            "evidence": [
                "Expert Review Red",
                "Literature"
            ],
            "phenotypes": [
                "infertility",
                "primary ciliary dyskinesia"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.576",
                "version_created": "2026-04-29T19:01:52.053429+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2208,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLVCR",
                    "MFSD7B",
                    "PCA"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:24682",
                "gene_name": "feline leukemia virus subgroup C cellular receptor 1",
                "omim_gene": [
                    "609144"
                ],
                "alias_name": null,
                "gene_symbol": "FLVCR1",
                "hgnc_symbol": "FLVCR1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:213031597-213072705",
                            "ensembl_id": "ENSG00000162769"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:212858255-212899363",
                            "ensembl_id": "ENSG00000162769"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2007-05-01"
            },
            "entity_type": "gene",
            "entity_name": "FLVCR1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "39306721"
            ],
            "evidence": [
                "Expert Review Green",
                "Genomics England PanelApp",
                "Genetic Health Queensland"
            ],
            "phenotypes": [
                "neurodevelopmental disorder MONDO:0700092, FLVCR1-related",
                "Ataxia, posterior column, with retinitis pigmentosa, MIM#609033"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.576",
                "version_created": "2026-04-29T19:01:52.053429+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2208,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA1630",
                    "MGC3090",
                    "DKFZP762M115",
                    "CMT2Q"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:23537",
                "gene_name": "dehydrogenase E1 and transketolase domain containing 1",
                "omim_gene": [
                    "614984"
                ],
                "alias_name": null,
                "gene_symbol": "DHTKD1",
                "hgnc_symbol": "DHTKD1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "10:12110971-12165224",
                            "ensembl_id": "ENSG00000181192"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "10:12068972-12123225",
                            "ensembl_id": "ENSG00000181192"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-11-24"
            },
            "entity_type": "gene",
            "entity_name": "DHTKD1",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "23141294",
                "29661920",
                "28902413",
                "27604308",
                "23141293",
                "25860818"
            ],
            "evidence": [
                "Expert Review Amber",
                "Genomics England PanelApp"
            ],
            "phenotypes": [
                "2-aminoadipic 2-oxoadipic aciduria MIM#204750",
                "Disorders of histidine, tryptophan or lysine metabolism"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.576",
                "version_created": "2026-04-29T19:01:52.053429+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2208,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DKFZP586B0923",
                    "TTC20",
                    "KBP"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:23419",
                "gene_name": "KIF1 binding protein",
                "omim_gene": [
                    "609367"
                ],
                "alias_name": [
                    "kinesin binding protein"
                ],
                "gene_symbol": "KIF1BP",
                "hgnc_symbol": "KIF1BP",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "10:70748487-70776738",
                            "ensembl_id": "ENSG00000198954"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "10:68988721-69043544",
                            "ensembl_id": "ENSG00000198954"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2015-03-27"
            },
            "entity_type": "gene",
            "entity_name": "KIF1BP",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "23427148",
                "15883926"
            ],
            "evidence": [
                "Expert Review Green",
                "Genomics England PanelApp",
                "Expert list"
            ],
            "phenotypes": [
                "Goldberg-Shprintzen megacolon syndrome, MIM# 609460"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.576",
                "version_created": "2026-04-29T19:01:52.053429+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2208,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "NY-REN-58",
                    "NPHP18"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:17966",
                "gene_name": "centrosomal protein 83",
                "omim_gene": [
                    "615847"
                ],
                "alias_name": null,
                "gene_symbol": "CEP83",
                "hgnc_symbol": "CEP83",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:94700225-94853764",
                            "ensembl_id": "ENSG00000173588"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:94306449-94459988",
                            "ensembl_id": "ENSG00000173588"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2014-03-06"
            },
            "entity_type": "gene",
            "entity_name": "CEP83",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "24882706"
            ],
            "evidence": [
                "Expert Review Green",
                "Genomics England PanelApp",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Nephronophthisis 18, MIM# 615862",
                "MONDO:0014374",
                "Hydrocephalus",
                "ID"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.576",
                "version_created": "2026-04-29T19:01:52.053429+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2208,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ10719"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25568",
                "gene_name": "Fanconi anemia complementation group I",
                "omim_gene": [
                    "611360"
                ],
                "alias_name": null,
                "gene_symbol": "FANCI",
                "hgnc_symbol": "FANCI",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "15:89787180-89860492",
                            "ensembl_id": "ENSG00000140525"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "15:89243949-89317261",
                            "ensembl_id": "ENSG00000140525"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2007-05-03"
            },
            "entity_type": "gene",
            "entity_name": "FANCI",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "IBMDx Study",
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Fanconi anemia, complementation group I, MIM# 609053",
                "MONDO:0012186"
            ],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 3829,
                "hash_id": null,
                "name": "IBMDx study",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The inherited bone marrow diseases (IBMD) are a diverse group of diseases featuring single or multi-lineage cytopaenias and numerous potential associated manifestations including multi-organ syndromic features, a predisposition to haematological malignancy and/or a bleeding phenotype.\r\n\r\nThis panel is appropriate to be used for the following phenotypes of IBMD :\r\n-\tFanconi anaemia (excluding BRCA1, BRCA2,  BRIP1 due to their more common association with familial breast cancer risk than FA) \r\n-\tDiamond-Blackfan anaemia\r\n-\tDyskeratosis congenita / telomere biology disorders\r\n-\tShwachman-Diamond syndrome\r\n-\tSevere congenital neutropenia\r\n-\tThrombocytopenia-absent radius syndrome\r\n-\tCongenital amegakaryocytic thrombocytopenia\r\n-\tAdenosine deaminase deficiency\r\n-\tGATA2 deficiency syndrome\r\n-\tSAMD9 / SAMD9L related disorders \r\n-\tCongenital dyserythropoietic anaemia\r\n-\tCongenital sideroblastic anaemia\r\n-\tBernard-Soulier syndrome\r\n\r\nThis panel is being used in the IBMDx study (NCT05196789) – “Diagnosis, discovery and novel phenotype characterisation using multimodal genomics in patients with inherited bone marrow failure and related disorders”\r\n\r\nSome heritable diseases associated with cytopaenias and/or bleeding (for example thalassaemia/haemoglobinopathies and haemophilia) are not assessed with this panel.",
                "status": "public",
                "version": "0.42",
                "version_created": "2026-03-19T18:45:41.236506+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 101,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Research",
                        "slug": "research",
                        "description": "Research panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "GS3",
                    "DNAJA5",
                    "JJJ1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:27030",
                "gene_name": "DnaJ heat shock protein family (Hsp40) member C21",
                "omim_gene": [
                    "617048"
                ],
                "alias_name": [
                    "JJJ1 DnaJ domain protein homolog (S. cerevisiae)"
                ],
                "gene_symbol": "DNAJC21",
                "hgnc_symbol": "DNAJC21",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "5:34929698-34959069",
                            "ensembl_id": "ENSG00000168724"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "5:34929593-34958964",
                            "ensembl_id": "ENSG00000168724"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2007-11-19"
            },
            "entity_type": "gene",
            "entity_name": "DNAJC21",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "IBMDx Study",
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Bone marrow failure syndrome 3, MIM# 617052"
            ],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 3829,
                "hash_id": null,
                "name": "IBMDx study",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The inherited bone marrow diseases (IBMD) are a diverse group of diseases featuring single or multi-lineage cytopaenias and numerous potential associated manifestations including multi-organ syndromic features, a predisposition to haematological malignancy and/or a bleeding phenotype.\r\n\r\nThis panel is appropriate to be used for the following phenotypes of IBMD :\r\n-\tFanconi anaemia (excluding BRCA1, BRCA2,  BRIP1 due to their more common association with familial breast cancer risk than FA) \r\n-\tDiamond-Blackfan anaemia\r\n-\tDyskeratosis congenita / telomere biology disorders\r\n-\tShwachman-Diamond syndrome\r\n-\tSevere congenital neutropenia\r\n-\tThrombocytopenia-absent radius syndrome\r\n-\tCongenital amegakaryocytic thrombocytopenia\r\n-\tAdenosine deaminase deficiency\r\n-\tGATA2 deficiency syndrome\r\n-\tSAMD9 / SAMD9L related disorders \r\n-\tCongenital dyserythropoietic anaemia\r\n-\tCongenital sideroblastic anaemia\r\n-\tBernard-Soulier syndrome\r\n\r\nThis panel is being used in the IBMDx study (NCT05196789) – “Diagnosis, discovery and novel phenotype characterisation using multimodal genomics in patients with inherited bone marrow failure and related disorders”\r\n\r\nSome heritable diseases associated with cytopaenias and/or bleeding (for example thalassaemia/haemoglobinopathies and haemophilia) are not assessed with this panel.",
                "status": "public",
                "version": "0.42",
                "version_created": "2026-03-19T18:45:41.236506+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 101,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Research",
                        "slug": "research",
                        "description": "Research panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "TRAPD"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:11326",
                "gene_name": "signal sequence receptor subunit 4",
                "omim_gene": [
                    "300090"
                ],
                "alias_name": [
                    "translocon-associated protein delta"
                ],
                "gene_symbol": "SSR4",
                "hgnc_symbol": "SSR4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:153058971-153063960",
                            "ensembl_id": "ENSG00000180879"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:153793516-153798505",
                            "ensembl_id": "ENSG00000180879"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1997-11-04"
            },
            "entity_type": "gene",
            "entity_name": "SSR4",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "4218363",
                "26264460",
                "33300232",
                "38805916"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Congenital disorder of glycosylation, type Iy MIM#300934"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.17",
                "version_created": "2026-04-24T17:00:21.626497+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "C6ST",
                    "C6ST1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:1971",
                "gene_name": "carbohydrate sulfotransferase 3",
                "omim_gene": [
                    "603799"
                ],
                "alias_name": [
                    "chondroitin 6 sulfotransferase 1"
                ],
                "gene_symbol": "CHST3",
                "hgnc_symbol": "CHST3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "10:73724123-73773322",
                            "ensembl_id": "ENSG00000122863"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "10:71964365-72013564",
                            "ensembl_id": "ENSG00000122863"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-04-15"
            },
            "entity_type": "gene",
            "entity_name": "CHST3",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "18513679"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Spondyloepiphyseal dysplasia with congenital joint dislocations, 143095 (3)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.17",
                "version_created": "2026-04-24T17:00:21.626497+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "PRSMG1",
                    "GCPL1",
                    "OSGEP1",
                    "KAE1",
                    "TCS3"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:18028",
                "gene_name": "O-sialoglycoprotein endopeptidase",
                "omim_gene": [
                    "610107"
                ],
                "alias_name": null,
                "gene_symbol": "OSGEP",
                "hgnc_symbol": "OSGEP",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "14:20914570-20923264",
                            "ensembl_id": "ENSG00000092094"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "14:20446411-20455105",
                            "ensembl_id": "ENSG00000092094"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-01-23"
            },
            "entity_type": "gene",
            "entity_name": "OSGEP",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "28805828",
                "28272532"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Galloway-Mowat syndrome 3, MIM# 617729"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.17",
                "version_created": "2026-04-24T17:00:21.626497+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "SLIM1",
                    "KYO-T",
                    "bA535K18.1",
                    "FHL1B",
                    "XMPMA",
                    "FLH1A",
                    "MGC111107"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3702",
                "gene_name": "four and a half LIM domains 1",
                "omim_gene": [
                    "300163"
                ],
                "alias_name": [
                    "Four-and-a-half LIM domains 1",
                    "LIM protein SLIMMER"
                ],
                "gene_symbol": "FHL1",
                "hgnc_symbol": "FHL1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:135229559-135293518",
                            "ensembl_id": "ENSG00000022267"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:136146702-136211359",
                            "ensembl_id": "ENSG00000022267"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1997-08-28"
            },
            "entity_type": "gene",
            "entity_name": "FHL1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "19716112",
                "20186852",
                "20301609",
                "18179901",
                "25274776",
                "34366191",
                "18274675",
                "19181672",
                "21310615",
                "40017287"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Reducing body myopathy MONDO:0019948",
                "X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.17",
                "version_created": "2026-04-24T17:00:21.626497+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "IL1RA",
                    "ICIL-1RA",
                    "IL1F3",
                    "IRAP",
                    "IL-1RN",
                    "MGC10430"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6000",
                "gene_name": "interleukin 1 receptor antagonist",
                "omim_gene": [
                    "147679"
                ],
                "alias_name": [
                    "interleukin-1 receptor antagonist protein",
                    "intracellular interleukin-1 receptor antagonist"
                ],
                "gene_symbol": "IL1RN",
                "hgnc_symbol": "IL1RN",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:113864791-113891593",
                            "ensembl_id": "ENSG00000136689"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:113107214-113134016",
                            "ensembl_id": "ENSG00000136689"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1990-11-20"
            },
            "entity_type": "gene",
            "entity_name": "IL1RN",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Interleukin 1 receptor antagonist deficiency, MIM# 612852"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [
                "treatable",
                "immunological"
            ],
            "panel": {
                "id": 3931,
                "hash_id": null,
                "name": "Genomic newborn screening: BabyScreen+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)",
                "status": "public",
                "version": "1.148",
                "version_created": "2026-03-31T15:17:11.094244+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1723,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "BAFFR",
                    "CD268"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:17755",
                "gene_name": "TNF receptor superfamily member 13C",
                "omim_gene": [
                    "606269"
                ],
                "alias_name": null,
                "gene_symbol": "TNFRSF13C",
                "hgnc_symbol": "TNFRSF13C",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "22:42321045-42322822",
                            "ensembl_id": "ENSG00000159958"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "22:41922023-41926818",
                            "ensembl_id": "ENSG00000159958"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-05-22"
            },
            "entity_type": "gene",
            "entity_name": "TNFRSF13C",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID: 19666484, PMID: 27250108, PMID: 18025937"
            ],
            "evidence": [
                "Expert Review Red",
                "Expert list"
            ],
            "phenotypes": [
                "Immunodeficiency, common variable, 4\tMIM#613494"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3931,
                "hash_id": null,
                "name": "Genomic newborn screening: BabyScreen+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)",
                "status": "public",
                "version": "1.148",
                "version_created": "2026-03-31T15:17:11.094244+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1723,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "OATP8",
                    "OATP1B3"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10961",
                "gene_name": "solute carrier organic anion transporter family member 1B3",
                "omim_gene": [
                    "605495"
                ],
                "alias_name": null,
                "gene_symbol": "SLCO1B3",
                "hgnc_symbol": "SLCO1B3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:20963636-21243040",
                            "ensembl_id": "ENSG00000111700"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:20810702-20916911",
                            "ensembl_id": "ENSG00000111700"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-11-26"
            },
            "entity_type": "gene",
            "entity_name": "SLCO1B3",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "BabySeq Category C gene",
                "Expert Review Red"
            ],
            "phenotypes": [
                "Hyperbilirubinemia, Rotor type, digenic"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3931,
                "hash_id": null,
                "name": "Genomic newborn screening: BabyScreen+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)",
                "status": "public",
                "version": "1.148",
                "version_created": "2026-03-31T15:17:11.094244+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1723,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ36445",
                    "Nesprin-4",
                    "Nesp4"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:26703",
                "gene_name": "spectrin repeat containing nuclear envelope family member 4",
                "omim_gene": [
                    "615535"
                ],
                "alias_name": null,
                "gene_symbol": "SYNE4",
                "hgnc_symbol": "SYNE4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:36494209-36499695",
                            "ensembl_id": "ENSG00000181392"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:36003307-36008793",
                            "ensembl_id": "ENSG00000181392"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2012-05-31"
            },
            "entity_type": "gene",
            "entity_name": "SYNE4",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "BabySeq Category C gene",
                "Expert Review Red"
            ],
            "phenotypes": [
                "Hearing loss"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3931,
                "hash_id": null,
                "name": "Genomic newborn screening: BabyScreen+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)",
                "status": "public",
                "version": "1.148",
                "version_created": "2026-03-31T15:17:11.094244+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1723,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10896",
                "gene_name": "SKI proto-oncogene",
                "omim_gene": [
                    "164780"
                ],
                "alias_name": null,
                "gene_symbol": "SKI",
                "hgnc_symbol": "SKI",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:2160134-2241558",
                            "ensembl_id": "ENSG00000157933"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:2228695-2310119",
                            "ensembl_id": "ENSG00000157933"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "SKI",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Red",
                "BabySeq Category A gene"
            ],
            "phenotypes": [
                "Shprintzen-Goldberg syndrome, MIM#182212"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3931,
                "hash_id": null,
                "name": "Genomic newborn screening: BabyScreen+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)",
                "status": "public",
                "version": "1.148",
                "version_created": "2026-03-31T15:17:11.094244+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1723,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "CORDX1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10295",
                "gene_name": "retinitis pigmentosa GTPase regulator",
                "omim_gene": [
                    "312610"
                ],
                "alias_name": null,
                "gene_symbol": "RPGR",
                "hgnc_symbol": "RPGR",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:38128416-38186817",
                            "ensembl_id": "ENSG00000156313"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:38269163-38327564",
                            "ensembl_id": "ENSG00000156313"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-04-29"
            },
            "entity_type": "gene",
            "entity_name": "RPGR",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Red",
                "BabySeq Category A gene"
            ],
            "phenotypes": [
                "Retinitis pigmentosa, X-linked, and sinorespiratory infections, with or without deafness, MIM# 300455"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "tags": [],
            "panel": {
                "id": 3931,
                "hash_id": null,
                "name": "Genomic newborn screening: BabyScreen+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)",
                "status": "public",
                "version": "1.148",
                "version_created": "2026-03-31T15:17:11.094244+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1723,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:4214",
                "gene_name": "growth differentiation factor 1",
                "omim_gene": [
                    "602880"
                ],
                "alias_name": null,
                "gene_symbol": "GDF1",
                "hgnc_symbol": "GDF1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:18979361-19006905",
                            "ensembl_id": "ENSG00000130283"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:18868545-18896096",
                            "ensembl_id": "ENSG00000130283"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1997-09-12"
            },
            "entity_type": "gene",
            "entity_name": "GDF1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "32144877",
                "20413652",
                "28991257"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Right atrial isomerism (Ivemark), MIM #208530"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 4225,
                "hash_id": null,
                "name": "Prepair 500+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.1",
                "version_created": "2026-04-24T17:01:18.976102+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 629,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DRCTNNB1A",
                    "HCC",
                    "HYCC1",
                    "hyccin"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:24587",
                "gene_name": "family with sequence similarity 126 member A",
                "omim_gene": [
                    "610531"
                ],
                "alias_name": [
                    "down regulated by Ctnnb1, a"
                ],
                "gene_symbol": "FAM126A",
                "hgnc_symbol": "FAM126A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "7:22980878-23053749",
                            "ensembl_id": "ENSG00000122591"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "7:22889371-23014130",
                            "ensembl_id": "ENSG00000122591"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-09-06"
            },
            "entity_type": "gene",
            "entity_name": "FAM126A",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "16951682",
                "21911699",
                "23998934",
                "22749724"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Leukodystrophy, hypomyelinating, 5 MIM#610532"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 4225,
                "hash_id": null,
                "name": "Prepair 500+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.1",
                "version_created": "2026-04-24T17:01:18.976102+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 629,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "hCaf1z"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:15954",
                "gene_name": "target of EGR1, exonuclease",
                "omim_gene": [
                    "613931"
                ],
                "alias_name": null,
                "gene_symbol": "TOE1",
                "hgnc_symbol": "TOE1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:45805342-45809647",
                            "ensembl_id": "ENSG00000132773"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:45339670-45343975",
                            "ensembl_id": "ENSG00000132773"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-08-24"
            },
            "entity_type": "gene",
            "entity_name": "TOE1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "28092684",
                "36738896"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Pontocerebellar hypoplasia, type 7 MIM#614969"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 4225,
                "hash_id": null,
                "name": "Prepair 500+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.1",
                "version_created": "2026-04-24T17:01:18.976102+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 629,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "TUBL1",
                    "LCA15"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:12423",
                "gene_name": "tubby like protein 1",
                "omim_gene": [
                    "602280"
                ],
                "alias_name": null,
                "gene_symbol": "TULP1",
                "hgnc_symbol": "TULP1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:35465651-35480715",
                            "ensembl_id": "ENSG00000112041"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:35497874-35512938",
                            "ensembl_id": "ENSG00000112041"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-01-06"
            },
            "entity_type": "gene",
            "entity_name": "TULP1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "15024725",
                "17962469",
                "17620573",
                "27440997"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Leber congenital amaurosis 15, MIM#613843",
                "Retinitis pigmentosa 14, MIM#600132"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 4225,
                "hash_id": null,
                "name": "Prepair 500+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.1",
                "version_created": "2026-04-24T17:01:18.976102+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 629,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA0683",
                    "hCLK2",
                    "TEL2"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29099",
                "gene_name": "telomere maintenance 2",
                "omim_gene": [
                    "611140"
                ],
                "alias_name": null,
                "gene_symbol": "TELO2",
                "hgnc_symbol": "TELO2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "16:1543345-1560458",
                            "ensembl_id": "ENSG00000100726"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "16:1493344-1510457",
                            "ensembl_id": "ENSG00000100726"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-09-25"
            },
            "entity_type": "gene",
            "entity_name": "TELO2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "You-Hoover-Fong syndrome, MIM#616954"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 4225,
                "hash_id": null,
                "name": "Prepair 500+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.1",
                "version_created": "2026-04-24T17:01:18.976102+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 629,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7432",
                "gene_name": "methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1",
                "omim_gene": [
                    "172460"
                ],
                "alias_name": null,
                "gene_symbol": "MTHFD1",
                "hgnc_symbol": "MTHFD1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "14:64854749-64926722",
                            "ensembl_id": "ENSG00000100714"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "14:64388031-64463457",
                            "ensembl_id": "ENSG00000100714"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-07-23"
            },
            "entity_type": "gene",
            "entity_name": "MTHFD1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "32414565",
                "19033438"
            ],
            "evidence": [
                "Expert Review Green"
            ],
            "phenotypes": [
                "Combined immunodeficiency and megaloblastic anemia with or without hyperhomocysteinemia MONDO:0060611",
                "Disorders of folate metabolism"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 4257,
                "hash_id": null,
                "name": "Vitamin metabolism disorders",
                "disease_group": "Metabolic disorders",
                "disease_sub_group": "",
                "description": "The gene panel contains genes that cause inborn errors of vitamin metabolism.\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.",
                "status": "public",
                "version": "1.7",
                "version_created": "2024-09-18T09:35:00.495806+10:00",
                "relevant_disorders": [
                    "Abnormality of vitamin metabolism",
                    "HP:0100508"
                ],
                "stats": {
                    "number_of_genes": 62,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "CD230",
                    "PRP",
                    "AltPrP"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:9449",
                "gene_name": "prion protein",
                "omim_gene": [
                    "176640"
                ],
                "alias_name": [
                    "Creutzfeldt-Jakob disease",
                    "Gerstmann-Strausler-Scheinker syndrome",
                    "fatal familial insomnia",
                    "p27-30"
                ],
                "gene_symbol": "PRNP",
                "hgnc_symbol": "PRNP",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "20:4666882-4682236",
                            "ensembl_id": "ENSG00000171867"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "20:4686236-4701590",
                            "ensembl_id": "ENSG00000171867"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1986-01-01"
            },
            "entity_type": "str",
            "entity_name": "PRNP_CJD_octapeptide",
            "confidence_level": "3",
            "penetrance": null,
            "publications": [
                "2159587",
                "20301407"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Creutzfeldt-Jakob disease MIM#123400",
                "Gerstmann-Straussler disease MIM#137440"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT",
            "chromosome": "20",
            "grch37_coordinates": [
                4680026,
                4680073
            ],
            "grch38_coordinates": [
                4699380,
                4699427
            ],
            "normal_repeats": 4,
            "pathogenic_repeats": 5,
            "tags": [],
            "panel": {
                "id": 26,
                "hash_id": null,
                "name": "Early-onset Parkinson disease",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.",
                "status": "public",
                "version": "2.55",
                "version_created": "2026-04-17T16:01:21.596122+10:00",
                "relevant_disorders": [
                    "Abnormality of extrapyramidal motor function",
                    "HP:0002071"
                ],
                "stats": {
                    "number_of_genes": 129,
                    "number_of_strs": 14,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            }
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:5102",
                "gene_name": "homeobox A13",
                "omim_gene": [
                    "142959"
                ],
                "alias_name": null,
                "gene_symbol": "HOXA13",
                "hgnc_symbol": "HOXA13",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "7:27233122-27239725",
                            "ensembl_id": "ENSG00000106031"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "7:27193503-27200106",
                            "ensembl_id": "ENSG00000106031"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1990-07-05"
            },
            "entity_type": "str",
            "entity_name": "HOXA13_HFGS_GCN3",
            "confidence_level": "3",
            "penetrance": null,
            "publications": [
                "10839976",
                "12073020",
                "33811808"
            ],
            "evidence": [
                "Expert list",
                "Expert Review Green",
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Hand-foot-uterus syndrome MIM#140000"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "repeated_sequence": "GCN",
            "chromosome": "7",
            "grch37_coordinates": [
                27239298,
                27239351
            ],
            "grch38_coordinates": [
                27199679,
                27199732
            ],
            "normal_repeats": 18,
            "pathogenic_repeats": 24,
            "tags": [
                "paediatric-onset"
            ],
            "panel": {
                "id": 163,
                "hash_id": null,
                "name": "Radial Ray Abnormalities",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Radial Dysplasia' panel and all differences have been resolved, with reciprocal feedback provided to Genomics England.",
                "status": "public",
                "version": "1.22",
                "version_created": "2026-04-22T15:49:55.738465+10:00",
                "relevant_disorders": [
                    "Abnormality of radial ray",
                    "HP:0410049"
                ],
                "stats": {
                    "number_of_genes": 62,
                    "number_of_strs": 1,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            }
        },
        {
            "gene_data": {
                "alias": [
                    "HRIHFB2206",
                    "CTG-B45d",
                    "CTG-B43a"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:23194",
                "gene_name": "THAP domain containing 11",
                "omim_gene": [
                    "609119"
                ],
                "alias_name": null,
                "gene_symbol": "THAP11",
                "hgnc_symbol": "THAP11",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "16:67876213-67878097",
                            "ensembl_id": "ENSG00000168286"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "16:67842082-67844195",
                            "ensembl_id": "ENSG00000168286"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-10-08"
            },
            "entity_type": "str",
            "entity_name": "THAP11_SCA51_CAG",
            "confidence_level": "2",
            "penetrance": null,
            "publications": [
                "15368101",
                "24677642",
                "34165550",
                "38113319",
                "40459937",
                "39651830",
                "37148549"
            ],
            "evidence": [
                "Expert Review Amber",
                "Other"
            ],
            "phenotypes": [
                "Spinocerebellar ataxia 51 MONDO:0975800"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "repeated_sequence": "CAG",
            "chromosome": "16",
            "grch37_coordinates": [
                67876766,
                67876853
            ],
            "grch38_coordinates": [
                67842863,
                67842950
            ],
            "normal_repeats": 39,
            "pathogenic_repeats": 47,
            "tags": [],
            "panel": {
                "id": 3597,
                "hash_id": null,
                "name": "Repeat Disorders",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.",
                "status": "public",
                "version": "0.272",
                "version_created": "2026-01-02T15:16:39.779953+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 0,
                    "number_of_strs": 76,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    }
                ],
                "child_panel_ids": []
            }
        }
    ]
}