Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=136
{ "count": 36124, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=137", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=135", "results": [ { "gene_data": { "alias": [ "KIAA1093" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29190", "gene_name": "trinucleotide repeat containing 6B", "omim_gene": [ "610740" ], "alias_name": null, "gene_symbol": "TNRC6B", "hgnc_symbol": "TNRC6B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:40440821-40731812", "ensembl_id": "ENSG00000100354" } }, "GRch38": { "90": { "location": "22:40044817-40335808", "ensembl_id": "ENSG00000100354" } } }, "hgnc_date_symbol_changed": "2004-12-17" }, "entity_type": "gene", "entity_name": "TNRC6B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32152250", "28135719", "25363768", "27479843", "28959963", "25228304" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Global developmental delay with speech and behavioural abnormalities, MIM# 619243" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 51, "hash_id": null, "name": "Autism", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.250", "version_created": "2026-04-29T19:13:12.780175+10:00", "relevant_disorders": [ "Autism", "HP:0000717" ], "stats": { "number_of_genes": 158, "number_of_strs": 0, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RBBP2H1A", "PLU-1", "CT31", "PPP1R98" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18039", "gene_name": "lysine demethylase 5B", "omim_gene": [ "605393" ], "alias_name": [ "cancer/testis antigen 31", "protein phosphatase 1, regulatory subunit 98" ], "gene_symbol": "KDM5B", "hgnc_symbol": "KDM5B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:202696526-202778598", "ensembl_id": "ENSG00000117139" } }, "GRch38": { "90": { "location": "1:202724491-202809470", "ensembl_id": "ENSG00000117139" } } }, "hgnc_date_symbol_changed": "2009-04-06" }, "entity_type": "gene", "entity_name": "KDM5B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29276005", "30217758", "30409806" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Neurodevelopmental disorder (MONDO#0700092), KDM5B-related, autosomal dominant", "Intellectual developmental disorder, autosomal recessive 65 (MIM#618109)" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 51, "hash_id": null, "name": "Autism", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.250", "version_created": "2026-04-29T19:13:12.780175+10:00", "relevant_disorders": [ "Autism", "HP:0000717" ], "stats": { "number_of_genes": 158, "number_of_strs": 0, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7108", "gene_name": "McKusick-Kaufman syndrome", "omim_gene": [ "604896" ], "alias_name": null, "gene_symbol": "MKKS", "hgnc_symbol": "MKKS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:10381657-10414870", "ensembl_id": "ENSG00000125863" } }, "GRch38": { "90": { "location": "20:10401009-10434222", "ensembl_id": "ENSG00000125863" } } }, "hgnc_date_symbol_changed": "1998-09-08" }, "entity_type": "gene", "entity_name": "MKKS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10973251" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bardet-Biedl syndrome 6 (MIM#605231)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 53, "hash_id": null, "name": "Bardet Biedl syndrome", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and is a consensus panel used by RMH.\r\n\r\nBardet Biedl syndrome is a multisystem ciliopathy characterised by a combination of obesity, pigmentary retinopathy, post-axial polydactyly, polycystic kidneys, hypogenitalism, and learning disabilities.\r\n\r\nMany ciliopathies present with overlapping features, please refer to the Ciliopathy panel if broader spectrum of conditions are being considered.", "status": "public", "version": "1.14", "version_created": "2025-05-21T20:50:29.131780+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 27, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC34275", "MGC125904", "MGC125905" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3007", "gene_name": "dolichyl-phosphate mannosyltransferase subunit 3", "omim_gene": [ "605951" ], "alias_name": [ "DPM synthase complex subunit" ], "gene_symbol": "DPM3", "hgnc_symbol": "DPM3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:155112367-155113071", "ensembl_id": "ENSG00000179085" } }, "GRch38": { "90": { "location": "1:155139891-155140595", "ensembl_id": "ENSG00000179085" } } }, "hgnc_date_symbol_changed": "2000-06-29" }, "entity_type": "gene", "entity_name": "DPM3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31266720", "28803818", "19576565", "31266720", "31469168" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 , MIM#612937", "Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 68, "hash_id": null, "name": "Congenital Disorders of Glycosylation", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Congenital Disorders of Glycosylation' panel v2.4 with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.88", "version_created": "2026-04-29T19:07:54.905474+10:00", "relevant_disorders": [ "Abnormal transferrin saturation", "HP:0040135" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ATPIB", "ML-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13533", "gene_name": "ATPase phospholipid transporting 8A2", "omim_gene": [ "605870" ], "alias_name": null, "gene_symbol": "ATP8A2", "hgnc_symbol": "ATP8A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:25946209-26599989", "ensembl_id": "ENSG00000132932" } }, "GRch38": { "90": { "location": "13:25372071-26025851", "ensembl_id": "ENSG00000132932" } } }, "hgnc_date_symbol_changed": "2000-09-25" }, "entity_type": "gene", "entity_name": "ATP8A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35321980", "30542205", "34077496" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Cerebellar ataxia, impaired intellectual development, and dysequilibrium syndrome, MIM#615268" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 73, "hash_id": null, "name": "Cerebral Palsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Cerebral palsy (CP) is a non-progressive neurodevelopmental disorder characterized by motor impairments, often accompanied by intellectual disability, epilepsy, visual and hearing impairment and speech and language deficits.\r\n\r\nPMID 33528536 reported a cohort of 1345 individuals undergoing genomic testing. Diagnostic yield ranged between 10-30% depending on presence of additional characteristics such as ID/epilepsy/ASD.\r\n\r\nThe aetiology of cerebral palsy is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia, Ataxia, Malformations of Cortical Development, Mitochondrial Disorders and the Bleeding and Platelet Disorders panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Jozef Gecz, Clare van Eyk, Luisa Weiss and team for their contribution to the development of this panel.", "status": "public", "version": "1.412", "version_created": "2026-04-29T13:55:13.542887+10:00", "relevant_disorders": [ "Cerebral palsy HP:0100021" ], "stats": { "number_of_genes": 364, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RFLAT-1", "BTEB3", "NSLP1", "FKLF-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13672", "gene_name": "Kruppel like factor 13", "omim_gene": [ "605328" ], "alias_name": null, "gene_symbol": "KLF13", "hgnc_symbol": "KLF13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:31619058-31727868", "ensembl_id": "ENSG00000169926" } }, "GRch38": { "90": { "location": "15:31326855-31435665", "ensembl_id": "ENSG00000169926" } } }, "hgnc_date_symbol_changed": "2000-09-28" }, "entity_type": "gene", "entity_name": "KLF13", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 32293321", "35369534", "33215447" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Congenital heart disease MONDO:0005453 - KLF13-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.540", "version_created": "2026-04-29T17:20:21.794068+10:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 254, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SUFUH", "SUFUXL", "PRO1280" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16466", "gene_name": "SUFU negative regulator of hedgehog signaling", "omim_gene": [ "607035" ], "alias_name": null, "gene_symbol": "SUFU", "hgnc_symbol": "SUFU", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:104263744-104393292", "ensembl_id": "ENSG00000107882" } }, "GRch38": { "90": { "location": "10:102503987-102633535", "ensembl_id": "ENSG00000107882" } } }, "hgnc_date_symbol_changed": "2001-08-28" }, "entity_type": "gene", "entity_name": "SUFU", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28965847", "33024317", "34675124" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Joubert syndrome 32, MIM#617757", "Neurodevelopmental disorder, MONDO:0700092, SUFU-related" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 84, "hash_id": null, "name": "Ciliopathies", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was created by merging the Ciliopathy panels created by VCGS and RMH and is a consensus panel used by both.\r\n\r\nIt covers conditions caused by mutations in the genes encoding non-motile cilia components as well as a small number of conditions that can present as phenocopies.\r\n\r\nPlease note a number of smaller panels are available that cover specific ciliopathy phenotypes such as Bardet-Biedl syndrome, Jeune syndrome and Joubert syndrome.\r\n\r\nPlease refer to the Ciliary Dyskinesia panel for conditions caused by mutations in genes encoding components of the motile cilia, which present with predominantly respiratory phenotypes.", "status": "public", "version": "1.99", "version_created": "2026-02-26T20:47:06.255758+11:00", "relevant_disorders": [ "Ciliopathy", "MONDO:0005308" ], "stats": { "number_of_genes": 158, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:14357", "gene_name": "matrix metallopeptidase 21", "omim_gene": [ "608416" ], "alias_name": null, "gene_symbol": "MMP21", "hgnc_symbol": "MMP21", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:127455022-127464390", "ensembl_id": "ENSG00000154485" } }, "GRch38": { "90": { "location": "10:125766453-125775821", "ensembl_id": "ENSG00000154485" } } }, "hgnc_date_symbol_changed": "2001-01-25" }, "entity_type": "gene", "entity_name": "MMP21", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26429889", "26437028", "26437029" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Heterotaxy, visceral, 7, autosomal,MIM# 616749" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 108, "hash_id": null, "name": "Heterotaxy", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Laterality disorders and isomerism' panel V1.19, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.45", "version_created": "2026-03-17T16:09:39.911604+11:00", "relevant_disorders": [ "Heterotaxy", "HP:0030853; Dextrocardia", "HP:0001651; Asplenia", "HP:0001746; Abnormal spatial orientation of cardiac segments", "HP:0011534; Polysplenia", "HP:0001748;Midline liver", "HP:0034188" ], "stats": { "number_of_genes": 67, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0699" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17208", "gene_name": "BICD cargo adaptor 2", "omim_gene": [ "609797" ], "alias_name": null, "gene_symbol": "BICD2", "hgnc_symbol": "BICD2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:95473645-95527094", "ensembl_id": "ENSG00000185963" } }, "GRch38": { "90": { "location": "9:92711363-92764812", "ensembl_id": "ENSG00000185963" } } }, "hgnc_date_symbol_changed": "2003-11-14" }, "entity_type": "gene", "entity_name": "BICD2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "37173812" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Spinal muscular atrophy, lower extremity-predominant 2B, prenatal-onset (MIM#609797)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 116, "hash_id": null, "name": "Hydrops fetalis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared with the Genomics England 100K Genomes Fetal Hydrops panel. All discrepancies have been resolved by George McGillivray and Zornitza Stark (30/12/2019), with reciprocal reviews provided to Genomics England PanelApp.", "status": "public", "version": "0.328", "version_created": "2025-07-08T23:27:02.854141+10:00", "relevant_disorders": [ "Hydrops fetalis", "HP:0001789" ], "stats": { "number_of_genes": 169, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:1967", "gene_name": "cholinergic receptor nicotinic gamma subunit", "omim_gene": [ "100730" ], "alias_name": [ "acetylcholine receptor, nicotinic, gamma (muscle)" ], "gene_symbol": "CHRNG", "hgnc_symbol": "CHRNG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:233404437-233411113", "ensembl_id": "ENSG00000196811" } }, "GRch38": { "90": { "location": "2:232539727-232546403", "ensembl_id": "ENSG00000196811" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "CHRNG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Multiple pterygium syndrome, lethal type, MIM# 253290" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 116, "hash_id": null, "name": "Hydrops fetalis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared with the Genomics England 100K Genomes Fetal Hydrops panel. All discrepancies have been resolved by George McGillivray and Zornitza Stark (30/12/2019), with reciprocal reviews provided to Genomics England PanelApp.", "status": "public", "version": "0.328", "version_created": "2025-07-08T23:27:02.854141+10:00", "relevant_disorders": [ "Hydrops fetalis", "HP:0001789" ], "stats": { "number_of_genes": 169, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7897", "gene_name": "NPC intracellular cholesterol transporter 1", "omim_gene": [ "607623" ], "alias_name": null, "gene_symbol": "NPC1", "hgnc_symbol": "NPC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:21086148-21166862", "ensembl_id": "ENSG00000141458" } }, "GRch38": { "90": { "location": "18:23506184-23586898", "ensembl_id": "ENSG00000141458" } } }, "hgnc_date_symbol_changed": "1993-04-13" }, "entity_type": "gene", "entity_name": "NPC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 126, "hash_id": null, "name": "Incidentalome", "disease_group": "", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with adult-onset cardiac, cancer and neurodegenerative disorders.\r\n\r\nThese genes are excluded from the Mendeliome panel to enable the use of the Mendeliome for panel-agnostic analysis in complex paediatric cases, while minimising the chance of incidental findings related to adult-onset conditions.\r\n\r\nIf analysis of these genes is required, the relevant panel should be requested (e.g. Adult Additional Findings; Neurodegenerative Disease_Adult Onset; Breast Cancer etc).", "status": "public", "version": "0.433", "version_created": "2026-03-25T17:03:27.624542+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 161, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PPI5PIV", "CORS1", "pharbin" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21474", "gene_name": "inositol polyphosphate-5-phosphatase E", "omim_gene": [ "613037" ], "alias_name": null, "gene_symbol": "INPP5E", "hgnc_symbol": "INPP5E", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:139323071-139334274", "ensembl_id": "ENSG00000148384" } }, "GRch38": { "90": { "location": "9:136428619-136439823", "ensembl_id": "ENSG00000148384" } } }, "hgnc_date_symbol_changed": "2003-06-13" }, "entity_type": "gene", "entity_name": "INPP5E", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19668216", "32139166", "29230161", "29052317", "27998989", "27401686" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Joubert syndrome 1, MIM# 213300", "MONDO:0008944" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 129, "hash_id": null, "name": "Joubert syndrome and other neurological ciliopathies", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It contains genes associated with Joubert syndrome, Meckel Gruber syndrome and other ciliopathies where structural CNS abnormalities are prominent.\r\n\r\nPlease consider also applying the Cerebellar and Pontocerebellar Hypoplasia panel in the presence of more non-specific cerebellar abnormalities and applying the Ciliopathy panel in the presence of additional clinical features suggestive of a multi-system ciliopathy.", "status": "public", "version": "1.33", "version_created": "2025-12-16T12:55:34.757878+11:00", "relevant_disorders": [ "Molar tooth sign on MRI", "HP:0002419; Joubert syndrome", "MONDO:0018772" ], "stats": { "number_of_genes": 69, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC14833", "bA6B20.2", "M19", "Cbp6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21237", "gene_name": "ubiquinol-cytochrome c reductase complex assembly factor 2", "omim_gene": [ "614461" ], "alias_name": [ "cytochrome B protein synthesis 6 homolog (S. cerevisiae)" ], "gene_symbol": "UQCC2", "hgnc_symbol": "UQCC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:33662070-33679504", "ensembl_id": "ENSG00000137288" } }, "GRch38": { "90": { "location": "6:33694293-33711727", "ensembl_id": "ENSG00000137288" } } }, "hgnc_date_symbol_changed": "2013-09-20" }, "entity_type": "gene", "entity_name": "UQCC2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24385928", "28804536" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Mitochondrial complex III deficiency, nuclear type 7 - MIM#615824" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Hcam3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8776", "gene_name": "phosphodiesterase 1C", "omim_gene": [ "602987" ], "alias_name": null, "gene_symbol": "PDE1C", "hgnc_symbol": "PDE1C", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:31790793-32338941", "ensembl_id": "ENSG00000154678" } }, "GRch38": { "90": { "location": "7:31751179-32299329", "ensembl_id": "ENSG00000154678" } } }, "hgnc_date_symbol_changed": "1994-07-29" }, "entity_type": "gene", "entity_name": "PDE1C", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29860631" ], "evidence": [ "Literature" ], "phenotypes": [ "autosomal dominant nonsyndromic hearing loss MONDO:0019587" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CD229", "mLY9", "SLAMF3", "hly9" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6730", "gene_name": "lymphocyte antigen 9", "omim_gene": [ "600684" ], "alias_name": null, "gene_symbol": "LY9", "hgnc_symbol": "LY9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:160765864-160798051", "ensembl_id": "ENSG00000122224" } }, "GRch38": { "90": { "location": "1:160796074-160828261", "ensembl_id": "ENSG00000122224" } } }, "hgnc_date_symbol_changed": "1998-06-05" }, "entity_type": "gene", "entity_name": "LY9", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40446017" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Inborn error of immunity, MONDO:0003778, LY9-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11200", "gene_name": "SRY-box 4", "omim_gene": [ "184430" ], "alias_name": null, "gene_symbol": "SOX4", "hgnc_symbol": "SOX4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:21593972-21598847", "ensembl_id": "ENSG00000124766" } }, "GRch38": { "90": { "location": "6:21592768-21598619", "ensembl_id": "ENSG00000124766" } } }, "hgnc_date_symbol_changed": "1993-11-30" }, "entity_type": "gene", "entity_name": "SOX4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30661772" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Coffin-Siris syndrome 10", "OMIM #618506" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "NYD-SP28", "FLJ35732", "FAP250", "CFAP250", "CILD27", "DRC2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29937", "gene_name": "coiled-coil domain containing 65", "omim_gene": [ "611088" ], "alias_name": null, "gene_symbol": "CCDC65", "hgnc_symbol": "CCDC65", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:49297893-49325623", "ensembl_id": "ENSG00000139537" } }, "GRch38": { "90": { "location": "12:48904110-48931840", "ensembl_id": "ENSG00000139537" } } }, "hgnc_date_symbol_changed": "2006-01-26" }, "entity_type": "gene", "entity_name": "CCDC65", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23991085", "24094744" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Ciliary dyskinesia, primary, 27, MIM# 615504" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "founder" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ32949", "SPATA34" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19414", "gene_name": "dpy-19 like 2", "omim_gene": [ "613893" ], "alias_name": [ "spermatogenesis associated 34" ], "gene_symbol": "DPY19L2", "hgnc_symbol": "DPY19L2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:63952693-64062719", "ensembl_id": "ENSG00000177990" } }, "GRch38": { "90": { "location": "12:63558913-63668939", "ensembl_id": "ENSG00000177990" } } }, "hgnc_date_symbol_changed": "2005-07-19" }, "entity_type": "gene", "entity_name": "DPY19L2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21397063", "22653751", "33108537" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Spermatogenic failure 9 - MIM#613958" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FBH", "FBH2", "FHH2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4379", "gene_name": "G protein subunit alpha 11", "omim_gene": [ "139313" ], "alias_name": null, "gene_symbol": "GNA11", "hgnc_symbol": "GNA11", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:3094408-3124002", "ensembl_id": "ENSG00000088256" } }, "GRch38": { "90": { "location": "19:3094410-3124004", "ensembl_id": "ENSG00000088256" } } }, "hgnc_date_symbol_changed": "1992-07-20" }, "entity_type": "gene", "entity_name": "GNA11", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "23802536", "23802516", "24823460", "26818911", "27334330" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hypocalcemia, autosomal dominant 2 MIM#615361", "Hypocalciuric hypercalcemia, type II MIM#145981" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1208", "MGC4170" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29670", "gene_name": "N-acetylglucosamine-1-phosphate transferase alpha and beta subunits", "omim_gene": [ "607840" ], "alias_name": null, "gene_symbol": "GNPTAB", "hgnc_symbol": "GNPTAB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:102139275-102224716", "ensembl_id": "ENSG00000111670" } }, "GRch38": { "90": { "location": "12:101745497-101830938", "ensembl_id": "ENSG00000111670" } } }, "hgnc_date_symbol_changed": "2005-09-11" }, "entity_type": "gene", "entity_name": "GNPTAB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20301728", "16465621" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "GNPTAB-mucolipidosis MONDO:0100122", "Mucolipidosis II alpha/beta, MIM# 252500", "Mucolipidosis III alpha/beta, MIM# 252600" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "OPHN4", "TIGIRR-2", "IL1R8" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5996", "gene_name": "interleukin 1 receptor accessory protein like 1", "omim_gene": [ "300206" ], "alias_name": null, "gene_symbol": "IL1RAPL1", "hgnc_symbol": "IL1RAPL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:28605516-29974840", "ensembl_id": "ENSG00000169306" } }, "GRch38": { "90": { "location": "X:28587399-29956723", "ensembl_id": "ENSG00000169306" } } }, "hgnc_date_symbol_changed": "1999-09-07" }, "entity_type": "gene", "entity_name": "IL1RAPL1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "34452636", "27470653", "21484992", "18801879", "18801879" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Intellectual developmental disorder, X-linked 21 MIM#300143" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:9944", "gene_name": "radixin", "omim_gene": [ "179410" ], "alias_name": null, "gene_symbol": "RDX", "hgnc_symbol": "RDX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:110045605-110167447", "ensembl_id": "ENSG00000137710" } }, "GRch38": { "90": { "location": "11:110174880-110296722", "ensembl_id": "ENSG00000137710" } } }, "hgnc_date_symbol_changed": "1992-12-08" }, "entity_type": "gene", "entity_name": "RDX", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17226784", "19215054", "22567349", "26226137", "15314067" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Deafness, autosomal recessive 24, MIM# 611022" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ZIBRA", "FLJ10111", "FLJ23501", "HOIP", "Paul" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16031", "gene_name": "ring finger protein 31", "omim_gene": [ "612487" ], "alias_name": [ "HOIL-1-interacting protein" ], "gene_symbol": "RNF31", "hgnc_symbol": "RNF31", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:24615892-24629870", "ensembl_id": "ENSG00000092098" } }, "GRch38": { "90": { "location": "14:24146683-24160661", "ensembl_id": "ENSG00000092098" } } }, "hgnc_date_symbol_changed": "2003-09-29" }, "entity_type": "gene", "entity_name": "RNF31", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26008899", "30936877", "39009172", "41026334" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Immunodeficiency 115 with autoinflammation, MIM# 620632" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DTDST" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10994", "gene_name": "solute carrier family 26 member 2", "omim_gene": [ "606718" ], "alias_name": null, "gene_symbol": "SLC26A2", "hgnc_symbol": "SLC26A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:149340300-149373018", "ensembl_id": "ENSG00000155850" } }, "GRch38": { "90": { "location": "5:149960737-149993455", "ensembl_id": "ENSG00000155850" } } }, "hgnc_date_symbol_changed": "1990-09-10" }, "entity_type": "gene", "entity_name": "SLC26A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20301483", "20301689", "11241838", "31880411" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Achondrogenesis 1B, MIM#600972", "Atelosteogenesis, type II, MIM#256050", "Diastrophic dysplasia, MIM#222600", "Epiphyseal dysplasia, multiple, 4, MIM#226900" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1910" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20297", "gene_name": "SLIT and NTRK like family member 1", "omim_gene": [ "609678" ], "alias_name": null, "gene_symbol": "SLITRK1", "hgnc_symbol": "SLITRK1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:84451344-84456528", "ensembl_id": "ENSG00000178235" } }, "GRch38": { "90": { "location": "13:83877205-83882393", "ensembl_id": "ENSG00000178235" } } }, "hgnc_date_symbol_changed": "2004-01-08" }, "entity_type": "gene", "entity_name": "SLITRK1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17304708", "35140465", "26317387" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Tourette syndrome, MIM# 137580" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "disputed" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Beta2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20771", "gene_name": "tubulin beta 4B class IVb", "omim_gene": [ "602660" ], "alias_name": [ "class IVb beta-tubulin" ], "gene_symbol": "TUBB4B", "hgnc_symbol": "TUBB4B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:140135665-140138159", "ensembl_id": "ENSG00000188229" } }, "GRch38": { "90": { "location": "9:137241213-137243707", "ensembl_id": "ENSG00000188229" } } }, "hgnc_date_symbol_changed": "2011-10-10" }, "entity_type": "gene", "entity_name": "TUBB4B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29198720", "35240325" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Leber congenital amaurosis with early onset deafness, LCAEOD, OMIM #617879", "MONDO:0060650", "Primary ciliary dyskinesia, MONDO:0016575, TUBB4B-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TR", "TRXR2", "TR3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18155", "gene_name": "thioredoxin reductase 2", "omim_gene": [ "606448" ], "alias_name": [ "thioredoxin reductase beta", "selenoprotein Z" ], "gene_symbol": "TXNRD2", "hgnc_symbol": "TXNRD2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:19863040-19929341", "ensembl_id": "ENSG00000184470" } }, "GRch38": { "90": { "location": "22:19875517-19941992", "ensembl_id": "ENSG00000184470" } } }, "hgnc_date_symbol_changed": "2002-02-22" }, "entity_type": "gene", "entity_name": "TXNRD2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24601690", "21247928", "34258490" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Glucocorticoid deficiency 5 (GCCD5), MIM#617825", "MONDO:0040502" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CARK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19661", "gene_name": "TNNI3 interacting kinase", "omim_gene": [ "613932" ], "alias_name": null, "gene_symbol": "TNNI3K", "hgnc_symbol": "TNNI3K", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:74663947-75010112", "ensembl_id": "ENSG00000116783" } }, "GRch38": { "90": { "location": "1:74235401-74544428", "ensembl_id": "ENSG00000116783" } } }, "hgnc_date_symbol_changed": "2004-01-19" }, "entity_type": "gene", "entity_name": "TNNI3K", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30010057", "29355681" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Cardiac conduction disease with or without dilated cardiomyopathy, MIM#\t616117" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "IFPS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:33276", "gene_name": "filaggrin family member 2", "omim_gene": [ "616284" ], "alias_name": null, "gene_symbol": "FLG2", "hgnc_symbol": "FLG2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:152321211-152332482", "ensembl_id": "ENSG00000143520" } }, "GRch38": { "90": { "location": "1:152348735-152360006", "ensembl_id": "ENSG00000143520" } } }, "hgnc_date_symbol_changed": "2007-08-21" }, "entity_type": "gene", "entity_name": "FLG2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29758285", "28884927", "29505760" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Peeling skin syndrome 6, MIM#\t618084" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4851", "version_created": "2026-04-30T15:45:56.907744+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6024, "number_of_strs": 43, "number_of_regions": 9 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ILRS", "IARS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5330", "gene_name": "isoleucyl-tRNA synthetase", "omim_gene": [ "600709" ], "alias_name": [ "isoleucine tRNA ligase 1, cytoplasmic" ], "gene_symbol": "IARS", "hgnc_symbol": "IARS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:94972489-95056038", "ensembl_id": "ENSG00000196305" } }, "GRch38": { "90": { "location": "9:92210207-92293756", "ensembl_id": "ENSG00000196305" } } }, "hgnc_date_symbol_changed": "1995-07-11" }, "entity_type": "gene", "entity_name": "IARS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "27426735", "27891590" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Growth retardation, impaired intellectual development, hypotonia, and hepatopathy, MIM#\t617093" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "new gene name" ], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.434", "version_created": "2026-04-30T15:02:27.868954+10:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 384, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "hNRD1", "hNRD2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7995", "gene_name": "nardilysin convertase", "omim_gene": [ "602651" ], "alias_name": [ "N-arginine dibasic convertase" ], "gene_symbol": "NRDC", "hgnc_symbol": "NRDC", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:52254863-52344477", "ensembl_id": "ENSG00000078618" } }, "GRch38": { "90": { "location": "1:51789191-51878937", "ensembl_id": "ENSG00000078618" } } }, "hgnc_date_symbol_changed": "2015-11-11" }, "entity_type": "gene", "entity_name": "NRDC", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "41449824", "28017472", "34582790", "19935654", "41734767", "41449824" ], "evidence": [ "Expert Review Green", "Literature", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, NRDC-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.434", "version_created": "2026-04-30T15:02:27.868954+10:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 384, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "EIEE2", "CFAP247" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11411", "gene_name": "cyclin dependent kinase like 5", "omim_gene": [ "300203" ], "alias_name": null, "gene_symbol": "CDKL5", "hgnc_symbol": "CDKL5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:18443703-18671749", "ensembl_id": "ENSG00000008086" } }, "GRch38": { "90": { "location": "X:18425583-18653629", "ensembl_id": "ENSG00000008086" } } }, "hgnc_date_symbol_changed": "2002-11-29" }, "entity_type": "gene", "entity_name": "CDKL5", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15689447", "19396824", "22678952", "31122804", "30928302" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Epileptic encephalopathy, early infantile, 2 (MIM#300672)" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.434", "version_created": "2026-04-30T15:02:27.868954+10:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 384, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "C2-PI3K", "PI3K-C2beta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8972", "gene_name": "phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta", "omim_gene": [ "602838" ], "alias_name": null, "gene_symbol": "PIK3C2B", "hgnc_symbol": "PIK3C2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:204391756-204463852", "ensembl_id": "ENSG00000133056" } }, "GRch38": { "90": { "location": "1:204422628-204494724", "ensembl_id": "ENSG00000133056" } } }, "hgnc_date_symbol_changed": "1998-05-21" }, "entity_type": "gene", "entity_name": "PIK3C2B", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 35786744" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "familial partial epilepsy - MONDO#0017704" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.414", "version_created": "2026-04-29T19:08:58.015652+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1157, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MARLIN1", "JAMIP1", "Gababrbp", "FLJ31564" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26460", "gene_name": "janus kinase and microtubule interacting protein 1", "omim_gene": [ "611195" ], "alias_name": null, "gene_symbol": "JAKMIP1", "hgnc_symbol": "JAKMIP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:6027926-6202318", "ensembl_id": "ENSG00000152969" } }, "GRch38": { "90": { "location": "4:6026199-6200591", "ensembl_id": "ENSG00000152969" } } }, "hgnc_date_symbol_changed": "2006-02-23" }, "entity_type": "gene", "entity_name": "JAKMIP1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29158550", "26627310", "27799067" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder (MONDO#0700092), JAKMIP1-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.414", "version_created": "2026-04-29T19:08:58.015652+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1157, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:13478", "gene_name": "ubiquitin protein ligase E3B", "omim_gene": [ "608047" ], "alias_name": null, "gene_symbol": "UBE3B", "hgnc_symbol": "UBE3B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:109915207-109974507", "ensembl_id": "ENSG00000151148" } }, "GRch38": { "90": { "location": "12:109477402-109536705", "ensembl_id": "ENSG00000151148" } } }, "hgnc_date_symbol_changed": "2004-03-02" }, "entity_type": "gene", "entity_name": "UBE3B", "confidence_level": "3", "penetrance": "Complete", "mode_of_pathogenicity": null, "publications": [ "32949109" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Kaufman oculocerebrofacial syndrome, MIM# 244450", "Blepharophimosis", "intellectual disability" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "PSST", "FLJ46880", "FLJ45860", "CI-20" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7714", "gene_name": "NADH:ubiquinone oxidoreductase core subunit S7", "omim_gene": [ "601825" ], "alias_name": [ "complex I 20kDa subunit", "NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial" ], "gene_symbol": "NDUFS7", "hgnc_symbol": "NDUFS7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:1383526-1395583", "ensembl_id": "ENSG00000115286" } }, "GRch38": { "90": { "location": "19:1383527-1395589", "ensembl_id": "ENSG00000115286" } } }, "hgnc_date_symbol_changed": "1996-07-26" }, "entity_type": "gene", "entity_name": "NDUFS7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "VATB", "Vma2", "HO57" ], "biotype": "protein_coding", "hgnc_id": "HGNC:854", "gene_name": "ATPase H+ transporting V1 subunit B2", "omim_gene": [ "606939" ], "alias_name": null, "gene_symbol": "ATP6V1B2", "hgnc_symbol": "ATP6V1B2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:20054878-20084330", "ensembl_id": "ENSG00000147416" } }, "GRch38": { "90": { "location": "8:20197367-20226819", "ensembl_id": "ENSG00000147416" } } }, "hgnc_date_symbol_changed": "2002-05-10" }, "entity_type": "gene", "entity_name": "ATP6V1B2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 24913193", "28396750", "34746137", "32873933", "25915598" ], "evidence": [ "Expert list", "Expert Review Green" ], "phenotypes": [ "Zimmermann-Laband syndrome 2, MIM# 616455", "Deafness, congenital, with onychodystrophy, autosomal dominant, MIM# 124480", "Epileptic encephalopathy" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "REL-B" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9956", "gene_name": "RELB proto-oncogene, NF-kB subunit", "omim_gene": [ "604758" ], "alias_name": null, "gene_symbol": "RELB", "hgnc_symbol": "RELB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:45504688-45541452", "ensembl_id": "ENSG00000104856" } }, "GRch38": { "90": { "location": "19:45001430-45038198", "ensembl_id": "ENSG00000104856" } } }, "hgnc_date_symbol_changed": "1995-10-02" }, "entity_type": "gene", "entity_name": "RELB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "7834753", "26385063", "39231201", "36402602" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Immunodeficiency 53, MIM#\t617585", "T cells: normal number, poor diversity, poor function", "recurrent infections" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 223, "hash_id": null, "name": "Combined Immunodeficiency", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause combined immunodeficiencies with associated or syndromic features, including genes classified by the International Union of Immunological Societies Inborn Errors of Immunity Committee (July 2024 update). These include genes that fall into the following subcategories:\r\n- Immunodeficiency with Congenital Thrombocytopenia\r\n- DNA Repair Defects\r\n- Thymic Defects with Additional Congenital Anomalies\r\n- Immuno-osseous Dysplasias\r\n- Hyper IgE Syndromes (HIES)\r\n- Defects of Vitamin B12 and Folate Metabolism\r\n- Anhidrotic Ectodermodysplasia with Immunodeficiency (EDA-ID)\r\n- Calcium Channel Defects\r\n- Other Combined immunodeficiencies with syndromic features\r\n- Combined Immunodeficiencies Generally Less Profound than Severe Combined Immunodeficiency (Immunodeficiencies affecting cellular and humoral immunity)\r\n\r\nThis panel was originally developed by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital) for the Melbourne Genomics Immunology Flagship.", "status": "public", "version": "1.147", "version_created": "2026-04-28T14:29:47.878410+10:00", "relevant_disorders": [ "Combined immunodeficiency", "MONDO:0015131; Combined immunodeficiency", "HP:0005387" ], "stats": { "number_of_genes": 170, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7562", "gene_name": "myeloid differentiation primary response 88", "omim_gene": [ "602170" ], "alias_name": null, "gene_symbol": "MYD88", "hgnc_symbol": "MYD88", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:38179969-38184513", "ensembl_id": "ENSG00000172936" } }, "GRch38": { "90": { "location": "3:38138478-38143022", "ensembl_id": "ENSG00000172936" } } }, "hgnc_date_symbol_changed": "1997-12-23" }, "entity_type": "gene", "entity_name": "MYD88", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18669862", "20538326", "31301515" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Immunodeficiency 68, MIM# 612260" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 231, "hash_id": null, "name": "Defects of intrinsic and innate immunity", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause defects in intrinsic and innate immunity, including the following:\r\n- Mendelian susceptibility to mycobacterial disease (MSMD)\r\n- Epidermodysplasia verruciformis (HPV)\r\n- Predisposition to severe viral infection\r\n- Herpes simplex encephalitis (HSE)\r\n- Predisposition to mucocutaneous candidiasis\r\n- Other inborn errors of immunity related to non-haematopoietic tissues\r\n- Other inborn errors of immunity related to leukocytes\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.39", "version_created": "2026-04-15T16:26:05.053680+10:00", "relevant_disorders": [ "Unusual infections", "HP:0032101" ], "stats": { "number_of_genes": 86, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD283" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11849", "gene_name": "toll like receptor 3", "omim_gene": [ "603029" ], "alias_name": null, "gene_symbol": "TLR3", "hgnc_symbol": "TLR3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:186990306-187009223", "ensembl_id": "ENSG00000164342" } }, "GRch38": { "90": { "location": "4:186069152-186088069", "ensembl_id": "ENSG00000164342" } } }, "hgnc_date_symbol_changed": "1998-06-25" }, "entity_type": "gene", "entity_name": "TLR3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17872438", "25339207" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "{Immunodeficiency 83, susceptibility to viral infections}, MIM# 613002" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 237, "hash_id": null, "name": "Susceptibility to Viral Infections", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital). It is currently maintained by VCGS.\r\n\r\nUpdated with the 2019 International Union of Immunological Societies Committee classification, Tangye et al. 2019 and the COVID Human Genetic Effort list, Casanova et al 2020.", "status": "public", "version": "1.10", "version_created": "2026-03-26T15:17:02.053015+11:00", "relevant_disorders": [ "Recurrent viral infections", "HP:0004429; Severe viral infection", "HP:0031691" ], "stats": { "number_of_genes": 54, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "hHR54", "hRAD54", "RAD54A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9826", "gene_name": "RAD54 like", "omim_gene": [ "603615" ], "alias_name": null, "gene_symbol": "RAD54L", "hgnc_symbol": "RAD54L", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:46713360-46744145", "ensembl_id": "ENSG00000085999" } }, "GRch38": { "90": { "location": "1:46247688-46278473", "ensembl_id": "ENSG00000085999" } } }, "hgnc_date_symbol_changed": "1998-11-04" }, "entity_type": "gene", "entity_name": "RAD54L", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "PMID: 16912188" ], "evidence": [ "Literature", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [ "umccr" ], "panel": { "id": 242, "hash_id": null, "name": "Homologous_recombination_deficiency_WTS_UMCCR", "disease_group": "Cancer", "disease_sub_group": "", "description": "Author: Jacek Marzec, jacek.marzec@unimelb.edu.au\r\n\r\nPurpose: panel of genes involved in homologous recombination DNA damage repair (HR-DDR) deficiency in various cancer types. This set of genes is used in UMCCR WTS report \"HRD genes\" section\r\n\r\nSource: -\r\n\r\nGithub: https://github.com/umccr/RNAsum", "status": "public", "version": "0.45", "version_created": "2025-11-03T15:31:09.278966+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 36, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "hRad50", "RAD50-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9816", "gene_name": "RAD50 double strand break repair protein", "omim_gene": [ "604040" ], "alias_name": null, "gene_symbol": "RAD50", "hgnc_symbol": "RAD50", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:131891711-131980313", "ensembl_id": "ENSG00000113522" } }, "GRch38": { "90": { "location": "5:132556019-132646344", "ensembl_id": "ENSG00000113522" } } }, "hgnc_date_symbol_changed": "1999-07-23" }, "entity_type": "gene", "entity_name": "RAD50", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "PMID: 30234181" ], "evidence": [ "Literature", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [ "umccr" ], "panel": { "id": 242, "hash_id": null, "name": "Homologous_recombination_deficiency_WTS_UMCCR", "disease_group": "Cancer", "disease_sub_group": "", "description": "Author: Jacek Marzec, jacek.marzec@unimelb.edu.au\r\n\r\nPurpose: panel of genes involved in homologous recombination DNA damage repair (HR-DDR) deficiency in various cancer types. This set of genes is used in UMCCR WTS report \"HRD genes\" section\r\n\r\nSource: -\r\n\r\nGithub: https://github.com/umccr/RNAsum", "status": "public", "version": "0.45", "version_created": "2025-11-03T15:31:09.278966+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 36, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC1346", "SF3b14b", "INI", "bK223H9.2", "Rds3", "SAP14b", "SF3B7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18000", "gene_name": "PHD finger protein 5A", "omim_gene": null, "alias_name": [ "splicing factor 3b, subunit 7" ], "gene_symbol": "PHF5A", "hgnc_symbol": "PHF5A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:41855721-41864729", "ensembl_id": "ENSG00000100410" } }, "GRch38": { "90": { "location": "22:41459717-41468725", "ensembl_id": "ENSG00000100410" } } }, "hgnc_date_symbol_changed": "2002-11-29" }, "entity_type": "gene", "entity_name": "PHF5A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 37422718" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Neurodevelopmental disorder (MONDO#0700092), PHF5A-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.780", "version_created": "2026-04-30T15:03:16.542762+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2529, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0578", "Hs.22998" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8008", "gene_name": "neurexin 1", "omim_gene": [ "600565" ], "alias_name": null, "gene_symbol": "NRXN1", "hgnc_symbol": "NRXN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:50145643-51259674", "ensembl_id": "ENSG00000179915" } }, "GRch38": { "90": { "location": "2:49918505-51225575", "ensembl_id": "ENSG00000179915" } } }, "hgnc_date_symbol_changed": "1998-10-14" }, "entity_type": "gene", "entity_name": "NRXN1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25486015", "19896112", "21964664", "30873608", "35101781", "22337556", "22670139" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Pitt-Hopkins-like syndrome 2 - MIM#614325" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.780", "version_created": "2026-04-30T15:03:16.542762+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2529, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:14244", "gene_name": "RAB18, member RAS oncogene family", "omim_gene": [ "602207" ], "alias_name": null, "gene_symbol": "RAB18", "hgnc_symbol": "RAB18", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:27793197-27831143", "ensembl_id": "ENSG00000099246" } }, "GRch38": { "90": { "location": "10:27504174-27542237", "ensembl_id": "ENSG00000099246" } } }, "hgnc_date_symbol_changed": "2000-12-12" }, "entity_type": "gene", "entity_name": "RAB18", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11237903", "23420520" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Warburg micro syndrome 3, MIM# 614222" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "founder" ], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.780", "version_created": "2026-04-30T15:03:16.542762+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2529, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RIBB", "ROC1", "MGC125864", "MGC125865" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10023", "gene_name": "Ras like without CAAX 1", "omim_gene": [ "609591" ], "alias_name": [ "Ric-like, expressed in many tissues", "GTP-binding protein Roc1" ], "gene_symbol": "RIT1", "hgnc_symbol": "RIT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:155867599-155881195", "ensembl_id": "ENSG00000143622" } }, "GRch38": { "90": { "location": "1:155897808-155911404", "ensembl_id": "ENSG00000143622" } } }, "hgnc_date_symbol_changed": "2002-09-13" }, "entity_type": "gene", "entity_name": "RIT1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments", "publications": [ "23791108", "25124994", "24939608", "27101134" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Noonan syndrome 8, MIM# 615355" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.780", "version_created": "2026-04-30T15:03:16.542762+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2529, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "M-SemaK", "KIAA0331", "coll-5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10727", "gene_name": "semaphorin 3E", "omim_gene": [ "608166" ], "alias_name": [ "M-sema H" ], "gene_symbol": "SEMA3E", "hgnc_symbol": "SEMA3E", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:82993222-83278326", "ensembl_id": "ENSG00000170381" } }, "GRch38": { "90": { "location": "7:83363906-83649010", "ensembl_id": "ENSG00000170381" } } }, "hgnc_date_symbol_changed": "1999-06-25" }, "entity_type": "gene", "entity_name": "SEMA3E", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15235037", "31691538", "31464029" ], "evidence": [ "Expert Review Amber", "Genetic Health Queensland" ], "phenotypes": [ "CHARGE syndrome, MIM#214800" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.780", "version_created": "2026-04-30T15:03:16.542762+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2529, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC12981", "FLJ30131", "ccp1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28178", "gene_name": "coiled-coil domain containing 115", "omim_gene": [ "613734" ], "alias_name": null, "gene_symbol": "CCDC115", "hgnc_symbol": "CCDC115", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:131095814-131099922", "ensembl_id": "ENSG00000136710" } }, "GRch38": { "90": { "location": "2:130338241-130342349", "ensembl_id": "ENSG00000136710" } } }, "hgnc_date_symbol_changed": "2006-07-03" }, "entity_type": "gene", "entity_name": "CCDC115", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Congenital disorder of glycosylation, type IIo MIM# 616828" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.780", "version_created": "2026-04-30T15:03:16.542762+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2529, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ10546", "KIAA1585", "msl-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25544", "gene_name": "MSL complex subunit 2", "omim_gene": [ "614802" ], "alias_name": [ "male-specific lethal-2 homolog (Drosophila)" ], "gene_symbol": "MSL2", "hgnc_symbol": "MSL2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:135867764-135916083", "ensembl_id": "ENSG00000174579" } }, "GRch38": { "90": { "location": "3:136148922-136197241", "ensembl_id": "ENSG00000174579" } } }, "hgnc_date_symbol_changed": "2008-10-29" }, "entity_type": "gene", "entity_name": "MSL2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31332282", "33057194" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Karayol-Borroto-Haghshenas neurodevelopmental syndrome, MIM# 620985" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.780", "version_created": "2026-04-30T15:03:16.542762+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2529, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:8777", "gene_name": "phosphodiesterase 2A", "omim_gene": [ "602658" ], "alias_name": null, "gene_symbol": "PDE2A", "hgnc_symbol": "PDE2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:72287185-72385635", "ensembl_id": "ENSG00000186642" } }, "GRch38": { "90": { "location": "11:72576141-72674591", "ensembl_id": "ENSG00000186642" } } }, "hgnc_date_symbol_changed": "1997-11-10" }, "entity_type": "gene", "entity_name": "PDE2A", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32467598", "32196122", "29392776" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Paroxysmal dyskinesia", "Intellectual developmental disorder with paroxysmal dyskinesia or seizures, MIM# 619150" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.780", "version_created": "2026-04-30T15:03:16.542762+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2529, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "EFO2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:27230", "gene_name": "establishment of sister chromatid cohesion N-acetyltransferase 2", "omim_gene": [ "609353" ], "alias_name": null, "gene_symbol": "ESCO2", "hgnc_symbol": "ESCO2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:27629466-27670157", "ensembl_id": "ENSG00000171320" } }, "GRch38": { "90": { "location": "8:27771949-27812640", "ensembl_id": "ENSG00000171320" } } }, "hgnc_date_symbol_changed": "2005-01-04" }, "entity_type": "gene", "entity_name": "ESCO2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "NHS GMS", "Victorian Clinical Genetics Services" ], "phenotypes": [ "SC phocomelia syndrome 269000", "Roberts syndrome 268300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.444", "version_created": "2026-04-30T17:18:26.299482+10:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 639, "number_of_strs": 4, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RES4-23", "CRBM" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10825", "gene_name": "SH3 domain binding protein 2", "omim_gene": [ "602104" ], "alias_name": null, "gene_symbol": "SH3BP2", "hgnc_symbol": "SH3BP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:2794750-2842825", "ensembl_id": "ENSG00000087266" } }, "GRch38": { "90": { "location": "4:2793023-2841098", "ensembl_id": "ENSG00000087266" } } }, "hgnc_date_symbol_changed": "1996-08-01" }, "entity_type": "gene", "entity_name": "SH3BP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments", "publications": [ "11381256", "22640988", "20301316", "22153076" ], "evidence": [ "Expert Review Green", "Illumina TruGenome Clinical Sequencing Services", "UKGTN", "Radboud University Medical Center, Nijmegen", "NHS GMS", "Expert list" ], "phenotypes": [ "Cherubism 118400" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.444", "version_created": "2026-04-30T17:18:26.299482+10:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 639, "number_of_strs": 4, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2084", "gene_name": "caseinolytic mitochondrial matrix peptidase proteolytic subunit", "omim_gene": [ "601119" ], "alias_name": [ "ATP-dependent protease ClpAP (E. coli), proteolytic subunit, human" ], "gene_symbol": "CLPP", "hgnc_symbol": "CLPP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:6361463-6368919", "ensembl_id": "ENSG00000125656" } }, "GRch38": { "90": { "location": "19:6361452-6368908", "ensembl_id": "ENSG00000125656" } } }, "hgnc_date_symbol_changed": "1999-09-20" }, "entity_type": "gene", "entity_name": "CLPP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25254289" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Perrault syndrome 3, MIM# 614129" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLVCR", "MFSD7B", "PCA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24682", "gene_name": "feline leukemia virus subgroup C cellular receptor 1", "omim_gene": [ "609144" ], "alias_name": null, "gene_symbol": "FLVCR1", "hgnc_symbol": "FLVCR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:213031597-213072705", "ensembl_id": "ENSG00000162769" } }, "GRch38": { "90": { "location": "1:212858255-212899363", "ensembl_id": "ENSG00000162769" } } }, "hgnc_date_symbol_changed": "2007-05-01" }, "entity_type": "gene", "entity_name": "FLVCR1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Ataxia, posterior column, with retinitis pigmentosa MIM#609033" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:31923", "gene_name": "LCA5, lebercilin", "omim_gene": [ "611408" ], "alias_name": null, "gene_symbol": "LCA5", "hgnc_symbol": "LCA5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:80194708-80247175", "ensembl_id": "ENSG00000135338" } }, "GRch38": { "90": { "location": "6:79484991-79537458", "ensembl_id": "ENSG00000135338" } } }, "hgnc_date_symbol_changed": "2005-02-23" }, "entity_type": "gene", "entity_name": "LCA5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Leber congenital amaurosis 5, 604537" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 277, "hash_id": null, "name": "Retinitis pigmentosa", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause nonsyndromic retinitis pigmentosa and Leber congenital amaurosis. \r\nNote: Exome sequencing may not be a suitable technique for detecting pathogenic variants in RPGR due to regions of low coverage.\r\n\r\nPlease consider the Syndromic Retinopathy and the Retinal Disorders Superpanel when additional features are present.", "status": "public", "version": "0.246", "version_created": "2026-04-24T16:58:06.901564+10:00", "relevant_disorders": [ "Abnormal retinal morphology", "HP:0000479" ], "stats": { "number_of_genes": 159, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PiT-2", "Glvr-2", "Ram-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10947", "gene_name": "solute carrier family 20 member 2", "omim_gene": [ "158378" ], "alias_name": null, "gene_symbol": "SLC20A2", "hgnc_symbol": "SLC20A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:42273993-42397069", "ensembl_id": "ENSG00000168575" } }, "GRch38": { "90": { "location": "8:42416475-42541926", "ensembl_id": "ENSG00000168575" } } }, "hgnc_date_symbol_changed": "1993-06-18" }, "entity_type": "gene", "entity_name": "SLC20A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22327515", "23334463", "24411498" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Basal ganglia calcification, idiopathic, 1 213600", "Dystonia" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.346", "version_created": "2026-04-29T13:58:21.830729+10:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CGI-18", "ASC1p50", "Em:AC022392.3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24268", "gene_name": "activating signal cointegrator 1 complex subunit 1", "omim_gene": [ "614215" ], "alias_name": null, "gene_symbol": "ASCC1", "hgnc_symbol": "ASCC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:73856278-73976892", "ensembl_id": "ENSG00000138303" } }, "GRch38": { "90": { "location": "10:72096032-72217134", "ensembl_id": "ENSG00000138303" } } }, "hgnc_date_symbol_changed": "2004-03-17" }, "entity_type": "gene", "entity_name": "ASCC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26924529" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Spinal muscular atrophy with congenital bone fractures 2" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:12591", "gene_name": "uroporphyrinogen decarboxylase", "omim_gene": [ "613521" ], "alias_name": null, "gene_symbol": "UROD", "hgnc_symbol": "UROD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:45477819-45481247", "ensembl_id": "ENSG00000126088" } }, "GRch38": { "90": { "location": "1:45012147-45015575", "ensembl_id": "ENSG00000126088" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "UROD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9792863" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Porphyria cutanea tarda (Porphyrias with erosive photodermatosis)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3077, "hash_id": null, "name": "Haem degradation and bilirubin metabolism defects", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause disorders of tetrapyrroles, including porphyria and disorders of bilirubin metabolism and biliary transport. \r\n\r\nThis panel is part of the Metabolic Disorders Superpanl. It was developed and maintained by RMH, and is a consensus panel used by VCGS.", "status": "public", "version": "0.20", "version_created": "2026-02-22T15:38:52.606788+11:00", "relevant_disorders": [ "Porphyria", "MONDO:0037939;Abnormal circulating porphyrin concentration", "HP:0010472;Hyperbilirubinemia", "HP:0002904" ], "stats": { "number_of_genes": 25, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ11856", "PAR1", "GPCR41", "D15Ertd747e", "RFVT2", "hRFT3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30224", "gene_name": "solute carrier family 52 member 2", "omim_gene": [ "607882" ], "alias_name": null, "gene_symbol": "SLC52A2", "hgnc_symbol": "SLC52A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:145577795-145584932", "ensembl_id": "ENSG00000185803" } }, "GRch38": { "90": { "location": "8:144354135-144361272", "ensembl_id": "ENSG00000185803" } } }, "hgnc_date_symbol_changed": "2012-02-29" }, "entity_type": "gene", "entity_name": "SLC52A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29193829", "31868069", "29053833", "26072523" ], "evidence": [ "Expert Review Green", "Expert list", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Brown-Vialetto-van Laere syndrome 2 MONDO:0013867" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3084, "hash_id": null, "name": "Rhabdomyolysis and Metabolic Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where rhabdomyolysis, exercise intolerance, and metabolic myopathy are a presenting or prominent feature. It was developed and maintained by the Royal Melbourne Hospital. It is a consensus panel used by VCGS.\r\n\r\nDepending on the clinical features present, consider applying additional panels such as Mitochondrial Disorders or the Myopathy Superpanel.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Rhabdomyolysis and metabolic muscle disorders' panel V1.42 on 8/10/2020, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.46", "version_created": "2026-03-31T19:05:14.301918+11:00", "relevant_disorders": [ "Rhabdomyolysis", "HP:0003201;Exercise intolerance", "HP:0003546;Metabolic myopathy", "MONDO:0020123" ], "stats": { "number_of_genes": 124, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CASIL" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7883", "gene_name": "notch 3", "omim_gene": [ "600276" ], "alias_name": null, "gene_symbol": "NOTCH3", "hgnc_symbol": "NOTCH3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:15270444-15311792", "ensembl_id": "ENSG00000074181" } }, "GRch38": { "90": { "location": "19:15159038-15200981", "ensembl_id": "ENSG00000074181" } } }, "hgnc_date_symbol_changed": "1994-07-04" }, "entity_type": "gene", "entity_name": "NOTCH3", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "19855400", "31868216", "24936512", "33712516" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Pulmonary arterial hypertension MONDO:0015924, NOTCH3-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [ "disputed" ], "panel": { "id": 3095, "hash_id": null, "name": "Pulmonary Arterial Hypertension", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel is maintained by the Royal Melbourne Hospital. It is a consensus panel used by VCGS.\r\n\r\nThe content of this panel has been compared against the Genomics England 'Pulmonary Arterial Hypertension' panel, with all discrepancies resolved and reciprocal feedback provided to Genomics England, 27/07/2020.\r\n\r\nThe content of this panel has been aligned with curations by the ClinGen PAH GCEP, PMID 37422716, 07/08/2023.", "status": "public", "version": "1.57", "version_created": "2026-04-07T13:46:27.864798+10:00", "relevant_disorders": [ "Pulmonary arterial hypertension", "HP:0002092" ], "stats": { "number_of_genes": 37, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "IKAP", "TOT1", "IKI3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5959", "gene_name": "elongator complex protein 1", "omim_gene": [ "603722" ], "alias_name": [ "elongator acetyltransferase complex subunit 1" ], "gene_symbol": "ELP1", "hgnc_symbol": "ELP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:111629797-111696396", "ensembl_id": "ENSG00000070061" } }, "GRch38": { "90": { "location": "9:108867517-108934116", "ensembl_id": "ENSG00000070061" } } }, "hgnc_date_symbol_changed": "2017-05-04" }, "entity_type": "gene", "entity_name": "ELP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17985250", "11179021", "11179008", "8102296" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Familial dysautonomia", "NEUROPATHY, HEREDITARY SENSORY AND AUTONOMIC, TYPE III", "Dysautonomia, familial, 223900" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3126, "hash_id": null, "name": "Pain syndromes", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Mendelian disorders of pain perception, including insensitivity to pain or increased pain perception, with thanks to Genomics England PanelApp.", "status": "public", "version": "0.38", "version_created": "2026-02-22T15:47:27.675595+11:00", "relevant_disorders": [ "Pain", "HP:0012531" ], "stats": { "number_of_genes": 31, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:9071", "gene_name": "plasminogen", "omim_gene": [ "173350" ], "alias_name": null, "gene_symbol": "PLG", "hgnc_symbol": "PLG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:161123270-161174347", "ensembl_id": "ENSG00000122194" } }, "GRch38": { "90": { "location": "6:160702238-160753315", "ensembl_id": "ENSG00000122194" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "PLG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Plasminogen deficiency, type I, 217090 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1374" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29262", "gene_name": "intraflagellar transport 80", "omim_gene": [ "611177" ], "alias_name": null, "gene_symbol": "IFT80", "hgnc_symbol": "IFT80", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:159974774-160117668", "ensembl_id": "ENSG00000068885" } }, "GRch38": { "90": { "location": "3:160256986-160399880", "ensembl_id": "ENSG00000068885" } } }, "hgnc_date_symbol_changed": "2005-11-02" }, "entity_type": "gene", "entity_name": "IFT80", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Short-rib thoracic dysplasia 2 with or without polydactyly, 611263 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ABC-C", "EST111653", "LBM180" ], "biotype": "protein_coding", "hgnc_id": "HGNC:33", "gene_name": "ATP binding cassette subfamily A member 3", "omim_gene": [ "601615" ], "alias_name": null, "gene_symbol": "ABCA3", "hgnc_symbol": "ABCA3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:2325882-2390747", "ensembl_id": "ENSG00000167972" } }, "GRch38": { "90": { "location": "16:2275881-2340746", "ensembl_id": "ENSG00000167972" } } }, "hgnc_date_symbol_changed": "1996-08-08" }, "entity_type": "gene", "entity_name": "ABCA3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Surfactant metabolism dysfunction, pulmonary, 3, 610921 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TBPIP", "GT198", "HUMGT198A", "Hop2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17928", "gene_name": "PSMC3 interacting protein", "omim_gene": [ "608665" ], "alias_name": [ "TBP-1 interacting protein" ], "gene_symbol": "PSMC3IP", "hgnc_symbol": "PSMC3IP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:40724333-40729849", "ensembl_id": "ENSG00000131470" } }, "GRch38": { "90": { "location": "17:42572315-42577831", "ensembl_id": "ENSG00000131470" } } }, "hgnc_date_symbol_changed": "2006-02-27" }, "entity_type": "gene", "entity_name": "PSMC3IP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21963259", "35352317", "34878148", "30406445", "29240891" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Ovarian dysgenesis 3, MIM# 614324" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3166, "hash_id": null, "name": "Primary Ovarian Insufficiency_Premature Ovarian Failure", "disease_group": "Endocrine disorders", "disease_sub_group": "Gonadal and sex development disorders", "description": "This panel contains genes that cause non-syndromic and syndromic amenorrhoea, and ovarian insufficiency/failure. It was developed by RMH and Genetic Health QLD. It is a consensus panel used by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Primary ovarian insufficiency' panel V1.69, with all discrepancies reviewed and resolved (October 2025). \r\n\r\nWith early onset premature ovarian insufficiency, the following should be considered:\r\n• X chromosome abnormality such as Turner syndrome\r\n• Presence of FMR1 premutation\r\n• Iatrogenic cause (bilateral oophorectomy, chemotherapy, radiotherapy or any other iatrogenic cause)\r\n• Presence of thyroid or adrenal auto-antibodies\r\n\r\nTesting for fragile X premutation and chromosome abnormalities are strongly recommended prior to genomic testing.\r\n\r\nThis panel should be used for individuals with raised FSH. If FSH is low, the Hypogonadotropic hypogonadism panel should be used.\r\n\r\nPlease also consider the Differences of Sex Development panel where appropriate depending on clinical features.", "status": "public", "version": "0.414", "version_created": "2026-04-13T17:24:24.650771+10:00", "relevant_disorders": [ "Premature ovarian insufficiency", "HP:0008209" ], "stats": { "number_of_genes": 164, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TIE2", "TIE-2", "VMCM1", "CD202b" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11724", "gene_name": "TEK receptor tyrosine kinase", "omim_gene": [ "600221" ], "alias_name": null, "gene_symbol": "TEK", "hgnc_symbol": "TEK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:27109139-27230173", "ensembl_id": "ENSG00000120156" } }, "GRch38": { "90": { "location": "9:27109141-27230175", "ensembl_id": "ENSG00000120156" } } }, "hgnc_date_symbol_changed": "1994-05-24" }, "entity_type": "gene", "entity_name": "TEK", "confidence_level": "3", "penetrance": "unknown", "mode_of_pathogenicity": "Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments", "publications": [ "27519652" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Venous malformations, multiple cutaneous and mucosal (600195)", "Blue rubber bleb naevus syndrome", "Sporadic multifocal vascular malformations" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3181, "hash_id": null, "name": "Vascular Malformations_Somatic", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel contains genes that cause vascular malformations as a result of somatic mutations and is suitable for use when affected tissue is being tested.\r\n\r\nIf a germline disorder is suspected, please use the Vascular Malformations_Germline panel.", "status": "public", "version": "1.16", "version_created": "2025-10-02T12:54:21.549968+10:00", "relevant_disorders": [ "Abnormal vascular morphology HP:0025015" ], "stats": { "number_of_genes": 25, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DAX1", "AHCH" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7960", "gene_name": "nuclear receptor subfamily 0 group B member 1", "omim_gene": [ "300473" ], "alias_name": null, "gene_symbol": "NR0B1", "hgnc_symbol": "NR0B1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:30322323-30327715", "ensembl_id": "ENSG00000169297" } }, "GRch38": { "90": { "location": "X:30304206-30309598", "ensembl_id": "ENSG00000169297" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "NR0B1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19508677", "26030781" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Adrenal hypoplasia, congenital (MIM# 300200)" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [ "SV/CNV" ], "panel": { "id": 3236, "hash_id": null, "name": "Pituitary hormone deficiency", "disease_group": "Endocrine disorders", "disease_sub_group": "Pituitary disorders", "description": "This panel contains genes associated with pituitary hormone deficiency. \r\nIncludes isolated hormone deficiency, combined hormone deficiencies, and panhypopituitarism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Pituitary hormone deficiency' panel V4.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.226", "version_created": "2026-04-23T15:35:12.037215+10:00", "relevant_disorders": [ "Hypopituitarism", "HP:0040075" ], "stats": { "number_of_genes": 128, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Atoh5", "Math4B", "ngn3", "bHLHa7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13806", "gene_name": "neurogenin 3", "omim_gene": [ "604882" ], "alias_name": null, "gene_symbol": "NEUROG3", "hgnc_symbol": "NEUROG3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:71331454-71332994", "ensembl_id": "ENSG00000122859" } }, "GRch38": { "90": { "location": "10:69571698-69573238", "ensembl_id": "ENSG00000122859" } } }, "hgnc_date_symbol_changed": "2000-11-28" }, "entity_type": "gene", "entity_name": "NEUROG3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16855267", "32574610", "28724572", "21490072" ], "evidence": [ "Expert Review Green", "BabySeq Category C gene" ], "phenotypes": [ "Diarrhoea 4, malabsorptive, congenital, MIM# 610370" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CLC1", "ClC-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2019", "gene_name": "chloride voltage-gated channel 1", "omim_gene": [ "118425" ], "alias_name": [ "Thomsen disease, autosomal dominant" ], "gene_symbol": "CLCN1", "hgnc_symbol": "CLCN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:143013219-143049176", "ensembl_id": "ENSG00000188037" } }, "GRch38": { "90": { "location": "7:143316126-143352083", "ensembl_id": "ENSG00000188037" } } }, "hgnc_date_symbol_changed": "1992-10-13" }, "entity_type": "gene", "entity_name": "CLCN1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Myotonia congenita, dominant, MIM# 160800", "Myotonia congenita, recessive, MIM# 255700" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:8512", "gene_name": "ornithine carbamoyltransferase", "omim_gene": [ "300461" ], "alias_name": null, "gene_symbol": "OTC", "hgnc_symbol": "OTC", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:38211798-38280703", "ensembl_id": "ENSG00000036473" } }, "GRch38": { "90": { "location": "X:38352545-38421450", "ensembl_id": "ENSG00000036473" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "OTC", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Ornithine transcarbamylase deficiency" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2210", "gene_name": "collagen type V alpha 2 chain", "omim_gene": [ "120190" ], "alias_name": [ "AB collagen" ], "gene_symbol": "COL5A2", "hgnc_symbol": "COL5A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:189896622-190044605", "ensembl_id": "ENSG00000204262" } }, "GRch38": { "90": { "location": "2:189031896-189179879", "ensembl_id": "ENSG00000204262" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "COL5A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Ehlers-Danlos syndrome" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TAFII28" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11544", "gene_name": "TATA-box binding protein associated factor 11", "omim_gene": [ "600772" ], "alias_name": null, "gene_symbol": "TAF11", "hgnc_symbol": "TAF11", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:34845555-34855866", "ensembl_id": "ENSG00000064995" } }, "GRch38": { "90": { "location": "6:34877778-34888089", "ensembl_id": "ENSG00000064995" } } }, "hgnc_date_symbol_changed": "2001-12-07" }, "entity_type": "gene", "entity_name": "TAF11", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "39727181" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "cleft lip MONDO:0004747" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.318", "version_created": "2026-04-27T11:53:17.890231+10:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11195", "gene_name": "SRY-box 2", "omim_gene": [ "184429" ], "alias_name": null, "gene_symbol": "SOX2", "hgnc_symbol": "SOX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:181429714-181432221", "ensembl_id": "ENSG00000181449" } }, "GRch38": { "90": { "location": "3:181711924-181714436", "ensembl_id": "ENSG00000181449" } } }, "hgnc_date_symbol_changed": "1993-11-30" }, "entity_type": "gene", "entity_name": "SOX2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red" ], "phenotypes": [ "MICROPHTHALMIA, SYNDROMIC 3", "MCOPS3" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.318", "version_created": "2026-04-27T11:53:17.890231+10:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ARA70", "RFG", "ELE1", "PTC3", "DKFZp762E1112" ], "biotype": null, "hgnc_id": "HGNC:7671", "gene_name": "nuclear receptor coactivator 4", "omim_gene": [ "601984" ], "alias_name": [ "RET-activating gene ELE1" ], "gene_symbol": "NCOA4", "hgnc_symbol": "NCOA4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:51565108-51590734", "ensembl_id": "ENSG00000138293" } }, "GRch38": { "90": { "location": "10:46005088-46030714", "ensembl_id": "ENSG00000266412" } } }, "hgnc_date_symbol_changed": "1999-12-17" }, "entity_type": "gene", "entity_name": "NCOA4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "NSW Health Pathology", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 3437, "hash_id": null, "name": "Incidentalome_PREGEN_DRAFT", "disease_group": "", "disease_sub_group": "", "description": "Imported to facilitate update work. Do not use while labeled as DRAFT", "status": "public", "version": "0.43", "version_created": "2021-01-20T16:42:09.286633+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 173, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "dJ20C7.5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21024", "gene_name": "cullin 7", "omim_gene": [ "609577" ], "alias_name": null, "gene_symbol": "CUL7", "hgnc_symbol": "CUL7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:43005355-43021683", "ensembl_id": "ENSG00000044090" } }, "GRch38": { "90": { "location": "6:43037617-43053945", "ensembl_id": "ENSG00000044090" } } }, "hgnc_date_symbol_changed": "2004-03-22" }, "entity_type": "gene", "entity_name": "CUL7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16142236", "19225462", "17675530" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "3-M syndrome 1, MIM# 273750", "Yakut short stature syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3631, "hash_id": null, "name": "Growth failure", "disease_group": "", "disease_sub_group": "", "description": "This panel contains genes associated with growth failure in infancy/early childhood, either isolated or as part of another disorder.\r\n\r\nConsider applying this panel in individuals with:\r\n -Height Standard Deviation Score (SDS) <-3 (very significant short stature - well below the 0.4th centile)\r\nAND at least one of:\r\n- History of small for gestational age (birth weight and/or length <-2SDS)\r\n- Body disproportion, e.g. discrepancy between stature and head size\r\n- Dysmorphic features and congenital anomalies\r\n- Abnormalities in the GH-IGF axis (evidence of GH insensitivity or deficiency) and/or other pituitary hormonal deficiencies\r\n- Family history of significant short stature (1st and 2nd degree relatives) and/or consanguinity\r\n\r\nPrior to genomic testing consider:\r\n-Chromosomal microarray analysis (e.g. Turner syndrome)\r\n-Methylation analysis for Russell-Silver syndrome and Temple syndrome\r\n-Skeletal survey\r\n\r\nAcquired causes of short stature are relatively common.\r\n\r\nDepending on the specific clinical features present, consider applying the Skeletal dysplasia, Intellectual Disability, and/or Pituitary Hormone deficiency panels.\r\n\r\nWith thanks to Genomics England for the original design of this panel.", "status": "public", "version": "1.107", "version_created": "2026-04-30T15:03:50.139368+10:00", "relevant_disorders": [ "Failure to thrive", "HP:0001508; Growth delay", "HP:0001510" ], "stats": { "number_of_genes": 204, "number_of_strs": 0, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0208" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3087", "gene_name": "dishevelled segment polarity protein 3", "omim_gene": [ "601368" ], "alias_name": null, "gene_symbol": "DVL3", "hgnc_symbol": "DVL3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:183873176-183891398", "ensembl_id": "ENSG00000161202" } }, "GRch38": { "90": { "location": "3:184155388-184173610", "ensembl_id": "ENSG00000161202" } } }, "hgnc_date_symbol_changed": "1997-04-21" }, "entity_type": "gene", "entity_name": "DVL3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26924530" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Robinow syndrome, autosomal dominant 3 MIM#616894" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.576", "version_created": "2026-04-29T19:01:52.053429+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2873", "gene_name": "cytochrome b5 reductase 3", "omim_gene": [ "613213" ], "alias_name": [ "NADH-cytochrome b5 reductase 3" ], "gene_symbol": "CYB5R3", "hgnc_symbol": "CYB5R3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:43013846-43045574", "ensembl_id": "ENSG00000100243" } }, "GRch38": { "90": { "location": "22:42617840-42649568", "ensembl_id": "ENSG00000100243" } } }, "hgnc_date_symbol_changed": "2005-07-13" }, "entity_type": "gene", "entity_name": "CYB5R3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Amber", "Genomics England PanelApp" ], "phenotypes": [ "Methaemoglobinemia, type II, MIM# 250800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.576", "version_created": "2026-04-29T19:01:52.053429+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "WDRPUH", "FLJ37528" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16053", "gene_name": "cilia and flagella associated protein 52", "omim_gene": [ "609804" ], "alias_name": [ "WD40-repeat protein upregulated in HCC" ], "gene_symbol": "CFAP52", "hgnc_symbol": "CFAP52", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:9479944-9546776", "ensembl_id": "ENSG00000166596" } }, "GRch38": { "90": { "location": "17:9576627-9643459", "ensembl_id": "ENSG00000166596" } } }, "hgnc_date_symbol_changed": "2014-09-29" }, "entity_type": "gene", "entity_name": "CFAP52", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 25469542", "33139725" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Heterotaxy, visceral, 10, autosomal, with male infertility, MIM#619607" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.576", "version_created": "2026-04-29T19:01:52.053429+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CLN10" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2529", "gene_name": "cathepsin D", "omim_gene": [ "116840" ], "alias_name": [ "ceroid-lipofuscinosis, neuronal 10" ], "gene_symbol": "CTSD", "hgnc_symbol": "CTSD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:1773982-1785222", "ensembl_id": "ENSG00000117984" } }, "GRch38": { "90": { "location": "11:1752752-1764573", "ensembl_id": "ENSG00000117984" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "CTSD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "1558577" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Ceroid lipofuscinosis, neuronal, 10, MIM# 610127" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.576", "version_created": "2026-04-29T19:01:52.053429+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "bHLHe14" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10882", "gene_name": "single-minded family bHLH transcription factor 1", "omim_gene": [ "603128" ], "alias_name": null, "gene_symbol": "SIM1", "hgnc_symbol": "SIM1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:100832891-100912805", "ensembl_id": "ENSG00000112246" } }, "GRch38": { "90": { "location": "6:100385015-100464929", "ensembl_id": "ENSG00000112246" } } }, "hgnc_date_symbol_changed": "1997-07-22" }, "entity_type": "gene", "entity_name": "SIM1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24097297", "25805767", "24260538", "23778136", "16924270", "23778139", "24814368" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "congenital obesity", "Prader-Willi-like syndrome" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3764, "hash_id": null, "name": "Severe early-onset obesity", "disease_group": "Endocrine disorders", "disease_sub_group": "", "description": "This panel contains genes associated with syndromic and non-syndromic causes of severe, early-onset obesity (weight >3 standard deviations above the mean, with onset before the age of 5 years).\r\n\r\nIf other growth parameters are affected, please consider the Overgrowth and the Macrocephaly_Megalencephaly panels.", "status": "public", "version": "1.32", "version_created": "2026-04-20T20:39:13.285624+10:00", "relevant_disorders": [ "Obesity", "HP:0001513" ], "stats": { "number_of_genes": 59, "number_of_strs": 0, "number_of_regions": 3 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0657" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29092", "gene_name": "obscurin like 1", "omim_gene": [ "610991" ], "alias_name": null, "gene_symbol": "OBSL1", "hgnc_symbol": "OBSL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:220415451-220436581", "ensembl_id": "ENSG00000124006" } }, "GRch38": { "90": { "location": "2:219550729-219571859", "ensembl_id": "ENSG00000124006" } } }, "hgnc_date_symbol_changed": "2005-10-20" }, "entity_type": "gene", "entity_name": "OBSL1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21737058", "19481195", "23018678", "19877176" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "3-M syndrome 2, 612921 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.17", "version_created": "2026-04-24T17:00:21.626497+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PUNP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7892", "gene_name": "purine nucleoside phosphorylase", "omim_gene": [ "164050" ], "alias_name": null, "gene_symbol": "PNP", "hgnc_symbol": "PNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:20937113-20945253", "ensembl_id": "ENSG00000198805" } }, "GRch38": { "90": { "location": "14:20468954-20477094", "ensembl_id": "ENSG00000198805" } } }, "hgnc_date_symbol_changed": "2009-12-02" }, "entity_type": "gene", "entity_name": "PNP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "3029074", "1384322", "11453975", "32695102", "32514656" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM# 613179" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.17", "version_created": "2026-04-24T17:00:21.626497+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GTC90" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14857", "gene_name": "component of oligomeric golgi complex 5", "omim_gene": [ "606821" ], "alias_name": null, "gene_symbol": "COG5", "hgnc_symbol": "COG5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:106842000-107204959", "ensembl_id": "ENSG00000164597" } }, "GRch38": { "90": { "location": "7:107201555-107564514", "ensembl_id": "ENSG00000164597" } } }, "hgnc_date_symbol_changed": "2002-05-10" }, "entity_type": "gene", "entity_name": "COG5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32174980", "31572517", "23228021" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Congenital disorder of glycosylation, type IIi, MIM# 613612" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.17", "version_created": "2026-04-24T17:00:21.626497+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NAG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7632", "gene_name": "N-acetyl-alpha-glucosaminidase", "omim_gene": [ "609701" ], "alias_name": [ "Sanfilippo disease IIIB" ], "gene_symbol": "NAGLU", "hgnc_symbol": "NAGLU", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:40688190-40696467", "ensembl_id": "ENSG00000108784" } }, "GRch38": { "90": { "location": "17:42536172-42544449", "ensembl_id": "ENSG00000108784" } } }, "hgnc_date_symbol_changed": "1995-09-15" }, "entity_type": "gene", "entity_name": "NAGLU", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25818867", "8650226", "14518829", "18392742", "11668611" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Mucopolysaccharidosis type IIIB (Sanfilippo B) MIM#252920" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.17", "version_created": "2026-04-24T17:00:21.626497+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2860", "gene_name": "7-dehydrocholesterol reductase", "omim_gene": [ "602858" ], "alias_name": null, "gene_symbol": "DHCR7", "hgnc_symbol": "DHCR7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:71139239-71163914", "ensembl_id": "ENSG00000172893" } }, "GRch38": { "90": { "location": "11:71428193-71452868", "ensembl_id": "ENSG00000172893" } } }, "hgnc_date_symbol_changed": "1998-04-27" }, "entity_type": "gene", "entity_name": "DHCR7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16906538", "10602371", "10677299" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Smith-Lemli-Opitz syndrome, 270400 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.17", "version_created": "2026-04-24T17:00:21.626497+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CARMA1", "BIMP3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16393", "gene_name": "caspase recruitment domain family member 11", "omim_gene": [ "607210" ], "alias_name": [ "card-maguk protein 1", "bcl10-interacting maguk protein 3" ], "gene_symbol": "CARD11", "hgnc_symbol": "CARD11", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:2945775-3083579", "ensembl_id": "ENSG00000198286" } }, "GRch38": { "90": { "location": "7:2906141-3043945", "ensembl_id": "ENSG00000198286" } } }, "hgnc_date_symbol_changed": "2001-08-13" }, "entity_type": "gene", "entity_name": "CARD11", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "PMID: 36729250", "23561803", "23374270", "28826773" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Immunodeficiency 11, 615206 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.17", "version_created": "2026-04-24T17:00:21.626497+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ALK6", "CDw293" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1077", "gene_name": "bone morphogenetic protein receptor type 1B", "omim_gene": [ "603248" ], "alias_name": null, "gene_symbol": "BMPR1B", "hgnc_symbol": "BMPR1B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:95679119-96079599", "ensembl_id": "ENSG00000138696" } }, "GRch38": { "90": { "location": "4:94757968-95158448", "ensembl_id": "ENSG00000138696" } } }, "hgnc_date_symbol_changed": "1997-03-19" }, "entity_type": "gene", "entity_name": "BMPR1B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15805157", "24129431", "26105076" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Acromesomelic dysplasia 3, MIM# 609441" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.17", "version_created": "2026-04-24T17:00:21.626497+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ENaCgamma", "SCNEG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10602", "gene_name": "sodium channel epithelial 1 gamma subunit", "omim_gene": [ "600761" ], "alias_name": null, "gene_symbol": "SCNN1G", "hgnc_symbol": "SCNN1G", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:23194036-23228204", "ensembl_id": "ENSG00000166828" } }, "GRch38": { "90": { "location": "16:23182715-23216883", "ensembl_id": "ENSG00000166828" } } }, "hgnc_date_symbol_changed": "1995-05-10" }, "entity_type": "gene", "entity_name": "SCNN1G", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BabySeq Category C gene", "BeginNGS" ], "phenotypes": [ "Pseudohypoaldosteronism, type I, MIM#\t264350" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "endocrine" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FXR", "RIP14", "HRR1", "HRR-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7967", "gene_name": "nuclear receptor subfamily 1 group H member 4", "omim_gene": [ "603826" ], "alias_name": [ "farnesoid X receptor" ], "gene_symbol": "NR1H4", "hgnc_symbol": "NR1H4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:100867486-100958191", "ensembl_id": "ENSG00000012504" } }, "GRch38": { "90": { "location": "12:100473708-100564413", "ensembl_id": "ENSG00000012504" } } }, "hgnc_date_symbol_changed": "1999-09-17" }, "entity_type": "gene", "entity_name": "NR1H4", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category C gene", "Expert Review Red" ], "phenotypes": [ "Cholestasis, infantile" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ZNRP", "BOV-1A", "BOV-1B", "BOV-1C", "RBM8B", "Y14" ], "biotype": null, "hgnc_id": "HGNC:9905", "gene_name": "RNA binding motif protein 8A", "omim_gene": [ "605313" ], "alias_name": null, "gene_symbol": "RBM8A", "hgnc_symbol": "RBM8A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:145507598-145513536", "ensembl_id": "ENSG00000131795" } }, "GRch38": { "90": { "location": "1:145917714-145927678", "ensembl_id": "ENSG00000265241" } } }, "hgnc_date_symbol_changed": "1999-05-05" }, "entity_type": "gene", "entity_name": "RBM8A", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category A gene" ], "phenotypes": [ "Thrombocytopenia-absent radius syndrome, MIM# 274000" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HsT17432" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6772", "gene_name": "SMAD family member 6", "omim_gene": [ "602931" ], "alias_name": null, "gene_symbol": "SMAD6", "hgnc_symbol": "SMAD6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:66994566-67074338", "ensembl_id": "ENSG00000137834" } }, "GRch38": { "90": { "location": "15:66702228-66782848", "ensembl_id": "ENSG00000137834" } } }, "hgnc_date_symbol_changed": "2004-05-26" }, "entity_type": "gene", "entity_name": "SMAD6", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category C gene", "Expert Review Red" ], "phenotypes": [ "Cardiovascular malformation, congenital" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HCORO1", "p57", "coronin-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2252", "gene_name": "coronin 1A", "omim_gene": [ "605000" ], "alias_name": [ "Clabp TACO" ], "gene_symbol": "CORO1A", "hgnc_symbol": "CORO1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:30194148-30200397", "ensembl_id": "ENSG00000102879" } }, "GRch38": { "90": { "location": "16:30182827-30189076", "ensembl_id": "ENSG00000102879" } } }, "hgnc_date_symbol_changed": "1999-10-19" }, "entity_type": "gene", "entity_name": "CORO1A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Immunodeficiency 8 MIM# 615401" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "immunological", "technically challenging" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA1374" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29262", "gene_name": "intraflagellar transport 80", "omim_gene": [ "611177" ], "alias_name": null, "gene_symbol": "IFT80", "hgnc_symbol": "IFT80", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:159974774-160117668", "ensembl_id": "ENSG00000068885" } }, "GRch38": { "90": { "location": "3:160256986-160399880", "ensembl_id": "ENSG00000068885" } } }, "hgnc_date_symbol_changed": "2005-11-02" }, "entity_type": "gene", "entity_name": "IFT80", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category C gene", "Expert Review Red" ], "phenotypes": [ "Asphyxiating thoracic dystrophy 2" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ38736" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26790", "gene_name": "WD repeat domain 72", "omim_gene": [ "613214" ], "alias_name": null, "gene_symbol": "WDR72", "hgnc_symbol": "WDR72", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:53805938-54055075", "ensembl_id": "ENSG00000166415" } }, "GRch38": { "90": { "location": "15:53513741-53762878", "ensembl_id": "ENSG00000166415" } } }, "hgnc_date_symbol_changed": "2005-05-26" }, "entity_type": "gene", "entity_name": "WDR72", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30028803", "30779877" ], "evidence": [ "Expert Review Green", "Expert Review", "Expert Review Green", "Expert Review" ], "phenotypes": [ "Amelogenesis imperfecta, type IIA3, MIM# 613211", "Distal RTA" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3993, "hash_id": null, "name": "Renal Tubulopathies and related disorders", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel was developed/updated in Dec'22 and is maintained by the KidGen Collaborative, and is a consensus panel used by VCGS, GHQ, and RMH.\r\n\r\nThis panel contains genes that cause:\r\n-renal tubular disorders\r\n-electrolyte abnormalities (e.g. Na, K, H, Mg, Ca, PO4, Cl, HCO3)\r\n-aldosterone abnormalities\r\n-nephrolithiasis\r\n-metabolic renal diseases \r\n\r\nIt supersedes the following panels: Bartter syndrome, Dent disease, Diabetes Insipidus, Hyperoxaluria, Metabolic renal disease, Nephrolithiasis and Nephrocalcinosis, Renal abnormalities of calcium and phosphate metabolism, Renal Abnormalities of Magnesium Metabolism, Renal Hypertension and Disorders of Aldosterone Metabolism, and Renal Tubulopathies_KidGen.", "status": "public", "version": "1.26", "version_created": "2026-03-30T10:01:51.458813+11:00", "relevant_disorders": [ "Renal tubular dysfunction", "HP:0000124; Nephrolithiasis", "HP:0000787; Abnormal circulating aldosterone", "HP:0040085" ], "stats": { "number_of_genes": 134, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "cPLA2-alpha" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9035", "gene_name": "phospholipase A2 group IVA", "omim_gene": [ "600522" ], "alias_name": null, "gene_symbol": "PLA2G4A", "hgnc_symbol": "PLA2G4A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:186798085-186958113", "ensembl_id": "ENSG00000116711" } }, "GRch38": { "90": { "location": "1:186828953-186988981", "ensembl_id": "ENSG00000116711" } } }, "hgnc_date_symbol_changed": "1994-11-30" }, "entity_type": "gene", "entity_name": "PLA2G4A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23268370", "25102815", "18451993" ], "evidence": [ "Expert list", "Expert Review Green" ], "phenotypes": [ "Gastrointestinal ulceration, recurrent, with dysfunctional platelets, MIM# 618372" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3662", "gene_name": "fibrinogen beta chain", "omim_gene": [ "134830" ], "alias_name": null, "gene_symbol": "FGB", "hgnc_symbol": "FGB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:155484108-155492238", "ensembl_id": "ENSG00000171564" } }, "GRch38": { "90": { "location": "4:154562956-154571086", "ensembl_id": "ENSG00000171564" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "FGB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12393540", "16195396" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Afibrinogenaemia, congenital, MIM# 202400", "Hypofibrinogenaemia, congenital, MIM# 202400", "Dysfibrinogenemia, congenital, MIM# 616004" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MFTC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29683", "gene_name": "solute carrier family 25 member 32", "omim_gene": [ "610815" ], "alias_name": null, "gene_symbol": "SLC25A32", "hgnc_symbol": "SLC25A32", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:104410863-104427417", "ensembl_id": "ENSG00000164933" } }, "GRch38": { "90": { "location": "8:103398635-103415189", "ensembl_id": "ENSG00000164933" } } }, "hgnc_date_symbol_changed": "2005-10-03" }, "entity_type": "gene", "entity_name": "SLC25A32", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26933868", "28443623" ], "evidence": [ "Expert Review Green" ], "phenotypes": [ "Exercise intolerance, riboflavin-responsive, MONDO:0014795", "Disorders of riboflavin metabolism" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4257, "hash_id": null, "name": "Vitamin metabolism disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "The gene panel contains genes that cause inborn errors of vitamin metabolism.\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.7", "version_created": "2024-09-18T09:35:00.495806+10:00", "relevant_disorders": [ "Abnormality of vitamin metabolism", "HP:0100508" ], "stats": { "number_of_genes": 62, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "p53", "LFS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11998", "gene_name": "tumor protein p53", "omim_gene": [ "191170" ], "alias_name": [ "Li-Fraumeni syndrome" ], "gene_symbol": "TP53", "hgnc_symbol": "TP53", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:7565097-7590856", "ensembl_id": "ENSG00000141510" } }, "GRch38": { "90": { "location": "17:7661779-7687550", "ensembl_id": "ENSG00000141510" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "TP53", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert Review", "Expert list" ], "phenotypes": [ "Malignant pancreatic neoplasm, MONDO:0009831", "Li-Fraumeni syndrome, MONDO:0018875", "Li-Fraumeni syndrome, MIM#151623" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4370, "hash_id": null, "name": "Pancreatic Cancer", "disease_group": "Cancer Predisposition", "disease_sub_group": "", "description": "This panel contains genes associated with pancreatic cancer. \r\n\r\nFurther information on the testing criteria for pancreatic cancer can be found at eviQ: \r\nhttps://www.eviq.org.au/cancer-genetics/adult/genetic-testing-using-cancer-gene-panels/3906-pancreatic-cancer-panel-testing\r\n\r\nOnly ‘Green’ genes should be tested and analysed for clinical testing, as they have sufficient peer-reviewed published evidence of association with pancreatic cancer and are clinically actionable for diagnostic and/or predictive genetic testing.\r\n\r\nEnsure testing includes copy number variant (CNV) analysis, as CNVs contribute to a clinically significant proportion of pathogenic variants associated with familial risk of cancer.\r\n\r\nThis panel has been compared against the Genomics England PanelApp and aligned with any assessments by ClinGen.\r\n\r\nThis panel has been developed under the guidance of experts in cancer genetics (Dr Helen Mar Fan and Dr Nicola Poplawski).", "status": "public", "version": "1.1", "version_created": "2024-11-01T16:32:06.575750+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 12, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Cancer Germline", "slug": "cancer-germline", "description": "Germline cancer panel" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Adult Genetics Unit, Royal Adelaide Hospital", "slug": "adult-genetics-unit-royal-adelaide-hospital", "description": "Adult Genetics Unit, Royal Adelaide Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CATSPER" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17116", "gene_name": "cation channel sperm associated 1", "omim_gene": [ "606389" ], "alias_name": null, "gene_symbol": "CATSPER1", "hgnc_symbol": "CATSPER1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:65784223-65793988", "ensembl_id": "ENSG00000175294" } }, "GRch38": { "90": { "location": "11:66016752-66026517", "ensembl_id": "ENSG00000175294" } } }, "hgnc_date_symbol_changed": "2002-06-20" }, "entity_type": "gene", "entity_name": "CATSPER1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "19344877", "11595941" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spermatogenic failure 7, MIM# 612997" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "SV/CNV" ], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.156", "version_created": "2026-04-30T15:46:29.604965+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 269, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699427 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [ "adult-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } } ] }