Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=175
{ "count": 36078, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=176", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=174", "results": [ { "gene_data": { "alias": [ "Magmas", "Tim16", "TIMM16" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29679", "gene_name": "presequence translocase associated motor 16", "omim_gene": [ "614336" ], "alias_name": [ "mitochondria associated protein involved in granulocyte macrophage colony stimulating factor signal transduction" ], "gene_symbol": "PAM16", "hgnc_symbol": "PAM16", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:4381550-4405608", "ensembl_id": "ENSG00000217930" } }, "GRch38": { "90": { "location": "16:4331549-4355607", "ensembl_id": "ENSG00000217930" } } }, "hgnc_date_symbol_changed": "2010-09-01" }, "entity_type": "gene", "entity_name": "PAM16", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "24786642" ], "evidence": [ "Expert Review Green", "Expert list", "Literature" ], "phenotypes": [ "Spondylometaphyseal dysplasia, Megarbane-Dagher-Melike type, OMIM # 613320" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 28, "hash_id": null, "name": "Skeletal Dysplasia_Fetal", "disease_group": "Skeletal disorders", "disease_sub_group": "", "description": "This panel was developed and used by the Melbourne Genomics Perinatal Autopsy Flagship. It is maintained by VCGS.\r\n\r\nIt contains genes associated with conditions primarily affecting bone and cartilage that present prenatally.\r\n\r\nPlease consider the larger Fetal Anomalies and Skeletal Dysplasia panels, or other specific panels such as Growth Failure, Craniosynostosis, Radial ray abnormalities, Polydactyly or Limb and Digital Malformations depending on the clinical presentation.", "status": "public", "version": "0.249", "version_created": "2026-04-23T20:41:39.653354+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 157, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0018", "seladin-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2859", "gene_name": "24-dehydrocholesterol reductase", "omim_gene": [ "606418" ], "alias_name": null, "gene_symbol": "DHCR24", "hgnc_symbol": "DHCR24", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:55315306-55352891", "ensembl_id": "ENSG00000116133" } }, "GRch38": { "90": { "location": "1:54849633-54887218", "ensembl_id": "ENSG00000116133" } } }, "hgnc_date_symbol_changed": "1998-04-27" }, "entity_type": "gene", "entity_name": "DHCR24", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Desmosterolosis, MONDO:0011217" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 47, "hash_id": null, "name": "Arthrogryposis", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that have been associated with multiple congenital contractures (arthrogryposis). Primary genetic aetiologies include neuropathic processes; myopathic processes; end-plate abnormalities; and syndromic/metabolic disorders that affect the movement of the developing embryo/fetus.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Arthrogryposis' panel with all discrepancies resolved, and reciprocal feedback provided to Genomics England, 1/8/2020.\r\n\r\nUpdated following literature review 25/11/2025.", "status": "public", "version": "1.19", "version_created": "2026-04-02T19:32:17.814766+11:00", "relevant_disorders": [ "Flexion contracture", "HP:0001371" ], "stats": { "number_of_genes": 241, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "beta-4", "CFEOM3", "CFEOM3A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20772", "gene_name": "tubulin beta 3 class III", "omim_gene": [ "602661" ], "alias_name": [ "class III beta-tubulin" ], "gene_symbol": "TUBB3", "hgnc_symbol": "TUBB3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:89987800-90005169", "ensembl_id": "ENSG00000258947" } }, "GRch38": { "90": { "location": "16:89921392-89938761", "ensembl_id": "ENSG00000258947" } } }, "hgnc_date_symbol_changed": "2004-11-22" }, "entity_type": "gene", "entity_name": "TUBB3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20074521", "34652576" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Fibrosis of extraocular muscles, congenital, 3A (MIM#600638)", "Neuropathy" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 47, "hash_id": null, "name": "Arthrogryposis", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that have been associated with multiple congenital contractures (arthrogryposis). Primary genetic aetiologies include neuropathic processes; myopathic processes; end-plate abnormalities; and syndromic/metabolic disorders that affect the movement of the developing embryo/fetus.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Arthrogryposis' panel with all discrepancies resolved, and reciprocal feedback provided to Genomics England, 1/8/2020.\r\n\r\nUpdated following literature review 25/11/2025.", "status": "public", "version": "1.19", "version_created": "2026-04-02T19:32:17.814766+11:00", "relevant_disorders": [ "Flexion contracture", "HP:0001371" ], "stats": { "number_of_genes": 241, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MEGF2", "HFMI1", "FMI1", "CDHF11", "ADGRC3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3230", "gene_name": "cadherin EGF LAG seven-pass G-type receptor 3", "omim_gene": [ "604264" ], "alias_name": [ "flamingo homolog 1 (Drosophila)", "adhesion G protein-coupled receptor C3" ], "gene_symbol": "CELSR3", "hgnc_symbol": "CELSR3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:48673902-48700348", "ensembl_id": "ENSG00000008300" } }, "GRch38": { "90": { "location": "3:48636469-48662915", "ensembl_id": "ENSG00000008300" } } }, "hgnc_date_symbol_changed": "1998-03-25" }, "entity_type": "gene", "entity_name": "CELSR3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "38429302" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder (MONDO#0700092), CELSR3-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 63, "hash_id": null, "name": "Congenital anomalies of the kidney and urinary tract (CAKUT)", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel contains genes associated with nonsyndromic and syndromic congenital anomalies of the kidney and urinary tract (CAKUT).", "status": "public", "version": "0.207", "version_created": "2026-04-15T16:43:07.852176+10:00", "relevant_disorders": [ "Abnormality of the urinary system HP:0000079" ], "stats": { "number_of_genes": 124, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "JTK7", "c-ABL", "p150" ], "biotype": "protein_coding", "hgnc_id": "HGNC:76", "gene_name": "ABL proto-oncogene 1, non-receptor tyrosine kinase", "omim_gene": [ "189980" ], "alias_name": null, "gene_symbol": "ABL1", "hgnc_symbol": "ABL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:133589333-133763062", "ensembl_id": "ENSG00000097007" } }, "GRch38": { "90": { "location": "9:130713946-130887675", "ensembl_id": "ENSG00000097007" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "ABL1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33461977", "28288113" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Congenital heart defects and skeletal malformations syndrome, MIM#\t617602" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 69, "hash_id": null, "name": "Congenital diaphragmatic hernia", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with syndromic and non-syndromic congenital diaphragmatic hernia.\r\n\r\nNote pathogenic variants in a broad range of genes have been ascertained in CDH cohorts (e.g. PMID 33461977), so a broader testing approach is recommended particularly in the perinatal period.", "status": "public", "version": "1.18", "version_created": "2025-11-21T16:59:26.431729+11:00", "relevant_disorders": [ "Congenital diaphragmatic hernia HP:0000776" ], "stats": { "number_of_genes": 49, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MDA-5", "Hlcd", "MDA5", "IDDM19" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18873", "gene_name": "interferon induced with helicase C domain 1", "omim_gene": [ "606951" ], "alias_name": [ "helicard", "melanoma differentiation-associated gene 5" ], "gene_symbol": "IFIH1", "hgnc_symbol": "IFIH1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:163123589-163175213", "ensembl_id": "ENSG00000115267" } }, "GRch38": { "90": { "location": "2:162267079-162318703", "ensembl_id": "ENSG00000115267" } } }, "hgnc_date_symbol_changed": "2004-06-25" }, "entity_type": "gene", "entity_name": "IFIH1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34788679", "33177673", "33528536" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Aicardi-Goutieres syndrome 7 MIM#615846" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 73, "hash_id": null, "name": "Cerebral Palsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Cerebral palsy (CP) is a non-progressive neurodevelopmental disorder characterized by motor impairments, often accompanied by intellectual disability, epilepsy, visual and hearing impairment and speech and language deficits.\r\n\r\nPMID 33528536 reported a cohort of 1345 individuals undergoing genomic testing. Diagnostic yield ranged between 10-30% depending on presence of additional characteristics such as ID/epilepsy/ASD.\r\n\r\nThe aetiology of cerebral palsy is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia, Ataxia, Malformations of Cortical Development, Mitochondrial Disorders and the Bleeding and Platelet Disorders panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Jozef Gecz, Clare van Eyk, Luisa Weiss and team for their contribution to the development of this panel.", "status": "public", "version": "1.410", "version_created": "2026-02-17T16:35:59.013988+11:00", "relevant_disorders": [ "Cerebral palsy HP:0100021" ], "stats": { "number_of_genes": 364, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0784", "ADNP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15766", "gene_name": "activity dependent neuroprotector homeobox", "omim_gene": [ "611386" ], "alias_name": [ "ADNP homeobox 1" ], "gene_symbol": "ADNP", "hgnc_symbol": "ADNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:49505585-49547958", "ensembl_id": "ENSG00000101126" } }, "GRch38": { "90": { "location": "20:50888919-50931240", "ensembl_id": "ENSG00000101126" } } }, "hgnc_date_symbol_changed": "2001-05-31" }, "entity_type": "gene", "entity_name": "ADNP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33528536" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Helsmoortel-van der Aa syndrome\tMIM#615873" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 73, "hash_id": null, "name": "Cerebral Palsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Cerebral palsy (CP) is a non-progressive neurodevelopmental disorder characterized by motor impairments, often accompanied by intellectual disability, epilepsy, visual and hearing impairment and speech and language deficits.\r\n\r\nPMID 33528536 reported a cohort of 1345 individuals undergoing genomic testing. Diagnostic yield ranged between 10-30% depending on presence of additional characteristics such as ID/epilepsy/ASD.\r\n\r\nThe aetiology of cerebral palsy is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia, Ataxia, Malformations of Cortical Development, Mitochondrial Disorders and the Bleeding and Platelet Disorders panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Jozef Gecz, Clare van Eyk, Luisa Weiss and team for their contribution to the development of this panel.", "status": "public", "version": "1.410", "version_created": "2026-02-17T16:35:59.013988+11:00", "relevant_disorders": [ "Cerebral palsy HP:0100021" ], "stats": { "number_of_genes": 364, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "WDR140", "WDR10p", "SPG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13556", "gene_name": "intraflagellar transport 122", "omim_gene": [ "606045" ], "alias_name": null, "gene_symbol": "IFT122", "hgnc_symbol": "IFT122", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:129158968-129239198", "ensembl_id": "ENSG00000163913" } }, "GRch38": { "90": { "location": "3:129440036-129520507", "ensembl_id": "ENSG00000163913" } } }, "hgnc_date_symbol_changed": "2005-11-02" }, "entity_type": "gene", "entity_name": "IFT122", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20493458", "23826986", "26792575", "29220510", "28370949", "27681595", "27681595" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cranioectodermal dysplasia 1, MIM# 218330", "MONDO:0021093", "Beemer-Langer syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 84, "hash_id": null, "name": "Ciliopathies", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was created by merging the Ciliopathy panels created by VCGS and RMH and is a consensus panel used by both.\r\n\r\nIt covers conditions caused by mutations in the genes encoding non-motile cilia components as well as a small number of conditions that can present as phenocopies.\r\n\r\nPlease note a number of smaller panels are available that cover specific ciliopathy phenotypes such as Bardet-Biedl syndrome, Jeune syndrome and Joubert syndrome.\r\n\r\nPlease refer to the Ciliary Dyskinesia panel for conditions caused by mutations in genes encoding components of the motile cilia, which present with predominantly respiratory phenotypes.", "status": "public", "version": "1.99", "version_created": "2026-02-26T20:47:06.255758+11:00", "relevant_disorders": [ "Ciliopathy", "MONDO:0005308" ], "stats": { "number_of_genes": 158, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RPC1", "RPC155", "hRPC155" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30074", "gene_name": "RNA polymerase III subunit A", "omim_gene": [ "614258" ], "alias_name": null, "gene_symbol": "POLR3A", "hgnc_symbol": "POLR3A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:79734907-79789303", "ensembl_id": "ENSG00000148606" } }, "GRch38": { "90": { "location": "10:77969251-78029545", "ensembl_id": "ENSG00000148606" } } }, "hgnc_date_symbol_changed": "2004-09-16" }, "entity_type": "gene", "entity_name": "POLR3A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "21855841", "25339210", "33005949", "22855961" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "POLR3A-related disorder MONDO:0700276" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.52", "version_created": "2026-04-23T10:59:57.828482+10:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 142, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FZD11" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11119", "gene_name": "smoothened, frizzled class receptor", "omim_gene": [ "601500" ], "alias_name": [ "frizzled family member 11" ], "gene_symbol": "SMO", "hgnc_symbol": "SMO", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:128828713-128853386", "ensembl_id": "ENSG00000128602" } }, "GRch38": { "90": { "location": "7:129188872-129213545", "ensembl_id": "ENSG00000128602" } } }, "hgnc_date_symbol_changed": "2003-01-17" }, "entity_type": "gene", "entity_name": "SMO", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32413283" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Microcephaly, congenital heart disease, polydactyly, aganglionosis", "Pallister-Hall-like syndrome\t, MIM#241800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 110, "hash_id": null, "name": "Hirschsprung disease", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.28", "version_created": "2026-01-04T18:41:54.183701+11:00", "relevant_disorders": [ "Aganglionic megacolon", "HP:0002251" ], "stats": { "number_of_genes": 14, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DXS423E", "KIAA0178", "SB1.8", "Smcb" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11111", "gene_name": "structural maintenance of chromosomes 1A", "omim_gene": [ "300040" ], "alias_name": null, "gene_symbol": "SMC1A", "hgnc_symbol": "SMC1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:53401070-53449677", "ensembl_id": "ENSG00000072501" } }, "GRch38": { "90": { "location": "X:53374149-53422728", "ensembl_id": "ENSG00000072501" } } }, "hgnc_date_symbol_changed": "2006-07-06" }, "entity_type": "gene", "entity_name": "SMC1A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17273969", "22106055", "19701948", "26752331", "28166369" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cornelia de Lange syndrome 2, MIM# 300590" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 120, "hash_id": null, "name": "Hypertrichosis syndromes", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.48", "version_created": "2026-01-14T13:37:51.409228+11:00", "relevant_disorders": [ "Hypertrichosis", "HP:0000998" ], "stats": { "number_of_genes": 29, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Dicer", "KIAA0928", "K12H4.8-LIKE", "HERNA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17098", "gene_name": "dicer 1, ribonuclease III", "omim_gene": [ "606241" ], "alias_name": [ "dicer 1, double-stranded RNA-specific endoribonuclease" ], "gene_symbol": "DICER1", "hgnc_symbol": "DICER1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:95552565-95624347", "ensembl_id": "ENSG00000100697" } }, "GRch38": { "90": { "location": "14:95086228-95158010", "ensembl_id": "ENSG00000100697" } } }, "hgnc_date_symbol_changed": "2002-05-09" }, "entity_type": "gene", "entity_name": "DICER1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "27441995" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "DICER1 syndrome, MONDO:0017288" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 135, "hash_id": null, "name": "Macrocephaly_Megalencephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.161", "version_created": "2026-01-12T09:38:37.890372+11:00", "relevant_disorders": [ "Macrocephaly", "HP:0000256; Megalencephaly", "HP:0001355" ], "stats": { "number_of_genes": 151, "number_of_strs": 0, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PLAP", "PLA2P", "FLJ11281", "FLJ12699", "DOA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9043", "gene_name": "phospholipase A2 activating protein", "omim_gene": [ "603873" ], "alias_name": [ "DOA1 homolog (S. cerevisiae)" ], "gene_symbol": "PLAA", "hgnc_symbol": "PLAA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:26904081-26947461", "ensembl_id": "ENSG00000137055" } }, "GRch38": { "90": { "location": "9:26904083-26947463", "ensembl_id": "ENSG00000137055" } } }, "hgnc_date_symbol_changed": "1999-04-15" }, "entity_type": "gene", "entity_name": "PLAA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28007986", "28413018", "31322726" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, MIM# 617527" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DRES-17", "HTCD37", "H-PRUNE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13420", "gene_name": "prune exopolyphosphatase 1", "omim_gene": [ "617413" ], "alias_name": null, "gene_symbol": "PRUNE1", "hgnc_symbol": "PRUNE1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:150980896-151008189", "ensembl_id": "ENSG00000143363" } }, "GRch38": { "90": { "location": "1:151008420-151035713", "ensembl_id": "ENSG00000143363" } } }, "hgnc_date_symbol_changed": "2016-06-06" }, "entity_type": "gene", "entity_name": "PRUNE1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26539891", "28334956", "33105479" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "dJ824F16.3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16175", "gene_name": "R-spondin 4", "omim_gene": [ "610573" ], "alias_name": null, "gene_symbol": "RSPO4", "hgnc_symbol": "RSPO4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:939095-982907", "ensembl_id": "ENSG00000101282" } }, "GRch38": { "90": { "location": "20:958452-1002264", "ensembl_id": "ENSG00000101282" } } }, "hgnc_date_symbol_changed": "2005-08-08" }, "entity_type": "gene", "entity_name": "RSPO4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17041604", "17914448", "18070203" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Anonychia congenita MIM# 206800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PGT", "OATP2A1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10955", "gene_name": "solute carrier organic anion transporter family member 2A1", "omim_gene": [ "601460" ], "alias_name": null, "gene_symbol": "SLCO2A1", "hgnc_symbol": "SLCO2A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:133651540-133771028", "ensembl_id": "ENSG00000174640" } }, "GRch38": { "90": { "location": "3:133932696-134052184", "ensembl_id": "ENSG00000174640" } } }, "hgnc_date_symbol_changed": "2003-11-26" }, "entity_type": "gene", "entity_name": "SLCO2A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23509104", "27134495", "33852188", "22331663", "27134495", "29313109" ], "evidence": [ "Literature", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hypertrophic osteoarthropathy, primary, autosomal dominant, MIM# 167100", "Hypertrophic osteoarthropathy, primary, autosomal recessive 2, MIM# 614441", "Inflammatory bowel disease, MONDO:0005265, SLCO2A1-related" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SNAP-25", "RIC-4", "RIC4", "SEC9", "bA416N4.2", "dJ1068F16.2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11132", "gene_name": "synaptosome associated protein 25", "omim_gene": [ "600322" ], "alias_name": [ "resistance to inhibitors of cholinesterase 4 homolog" ], "gene_symbol": "SNAP25", "hgnc_symbol": "SNAP25", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:10199478-10288066", "ensembl_id": "ENSG00000132639" } }, "GRch38": { "90": { "location": "20:10218830-10307418", "ensembl_id": "ENSG00000132639" } } }, "hgnc_date_symbol_changed": "1995-01-24" }, "entity_type": "gene", "entity_name": "SNAP25", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25003006", "29100083", "28135719", "17283335", "29491473", "25381298" ], "evidence": [ "Expert Review Green", "Expert list", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, SNAP25-related", "Myasthenic syndrome, congenital, 18, MIM# 616330" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "XOR", "XO" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12805", "gene_name": "xanthine dehydrogenase", "omim_gene": [ "607633" ], "alias_name": null, "gene_symbol": "XDH", "hgnc_symbol": "XDH", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:31557187-31637581", "ensembl_id": "ENSG00000158125" } }, "GRch38": { "90": { "location": "2:31334321-31414715", "ensembl_id": "ENSG00000158125" } } }, "hgnc_date_symbol_changed": "1994-04-08" }, "entity_type": "gene", "entity_name": "XDH", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32071838" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Xanthinuria, type I (MIM#278300)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CGI-39", "CDA016", "GRIM-19", "GRIM19", "B16.6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17194", "gene_name": "NADH:ubiquinone oxidoreductase subunit A13", "omim_gene": [ "609435" ], "alias_name": [ "complex I B16.6 subunit" ], "gene_symbol": "NDUFA13", "hgnc_symbol": "NDUFA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:19626545-19644285", "ensembl_id": "ENSG00000186010" } }, "GRch38": { "90": { "location": "19:19515736-19529054", "ensembl_id": "ENSG00000186010" } } }, "hgnc_date_symbol_changed": "2005-07-20" }, "entity_type": "gene", "entity_name": "NDUFA13", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25901006", "32722639" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Mitochondrial complex I deficiency, nuclear type 28, MIM# 618249" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3791", "gene_name": "folate receptor 1", "omim_gene": [ "136430" ], "alias_name": [ "folate receptor alpha" ], "gene_symbol": "FOLR1", "hgnc_symbol": "FOLR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:71900602-71907345", "ensembl_id": "ENSG00000110195" } }, "GRch38": { "90": { "location": "11:72189558-72196323", "ensembl_id": "ENSG00000110195" } } }, "hgnc_date_symbol_changed": "1991-08-08" }, "entity_type": "gene", "entity_name": "FOLR1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19732866", "30420205", "27743887" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Neurodegeneration due to cerebral folate transport deficiency, MIM# 613068" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PI31" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9571", "gene_name": "proteasome inhibitor subunit 1", "omim_gene": null, "alias_name": [ "proteasome inhibitor hP131 subunit" ], "gene_symbol": "PSMF1", "hgnc_symbol": "PSMF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:1093906-1160596", "ensembl_id": "ENSG00000125818" } }, "GRch38": { "90": { "location": "20:1113263-1189415", "ensembl_id": "ENSG00000125818" } } }, "hgnc_date_symbol_changed": "1999-04-15" }, "entity_type": "gene", "entity_name": "PSMF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:33551", "gene_name": "NADH:ubiquinone oxidoreductase complex assembly factor 8", "omim_gene": null, "alias_name": null, "gene_symbol": "NDUFAF8", "hgnc_symbol": "NDUFAF8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:79213039-79215081", "ensembl_id": "ENSG00000224877" } }, "GRch38": { "90": { "location": "17:81239239-81241281", "ensembl_id": "ENSG00000224877" } } }, "hgnc_date_symbol_changed": "2016-08-02" }, "entity_type": "gene", "entity_name": "NDUFAF8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31866046" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Leigh syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:37216", "gene_name": "lipoyl(octanoyl) transferase 2", "omim_gene": [ "617659" ], "alias_name": null, "gene_symbol": "LIPT2", "hgnc_symbol": "LIPT2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:74202757-74204778", "ensembl_id": "ENSG00000175536" } }, "GRch38": { "90": { "location": "11:74491712-74493733", "ensembl_id": "ENSG00000175536" } } }, "hgnc_date_symbol_changed": "2009-09-09" }, "entity_type": "gene", "entity_name": "LIPT2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28757203" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM#617668" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "K12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6414", "gene_name": "keratin 12", "omim_gene": [ "601687" ], "alias_name": [ "Meesmann corneal dystrophy" ], "gene_symbol": "KRT12", "hgnc_symbol": "KRT12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:39017555-39023462", "ensembl_id": "ENSG00000187242" } }, "GRch38": { "90": { "location": "17:40861303-40867210", "ensembl_id": "ENSG00000187242" } } }, "hgnc_date_symbol_changed": "1997-07-22" }, "entity_type": "gene", "entity_name": "KRT12", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9171831", "22174841" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Meesmann corneal dystrophy 1, MIM# 122100" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DHAPAT", "DAPAT", "DAP-AT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4416", "gene_name": "glyceronephosphate O-acyltransferase", "omim_gene": [ "602744" ], "alias_name": [ "glycerone-phosphate O-acyltransferase", "dihydroxyacetone phosphate acyltransferase" ], "gene_symbol": "GNPAT", "hgnc_symbol": "GNPAT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:231376953-231413719", "ensembl_id": "ENSG00000116906" } }, "GRch38": { "90": { "location": "1:231241207-231277973", "ensembl_id": "ENSG00000116906" } } }, "hgnc_date_symbol_changed": "1998-10-29" }, "entity_type": "gene", "entity_name": "GNPAT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9536089", "11152660", "21990100" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Rhizomelic chondrodysplasia punctata, type 2, MIM# 222765", "MONDO:0009112" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BSN2", "FLJ20043" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30988", "gene_name": "basonuclin 2", "omim_gene": [ "608669" ], "alias_name": null, "gene_symbol": "BNC2", "hgnc_symbol": "BNC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:16409501-16870841", "ensembl_id": "ENSG00000173068" } }, "GRch38": { "90": { "location": "9:16409503-16870843", "ensembl_id": "ENSG00000173068" } } }, "hgnc_date_symbol_changed": "2004-04-29" }, "entity_type": "gene", "entity_name": "BNC2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31656805", "31051115" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Lower urinary tract obstruction, congenital", "OMIM #618612" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "G6PD1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4057", "gene_name": "glucose-6-phosphate dehydrogenase", "omim_gene": [ "305900" ], "alias_name": null, "gene_symbol": "G6PD", "hgnc_symbol": "G6PD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:153759606-153775787", "ensembl_id": "ENSG00000160211" } }, "GRch38": { "90": { "location": "X:154531391-154547572", "ensembl_id": "ENSG00000160211" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "G6PD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18177777" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Haemolytic anaemia, G6PD deficient (favism), MIM# 300908" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ZKSCAN15", "ZSCAN47" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21018", "gene_name": "zinc finger protein 445", "omim_gene": null, "alias_name": null, "gene_symbol": "ZNF445", "hgnc_symbol": "ZNF445", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:44481262-44519162", "ensembl_id": "ENSG00000185219" } }, "GRch38": { "90": { "location": "3:44431720-44477670", "ensembl_id": "ENSG00000185219" } } }, "hgnc_date_symbol_changed": "2003-06-02" }, "entity_type": "gene", "entity_name": "ZNF445", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34039421", "30602440", "30846001" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Temple syndrome", "Multi locus imprinting disturbance (MLID)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "WALp4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:963", "gene_name": "bromodomain adjacent to zinc finger domain 2B", "omim_gene": [ "605683" ], "alias_name": null, "gene_symbol": "BAZ2B", "hgnc_symbol": "BAZ2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:160175490-160473203", "ensembl_id": "ENSG00000123636" } }, "GRch38": { "90": { "location": "2:159318979-159616692", "ensembl_id": "ENSG00000123636" } } }, "hgnc_date_symbol_changed": "1999-09-06" }, "entity_type": "gene", "entity_name": "BAZ2B", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31999386", "28135719", "25363768", "37872713" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, BAZ2B-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CYPA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9253", "gene_name": "peptidylprolyl isomerase A", "omim_gene": [ "123840" ], "alias_name": [ "cyclophilin A" ], "gene_symbol": "PPIA", "hgnc_symbol": "PPIA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:44836279-44864163", "ensembl_id": "ENSG00000196262" } }, "GRch38": { "90": { "location": "7:44796680-44824564", "ensembl_id": "ENSG00000196262" } } }, "hgnc_date_symbol_changed": "1991-12-06" }, "entity_type": "gene", "entity_name": "PPIA", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 34972208" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "amyotrophic lateral sclerosis, MONDO:0004976" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MOP2", "PASD2", "HIF2A", "HLF", "bHLHe73" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3374", "gene_name": "endothelial PAS domain protein 1", "omim_gene": [ "603349" ], "alias_name": [ "HIF-1 alpha-like factor" ], "gene_symbol": "EPAS1", "hgnc_symbol": "EPAS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:46520806-46613836", "ensembl_id": "ENSG00000116016" } }, "GRch38": { "90": { "location": "2:46293667-46386703", "ensembl_id": "ENSG00000116016" } } }, "hgnc_date_symbol_changed": "1998-05-29" }, "entity_type": "gene", "entity_name": "EPAS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "27292716", "19208626", "39613395" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Familial erythrocytosis (MIM#611783)", "Hereditary anaemia, MONDO:0016624, EPAS1-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3542", "gene_name": "coagulation factor V", "omim_gene": [ "612309" ], "alias_name": null, "gene_symbol": "F5", "hgnc_symbol": "F5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:169483404-169555826", "ensembl_id": "ENSG00000198734" } }, "GRch38": { "90": { "location": "1:169514166-169586588", "ensembl_id": "ENSG00000198734" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "F5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9576178", "11435304", "8164741", "9454742" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Factor V deficiency, MIM# 227400", "MONDO:0009210", "Thrombophilia due to activated protein C resistance, MIM# 188055", "MONDO:0008560", "{Thrombophilia, susceptibility to, due to factor V Leiden}, MIM# 188055" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD73", "eN", "eNT", "CALJA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8021", "gene_name": "5'-nucleotidase ecto", "omim_gene": [ "129190" ], "alias_name": null, "gene_symbol": "NT5E", "hgnc_symbol": "NT5E", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:86159809-86205500", "ensembl_id": "ENSG00000135318" } }, "GRch38": { "90": { "location": "6:85449584-85495791", "ensembl_id": "ENSG00000135318" } } }, "hgnc_date_symbol_changed": "2002-04-19" }, "entity_type": "gene", "entity_name": "NT5E", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21288095" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Calcification of joints and arteries, MIM# 211800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20265", "GPI7", "LAS21" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25985", "gene_name": "phosphatidylinositol glycan anchor biosynthesis class G", "omim_gene": [ "616918" ], "alias_name": null, "gene_symbol": "PIGG", "hgnc_symbol": "PIGG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:492989-533985", "ensembl_id": "ENSG00000174227" } }, "GRch38": { "90": { "location": "4:499210-540196", "ensembl_id": "ENSG00000174227" } } }, "hgnc_date_symbol_changed": "2006-02-08" }, "entity_type": "gene", "entity_name": "PIGG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26996948" ], "evidence": [ "Expert Review Green", "Expert Review", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Neurodevelopmental disorder with or without hypotonia, seizures, and cerebellar atrophy\tMIM#616917" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4788", "version_created": "2026-04-25T18:32:26.912564+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6016, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CMPST", "hCST" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11021", "gene_name": "solute carrier family 35 member A1", "omim_gene": [ "605634" ], "alias_name": null, "gene_symbol": "SLC35A1", "hgnc_symbol": "SLC35A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:88180341-88222054", "ensembl_id": "ENSG00000164414" } }, "GRch38": { "90": { "location": "6:87470623-87512336", "ensembl_id": "ENSG00000164414" } } }, "hgnc_date_symbol_changed": "1999-10-05" }, "entity_type": "gene", "entity_name": "SLC35A1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "28856833", "23873973", "11157507" ], "evidence": [ "Expert Review Amber", "Expert Review" ], "phenotypes": [ "Congenital disorder of glycosylation, type IIf, MIM# 603585" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.410", "version_created": "2026-04-24T13:36:55.078812+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "HADH1", "SCHAD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4799", "gene_name": "hydroxyacyl-CoA dehydrogenase", "omim_gene": [ "601609" ], "alias_name": null, "gene_symbol": "HADH", "hgnc_symbol": "HADH", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:108910870-108956331", "ensembl_id": "ENSG00000138796" } }, "GRch38": { "90": { "location": "4:107989714-108035175", "ensembl_id": "ENSG00000138796" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "HADH", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "25778941", "23430856", "27771675", "11489939" ], "evidence": [ "Expert Review Green", "Expert Review Green", "NHS GMS", "Literature", "Victorian Clinical Genetics Services" ], "phenotypes": [ "3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ODC1", "ODC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14411", "gene_name": "solute carrier family 25 member 21", "omim_gene": [ "607571" ], "alias_name": null, "gene_symbol": "SLC25A21", "hgnc_symbol": "SLC25A21", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:37147636-37642071", "ensembl_id": "ENSG00000183032" } }, "GRch38": { "90": { "location": "14:36678431-37172866", "ensembl_id": "ENSG00000183032" } } }, "hgnc_date_symbol_changed": "2001-01-18" }, "entity_type": "gene", "entity_name": "SLC25A21", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29517768" ], "evidence": [ "Expert Review Amber", "NHS GMS", "Expert Review Amber", "NHS GMS" ], "phenotypes": [ "Mitochondrial DNA depletion syndrome-18 MIM#618811" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MWFE", "CI-MWFE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7683", "gene_name": "NADH:ubiquinone oxidoreductase subunit A1", "omim_gene": [ "300078" ], "alias_name": [ "NADH:ubiquinone oxidoreductase (complex 1)", "type I dehydrogenase", "NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)", "complex I MWFE subunit" ], "gene_symbol": "NDUFA1", "hgnc_symbol": "NDUFA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:119005450-119010625", "ensembl_id": "ENSG00000125356" } }, "GRch38": { "90": { "location": "X:119871487-119876662", "ensembl_id": "ENSG00000125356" } } }, "hgnc_date_symbol_changed": "1996-08-16" }, "entity_type": "gene", "entity_name": "NDUFA1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CRTR", "CT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11055", "gene_name": "solute carrier family 6 member 8", "omim_gene": [ "300036" ], "alias_name": [ "creatine transporter" ], "gene_symbol": "SLC6A8", "hgnc_symbol": "SLC6A8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:152953554-152962048", "ensembl_id": "ENSG00000130821" } }, "GRch38": { "90": { "location": "X:153688099-153696593", "ensembl_id": "ENSG00000130821" } } }, "hgnc_date_symbol_changed": "1994-12-19" }, "entity_type": "gene", "entity_name": "SLC6A8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "STL2", "CO11A1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2186", "gene_name": "collagen type XI alpha 1 chain", "omim_gene": [ "120280" ], "alias_name": [ "collagen XI, alpha-1 polypeptide" ], "gene_symbol": "COL11A1", "hgnc_symbol": "COL11A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:103342023-103574052", "ensembl_id": "ENSG00000060718" } }, "GRch38": { "90": { "location": "1:102876467-103108496", "ensembl_id": "ENSG00000060718" } } }, "hgnc_date_symbol_changed": "1989-05-08" }, "entity_type": "gene", "entity_name": "COL11A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Deafness Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Stickler syndrome, type II, MIM# 604841", "Marshall syndrome, MIM# 154780" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "H2-KE4", "D6S2244E", "KE4", "RING5", "ZIP7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4927", "gene_name": "solute carrier family 39 member 7", "omim_gene": [ "601416" ], "alias_name": null, "gene_symbol": "SLC39A7", "hgnc_symbol": "SLC39A7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:33168222-33172216", "ensembl_id": "ENSG00000112473" } }, "GRch38": { "90": { "location": "6:33200445-33204439", "ensembl_id": "ENSG00000112473" } } }, "hgnc_date_symbol_changed": "2003-10-27" }, "entity_type": "gene", "entity_name": "SLC39A7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30718914" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Agammaglobulinaemia 9, autosomal recessive, MIM# 619693", "Antibody deficiency", "early onset infections", "blistering dermatosis", "failure to thrive", "thrombocytopaenia" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 222, "hash_id": null, "name": "Predominantly Antibody Deficiency", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause predominantly antibody deficiency, including:\r\n- Agammaglobulinemia\r\n- Severe Reduction in All Serum Immunoglobulin Isotypes with Profoundly Decreased or Absent B Cells, Agammaglobulinemia \r\n- CVID Phenotype\r\n- Severe Reduction in at Least 2 Serum Immunoglobulin Isotypes with Normal or Low Number of B Cells, CVID Phenotype\r\n- Severe Reduction in Serum IgG and IgA with Normal/Elevated IgM and Normal Numbers of B cells, Hyper IgM\r\n- Isotype, Light Chain, or Functional Deficiencies with Generally Normal Numbers of B Cells\r\n\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.4", "version_created": "2025-09-11T18:11:50.640122+10:00", "relevant_disorders": [ "Decreased immunoglobulin level", "HP:0041078" ], "stats": { "number_of_genes": 58, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MAR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6116", "gene_name": "interferon regulatory factor 1", "omim_gene": [ "147575" ], "alias_name": [ "interferon regulatory factor-1" ], "gene_symbol": "IRF1", "hgnc_symbol": "IRF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:131817301-131826490", "ensembl_id": "ENSG00000125347" } }, "GRch38": { "90": { "location": "5:132481609-132490798", "ensembl_id": "ENSG00000125347" } } }, "hgnc_date_symbol_changed": "1991-05-09" }, "entity_type": "gene", "entity_name": "IRF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "36736301" ], "evidence": [ "Expert Review Green", "Expert list", "Literature" ], "phenotypes": [ "Immunodeficiency 117, mycobacteriosis, autosomal recessive, MIM# 620668" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 231, "hash_id": null, "name": "Defects of intrinsic and innate immunity", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause defects in intrinsic and innate immunity, including the following:\r\n- Mendelian susceptibility to mycobacterial disease (MSMD)\r\n- Epidermodysplasia verruciformis (HPV)\r\n- Predisposition to severe viral infection\r\n- Herpes simplex encephalitis (HSE)\r\n- Predisposition to mucocutaneous candidiasis\r\n- Other inborn errors of immunity related to non-haematopoietic tissues\r\n- Other inborn errors of immunity related to leukocytes\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.39", "version_created": "2026-04-15T16:26:05.053680+10:00", "relevant_disorders": [ "Unusual infections", "HP:0032101" ], "stats": { "number_of_genes": 86, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CD288" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15632", "gene_name": "toll like receptor 8", "omim_gene": [ "300366" ], "alias_name": null, "gene_symbol": "TLR8", "hgnc_symbol": "TLR8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:12924739-12941288", "ensembl_id": "ENSG00000101916" } }, "GRch38": { "90": { "location": "X:12906620-12923169", "ensembl_id": "ENSG00000101916" } } }, "hgnc_date_symbol_changed": "2001-04-27" }, "entity_type": "gene", "entity_name": "TLR8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "33512449", "34981838" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Immunodeficiency 98 with autoinflammation, X-linked, MIM# 301078" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 231, "hash_id": null, "name": "Defects of intrinsic and innate immunity", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause defects in intrinsic and innate immunity, including the following:\r\n- Mendelian susceptibility to mycobacterial disease (MSMD)\r\n- Epidermodysplasia verruciformis (HPV)\r\n- Predisposition to severe viral infection\r\n- Herpes simplex encephalitis (HSE)\r\n- Predisposition to mucocutaneous candidiasis\r\n- Other inborn errors of immunity related to non-haematopoietic tissues\r\n- Other inborn errors of immunity related to leukocytes\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.39", "version_created": "2026-04-15T16:26:05.053680+10:00", "relevant_disorders": [ "Unusual infections", "HP:0032101" ], "stats": { "number_of_genes": 86, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FPR", "FMLP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3826", "gene_name": "formyl peptide receptor 1", "omim_gene": [ "136537" ], "alias_name": null, "gene_symbol": "FPR1", "hgnc_symbol": "FPR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:52248425-52307363", "ensembl_id": "ENSG00000171051" } }, "GRch38": { "90": { "location": "19:51745172-51804110", "ensembl_id": "ENSG00000171051" } } }, "hgnc_date_symbol_changed": "1991-06-05" }, "entity_type": "gene", "entity_name": "FPR1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29105764", "28371599" ], "evidence": [ "Expert Review Red", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Periodontitis" ], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 233, "hash_id": null, "name": "Phagocyte Defects", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with abnormalities in phagocyte number, function or both. Susceptibility to infection from phagocytic dysfunction ranges from mild, recurrent skin infections to overwhelming, fatal systemic infection. Affected individuals are more susceptible to bacterial and fungal infections but have a normal resistance to viral infections. Most are diagnosed in infancy due to the severity of the infection or the unusual presentation of the organism, but some are diagnosed in adulthood. Includes:\r\n- Congenital Neutropenias\r\n- Defects of Motility\r\n- Defects of Respiratory Burst\r\n- Other Non-Lymphoid Defects\r\n\r\nUpdated with the 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications. \r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).\r\n\r\nThis panel was merged with and replaces the Melbourne Genomics Immunology Flagship Neutrophil Defects gene panel (22/03/2021).", "status": "public", "version": "1.45", "version_created": "2025-12-15T10:26:57.519304+11:00", "relevant_disorders": [ "Unusual infection", "HP:0032101" ], "stats": { "number_of_genes": 58, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HSPC015", "HINT-5", "HSL1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29812", "gene_name": "decapping enzyme, scavenger", "omim_gene": [ "610534" ], "alias_name": [ "5'-(N(7)-methyl 5'-triphosphoguanosine)-[mRNA] diphosphatase" ], "gene_symbol": "DCPS", "hgnc_symbol": "DCPS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:126173647-126215644", "ensembl_id": "ENSG00000110063" } }, "GRch38": { "90": { "location": "11:126303752-126345749", "ensembl_id": "ENSG00000110063" } } }, "hgnc_date_symbol_changed": "2005-01-07" }, "entity_type": "gene", "entity_name": "DCPS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "25701870", "30289615", "25712129" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Al-Raqad syndrome, MIM#616459" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.756", "version_created": "2026-04-24T13:54:47.562690+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "IGF1A", "IGFI", "IGF-I" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5464", "gene_name": "insulin like growth factor 1", "omim_gene": [ "147440" ], "alias_name": [ "somatomedin C" ], "gene_symbol": "IGF1", "hgnc_symbol": "IGF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:102789645-102874423", "ensembl_id": "ENSG00000017427" } }, "GRch38": { "90": { "location": "12:102395867-102480645", "ensembl_id": "ENSG00000017427" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "IGF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8857020", "15769976", "14684690", "31539878", "28768959", "34125705", "22832530" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.756", "version_created": "2026-04-24T13:54:47.562690+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "p53R2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17296", "gene_name": "ribonucleotide reductase regulatory TP53 inducible subunit M2B", "omim_gene": [ "604712" ], "alias_name": null, "gene_symbol": "RRM2B", "hgnc_symbol": "RRM2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:103216730-103251346", "ensembl_id": "ENSG00000048392" } }, "GRch38": { "90": { "location": "8:102204502-102239118", "ensembl_id": "ENSG00000048392" } } }, "hgnc_date_symbol_changed": "2002-01-14" }, "entity_type": "gene", "entity_name": "RRM2B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075", "Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.756", "version_created": "2026-04-24T13:54:47.562690+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "WINS1", "LINS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30922", "gene_name": "lines homolog 1", "omim_gene": [ "610350" ], "alias_name": [ "lines homolog (Drosophila)", "lines homolog 1 (Drosophila)" ], "gene_symbol": "LINS1", "hgnc_symbol": "LINS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:101099574-101143435", "ensembl_id": "ENSG00000140471" } }, "GRch38": { "90": { "location": "15:100559369-100603230", "ensembl_id": "ENSG00000140471" } } }, "hgnc_date_symbol_changed": "2015-08-18" }, "entity_type": "gene", "entity_name": "LINS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32802957", "34450347", "32499722", "31922598", "28181389" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Intellectual developmental disorder, autosomal recessive 27, MIM# 614340" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.756", "version_created": "2026-04-24T13:54:47.562690+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:799", "gene_name": "ATPase Na+/K+ transporting subunit alpha 1", "omim_gene": [ "182310" ], "alias_name": [ "sodium/potassium-transporting ATPase subunit alpha-1", "sodium pump subunit alpha-1", "sodium-potassium ATPase catalytic subunit alpha-1" ], "gene_symbol": "ATP1A1", "hgnc_symbol": "ATP1A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:116915290-116952883", "ensembl_id": "ENSG00000163399" } }, "GRch38": { "90": { "location": "1:116372668-116410261", "ensembl_id": "ENSG00000163399" } } }, "hgnc_date_symbol_changed": "1988-05-11" }, "entity_type": "gene", "entity_name": "ATP1A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30388404" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Intellectual disability", "seizures", "hypomagnesaemia" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.756", "version_created": "2026-04-24T13:54:47.562690+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "Crescerin-1", "crescerin" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19959", "gene_name": "TOG array regulator of axonemal microtubules 1", "omim_gene": [ "617618" ], "alias_name": [ "crescerin" ], "gene_symbol": "TOGARAM1", "hgnc_symbol": "TOGARAM1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:45431411-45543634", "ensembl_id": "ENSG00000198718" } }, "GRch38": { "90": { "location": "14:44962208-45074431", "ensembl_id": "ENSG00000198718" } } }, "hgnc_date_symbol_changed": "2017-01-13" }, "entity_type": "gene", "entity_name": "TOGARAM1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32747439", "32453716" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Joubert syndrome 37, MIM# 619185" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.756", "version_created": "2026-04-24T13:54:47.562690+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0821", "CIRL1", "LEC2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20973", "gene_name": "adhesion G protein-coupled receptor L1", "omim_gene": [ "616416" ], "alias_name": null, "gene_symbol": "ADGRL1", "hgnc_symbol": "ADGRL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:14260750-14316999", "ensembl_id": "ENSG00000072071" } }, "GRch38": { "90": { "location": "19:14147743-14206187", "ensembl_id": "ENSG00000072071" } } }, "hgnc_date_symbol_changed": "2015-03-03" }, "entity_type": "gene", "entity_name": "ADGRL1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 35907405" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Developmental delay, behavioral abnormalities, and neuropsychiatric disorders, MIM# 620065" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.756", "version_created": "2026-04-24T13:54:47.562690+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "TP53BPL", "LUN" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21653", "gene_name": "TOP1 binding arginine/serine rich protein", "omim_gene": [ "609507" ], "alias_name": null, "gene_symbol": "TOPORS", "hgnc_symbol": "TOPORS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:32540542-32552551", "ensembl_id": "ENSG00000197579" } }, "GRch38": { "90": { "location": "9:32540544-32552553", "ensembl_id": "ENSG00000197579" } } }, "hgnc_date_symbol_changed": "2003-07-07" }, "entity_type": "gene", "entity_name": "TOPORS", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review", "Emory Genetics Laboratory" ], "phenotypes": [], "mode_of_inheritance": "", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.433", "version_created": "2026-04-23T20:38:03.561440+10:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC13379", "HSPC244", "JBTS2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25018", "gene_name": "transmembrane protein 216", "omim_gene": [ "613277" ], "alias_name": null, "gene_symbol": "TMEM216", "hgnc_symbol": "TMEM216", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:61159159-61166335", "ensembl_id": "ENSG00000187049" } }, "GRch38": { "90": { "location": "11:61391687-61398863", "ensembl_id": "ENSG00000187049" } } }, "hgnc_date_symbol_changed": "2008-06-10" }, "entity_type": "gene", "entity_name": "TMEM216", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Illumina TruGenome Clinical Sequencing Services", "UKGTN", "Radboud University Medical Center, Nijmegen", "Expert Review Green", "NHS GMS", "Expert list", "Emory Genetics Laboratory", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Meckel syndrome 2 603194", "Joubert syndrome 2 608091" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.433", "version_created": "2026-04-23T20:38:03.561440+10:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2910", "gene_name": "delta like canonical Notch ligand 4", "omim_gene": [ "605185" ], "alias_name": null, "gene_symbol": "DLL4", "hgnc_symbol": "DLL4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:41221538-41231237", "ensembl_id": "ENSG00000128917" } }, "GRch38": { "90": { "location": "15:40929340-40939072", "ensembl_id": "ENSG00000128917" } } }, "hgnc_date_symbol_changed": "2000-07-31" }, "entity_type": "gene", "entity_name": "DLL4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26299364" ], "evidence": [ "Expert Review Green", "Expert Review Green", "Other", "NHS GMS", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Adams-Oliver syndrome 6, 616589" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.433", "version_created": "2026-04-23T20:38:03.561440+10:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:6469", "gene_name": "kynureninase", "omim_gene": [ "605197" ], "alias_name": [ "L-kynurenine hydrolase" ], "gene_symbol": "KYNU", "hgnc_symbol": "KYNU", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:143635067-143799890", "ensembl_id": "ENSG00000115919" } }, "GRch38": { "90": { "location": "2:142877498-143055832", "ensembl_id": "ENSG00000115919" } } }, "hgnc_date_symbol_changed": "1999-09-20" }, "entity_type": "gene", "entity_name": "KYNU", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17334708", "28792876", "31923704" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "NHS GMS", "NHS GMS" ], "phenotypes": [ "Hydroxykynureninuria MIM#236800", "Vertebral, cardiac, renal, and limb defects syndrome 2 MIM#617661", "Disorders of histidine, tryptophan or lysine metabolism" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.433", "version_created": "2026-04-23T20:38:03.561440+10:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0123", "Alpha-MPP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18667", "gene_name": "peptidase, mitochondrial processing alpha subunit", "omim_gene": [ "613036" ], "alias_name": null, "gene_symbol": "PMPCA", "hgnc_symbol": "PMPCA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:139305110-139318213", "ensembl_id": "ENSG00000165688" } }, "GRch38": { "90": { "location": "9:136410570-136423761", "ensembl_id": "ENSG00000165688" } } }, "hgnc_date_symbol_changed": "2003-06-20" }, "entity_type": "gene", "entity_name": "PMPCA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25808372", "26657514", "33272776", "30617178" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CSNB3", "rd1", "RP40", "CSNBAD2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8786", "gene_name": "phosphodiesterase 6B", "omim_gene": [ "180072" ], "alias_name": [ "congenital stationary night blindness 3, autosomal dominant" ], "gene_symbol": "PDE6B", "hgnc_symbol": "PDE6B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:619373-664571", "ensembl_id": "ENSG00000133256" } }, "GRch38": { "90": { "location": "4:625584-670782", "ensembl_id": "ENSG00000133256" } } }, "hgnc_date_symbol_changed": "1991-01-15" }, "entity_type": "gene", "entity_name": "PDE6B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17044014", "24760071", "8075643" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Night blindness, congenital stationary, autosomal dominant 2, 163500", "Retinitis pigmentosa" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 283, "hash_id": null, "name": "Congenital Stationary Night Blindness", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by RMH and is a consensus panel used by VCGS.\r\n\r\nConsider using the broader Retinal Disorders superpanel when ophthalmological findings are not specific for this sub-group of disorders, particularly in individuals early in the diagnostic trajectory or where additional features are present.", "status": "public", "version": "0.24", "version_created": "2026-01-09T18:46:33.929328+11:00", "relevant_disorders": [ "Congenital stationary night blindness", "HP:0007642; Retinal dystrophy", "HP:0000556" ], "stats": { "number_of_genes": 21, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CG22", "CKAPI" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1989", "gene_name": "tubulin folding cofactor B", "omim_gene": [ "601303" ], "alias_name": null, "gene_symbol": "TBCB", "hgnc_symbol": "TBCB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:36605191-36616849", "ensembl_id": "ENSG00000105254" } }, "GRch38": { "90": { "location": "19:36114289-36125947", "ensembl_id": "ENSG00000105254" } } }, "hgnc_date_symbol_changed": "2006-11-22" }, "entity_type": "gene", "entity_name": "TBCB", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 40856104" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SPAX2", "SPG58" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6317", "gene_name": "kinesin family member 1C", "omim_gene": [ "603060" ], "alias_name": null, "gene_symbol": "KIF1C", "hgnc_symbol": "KIF1C", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:4901243-4931696", "ensembl_id": "ENSG00000129250" } }, "GRch38": { "90": { "location": "17:4997948-5028401", "ensembl_id": "ENSG00000129250" } } }, "hgnc_date_symbol_changed": "1998-09-25" }, "entity_type": "gene", "entity_name": "KIF1C", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24482476", "24319291", "31413903", "29544888" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Spastic ataxia 2, autosomal recessive, 611302", "Spastic ataxia 2, autosomal recessive" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:610", "gene_name": "apolipoprotein C3", "omim_gene": [ "107720" ], "alias_name": null, "gene_symbol": "APOC3", "hgnc_symbol": "APOC3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:116700422-116703788", "ensembl_id": "ENSG00000110245" } }, "GRch38": { "90": { "location": "11:116829706-116833072", "ensembl_id": "ENSG00000110245" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "APOC3", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "PMID: 19074352" ], "evidence": [ "Expert Review Red", "Royal Melbourne Hospital" ], "phenotypes": [ "Apolipoprotein C-III deficiency MIM#614028" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 332, "hash_id": null, "name": "Dyslipidaemia", "disease_group": "Endocrine disorders; Cardiovascular disorders", "disease_sub_group": "", "description": "This panel contains genes that cause dyslipidaemia, abnormal amount of lipids (e.g. triglycerides, cholesterol and/or fat phospholipids). It contains all the genes that cause hyperlipidaemias. It was developed for use by the Royal Melbourne Hospital endocrine genetics clinic.", "status": "public", "version": "0.51", "version_created": "2026-04-03T15:42:30.681985+11:00", "relevant_disorders": [ "Abnormal circulating lipid concentration", "HP:0003119" ], "stats": { "number_of_genes": 29, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ZCW3", "KIAA0852", "AC004542.C22.1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23573", "gene_name": "MORC family CW-type zinc finger 2", "omim_gene": [ "616661" ], "alias_name": null, "gene_symbol": "MORC2", "hgnc_symbol": "MORC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:31321117-31364284", "ensembl_id": "ENSG00000133422" } }, "GRch38": { "90": { "location": "22:30925130-30968298", "ensembl_id": "ENSG00000133422" } } }, "hgnc_date_symbol_changed": "2005-06-15" }, "entity_type": "gene", "entity_name": "MORC2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32693025", "26497905", "26659848" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ14466", "CRACM1" ], "biotype": null, "hgnc_id": "HGNC:25896", "gene_name": "ORAI calcium release-activated calcium modulator 1", "omim_gene": [ "610277" ], "alias_name": [ "calcium release-activated calcium modulator 1" ], "gene_symbol": "ORAI1", "hgnc_symbol": "ORAI1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:122064455-122080583", "ensembl_id": "ENSG00000182500" } }, "GRch38": { "90": { "location": "12:121626550-121642677", "ensembl_id": "ENSG00000276045" } } }, "hgnc_date_symbol_changed": "2007-08-14" }, "entity_type": "gene", "entity_name": "ORAI1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31448844" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Myopathy, tubular aggregate, 2 (MIM#615883)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MTPB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4803", "gene_name": "hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta", "omim_gene": [ "143450" ], "alias_name": [ "mitochondrial trifunctional protein, beta subunit" ], "gene_symbol": "HADHB", "hgnc_symbol": "HADHB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:26466038-26513336", "ensembl_id": "ENSG00000138029" } }, "GRch38": { "90": { "location": "2:26243170-26290468", "ensembl_id": "ENSG00000138029" } } }, "hgnc_date_symbol_changed": "1994-12-16" }, "entity_type": "gene", "entity_name": "HADHB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25778941", "30682426", "9259266", "29956646" ], "evidence": [ "Expert Review Green", "Literature", "NHS GMS", "Royal Melbourne Hospital", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Trifunctional protein deficiency MIM#609015" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 3084, "hash_id": null, "name": "Rhabdomyolysis and Metabolic Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where rhabdomyolysis, exercise intolerance, and metabolic myopathy are a presenting or prominent feature. It was developed and maintained by the Royal Melbourne Hospital. It is a consensus panel used by VCGS.\r\n\r\nDepending on the clinical features present, consider applying additional panels such as Mitochondrial Disorders or the Myopathy Superpanel.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Rhabdomyolysis and metabolic muscle disorders' panel V1.42 on 8/10/2020, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.46", "version_created": "2026-03-31T19:05:14.301918+11:00", "relevant_disorders": [ "Rhabdomyolysis", "HP:0003201;Exercise intolerance", "HP:0003546;Metabolic myopathy", "MONDO:0020123" ], "stats": { "number_of_genes": 124, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0840", "FBL7", "FBL6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13604", "gene_name": "F-box and leucine rich repeat protein 7", "omim_gene": [ "605656" ], "alias_name": null, "gene_symbol": "FBXL7", "hgnc_symbol": "FBXL7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:15500305-15939900", "ensembl_id": "ENSG00000183580" } }, "GRch38": { "90": { "location": "5:15500196-15939795", "ensembl_id": "ENSG00000183580" } } }, "hgnc_date_symbol_changed": "2000-09-27" }, "entity_type": "gene", "entity_name": "FBXL7", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31633297" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Hennekam syndrome", "lymphedema" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3098, "hash_id": null, "name": "Lymphoedema", "disease_group": "Cardiovascular disorders", "disease_sub_group": "Lymphatic Disorders", "description": "The panel contains genes associated with nonsyndromic and syndromic lymphoedema.", "status": "public", "version": "0.32", "version_created": "2026-02-06T22:04:55.315713+11:00", "relevant_disorders": [ "Lymphedema", "HP:0001004" ], "stats": { "number_of_genes": 59, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11073", "gene_name": "solute carrier family 9 member A3", "omim_gene": [ "182307" ], "alias_name": null, "gene_symbol": "SLC9A3", "hgnc_symbol": "SLC9A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:473425-524447", "ensembl_id": "ENSG00000066230" } }, "GRch38": { "90": { "location": "5:473310-524332", "ensembl_id": "ENSG00000066230" } } }, "hgnc_date_symbol_changed": "1992-06-12" }, "entity_type": "gene", "entity_name": "SLC9A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Diarrhea 8, secretory sodium, congenital, 616868 (3), Autosomal recessive" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DC47", "MRP-S36" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16631", "gene_name": "mitochondrial ribosomal protein S36", "omim_gene": [ "611996" ], "alias_name": null, "gene_symbol": "MRPS36", "hgnc_symbol": "MRPS36", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:68513587-68525956", "ensembl_id": "ENSG00000134056" } }, "GRch38": { "90": { "location": "5:69217760-69230129", "ensembl_id": "ENSG00000134056" } } }, "hgnc_date_symbol_changed": "2001-09-20" }, "entity_type": "gene", "entity_name": "MRPS36", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 41018056", "38685873" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3270, "hash_id": null, "name": "Cardiomyopathy_Paediatric", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "With thanks to Genomics England PanelApp for the original design of this panel.\r\n\r\nThis panel contains genes associated with childhood-onset cardiomyopathy, including as part of syndromic and metabolic conditions. It is maintained by VCGS.", "status": "public", "version": "0.229", "version_created": "2026-03-31T18:53:53.165018+11:00", "relevant_disorders": [ "Cardiomyopathy", "HP:0001638;Abnormality of the myocardium", "HP:0001637" ], "stats": { "number_of_genes": 252, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MSF1", "KIAA0991", "PNUTL4", "AF17q25", "SeptD1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7323", "gene_name": "septin 9", "omim_gene": [ "604061" ], "alias_name": [ "Ov/Br septin" ], "gene_symbol": "SEPT9", "hgnc_symbol": "SEPT9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:75276651-75496678", "ensembl_id": "ENSG00000184640" } }, "GRch38": { "90": { "location": "17:77280569-77500596", "ensembl_id": "ENSG00000184640" } } }, "hgnc_date_symbol_changed": "2005-01-12" }, "entity_type": "gene", "entity_name": "SEPT9", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Amyotrophy, hereditary neuralgic" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3974", "gene_name": "formimidoyltransferase cyclodeaminase", "omim_gene": [ "606806" ], "alias_name": null, "gene_symbol": "FTCD", "hgnc_symbol": "FTCD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:47556176-47575481", "ensembl_id": "ENSG00000160282" } }, "GRch38": { "90": { "location": "21:46136262-46155567", "ensembl_id": "ENSG00000160282" } } }, "hgnc_date_symbol_changed": "1999-07-23" }, "entity_type": "gene", "entity_name": "FTCD", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Glutamate formiminotransferase deficiency" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ATF1", "ATF2", "HFB1-GDNF" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4232", "gene_name": "glial cell derived neurotrophic factor", "omim_gene": [ "600837" ], "alias_name": [ "astrocyte-derived trophic factor", "glial cell line derived neurotrophic factor", "glial derived neurotrophic factor" ], "gene_symbol": "GDNF", "hgnc_symbol": "GDNF", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:37812779-37839788", "ensembl_id": "ENSG00000168621" } }, "GRch38": { "90": { "location": "5:37812677-37839686", "ensembl_id": "ENSG00000168621" } } }, "hgnc_date_symbol_changed": "1995-05-04" }, "entity_type": "gene", "entity_name": "GDNF", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Hirschsprung disease", "Central hypoventilation syndrome" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "QP-C", "QCR7", "UQCR6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12582", "gene_name": "ubiquinol-cytochrome c reductase binding protein", "omim_gene": [ "191330" ], "alias_name": [ "ubiquinol-cytochrome c reductase, complex III subunit VI", "cytochrome b-c1 complex subunit 7" ], "gene_symbol": "UQCRB", "hgnc_symbol": "UQCRB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:97238148-97247862", "ensembl_id": "ENSG00000156467" } }, "GRch38": { "90": { "location": "8:96225920-96235634", "ensembl_id": "ENSG00000156467" } } }, "hgnc_date_symbol_changed": "1991-08-20" }, "entity_type": "gene", "entity_name": "UQCRB", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Mitochondrial complex III deficiency" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ39501" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26820", "gene_name": "cytochrome P450 family 4 subfamily F member 22", "omim_gene": [ "611495" ], "alias_name": null, "gene_symbol": "CYP4F22", "hgnc_symbol": "CYP4F22", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:15619304-15663128", "ensembl_id": "ENSG00000171954" } }, "GRch38": { "90": { "location": "19:15508493-15552317", "ensembl_id": "ENSG00000171954" } } }, "hgnc_date_symbol_changed": "2007-05-18" }, "entity_type": "gene", "entity_name": "CYP4F22", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Ichthyosis, congenital, autosomal recessive" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "D6S586E" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1802", "gene_name": "corneodesmosin", "omim_gene": [ "602593" ], "alias_name": null, "gene_symbol": "CDSN", "hgnc_symbol": "CDSN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:31082867-31088223", "ensembl_id": "ENSG00000204539" } }, "GRch38": { "90": { "location": "6:31115090-31120446", "ensembl_id": "ENSG00000204539" } } }, "hgnc_date_symbol_changed": "1998-05-14" }, "entity_type": "gene", "entity_name": "CDSN", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Hypotrichosis" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MASS", "OCTD", "SGS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3603", "gene_name": "fibrillin 1", "omim_gene": [ "134797" ], "alias_name": [ "Marfan syndrome", "asprosin" ], "gene_symbol": "FBN1", "hgnc_symbol": "FBN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:48700503-48938046", "ensembl_id": "ENSG00000166147" } }, "GRch38": { "90": { "location": "15:48408306-48645849", "ensembl_id": "ENSG00000166147" } } }, "hgnc_date_symbol_changed": "1987-09-11" }, "entity_type": "gene", "entity_name": "FBN1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BabySeq Category C gene", "BabySeq Category A gene" ], "phenotypes": [ "Marfan's syndrome", "Weill-Marchesani syndrome 2, dominant", "Shprintzen-Goldberg syndrome" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "cblA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18871", "gene_name": "methylmalonic aciduria (cobalamin deficiency) cblA type", "omim_gene": [ "607481" ], "alias_name": null, "gene_symbol": "MMAA", "hgnc_symbol": "MMAA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:146539415-146581187", "ensembl_id": "ENSG00000151611" } }, "GRch38": { "90": { "location": "4:145618263-145660035", "ensembl_id": "ENSG00000151611" } } }, "hgnc_date_symbol_changed": "2003-02-11" }, "entity_type": "gene", "entity_name": "MMAA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Methylmalonic aciduria, vitamin B12-responsive" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1034", "FLJ21474" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21637", "gene_name": "SATB homeobox 2", "omim_gene": [ "608148" ], "alias_name": null, "gene_symbol": "SATB2", "hgnc_symbol": "SATB2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:200134223-200335989", "ensembl_id": "ENSG00000119042" } }, "GRch38": { "90": { "location": "2:199269500-199471266", "ensembl_id": "ENSG00000119042" } } }, "hgnc_date_symbol_changed": "2003-07-08" }, "entity_type": "gene", "entity_name": "SATB2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16179223", "29023086", "28151491", "32446642" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Radboud University Medical Center, Nijmegen", "UKGTN" ], "phenotypes": [ "Glass syndrome, MIM# 612313", "MONDO:0100147" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "IDN3", "DKFZp434L1319", "FLJ11203", "FLJ12597", "FLJ13354", "FLJ13648", "Scc2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28862", "gene_name": "NIPBL, cohesin loading factor", "omim_gene": [ "608667" ], "alias_name": [ "sister chromatid cohesion 2 homolog (yeast)" ], "gene_symbol": "NIPBL", "hgnc_symbol": "NIPBL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:36876861-37066515", "ensembl_id": "ENSG00000164190" } }, "GRch38": { "90": { "location": "5:36876759-37066413", "ensembl_id": "ENSG00000164190" } } }, "hgnc_date_symbol_changed": "2004-07-21" }, "entity_type": "gene", "entity_name": "NIPBL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16604071", "20358602", "16236812", "17661813" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Cornelia de Lange syndrome 1, MIM # 122470" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3631, "hash_id": null, "name": "Growth failure", "disease_group": "", "disease_sub_group": "", "description": "This panel contains genes associated with growth failure in infancy/early childhood, either isolated or as part of another disorder.\r\n\r\nConsider applying this panel in individuals with:\r\n -Height Standard Deviation Score (SDS) <-3 (very significant short stature - well below the 0.4th centile)\r\nAND at least one of:\r\n- History of small for gestational age (birth weight and/or length <-2SDS)\r\n- Body disproportion, e.g. discrepancy between stature and head size\r\n- Dysmorphic features and congenital anomalies\r\n- Abnormalities in the GH-IGF axis (evidence of GH insensitivity or deficiency) and/or other pituitary hormonal deficiencies\r\n- Family history of significant short stature (1st and 2nd degree relatives) and/or consanguinity\r\n\r\nPrior to genomic testing consider:\r\n-Chromosomal microarray analysis (e.g. Turner syndrome)\r\n-Methylation analysis for Russell-Silver syndrome and Temple syndrome\r\n-Skeletal survey\r\n\r\nAcquired causes of short stature are relatively common.\r\n\r\nDepending on the specific clinical features present, consider applying the Skeletal dysplasia, Intellectual Disability, and/or Pituitary Hormone deficiency panels.\r\n\r\nWith thanks to Genomics England for the original design of this panel.", "status": "public", "version": "1.103", "version_created": "2026-04-22T15:49:55.410983+10:00", "relevant_disorders": [ "Failure to thrive", "HP:0001508; Growth delay", "HP:0001510" ], "stats": { "number_of_genes": 204, "number_of_strs": 0, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BLOC3S1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5163", "gene_name": "HPS1, biogenesis of lysosomal organelles complex 3 subunit 1", "omim_gene": [ "604982" ], "alias_name": null, "gene_symbol": "HPS1", "hgnc_symbol": "HPS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:100175955-100206684", "ensembl_id": "ENSG00000107521" } }, "GRch38": { "90": { "location": "10:98416198-98446947", "ensembl_id": "ENSG00000107521" } } }, "hgnc_date_symbol_changed": "2002-05-01" }, "entity_type": "gene", "entity_name": "HPS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9705234", "10971344", "9497254", "7573033" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "NHS Genomic Medicine Service", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hermansky-Pudlak syndrome 1, MIM# 203300", "MONDO:0008748" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3762, "hash_id": null, "name": "Congenital nystagmus", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with isolated or syndromic nystagmus presenting in infancy or early childhood.", "status": "public", "version": "1.24", "version_created": "2026-01-26T13:26:36.043723+11:00", "relevant_disorders": [ "Nystagmus HP:0000639" ], "stats": { "number_of_genes": 84, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0833" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18806", "gene_name": "calmodulin binding transcription activator 1", "omim_gene": [ "611501" ], "alias_name": null, "gene_symbol": "CAMTA1", "hgnc_symbol": "CAMTA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:6845384-7829766", "ensembl_id": "ENSG00000171735" } }, "GRch38": { "90": { "location": "1:6785324-7769706", "ensembl_id": "ENSG00000171735" } } }, "hgnc_date_symbol_changed": "2002-06-20" }, "entity_type": "gene", "entity_name": "CAMTA1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32157189", "22693284" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Cerebellar ataxia, nonprogressive, with mental retardation (614756 AD)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TMPT27", "TPARL", "GDT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30760", "gene_name": "transmembrane protein 165", "omim_gene": [ "614726" ], "alias_name": [ "TPA regulated locus" ], "gene_symbol": "TMEM165", "hgnc_symbol": "TMEM165", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:56262124-56319564", "ensembl_id": "ENSG00000134851" } }, "GRch38": { "90": { "location": "4:55395957-55453397", "ensembl_id": "ENSG00000134851" } } }, "hgnc_date_symbol_changed": "2006-07-17" }, "entity_type": "gene", "entity_name": "TMEM165", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22683087", "28323990", "27401145", "27008884", "26238249", "25609749" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Congenital disorder of glycosylation, type IIk, MIM# 614727", "TMEM165-CDG, MONDO:0013870" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PTC", "CDHF12", "RET51", "CDHR16" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9967", "gene_name": "ret proto-oncogene", "omim_gene": [ "164761" ], "alias_name": [ "cadherin-related family member 16", "RET receptor tyrosine kinase", "rearranged during transfection" ], "gene_symbol": "RET", "hgnc_symbol": "RET", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:43572475-43625799", "ensembl_id": "ENSG00000165731" } }, "GRch38": { "90": { "location": "10:43077027-43130351", "ensembl_id": "ENSG00000165731" } } }, "hgnc_date_symbol_changed": "1990-07-15" }, "entity_type": "gene", "entity_name": "RET", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Central hypoventilation syndrome, congenital, MIM#209880", "Multiple endocrine neoplasia IIA, MIM#171400", "Multiple endocrine neoplasia IIB, MIM#162300" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RPC1", "RPC155", "hRPC155" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30074", "gene_name": "RNA polymerase III subunit A", "omim_gene": [ "614258" ], "alias_name": null, "gene_symbol": "POLR3A", "hgnc_symbol": "POLR3A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:79734907-79789303", "ensembl_id": "ENSG00000148606" } }, "GRch38": { "90": { "location": "10:77969251-78029545", "ensembl_id": "ENSG00000148606" } } }, "hgnc_date_symbol_changed": "2004-09-16" }, "entity_type": "gene", "entity_name": "POLR3A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30323018" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Wiedemann-Rautenstrauch syndrome, MIM# 264090" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GSD1b", "GSD1c", "GSD1d" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4061", "gene_name": "solute carrier family 37 member 4", "omim_gene": [ "602671" ], "alias_name": null, "gene_symbol": "SLC37A4", "hgnc_symbol": "SLC37A4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:118894824-118901616", "ensembl_id": "ENSG00000137700" } }, "GRch38": { "90": { "location": "11:119024114-119030906", "ensembl_id": "ENSG00000137700" } } }, "hgnc_date_symbol_changed": "2003-09-10" }, "entity_type": "gene", "entity_name": "SLC37A4", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32884905", "33728255", "33964207" ], "evidence": [ "Expert Review Amber", "Genomics England PanelApp", "Literature", "Literature" ], "phenotypes": [ "Glycogen storage disease Ib 232220", "Congenital disorder of glycosylation, type IIw 619525" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SSADH", "SSDH" ], "biotype": "protein_coding", "hgnc_id": "HGNC:408", "gene_name": "aldehyde dehydrogenase 5 family member A1", "omim_gene": [ "610045" ], "alias_name": [ "succinate-semialdehyde dehydrogenase" ], "gene_symbol": "ALDH5A1", "hgnc_symbol": "ALDH5A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:24495080-24537435", "ensembl_id": "ENSG00000112294" } }, "GRch38": { "90": { "location": "6:24494852-24537207", "ensembl_id": "ENSG00000112294" } } }, "hgnc_date_symbol_changed": "1999-06-11" }, "entity_type": "gene", "entity_name": "ALDH5A1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "14635103" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Succinic semialdehyde dehydrogenase deficiency, MIM# 271980" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HYPB", "HIF-1", "KIAA1732", "FLJ23184", "KMT3A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18420", "gene_name": "SET domain containing 2", "omim_gene": [ "612778" ], "alias_name": null, "gene_symbol": "SETD2", "hgnc_symbol": "SETD2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:47057919-47205457", "ensembl_id": "ENSG00000181555" } }, "GRch38": { "90": { "location": "3:47016429-47163967", "ensembl_id": "ENSG00000181555" } } }, "hgnc_date_symbol_changed": "2006-02-15" }, "entity_type": "gene", "entity_name": "SETD2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29681085" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Luscan-Lumish syndrome, MIM#616831" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ44734", "IGF-II" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5466", "gene_name": "insulin like growth factor 2", "omim_gene": [ "147470" ], "alias_name": [ "somatomedin A", "preptin" ], "gene_symbol": "IGF2", "hgnc_symbol": "IGF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:2150342-2170833", "ensembl_id": "ENSG00000167244" } }, "GRch38": { "90": { "location": "11:2129112-2141238", "ensembl_id": "ENSG00000167244" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "IGF2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31544945", "26154720" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Literature", "Genetic Health Queensland" ], "phenotypes": [ "Growth restriction, severe, with distinctive facies, MIM#616489" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "gene", "entity_name": "HOXA13", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome, MIM# 140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HBGF-3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3681", "gene_name": "fibroblast growth factor 3", "omim_gene": [ "164950" ], "alias_name": [ "INT-2 proto-oncogene protein", "oncogene INT2", "V-INT2 murine mammary tumor virus integration site oncogene homolog", "murine mammary tumor virus integration site 2, mouse" ], "gene_symbol": "FGF3", "hgnc_symbol": "FGF3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:69624992-69633792", "ensembl_id": "ENSG00000186895" } }, "GRch38": { "90": { "location": "11:69810224-69819024", "ensembl_id": "ENSG00000186895" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "FGF3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21480479", "21306635", "18435799", "17236138", "21306635", "18701883", "8223243", "26995070", "29902227", "30504125" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Deafness, congenital with inner ear agenesis, microtia, and microdontia, MIM#610706" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:969", "gene_name": "Bardet-Biedl syndrome 4", "omim_gene": [ "600374" ], "alias_name": null, "gene_symbol": "BBS4", "hgnc_symbol": "BBS4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:72978527-73030817", "ensembl_id": "ENSG00000140463" } }, "GRch38": { "90": { "location": "15:72686179-72738476", "ensembl_id": "ENSG00000140463" } } }, "hgnc_date_symbol_changed": "1995-07-11" }, "entity_type": "gene", "entity_name": "BBS4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28425981", "12016587", "11381270" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "KidGen_CilioNephronop v38.1.0" ], "phenotypes": [ "Bardet-Biedl syndrome 4, MIM#615982", "MONDO:0014433" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CGRPR", "CRLR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16709", "gene_name": "calcitonin receptor like receptor", "omim_gene": [ "114190" ], "alias_name": null, "gene_symbol": "CALCRL", "hgnc_symbol": "CALCRL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:188207856-188313187", "ensembl_id": "ENSG00000064989" } }, "GRch38": { "90": { "location": "2:187343129-187448460", "ensembl_id": "ENSG00000064989" } } }, "hgnc_date_symbol_changed": "2001-10-02" }, "entity_type": "gene", "entity_name": "CALCRL", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16537897", "30115739" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp", "Literature" ], "phenotypes": [ "Lymphatic malformation 8, MONDO:0032907", "Lymphatic malformation 8, OMIM:618773", "Hydrops fetalis" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MWFE", "CI-MWFE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7683", "gene_name": "NADH:ubiquinone oxidoreductase subunit A1", "omim_gene": [ "300078" ], "alias_name": [ "NADH:ubiquinone oxidoreductase (complex 1)", "type I dehydrogenase", "NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)", "complex I MWFE subunit" ], "gene_symbol": "NDUFA1", "hgnc_symbol": "NDUFA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:119005450-119010625", "ensembl_id": "ENSG00000125356" } }, "GRch38": { "90": { "location": "X:119871487-119876662", "ensembl_id": "ENSG00000125356" } } }, "hgnc_date_symbol_changed": "1996-08-16" }, "entity_type": "gene", "entity_name": "NDUFA1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29506883", "19185523", "17262856", "21596602" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp" ], "phenotypes": [ "Mitochondrial complex I deficiency, nuclear type 12 MIM#301020" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.567", "version_created": "2026-04-23T20:40:49.710516+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LEAP-1", "HEPC", "HFE2B", "LEAP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15598", "gene_name": "hepcidin antimicrobial peptide", "omim_gene": [ "606464" ], "alias_name": null, "gene_symbol": "HAMP", "hgnc_symbol": "HAMP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:35771619-35776046", "ensembl_id": "ENSG00000105697" } }, "GRch38": { "90": { "location": "19:35280716-35285143", "ensembl_id": "ENSG00000105697" } } }, "hgnc_date_symbol_changed": "2001-05-29" }, "entity_type": "gene", "entity_name": "HAMP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12469120", "12490283", "34828384", "15198949" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Haemochromatosis, type 2B MIM#613313" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.17", "version_created": "2026-04-24T17:00:21.626497+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CATCH22" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11592", "gene_name": "T-box 1", "omim_gene": [ "602054" ], "alias_name": null, "gene_symbol": "TBX1", "hgnc_symbol": "TBX1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:19744226-19771116", "ensembl_id": "ENSG00000184058" } }, "GRch38": { "90": { "location": "22:19756703-19783593", "ensembl_id": "ENSG00000184058" } } }, "hgnc_date_symbol_changed": "1997-05-15" }, "entity_type": "gene", "entity_name": "TBX1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "20301696", "16684884", "14585638", "30137364" ], "evidence": [ "Expert Review Green", "Literature", "Expert list" ], "phenotypes": [ "DiGeorge syndrome MIM# 188400", "Velocardiofacial syndrome MIM# 192430", "Decreased T cells", "Hypoparathyroidism", "Conotruncal cardiac malformation", "velopalatal insufficiency", "abnormal facies (cleft palate, prominent tubular nose etc)", "intellectual disability", "Immunodeficiency", "thymic hypoplasia or aplasia with resultant T‐cell dysfunction", "renal anomalies", "autoimmunity" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3894, "hash_id": null, "name": "Familial hypoparathyroidism", "disease_group": "Endocrine disorders", "disease_sub_group": "Calcium disorders", "description": "This panel contains genes associated with familial hypoparathyroidism. \r\n\r\nIt has been compared against the Genomics England PanelApp 'familial hypoparathyroidism' panel V3.1, with all discrepancies reviewed and resolved (August 2025).", "status": "public", "version": "1.13", "version_created": "2026-01-29T12:46:06.444681+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 8, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CD107b" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6501", "gene_name": "lysosomal associated membrane protein 2", "omim_gene": [ "309060" ], "alias_name": null, "gene_symbol": "LAMP2", "hgnc_symbol": "LAMP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:119561682-119603220", "ensembl_id": "ENSG00000005893" } }, "GRch38": { "90": { "location": "X:120427827-120469365", "ensembl_id": "ENSG00000005893" } } }, "hgnc_date_symbol_changed": "1990-08-03" }, "entity_type": "gene", "entity_name": "LAMP2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Amber", "BabySeq Category A gene" ], "phenotypes": [ "Danon disease, MIM# 300257" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [ "cardiac" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GHBP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4263", "gene_name": "growth hormone receptor", "omim_gene": [ "600946" ], "alias_name": [ "growth hormone binding protein" ], "gene_symbol": "GHR", "hgnc_symbol": "GHR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:42423879-42721979", "ensembl_id": "ENSG00000112964" } }, "GRch38": { "90": { "location": "5:42423777-42721878", "ensembl_id": "ENSG00000112964" } } }, "hgnc_date_symbol_changed": "1989-06-30" }, "entity_type": "gene", "entity_name": "GHR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Growth hormone insensitivity, partial, MIM# 604271", "Laron dwarfism, MIM# 262500" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [ "treatable", "endocrine" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "HSPC192", "FLJ10595", "FLJ21788", "LARS1", "LEUS", "RNTLS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6512", "gene_name": "leucyl-tRNA synthetase", "omim_gene": [ "151350" ], "alias_name": [ "leucine tRNA ligase 1, cytoplasmic" ], "gene_symbol": "LARS", "hgnc_symbol": "LARS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:145492601-145562223", "ensembl_id": "ENSG00000133706" } }, "GRch38": { "90": { "location": "5:146113038-146182660", "ensembl_id": "ENSG00000133706" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "LARS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Infantile liver failure syndrome 1, MIM# 615438" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "new gene name" ], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.1", "version_created": "2026-04-24T17:01:18.976102+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RNF69" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8851", "gene_name": "peroxisomal biogenesis factor 10", "omim_gene": [ "602859" ], "alias_name": null, "gene_symbol": "PEX10", "hgnc_symbol": "PEX10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:2336236-2345236", "ensembl_id": "ENSG00000157911" } }, "GRch38": { "90": { "location": "1:2403964-2413797", "ensembl_id": "ENSG00000157911" } } }, "hgnc_date_symbol_changed": "1998-08-05" }, "entity_type": "gene", "entity_name": "PEX10", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10862081", "21031596", "30640048" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870", "Peroxisome biogenesis disorder 6B MIM#614871" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.1", "version_created": "2026-04-24T17:01:18.976102+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SNAP-29", "CEDNIK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11133", "gene_name": "synaptosome associated protein 29", "omim_gene": [ "604202" ], "alias_name": [ "soluble 29 kDa NSF attachment protein" ], "gene_symbol": "SNAP29", "hgnc_symbol": "SNAP29", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:21213271-21245506", "ensembl_id": "ENSG00000099940" } }, "GRch38": { "90": { "location": "22:20858983-20891218", "ensembl_id": "ENSG00000099940" } } }, "hgnc_date_symbol_changed": "1998-12-17" }, "entity_type": "gene", "entity_name": "SNAP29", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29051910", "21073448", "30793783", "33977139" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.1", "version_created": "2026-04-24T17:01:18.976102+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SDR11E2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5218", "gene_name": "hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2", "omim_gene": [ "613890" ], "alias_name": [ "short chain dehydrogenase/reductase family 11E, member 2" ], "gene_symbol": "HSD3B2", "hgnc_symbol": "HSD3B2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:119957554-119965658", "ensembl_id": "ENSG00000203859" } }, "GRch38": { "90": { "location": "1:119414931-119423035", "ensembl_id": "ENSG00000203859" } } }, "hgnc_date_symbol_changed": "1992-09-10" }, "entity_type": "gene", "entity_name": "HSD3B2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "33757164", "1363812" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Adrenal hyperplasia, congenital, due to 3-beta-hydroxysteroid dehydrogenase 2 deficiency, MIM#201810" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.1", "version_created": "2026-04-24T17:01:18.976102+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LHR", "LCGR", "LGR2", "ULG5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6585", "gene_name": "luteinizing hormone/choriogonadotropin receptor", "omim_gene": [ "152790" ], "alias_name": null, "gene_symbol": "LHCGR", "hgnc_symbol": "LHCGR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:48859428-48982880", "ensembl_id": "ENSG00000138039" } }, "GRch38": { "90": { "location": "2:48686775-48755730", "ensembl_id": "ENSG00000138039" } } }, "hgnc_date_symbol_changed": "1990-03-05" }, "entity_type": "gene", "entity_name": "LHCGR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "10714363, 8559204, 21683950", "39162678", "37462066", "32860205", "29912377", "30016538" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Luteinizing hormone resistance, female/ Leydig cell hypoplasia with pseudohermaphroditism/ Leydig cell hypoplasia with hypergonadotropic hypogonadism, MIM# 238320" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.148", "version_created": "2026-04-21T17:36:51.081048+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 266, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0111", "EIF4AIII", "Fal1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18683", "gene_name": "eukaryotic translation initiation factor 4A3", "omim_gene": [ "608546" ], "alias_name": null, "gene_symbol": "EIF4A3", "hgnc_symbol": "EIF4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78109013-78120982", "ensembl_id": "ENSG00000141543" } }, "GRch38": { "90": { "location": "17:80135214-80147183", "ensembl_id": "ENSG00000141543" } } }, "hgnc_date_symbol_changed": "2006-11-27" }, "entity_type": "str", "entity_name": "EIF4A3_RCPS_complex", "confidence_level": "3", "penetrance": null, "publications": [ "24360810", "29112243" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Robin sequence with cleft mandible and limb anomalies MIM#268305", "Richieri-Costa-Pereira syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "TCGGCAGCGGCGCAGCGAGG", "chromosome": "17", "grch37_coordinates": [ 78120803, 78120938 ], "grch38_coordinates": [ 80147004, 80147139 ], "normal_repeats": 12, "pathogenic_repeats": 14, "tags": [], "panel": { "id": 160, "hash_id": null, "name": "Pierre Robin Sequence", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.64", "version_created": "2026-04-12T14:13:00.975329+10:00", "relevant_disorders": [ "Pierre Robin sequence", "HP:0000201" ], "stats": { "number_of_genes": 55, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } } ] }