Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=199
{ "count": 36056, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=200", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=198", "results": [ { "gene_data": { "alias": [ "71-7A", "JBTS10" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2567", "gene_name": "OFD1, centriole and centriolar satellite protein", "omim_gene": [ "300170" ], "alias_name": null, "gene_symbol": "OFD1", "hgnc_symbol": "OFD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:13752832-13787480", "ensembl_id": "ENSG00000046651" } }, "GRch38": { "90": { "location": "X:13734745-13769353", "ensembl_id": "ENSG00000046651" } } }, "hgnc_date_symbol_changed": "1998-10-01" }, "entity_type": "gene", "entity_name": "OFD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Expert Review Green", "Melbourne Genomics Health Alliance Perinatal Autopsy Flagship" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 28, "hash_id": null, "name": "Skeletal Dysplasia_Fetal", "disease_group": "Skeletal disorders", "disease_sub_group": "", "description": "This panel was developed and used by the Melbourne Genomics Perinatal Autopsy Flagship. It is maintained by VCGS.\r\n\r\nIt contains genes associated with conditions primarily affecting bone and cartilage that present prenatally.\r\n\r\nPlease consider the larger Fetal Anomalies and Skeletal Dysplasia panels, or other specific panels such as Growth Failure, Craniosynostosis, Radial ray abnormalities, Polydactyly or Limb and Digital Malformations depending on the clinical presentation.", "status": "public", "version": "0.246", "version_created": "2026-03-02T10:22:48.751874+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 157, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PFM2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9349", "gene_name": "PR/SET domain 5", "omim_gene": [ "614161" ], "alias_name": null, "gene_symbol": "PRDM5", "hgnc_symbol": "PRDM5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:121606074-121844025", "ensembl_id": "ENSG00000138738" } }, "GRch38": { "90": { "location": "4:120684919-120922870", "ensembl_id": "ENSG00000138738" } } }, "hgnc_date_symbol_changed": "1999-08-23" }, "entity_type": "gene", "entity_name": "PRDM5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "28306229", "21664999" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Brittle cornea syndrome 2, MIM#614170" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 44, "hash_id": null, "name": "Aortopathy_Connective Tissue Disorders", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and is a consensus panel used by RMH.\r\n\r\nIt contains genes that cause isolated thoracic aortic aneurysm; connective tissue disorders, including Ehlers Danlos syndromes and cutis laxa; and other syndromic/multi-system disorders where connective tissue involvement is prominent.\r\n\r\nThis panel incorporates assessments from the ClinGen Familial Thoracic Aortic Aneurysm and Dissection Gene Curation Expert Panel (PMID: 30071989) and the \r\nThe 2017 international classification of the Ehlers-Danlos syndromes (PMID: 28306229).\r\n\r\nThe panel has been compared against the Genomics England PanelApp 'Thoracic Aortic Aneurysm and Dissection' and 'Ehlers Danlos syndrome' panels, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England.\r\n\r\nFurther comparison and consolidation undertaken against the Genomics England/GMS 'Thoracic aortic aneurysm and dissection' panel V4.0 in July 2025.", "status": "public", "version": "1.105", "version_created": "2026-02-05T18:09:24.690760+11:00", "relevant_disorders": [ "Aortic aneurysm", "HP:0004942;Joint dislocation", "HP:0001373;Cutis laxa", "HP:0000973; Ectopia lentis", "HP:0001083;Arachnodactyly", "HP:0001166" ], "stats": { "number_of_genes": 100, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:10586", "gene_name": "sodium voltage-gated channel beta subunit 1", "omim_gene": [ "600235" ], "alias_name": null, "gene_symbol": "SCN1B", "hgnc_symbol": "SCN1B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:35521588-35531352", "ensembl_id": "ENSG00000105711" } }, "GRch38": { "90": { "location": "19:35030466-35040449", "ensembl_id": "ENSG00000105711" } } }, "hgnc_date_symbol_changed": "1990-05-14" }, "entity_type": "gene", "entity_name": "SCN1B", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29959160" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Brugada syndrome 1, MONDO:0011001" ], "mode_of_inheritance": "Unknown", "tags": [ "disputed" ], "panel": { "id": 60, "hash_id": null, "name": "Brugada syndrome", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.46", "version_created": "2026-02-06T09:29:49.325637+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 23, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MRG1", "HsT18361" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7001", "gene_name": "Meis homeobox 2", "omim_gene": [ "601740" ], "alias_name": null, "gene_symbol": "MEIS2", "hgnc_symbol": "MEIS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:37181406-37393504", "ensembl_id": "ENSG00000134138" } }, "GRch38": { "90": { "location": "15:36889204-37101299", "ensembl_id": "ENSG00000134138" } } }, "hgnc_date_symbol_changed": "1998-02-09" }, "entity_type": "gene", "entity_name": "MEIS2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "33427397", "25712757" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cleft palate, cardiac defects, and mental retardation (MIM#600987)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.535", "version_created": "2026-04-21T11:25:32.018166+10:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 254, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PAP-A", "PAPA", "PAPA1", "PAPB", "ACLS", "PPDIV" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4319", "gene_name": "GLI family zinc finger 3", "omim_gene": [ "165240" ], "alias_name": [ "zinc finger protein GLI3", "oncogene GLI3", "DNA-binding protein" ], "gene_symbol": "GLI3", "hgnc_symbol": "GLI3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:42000548-42277469", "ensembl_id": "ENSG00000106571" } }, "GRch38": { "90": { "location": "7:41960950-42237870", "ensembl_id": "ENSG00000106571" } } }, "hgnc_date_symbol_changed": "1989-05-29" }, "entity_type": "gene", "entity_name": "GLI3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "24736735", "7211952" ], "evidence": [ "Expert Review Green", "Expert list", "Literature" ], "phenotypes": [ "Pallister-Hall syndrome, MIM# 146510", "ASD, VSD, AVSD, aortic arch anomaly, PDA" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.535", "version_created": "2026-04-21T11:25:32.018166+10:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 254, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ12571", "dyf-13", "DYF13", "IFT56" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21882", "gene_name": "tetratricopeptide repeat domain 26", "omim_gene": [ "617453" ], "alias_name": null, "gene_symbol": "TTC26", "hgnc_symbol": "TTC26", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:138818490-138876732", "ensembl_id": "ENSG00000105948" } }, "GRch38": { "90": { "location": "7:139133744-139191986", "ensembl_id": "ENSG00000105948" } } }, "hgnc_date_symbol_changed": "2006-03-17" }, "entity_type": "gene", "entity_name": "TTC26", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34177428", "32617964", "31595528", "24596149", "22718903" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Biliary, renal, neurologic, and skeletal syndrome, MIM# 619534", "Ciliopathy Syndrome with Biliary, Renal, Neurological, and Skeletal Manifestations" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 78, "hash_id": null, "name": "Cholestasis", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel was developed by and is maintained by VCGS.\r\n\r\nIt includes primary liver disorders as well as metabolic and other multi-system disorders that have been reported to cause cholestasis.\r\n\r\nPlease also consider using the Liver Failure_Paediatric panel if clinically indicated.\r\n\r\nThe content of this panel has been compared against the Genomics England PanelApp 'Cholestasis' panel V1.21, with all discrepancies reviewed and resolved, and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.10", "version_created": "2026-03-26T17:26:27.105917+11:00", "relevant_disorders": [ "Cholestasis HP:0001396" ], "stats": { "number_of_genes": 99, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ20695" ], "biotype": "protein_coding", "hgnc_id": "HGNC:22965", "gene_name": "peroxisomal biogenesis factor 26", "omim_gene": [ "608666" ], "alias_name": null, "gene_symbol": "PEX26", "hgnc_symbol": "PEX26", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:18560689-18613905", "ensembl_id": "ENSG00000215193" } }, "GRch38": { "90": { "location": "22:18077920-18131138", "ensembl_id": "ENSG00000215193" } } }, "hgnc_date_symbol_changed": "2003-08-05" }, "entity_type": "gene", "entity_name": "PEX26", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 78, "hash_id": null, "name": "Cholestasis", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel was developed by and is maintained by VCGS.\r\n\r\nIt includes primary liver disorders as well as metabolic and other multi-system disorders that have been reported to cause cholestasis.\r\n\r\nPlease also consider using the Liver Failure_Paediatric panel if clinically indicated.\r\n\r\nThe content of this panel has been compared against the Genomics England PanelApp 'Cholestasis' panel V1.21, with all discrepancies reviewed and resolved, and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.10", "version_created": "2026-03-26T17:26:27.105917+11:00", "relevant_disorders": [ "Cholestasis HP:0001396" ], "stats": { "number_of_genes": 99, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PRO19563" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18053", "gene_name": "polycystin 1 like 1, transient receptor potential channel interacting", "omim_gene": [ "609721" ], "alias_name": [ "polycystin-1L1" ], "gene_symbol": "PKD1L1", "hgnc_symbol": "PKD1L1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:47814250-47988088", "ensembl_id": "ENSG00000158683" } }, "GRch38": { "90": { "location": "7:47774652-47948491", "ensembl_id": "ENSG00000158683" } } }, "hgnc_date_symbol_changed": "2002-03-21" }, "entity_type": "gene", "entity_name": "PKD1L1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27616478", "30664273", "20080492", "31026592" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Heterotaxy, visceral, 8, autosomal (MIM#617205)", "heterotaxy and congenital heart disease without pulmonary ciliary dyskinesia" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 108, "hash_id": null, "name": "Heterotaxy", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Laterality disorders and isomerism' panel V1.19, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.45", "version_created": "2026-03-17T16:09:39.911604+11:00", "relevant_disorders": [ "Heterotaxy", "HP:0030853; Dextrocardia", "HP:0001651; Asplenia", "HP:0001746; Abnormal spatial orientation of cardiac segments", "HP:0011534; Polysplenia", "HP:0001748;Midline liver", "HP:0034188" ], "stats": { "number_of_genes": 67, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TNSALP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:438", "gene_name": "alkaline phosphatase, liver/bone/kidney", "omim_gene": [ "171760" ], "alias_name": null, "gene_symbol": "ALPL", "hgnc_symbol": "ALPL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:21835858-21904905", "ensembl_id": "ENSG00000162551" } }, "GRch38": { "90": { "location": "1:21509372-21578412", "ensembl_id": "ENSG00000162551" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "ALPL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hypophosphatasia, infantile, MIM# 241500" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 122, "hash_id": null, "name": "Hypophosphataemia or rickets", "disease_group": "Endocrine disorders; Skeletal disorders", "disease_sub_group": "", "description": "This panel contains genes associated with hypophosphataemia or rickets. \r\n\r\nIt has been compared against the Genomics England PanelApp 'hypophosphataemia or rickets' panel V4.1, with all discrepancies reviewed and resolved (October 2025).", "status": "public", "version": "0.53", "version_created": "2026-02-05T11:00:41.159014+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 19, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC71996", "NBIA3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3999", "gene_name": "ferritin light chain", "omim_gene": [ "134790" ], "alias_name": [ "ferritin light polypeptide-like 3", "L apoferritin", "ferritin L subunit", "ferritin light chain", "ferritin L-chain", "neurodegeneration with brain iron accumulation 3" ], "gene_symbol": "FTL", "hgnc_symbol": "FTL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:49468558-49470135", "ensembl_id": "ENSG00000087086" } }, "GRch38": { "90": { "location": "19:48965301-48966878", "ensembl_id": "ENSG00000087086" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "FTL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11438811", "18854324", "15099026", "15173247" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Melbourne Genomics Health Alliance Complex Neurology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Neurodegeneration with brain iron accumulation 3, MIM# 606159" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "neurological" ], "panel": { "id": 126, "hash_id": null, "name": "Incidentalome", "disease_group": "", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with adult-onset cardiac, cancer and neurodegenerative disorders.\r\n\r\nThese genes are excluded from the Mendeliome panel to enable the use of the Mendeliome for panel-agnostic analysis in complex paediatric cases, while minimising the chance of incidental findings related to adult-onset conditions.\r\n\r\nIf analysis of these genes is required, the relevant panel should be requested (e.g. Adult Additional Findings; Neurodegenerative Disease_Adult Onset; Breast Cancer etc).", "status": "public", "version": "0.433", "version_created": "2026-03-25T17:03:27.624542+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 161, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Atoh5", "Math4B", "ngn3", "bHLHa7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13806", "gene_name": "neurogenin 3", "omim_gene": [ "604882" ], "alias_name": null, "gene_symbol": "NEUROG3", "hgnc_symbol": "NEUROG3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:71331454-71332994", "ensembl_id": "ENSG00000122859" } }, "GRch38": { "90": { "location": "10:69571698-69573238", "ensembl_id": "ENSG00000122859" } } }, "hgnc_date_symbol_changed": "2000-11-28" }, "entity_type": "gene", "entity_name": "NEUROG3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16855267", "32574610", "28724572", "21490072" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Diarrhoea 4, malabsorptive, congenital, MIM# 610370" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:8772", "gene_name": "phosphodiesterase 10A", "omim_gene": [ "610652" ], "alias_name": [ "cAMP and cAMP-inhibited cGMP 3',5'-cyclic phosphodiesterase 10A" ], "gene_symbol": "PDE10A", "hgnc_symbol": "PDE10A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:165740776-166400091", "ensembl_id": "ENSG00000112541" } }, "GRch38": { "90": { "location": "6:165327287-165986603", "ensembl_id": "ENSG00000112541" } } }, "hgnc_date_symbol_changed": "1999-07-30" }, "entity_type": "gene", "entity_name": "PDE10A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27058446", "27058447" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Dyskinesia, limb and orofacial, infantile-onset, MIM#616921", "Striatal degeneration, autosomal dominant, MIM# 616922" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0436" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30228", "gene_name": "prolyl endopeptidase-like", "omim_gene": [ "609557" ], "alias_name": null, "gene_symbol": "PREPL", "hgnc_symbol": "PREPL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:44543420-44589001", "ensembl_id": "ENSG00000138078" } }, "GRch38": { "90": { "location": "2:44316281-44361862", "ensembl_id": "ENSG00000138078" } } }, "hgnc_date_symbol_changed": "2005-02-25" }, "entity_type": "gene", "entity_name": "PREPL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28726805", "27604308", "24610330" ], "evidence": [ "Expert Review Green", "Literature", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Myasthenic syndrome, congenital, 22 MIM#616224", "hypotonia-cystinuria syndrome", "Disorders of amino acid transport" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:10701", "gene_name": "Sec23 homolog A, coat complex II component", "omim_gene": [ "610511" ], "alias_name": null, "gene_symbol": "SEC23A", "hgnc_symbol": "SEC23A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:39501123-39578850", "ensembl_id": "ENSG00000100934" } }, "GRch38": { "90": { "location": "14:39031919-39109646", "ensembl_id": "ENSG00000100934" } } }, "hgnc_date_symbol_changed": "2000-01-07" }, "entity_type": "gene", "entity_name": "SEC23A", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16980979", "21039434", "16980978", "27148587", "38275611", "37828500", "34580982" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Craniolenticulosutural dysplasia (MIM# 607812)" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11494", "gene_name": "synapsin I", "omim_gene": [ "313440" ], "alias_name": null, "gene_symbol": "SYN1", "hgnc_symbol": "SYN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:47431303-47479252", "ensembl_id": "ENSG00000008056" } }, "GRch38": { "90": { "location": "X:47571898-47619943", "ensembl_id": "ENSG00000008056" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "SYN1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "14985377", "21441247", "28973667", "21441247", "34243774" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Epilepsy, X-linked, with variable learning disabilities and behaviour disorders, MIM# 300491", "Intellectual developmental disorder, X-linked 50, MIM# 300115" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0847" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19141", "gene_name": "tau tubulin kinase 2", "omim_gene": [ "611695" ], "alias_name": null, "gene_symbol": "TTBK2", "hgnc_symbol": "TTBK2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:43030932-43213007", "ensembl_id": "ENSG00000128881" } }, "GRch38": { "90": { "location": "15:42738734-42920809", "ensembl_id": "ENSG00000128881" } } }, "hgnc_date_symbol_changed": "2003-05-28" }, "entity_type": "gene", "entity_name": "TTBK2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18037885", "31485862", "20667868", "27165044", "20301723" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Spinocerebellar ataxia 11, MIM# 604432, MONDO:0011464" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:28984", "gene_name": "WASH complex subunit 5", "omim_gene": [ "610657" ], "alias_name": [ "strumpellin" ], "gene_symbol": "WASHC5", "hgnc_symbol": "WASHC5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:126036502-126104082", "ensembl_id": "ENSG00000164961" } }, "GRch38": { "90": { "location": "8:125024260-125091840", "ensembl_id": "ENSG00000164961" } } }, "hgnc_date_symbol_changed": "2016-10-14" }, "entity_type": "gene", "entity_name": "WASHC5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17160902", "23455931", "30778698", "24065355", "33456446" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Ritscher-Schinzel syndrome 1, MIM# 220210", "Spastic paraplegia 8, autosomal dominant, MIM# 603563" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "STB2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15512", "gene_name": "VANGL planar cell polarity protein 1", "omim_gene": [ "610132" ], "alias_name": null, "gene_symbol": "VANGL1", "hgnc_symbol": "VANGL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:116184574-116240845", "ensembl_id": "ENSG00000173218" } }, "GRch38": { "90": { "location": "1:115641953-115698224", "ensembl_id": "ENSG00000173218" } } }, "hgnc_date_symbol_changed": "2001-04-06" }, "entity_type": "gene", "entity_name": "VANGL1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17409324" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Caudal regression syndrome, MIM# 600145", "{Neural tube defects, susceptibility to} 182940" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AP-4-EPSILON", "SPG51" ], "biotype": "protein_coding", "hgnc_id": "HGNC:573", "gene_name": "adaptor related protein complex 4 epsilon 1 subunit", "omim_gene": [ "607244" ], "alias_name": null, "gene_symbol": "AP4E1", "hgnc_symbol": "AP4E1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:51200869-51298097", "ensembl_id": "ENSG00000081014" } }, "GRch38": { "90": { "location": "15:50908672-51005900", "ensembl_id": "ENSG00000081014" } } }, "hgnc_date_symbol_changed": "2000-09-01" }, "entity_type": "gene", "entity_name": "AP4E1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20972249", "21620353", "21937992" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Spastic paraplegia 51, autosomal recessive, MIM# 613744" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ACHRE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1966", "gene_name": "cholinergic receptor nicotinic epsilon subunit", "omim_gene": [ "100725" ], "alias_name": [ "acetylcholine receptor, nicotinic, epsilon (muscle)" ], "gene_symbol": "CHRNE", "hgnc_symbol": "CHRNE", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:4801069-4806369", "ensembl_id": "ENSG00000108556" } }, "GRch38": { "90": { "location": "17:4897774-4903074", "ensembl_id": "ENSG00000108556" } } }, "hgnc_date_symbol_changed": "1992-04-23" }, "entity_type": "gene", "entity_name": "CHRNE", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8755487", "8957026", "11030414", "12417530", "32727330", "32070632", "31773638" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Myasthenic syndrome, congenital, 4B, fast-channel, 616324", "Myasthenic syndrome, congenital, 4C, associated with acetylcholine receptor deficiency, 608931", "Myasthenic syndrome, slow-channel congenital, 601462", "Myasthenic syndrome, congenital, 4A, slow-channel, 605809" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2204", "gene_name": "collagen type IV alpha 3 chain", "omim_gene": [ "120070" ], "alias_name": [ "tumstatin" ], "gene_symbol": "COL4A3", "hgnc_symbol": "COL4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:228029281-228179508", "ensembl_id": "ENSG00000169031" } }, "GRch38": { "90": { "location": "2:227164565-227314792", "ensembl_id": "ENSG00000169031" } } }, "hgnc_date_symbol_changed": "1991-09-12" }, "entity_type": "gene", "entity_name": "COL4A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Alport syndrome 2, autosomal recessive, MIM# 203780", "Alport syndrome 3, autosomal dominant, MIM# 104200" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD116", "alphaGMR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2435", "gene_name": "colony stimulating factor 2 receptor alpha subunit", "omim_gene": [ "306250", "425000" ], "alias_name": [ "alpha-GM-CSF receptor" ], "gene_symbol": "CSF2RA", "hgnc_symbol": "CSF2RA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:1387693-1429274", "ensembl_id": "ENSG00000198223" } }, "GRch38": { "90": { "location": "X:1268800-1310381", "ensembl_id": "ENSG00000198223" } } }, "hgnc_date_symbol_changed": "1990-07-03" }, "entity_type": "gene", "entity_name": "CSF2RA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20622029", "25425184", "18955570" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Surfactant metabolism dysfunction, pulmonary, 4, MIM# 300770" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ET3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3178", "gene_name": "endothelin 3", "omim_gene": [ "131242" ], "alias_name": null, "gene_symbol": "EDN3", "hgnc_symbol": "EDN3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:57875482-57901047", "ensembl_id": "ENSG00000124205" } }, "GRch38": { "90": { "location": "20:59300427-59325992", "ensembl_id": "ENSG00000124205" } } }, "hgnc_date_symbol_changed": "1989-09-06" }, "entity_type": "gene", "entity_name": "EDN3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8630502", "11303518", "9359047", "10231870", "30171849", "27370713" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Central hypoventilation syndrome, congenital, MIM# 209880", "Waardenburg syndrome, type 4B, MIM# 613265", "{Hirschsprung disease, susceptibility to, 4}, MIM# 613712" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EARS", "PARS", "GLUPRORS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3418", "gene_name": "glutamyl-prolyl-tRNA synthetase", "omim_gene": [ "138295" ], "alias_name": [ "glutamate tRNA ligase", "proline tRNA ligase" ], "gene_symbol": "EPRS", "hgnc_symbol": "EPRS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:220141943-220220000", "ensembl_id": "ENSG00000136628" } }, "GRch38": { "90": { "location": "1:219968601-220046658", "ensembl_id": "ENSG00000136628" } } }, "hgnc_date_symbol_changed": "1991-02-20" }, "entity_type": "gene", "entity_name": "EPRS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29576217" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Leukodystrophy, hypomyelinating, 15, MIM# 617951" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4065", "gene_name": "glucosidase alpha, acid", "omim_gene": [ "606800" ], "alias_name": [ "Pompe disease", "glycogen storage disease type II" ], "gene_symbol": "GAA", "hgnc_symbol": "GAA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78075355-78093678", "ensembl_id": "ENSG00000171298" } }, "GRch38": { "90": { "location": "17:80101556-80119879", "ensembl_id": "ENSG00000171298" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "GAA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Glycogen storage disease II, MIM# 232300", "MONDO:0009290" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HADH1", "SCHAD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4799", "gene_name": "hydroxyacyl-CoA dehydrogenase", "omim_gene": [ "601609" ], "alias_name": null, "gene_symbol": "HADH", "hgnc_symbol": "HADH", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:108910870-108956331", "ensembl_id": "ENSG00000138796" } }, "GRch38": { "90": { "location": "4:107989714-108035175", "ensembl_id": "ENSG00000138796" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "HADH", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "3-hydroxyacyl-CoA dehydrogenase deficiency, MIM# 231530", "Hyperinsulinemic hypoglycemia, familial, 4, MIM# 609975" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1259", "Ino80", "hINO80", "INO80A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26956", "gene_name": "INO80 complex subunit", "omim_gene": [ "610169" ], "alias_name": [ "INO80 complex subunit A" ], "gene_symbol": "INO80", "hgnc_symbol": "INO80", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:41271078-41408552", "ensembl_id": "ENSG00000128908" } }, "GRch38": { "90": { "location": "15:40978880-41116354", "ensembl_id": "ENSG00000128908" } } }, "hgnc_date_symbol_changed": "2008-08-07" }, "entity_type": "gene", "entity_name": "INO80", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25312759" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Primary immunodeficiency, MONDO:0003778" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1075", "C1-TEN" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19737", "gene_name": "tensin 2", "omim_gene": [ "607717" ], "alias_name": null, "gene_symbol": "TNS2", "hgnc_symbol": "TNS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:53440753-53458156", "ensembl_id": "ENSG00000111077" } }, "GRch38": { "90": { "location": "12:53046969-53064372", "ensembl_id": "ENSG00000111077" } } }, "hgnc_date_symbol_changed": "2015-01-09" }, "entity_type": "gene", "entity_name": "TNS2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29773874" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Nephrotic syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0290" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29002", "gene_name": "FCH domain only 1", "omim_gene": [ "613437" ], "alias_name": null, "gene_symbol": "FCHO1", "hgnc_symbol": "FCHO1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:17858527-17899377", "ensembl_id": "ENSG00000130475" } }, "GRch38": { "90": { "location": "19:17747718-17788568", "ensembl_id": "ENSG00000130475" } } }, "hgnc_date_symbol_changed": "2004-01-08" }, "entity_type": "gene", "entity_name": "FCHO1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32098969", "30822429" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Immunodeficiency 76, MIM# 619164", "Combined immunodeficiency", "T cells: low, poor proliferation", "B cells: normal number", "Recurrent infections (viral, mycobacteria, bacterial, fungal)", "lymphoproliferation", "Failure to thrive", "Increased activation-induced T-cell death", "Defective clathrin-mediated endocytosis" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DCYTB", "FLJ23462", "FRRS3", "CYB561A2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20797", "gene_name": "cytochrome b reductase 1", "omim_gene": [ "605745" ], "alias_name": [ "ferric-chelate reductase 3", "cytochrome b561 family, member A2" ], "gene_symbol": "CYBRD1", "hgnc_symbol": "CYBRD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:172378757-172414643", "ensembl_id": "ENSG00000071967" } }, "GRch38": { "90": { "location": "2:171522247-171558133", "ensembl_id": "ENSG00000071967" } } }, "hgnc_date_symbol_changed": "2003-07-16" }, "entity_type": "gene", "entity_name": "CYBRD1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "15338274" ], "evidence": [ "Expert Review Red", "Expert list" ], "phenotypes": [ "Iron metabolism disease, MONDO:0002279, CYBRD1-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "BARK1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:289", "gene_name": "G protein-coupled receptor kinase 2", "omim_gene": [ "109635" ], "alias_name": null, "gene_symbol": "GRK2", "hgnc_symbol": "GRK2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:67033881-67054027", "ensembl_id": "ENSG00000173020" } }, "GRch38": { "90": { "location": "11:67266410-67286556", "ensembl_id": "ENSG00000173020" } } }, "hgnc_date_symbol_changed": "2016-05-16" }, "entity_type": "gene", "entity_name": "GRK2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33200460", "38647386" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Jeune asphyxiating thoracic dystrophy (ATD), MONDO:0018770" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "HBLP1", "VRP", "AD3", "GRAMD8" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17791", "gene_name": "TBC1 domain family member 8", "omim_gene": null, "alias_name": [ "BUB2-like protein 1", "vascular Rab-GAP/TBC-containing protein" ], "gene_symbol": "TBC1D8", "hgnc_symbol": "TBC1D8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:101624079-101869328", "ensembl_id": "ENSG00000204634" } }, "GRch38": { "90": { "location": "2:101007617-101252866", "ensembl_id": "ENSG00000204634" } } }, "hgnc_date_symbol_changed": "2003-05-19" }, "entity_type": "gene", "entity_name": "TBC1D8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "41556581", "35248088", "33584793" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Lennox‑Gastaut syndrome MONDO:0016532", "non-syndromic hearing loss MONDO:0019587", "non obstructive azoospermia or cryptozoospermia MONDO:0005372" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4757", "version_created": "2026-04-22T15:49:09.648412+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DPPX", "DPL1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3010", "gene_name": "dipeptidyl peptidase like 6", "omim_gene": [ "126141" ], "alias_name": null, "gene_symbol": "DPP6", "hgnc_symbol": "DPP6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:153584182-154685995", "ensembl_id": "ENSG00000130226" } }, "GRch38": { "90": { "location": "7:153887097-154894285", "ensembl_id": "ENSG00000130226" } } }, "hgnc_date_symbol_changed": "1993-02-11" }, "entity_type": "gene", "entity_name": "DPP6", "confidence_level": "1", "penetrance": "unknown", "mode_of_pathogenicity": null, "publications": [ "23832105" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Intellectual disability, autosomal dominant 33 (MIM#616311)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [ "SV/CNV", "disputed" ], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.427", "version_created": "2026-04-02T17:28:09.565635+11:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 383, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PCD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8646", "gene_name": "pterin-4 alpha-carbinolamine dehydratase 1", "omim_gene": [ "126090" ], "alias_name": [ "Pterin-4a-carbinolamine dehydratase (dimerization cofactor of hepatic nuclear factor 1-alpha)", "pterin-4-alpha carbinolamine dehydratase", "dimerizing cofactor for HNF1" ], "gene_symbol": "PCBD1", "hgnc_symbol": "PCBD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:72642037-72648541", "ensembl_id": "ENSG00000166228" } }, "GRch38": { "90": { "location": "10:70882280-70888784", "ensembl_id": "ENSG00000166228" } } }, "hgnc_date_symbol_changed": "2005-02-11" }, "entity_type": "gene", "entity_name": "PCBD1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9585615" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hyperphenylalaninemia, BH4-deficient, D, MIM# 264070" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 145, "hash_id": null, "name": "Neurotransmitter Defects", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThe panel contains genes associated with neurotransmitter disorders, a heterogeneous group of disorders involving defects in the metabolism of monoamines (dopamine, norepinephrine, epinephrine and serotonin), GABA and glycine. The clinical presentations were highly variable, and may include seizures, neurodevelopmental delay, movement disorders, gait abnormalities, hypotonia, autonomic features. Measurement of neurotransmitter metabolites in cerebral spinal fluid (CSF) may be helpful in delineating the metabolic defects.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Neurotransmitter disorders' panel V1.6 with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.8", "version_created": "2026-01-09T20:59:22.980216+11:00", "relevant_disorders": [ "Abnormal CSF metabolite concentration", "HP:0025454" ], "stats": { "number_of_genes": 41, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1374" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29262", "gene_name": "intraflagellar transport 80", "omim_gene": [ "611177" ], "alias_name": null, "gene_symbol": "IFT80", "hgnc_symbol": "IFT80", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:159974774-160117668", "ensembl_id": "ENSG00000068885" } }, "GRch38": { "90": { "location": "3:160256986-160399880", "ensembl_id": "ENSG00000068885" } } }, "hgnc_date_symbol_changed": "2005-11-02" }, "entity_type": "gene", "entity_name": "IFT80", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 159, "hash_id": null, "name": "Polydactyly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It contains genes that cause syndromic and non-syndromic polydactyly.", "status": "public", "version": "0.301", "version_created": "2026-03-12T11:30:58.449890+11:00", "relevant_disorders": [ "Polydactyly", "HP:0010442" ], "stats": { "number_of_genes": 141, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PE-2", "PE2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3444", "gene_name": "ETS2 repressor factor", "omim_gene": [ "611888" ], "alias_name": null, "gene_symbol": "ERF", "hgnc_symbol": "ERF", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:42751724-42759309", "ensembl_id": "ENSG00000105722" } }, "GRch38": { "90": { "location": "19:42247572-42255157", "ensembl_id": "ENSG00000105722" } } }, "hgnc_date_symbol_changed": "1998-07-17" }, "entity_type": "gene", "entity_name": "ERF", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 38824261" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Noonan syndrome-like, MONDO:0018997, with or without craniosynostosis, ERF-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 164, "hash_id": null, "name": "Rasopathy", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the ClinGen Rasopathy Working Group gene-disease validity assessments (PMID: 30311384) and against the Genomics England PanelApp Rasopathies panel, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "0.113", "version_created": "2026-01-26T17:08:48.260163+11:00", "relevant_disorders": [ "Rasopathy", "MONDO:0021060" ], "stats": { "number_of_genes": 32, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4084", "gene_name": "gamma-aminobutyric acid type A receptor delta subunit", "omim_gene": [ "137163" ], "alias_name": [ "GABA(A) receptor, delta" ], "gene_symbol": "GABRD", "hgnc_symbol": "GABRD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:1950780-1962192", "ensembl_id": "ENSG00000187730" } }, "GRch38": { "90": { "location": "1:2019298-2030758", "ensembl_id": "ENSG00000187730" } } }, "hgnc_date_symbol_changed": "1991-08-06" }, "entity_type": "gene", "entity_name": "GABRD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "15115768", "34633442" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Intellectual disability", "Epilepsy", "Susceptibility to epilepsy, MIM#613060" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.409", "version_created": "2026-04-18T18:50:54.267331+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MOF", "FLJ14040", "hMOF", "ZC2HC8" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17933", "gene_name": "lysine acetyltransferase 8", "omim_gene": [ "609912" ], "alias_name": null, "gene_symbol": "KAT8", "hgnc_symbol": "KAT8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:31127075-31142714", "ensembl_id": "ENSG00000103510" } }, "GRch38": { "90": { "location": "16:31115754-31131393", "ensembl_id": "ENSG00000103510" } } }, "hgnc_date_symbol_changed": "2011-07-21" }, "entity_type": "gene", "entity_name": "KAT8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31794431" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Intellectual disability", "seizures", "autism", "dysmorphic features", "Li-Ghorbani-Weisz syndrome, MIM#618974" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.409", "version_created": "2026-04-18T18:50:54.267331+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CI-49" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7708", "gene_name": "NADH:ubiquinone oxidoreductase core subunit S2", "omim_gene": [ "602985" ], "alias_name": [ "complex I 49kDa subunit", "NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial" ], "gene_symbol": "NDUFS2", "hgnc_symbol": "NDUFS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:161166894-161184185", "ensembl_id": "ENSG00000158864" } }, "GRch38": { "90": { "location": "1:161197104-161214395", "ensembl_id": "ENSG00000158864" } } }, "hgnc_date_symbol_changed": "1992-06-30" }, "entity_type": "gene", "entity_name": "NDUFS2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23266820", "22036843", "20819849" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship" ], "phenotypes": [ "Mitochondrial complex I deficiency, MIM#252010" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.409", "version_created": "2026-04-18T18:50:54.267331+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Dnchc1", "HL-3", "p22", "DHC1", "CMT2O" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2961", "gene_name": "dynein cytoplasmic 1 heavy chain 1", "omim_gene": [ "600112" ], "alias_name": null, "gene_symbol": "DYNC1H1", "hgnc_symbol": "DYNC1H1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:102430865-102517129", "ensembl_id": "ENSG00000197102" } }, "GRch38": { "90": { "location": "14:101964528-102050792", "ensembl_id": "ENSG00000197102" } } }, "hgnc_date_symbol_changed": "2005-11-24" }, "entity_type": "gene", "entity_name": "DYNC1H1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21820100", "32788638", "27549087", "25512093", "28196890" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cortical dysplasia, complex, with other brain malformations 13, MIM# 614563" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.409", "version_created": "2026-04-18T18:50:54.267331+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4908", "gene_name": "3-hydroxyisobutyryl-CoA hydrolase", "omim_gene": [ "610690" ], "alias_name": null, "gene_symbol": "HIBCH", "hgnc_symbol": "HIBCH", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:191054461-191208919", "ensembl_id": "ENSG00000198130" } }, "GRch38": { "90": { "location": "2:190189735-190344193", "ensembl_id": "ENSG00000198130" } } }, "hgnc_date_symbol_changed": "1999-12-07" }, "entity_type": "gene", "entity_name": "HIBCH", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "D11S812E", "AN", "WAGR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8620", "gene_name": "paired box 6", "omim_gene": [ "607108" ], "alias_name": [ "aniridia, keratitis" ], "gene_symbol": "PAX6", "hgnc_symbol": "PAX6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:31806340-31839509", "ensembl_id": "ENSG00000007372" } }, "GRch38": { "90": { "location": "11:31784779-31818062", "ensembl_id": "ENSG00000007372" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "PAX6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FPP", "PFM", "KIAA1788" ], "biotype": "protein_coding", "hgnc_id": "HGNC:450", "gene_name": "ALX homeobox 4", "omim_gene": [ "605420" ], "alias_name": null, "gene_symbol": "ALX4", "hgnc_symbol": "ALX4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:44281994-44331716", "ensembl_id": "ENSG00000052850" } }, "GRch38": { "90": { "location": "11:44260444-44310166", "ensembl_id": "ENSG00000052850" } } }, "hgnc_date_symbol_changed": "2000-06-15" }, "entity_type": "gene", "entity_name": "ALX4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LZTR-1", "BTBD29" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6742", "gene_name": "leucine zipper like transcription regulator 1", "omim_gene": [ "600574" ], "alias_name": null, "gene_symbol": "LZTR1", "hgnc_symbol": "LZTR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:21333751-21353327", "ensembl_id": "ENSG00000099949" } }, "GRch38": { "90": { "location": "22:20979462-20999038", "ensembl_id": "ENSG00000099949" } } }, "hgnc_date_symbol_changed": "1999-10-19" }, "entity_type": "gene", "entity_name": "LZTR1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RACE", "P504S" ], "biotype": "protein_coding", "hgnc_id": "HGNC:451", "gene_name": "alpha-methylacyl-CoA racemase", "omim_gene": [ "604489" ], "alias_name": null, "gene_symbol": "AMACR", "hgnc_symbol": "AMACR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:33986283-34008220", "ensembl_id": "ENSG00000242110" } }, "GRch38": { "90": { "location": "5:33986178-34008108", "ensembl_id": "ENSG00000242110" } } }, "hgnc_date_symbol_changed": "1999-10-19" }, "entity_type": "gene", "entity_name": "AMACR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AST", "SD", "ISSD", "NSD", "SIALIN", "SLD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10933", "gene_name": "solute carrier family 17 member 5", "omim_gene": [ "604322" ], "alias_name": null, "gene_symbol": "SLC17A5", "hgnc_symbol": "SLC17A5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:74303102-74363878", "ensembl_id": "ENSG00000119899" } }, "GRch38": { "90": { "location": "6:73593379-73654155", "ensembl_id": "ENSG00000119899" } } }, "hgnc_date_symbol_changed": "2000-01-06" }, "entity_type": "gene", "entity_name": "SLC17A5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PDZ73", "harmonin", "NY-CO-37", "NY-CO-38", "PDZ-73", "AIE-75", "PDZD7C" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12597", "gene_name": "USH1 protein network component harmonin", "omim_gene": [ "605242" ], "alias_name": [ "harmonin" ], "gene_symbol": "USH1C", "hgnc_symbol": "USH1C", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:17515442-17565963", "ensembl_id": "ENSG00000006611" } }, "GRch38": { "90": { "location": "11:17493895-17544416", "ensembl_id": "ENSG00000006611" } } }, "hgnc_date_symbol_changed": "1992-06-08" }, "entity_type": "gene", "entity_name": "USH1C", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10973247", "10973248", "11239869", "21203349", "12107438", "31858762" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Deafness Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Usher syndrome, type 1C, MIM# 276904", "Deafness, autosomal recessive 18A, MIM# 602092", "Deafness, autosomal dominant" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MCH5", "MACH", "FLICE", "Casp-8" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1509", "gene_name": "caspase 8", "omim_gene": [ "601763" ], "alias_name": null, "gene_symbol": "CASP8", "hgnc_symbol": "CASP8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:202098166-202152434", "ensembl_id": "ENSG00000064012" } }, "GRch38": { "90": { "location": "2:201233443-201287711", "ensembl_id": "ENSG00000064012" } } }, "hgnc_date_symbol_changed": "1996-11-11" }, "entity_type": "gene", "entity_name": "CASP8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12353035", "25814141", "12654726", "17213198", "16148088", "41026346" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Autoimmune lymphoproliferative syndrome, type IIB MIM#607271" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "founder" ], "panel": { "id": 229, "hash_id": null, "name": "Disorders of immune dysregulation", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause diseases of immune dysregulation, including:\r\n- Familial Hemophagocytic Lymphohistiocytosis (FHL syndromes)\r\n- FHL Syndromes with Hypopigmentation\r\n- Regulatory T Cell Defects\r\n- Autoimmunity with or without Lymphoproliferation\r\n- Immune Dysregulation with Colitis\r\n- Autoimmune Lymphoproliferative Syndrome (ALPS, Canale Smith syndrome)\r\n- Susceptibility to EBV and Lymphoproliferative Conditions\r\n\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.43", "version_created": "2026-04-06T13:01:39.255117+10:00", "relevant_disorders": [ "Immune dysregulation", "HP:0002958" ], "stats": { "number_of_genes": 118, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "IL5RB", "CD131", "betaGMR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2436", "gene_name": "colony stimulating factor 2 receptor beta common subunit", "omim_gene": [ "138981" ], "alias_name": [ "beta common cytokine receptor", "beta-GM-CSF receptor" ], "gene_symbol": "CSF2RB", "hgnc_symbol": "CSF2RB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:37309670-37336491", "ensembl_id": "ENSG00000100368" } }, "GRch38": { "90": { "location": "22:36913628-36940449", "ensembl_id": "ENSG00000100368" } } }, "hgnc_date_symbol_changed": "1991-08-07" }, "entity_type": "gene", "entity_name": "CSF2RB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "7568173", "21075760", "21205713", "25274301", "30846703", "32048120" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Surfactant metabolism dysfunction, pulmonary, 5 MIM#614370" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 233, "hash_id": null, "name": "Phagocyte Defects", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with abnormalities in phagocyte number, function or both. Susceptibility to infection from phagocytic dysfunction ranges from mild, recurrent skin infections to overwhelming, fatal systemic infection. Affected individuals are more susceptible to bacterial and fungal infections but have a normal resistance to viral infections. Most are diagnosed in infancy due to the severity of the infection or the unusual presentation of the organism, but some are diagnosed in adulthood. Includes:\r\n- Congenital Neutropenias\r\n- Defects of Motility\r\n- Defects of Respiratory Burst\r\n- Other Non-Lymphoid Defects\r\n\r\nUpdated with the 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications. \r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).\r\n\r\nThis panel was merged with and replaces the Melbourne Genomics Immunology Flagship Neutrophil Defects gene panel (22/03/2021).", "status": "public", "version": "1.45", "version_created": "2025-12-15T10:26:57.519304+11:00", "relevant_disorders": [ "Unusual infection", "HP:0032101" ], "stats": { "number_of_genes": 58, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "IKKE", "IKK-i", "KIAA0151" ], "biotype": null, "hgnc_id": "HGNC:14552", "gene_name": "inhibitor of nuclear factor kappa B kinase subunit epsilon", "omim_gene": [ "605048" ], "alias_name": null, "gene_symbol": "IKBKE", "hgnc_symbol": "IKBKE", "hgnc_release": "2017-11-03", "ensembl_genes": {}, "hgnc_date_symbol_changed": "2002-12-02" }, "entity_type": "gene", "entity_name": "IKBKE", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 37937644" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Encephalitis, acute, infection-induced, susceptibility to, MONDO:0800174, IKBKE-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 237, "hash_id": null, "name": "Susceptibility to Viral Infections", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital). It is currently maintained by VCGS.\r\n\r\nUpdated with the 2019 International Union of Immunological Societies Committee classification, Tangye et al. 2019 and the COVID Human Genetic Effort list, Casanova et al 2020.", "status": "public", "version": "1.10", "version_created": "2026-03-26T15:17:02.053015+11:00", "relevant_disorders": [ "Recurrent viral infections", "HP:0004429; Severe viral infection", "HP:0031691" ], "stats": { "number_of_genes": 54, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "YPT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9758", "gene_name": "RAB1A, member RAS oncogene family", "omim_gene": [ "179508" ], "alias_name": [ "Rab GTPase YPT1 homolog (yeast)" ], "gene_symbol": "RAB1A", "hgnc_symbol": "RAB1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:65297835-65357240", "ensembl_id": "ENSG00000138069" } }, "GRch38": { "90": { "location": "2:65070701-65130106", "ensembl_id": "ENSG00000138069" } } }, "hgnc_date_symbol_changed": "2002-03-17" }, "entity_type": "gene", "entity_name": "RAB1A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "37924809", "38091987" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "neurodevelopmental disorder MONDO:0700092, RAB1A-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "YAP65" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16262", "gene_name": "Yes associated protein 1", "omim_gene": [ "606608" ], "alias_name": null, "gene_symbol": "YAP1", "hgnc_symbol": "YAP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:101981192-102104154", "ensembl_id": "ENSG00000137693" } }, "GRch38": { "90": { "location": "11:102110461-102233423", "ensembl_id": "ENSG00000137693" } } }, "hgnc_date_symbol_changed": "2001-07-17" }, "entity_type": "gene", "entity_name": "YAP1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24462371" ], "evidence": [ "Expert Review Amber", "Genetic Health Queensland" ], "phenotypes": [ "Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation OMIM #120433" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SKD2", "SEC18" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8016", "gene_name": "N-ethylmaleimide sensitive factor, vesicle fusing ATPase", "omim_gene": [ "601633" ], "alias_name": [ "N-ethylmaleimide-sensitive factor-like protein" ], "gene_symbol": "NSF", "hgnc_symbol": "NSF", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:44668035-44834830", "ensembl_id": "ENSG00000073969" } }, "GRch38": { "90": { "location": "17:46590669-46757464", "ensembl_id": "ENSG00000073969" } } }, "hgnc_date_symbol_changed": "1996-08-28" }, "entity_type": "gene", "entity_name": "NSF", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31675180" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Developmental and epileptic encephalopathy 96, MIM# 619340", "Seizures", "EEG with burst suppression", "Global developmental delay", "Intellectual disability" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ITBA2", "CVG5", "DXS9951E", "DXS9879E", "ESO3", "Pcc1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26058", "gene_name": "L antigen family member 3", "omim_gene": [ "300060" ], "alias_name": [ "DNA segment on chromosome X (unique) 9879 expressed sequence" ], "gene_symbol": "LAGE3", "hgnc_symbol": "LAGE3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:153706028-153707596", "ensembl_id": "ENSG00000196976" } }, "GRch38": { "90": { "location": "X:154477769-154479257", "ensembl_id": "ENSG00000196976" } } }, "hgnc_date_symbol_changed": "2006-07-04" }, "entity_type": "gene", "entity_name": "LAGE3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28805828" ], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Galloway-Mowat syndrome 2, X-linked, MIM# 301006" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "XPO3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12826", "gene_name": "exportin for tRNA", "omim_gene": [ "603180" ], "alias_name": null, "gene_symbol": "XPOT", "hgnc_symbol": "XPOT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:64798130-64844907", "ensembl_id": "ENSG00000184575" } }, "GRch38": { "90": { "location": "12:64404350-64451127", "ensembl_id": "ENSG00000184575" } } }, "hgnc_date_symbol_changed": "1999-09-28" }, "entity_type": "gene", "entity_name": "XPOT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "10.64898/2026.01.28.26344748" ], "evidence": [ "Expert Review Green", "Literature", "Literature" ], "phenotypes": [ "Syndromic disease, MONDO:0002254" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "preprint" ], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "TIN2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11824", "gene_name": "TERF1 interacting nuclear factor 2", "omim_gene": [ "604319" ], "alias_name": null, "gene_symbol": "TINF2", "hgnc_symbol": "TINF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:24708849-24711880", "ensembl_id": "ENSG00000092330" } }, "GRch38": { "90": { "location": "14:24239643-24242674", "ensembl_id": "ENSG00000092330" } } }, "hgnc_date_symbol_changed": "1999-11-19" }, "entity_type": "gene", "entity_name": "TINF2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "1404302", "18252230", "21477109" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Revesz syndrome, MIM# 268130" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC33212" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28482", "gene_name": "Tctex1 domain containing 2", "omim_gene": [ "617353" ], "alias_name": null, "gene_symbol": "TCTEX1D2", "hgnc_symbol": "TCTEX1D2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:196018090-196045170", "ensembl_id": "ENSG00000213123" } }, "GRch38": { "90": { "location": "3:196291219-196318299", "ensembl_id": "ENSG00000213123" } } }, "hgnc_date_symbol_changed": "2007-12-17" }, "entity_type": "gene", "entity_name": "TCTEX1D2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25830415", "26044572" ], "evidence": [ "Expert Review Green", "Expert Review Green", "Literature", "NHS GMS", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Short-rib thoracic dysplasia 17 with or without polydactyly, 617405" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.431", "version_created": "2026-04-22T15:50:41.067259+10:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2185", "gene_name": "collagen type X alpha 1 chain", "omim_gene": [ "120110" ], "alias_name": [ "Schmid metaphyseal chondrodysplasia" ], "gene_symbol": "COL10A1", "hgnc_symbol": "COL10A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:116440086-116479910", "ensembl_id": "ENSG00000123500" } }, "GRch38": { "90": { "location": "6:116118923-116158747", "ensembl_id": "ENSG00000123500" } } }, "hgnc_date_symbol_changed": "1991-10-07" }, "entity_type": "gene", "entity_name": "COL10A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15880705", "31633898" ], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green", "Expert Review Green", "NHS GMS", "Emory Genetics Laboratory", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Metaphyseal chondrodysplasia, Schmid type 156500" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.431", "version_created": "2026-04-22T15:50:41.067259+10:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "gene", "entity_name": "HOXA13", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "Expert list", "Radboud University Medical Center, Nijmegen", "NHS GMS", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Guttmacher syndrome 176305", "Hand-foot-uterus syndrome 140000", "Hand-foot-genital syndrome 140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.431", "version_created": "2026-04-22T15:50:41.067259+10:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:8775", "gene_name": "phosphodiesterase 1B", "omim_gene": [ "171891" ], "alias_name": null, "gene_symbol": "PDE1B", "hgnc_symbol": "PDE1B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:54943134-54973023", "ensembl_id": "ENSG00000123360" } }, "GRch38": { "90": { "location": "12:54549350-54579239", "ensembl_id": "ENSG00000123360" } } }, "hgnc_date_symbol_changed": "1990-01-02" }, "entity_type": "gene", "entity_name": "PDE1B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40492975" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FAAH", "FLJ25287" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21197", "gene_name": "fatty acid 2-hydroxylase", "omim_gene": [ "611026" ], "alias_name": [ "fatty acid hydroxylase" ], "gene_symbol": "FA2H", "hgnc_symbol": "FA2H", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:74746853-74808729", "ensembl_id": "ENSG00000103089" } }, "GRch38": { "90": { "location": "16:74712955-74774831", "ensembl_id": "ENSG00000103089" } } }, "hgnc_date_symbol_changed": "2003-10-31" }, "entity_type": "gene", "entity_name": "FA2H", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31135052" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spastic paraplegia 35, autosomal recessive\tMIM#612319" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2213", "gene_name": "collagen type VI alpha 3 chain", "omim_gene": [ "120250" ], "alias_name": null, "gene_symbol": "COL6A3", "hgnc_symbol": "COL6A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:238232646-238323018", "ensembl_id": "ENSG00000163359" } }, "GRch38": { "90": { "location": "2:237324003-237414375", "ensembl_id": "ENSG00000163359" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "COL6A3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26004199", "32037012", "26872670", "32037012" ], "evidence": [ "Victorian Clinical Genetics Services", "Royal Melbourne Hospital", "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Dystonia 27, MIM#616411" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.344", "version_created": "2026-04-06T11:07:45.734922+10:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PPP1R115" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8104", "gene_name": "occludin", "omim_gene": [ "602876" ], "alias_name": [ "tight junction protein occludin TM4 minus", "phosphatase 1, regulatory subunit 115" ], "gene_symbol": "OCLN", "hgnc_symbol": "OCLN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:68788119-68853931", "ensembl_id": "ENSG00000197822" } }, "GRch38": { "90": { "location": "5:69492292-69558104", "ensembl_id": "ENSG00000197822" } } }, "hgnc_date_symbol_changed": "1998-01-20" }, "entity_type": "gene", "entity_name": "OCLN", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert list" ], "phenotypes": [ "Pseudo-TORCH syndrome 1 251290" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.394", "version_created": "2026-04-07T13:49:15.516142+10:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MTPOLB", "HP55" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9180", "gene_name": "DNA polymerase gamma 2, accessory subunit", "omim_gene": [ "604983" ], "alias_name": null, "gene_symbol": "POLG2", "hgnc_symbol": "POLG2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:62473902-62493154", "ensembl_id": "ENSG00000256525" } }, "GRch38": { "90": { "location": "17:64477785-64497036", "ensembl_id": "ENSG00000256525" } } }, "hgnc_date_symbol_changed": "1999-09-16" }, "entity_type": "gene", "entity_name": "POLG2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25655951" ], "evidence": [ "Royal Melbourne Hospital", "Expert Review Amber", "Expert Review Amber" ], "phenotypes": [ "Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4 610131" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.394", "version_created": "2026-04-07T13:49:15.516142+10:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SPG48", "zeta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:22197", "gene_name": "adaptor related protein complex 5 zeta 1 subunit", "omim_gene": [ "613653" ], "alias_name": null, "gene_symbol": "AP5Z1", "hgnc_symbol": "AP5Z1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:4815253-4833943", "ensembl_id": "ENSG00000242802" } }, "GRch38": { "90": { "location": "7:4775622-4794312", "ensembl_id": "ENSG00000242802" } } }, "hgnc_date_symbol_changed": "2012-03-20" }, "entity_type": "gene", "entity_name": "AP5Z1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40081374" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Hereditary macular dystrophy MONDO:0020242" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 303, "hash_id": null, "name": "Macular Dystrophy/Stargardt Disease", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause macular dystrophy and Stargardt disease. It is maintained by the Royal Melbourne Hospital for use in the ocular genetics clinic. It is a consensus panel used by VCGS.\r\n\r\nConsider using the broader Retinal Disorders superpanel when ophthalmological findings are not specific for this sub-group of disorders, particularly in individuals early in the diagnostic trajectory or where additional features are present.", "status": "public", "version": "0.60", "version_created": "2026-03-31T16:05:02.510211+11:00", "relevant_disorders": [ "Macular dystrophy", "HP:0007754" ], "stats": { "number_of_genes": 39, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ABP-280", "ABPL" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3756", "gene_name": "filamin C", "omim_gene": [ "102565" ], "alias_name": [ "actin binding protein 280", "gamma filamin" ], "gene_symbol": "FLNC", "hgnc_symbol": "FLNC", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:128470431-128499328", "ensembl_id": "ENSG00000128591" } }, "GRch38": { "90": { "location": "7:128830377-128859274", "ensembl_id": "ENSG00000128591" } } }, "hgnc_date_symbol_changed": "1993-08-24" }, "entity_type": "gene", "entity_name": "FLNC", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "PMID: 29858533" ], "evidence": [ "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Cardiomyopathy, familial restrictive 5\t617047", "Myopathy, distal, 4\t614065", "Myopathy, myofibrillar, 5\t609524" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MCPR", "TSG24", "APC1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19988", "gene_name": "anaphase promoting complex subunit 1", "omim_gene": [ "608473" ], "alias_name": null, "gene_symbol": "ANAPC1", "hgnc_symbol": "ANAPC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:112523848-112642267", "ensembl_id": "ENSG00000153107" } }, "GRch38": { "90": { "location": "2:111766271-111884690", "ensembl_id": "ENSG00000153107" } } }, "hgnc_date_symbol_changed": "2004-01-13" }, "entity_type": "gene", "entity_name": "ANAPC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31303264" ], "evidence": [ "Expert Review Green", "NHS GMS", "Expert Review Green", "Literature" ], "phenotypes": [ "Rothmund-Thomson syndrome, type 1 MIM#618625", "MONDO:0016368" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "deep intronic" ], "panel": { "id": 3089, "hash_id": null, "name": "Ectodermal Dysplasia", "disease_group": "Dermatological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause heritable conditions in which there are abnormalities of two or more ectodermal structures such as the hair, teeth, nails, sweat glands, salivary glands, cranial-facial structure, digits and other parts of the body.\r\n\r\nThis is a consensus panel used by RMH and VCGS.\r\n\r\nPlease refer to the Hair Disorders panel for disorders primarily affecting hair.", "status": "public", "version": "0.110", "version_created": "2026-03-31T16:43:36.155380+11:00", "relevant_disorders": [ "Ectodermal dysplasia", "HP:0000968" ], "stats": { "number_of_genes": 61, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "GM" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9291", "gene_name": "protein phosphatase 1 regulatory subunit 3A", "omim_gene": [ "600917" ], "alias_name": [ "glycogen-associated regulatory subunit of protein phosphatase-1", "protein phosphatase 1 regulatory subunit GM" ], "gene_symbol": "PPP1R3A", "hgnc_symbol": "PPP1R3A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:113516832-113715975", "ensembl_id": "ENSG00000154415" } }, "GRch38": { "90": { "location": "7:113876777-114075920", "ensembl_id": "ENSG00000154415" } } }, "hgnc_date_symbol_changed": "2001-07-02" }, "entity_type": "gene", "entity_name": "PPP1R3A", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29948331", "12118251", "18232732" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Insulin resistance, severe, digenic 125853" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3093, "hash_id": null, "name": "Monogenic Diabetes", "disease_group": "Endocrine disorders", "disease_sub_group": "", "description": "This panel contains genes associated with monogenic diabetes, including: \r\n-familial diabetes\r\n-neonatal diabetes\r\n-maturity onset diabetes of the young\r\n-insulin resistance (including lipodystrophy)\r\n\r\nIt has been compared against the following Genomics England PanelApp panels with all discrepancies reviewed and resolved (February 2026) : monogenic diabetes (V3.8), familial diabetes (V1.68), neonatal diabetes (V5.14), multi-organ autoimmune diabetes (V1.12), diabetes with additional phenotypes suggestive of a monogenic aetiology (V1.68), and insulin resistance (including lipodystrophy)(V1.18). \r\n\r\nFor a high suspicion of a mitochondrial DNA disorder: \r\nrequest a specific assay for mitochondrially encoded genes (such as mitochondrial genome sequencing or whole genome sequencing).", "status": "public", "version": "0.224", "version_created": "2026-04-06T18:03:06.439122+10:00", "relevant_disorders": [ "Diabetes mellitus", "HP:0000819" ], "stats": { "number_of_genes": 109, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "nudE", "FLJ20101", "NDE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17619", "gene_name": "nudE neurodevelopment protein 1", "omim_gene": [ "609449" ], "alias_name": null, "gene_symbol": "NDE1", "hgnc_symbol": "NDE1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:15737124-15820210", "ensembl_id": "ENSG00000072864" } }, "GRch38": { "90": { "location": "16:15643267-15726353", "ensembl_id": "ENSG00000072864" } } }, "hgnc_date_symbol_changed": "2003-04-10" }, "entity_type": "gene", "entity_name": "NDE1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Lissencephaly 4 (with microcephaly), 614019 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7866", "gene_name": "noggin", "omim_gene": [ "602991" ], "alias_name": null, "gene_symbol": "NOG", "hgnc_symbol": "NOG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:54671060-54672951", "ensembl_id": "ENSG00000183691" } }, "GRch38": { "90": { "location": "17:56593699-56595590", "ensembl_id": "ENSG00000183691" } } }, "hgnc_date_symbol_changed": "1999-03-24" }, "entity_type": "gene", "entity_name": "NOG", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15066478", "22088931", "17381491" ], "evidence": [ "Expert Review Red", "Genetic Health QLD" ], "phenotypes": [ "Symphalangism, proximal, 1A MIM#185800" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3166, "hash_id": null, "name": "Primary Ovarian Insufficiency_Premature Ovarian Failure", "disease_group": "Endocrine disorders", "disease_sub_group": "Gonadal and sex development disorders", "description": "This panel contains genes that cause non-syndromic and syndromic amenorrhoea, and ovarian insufficiency/failure. It was developed by RMH and Genetic Health QLD. It is a consensus panel used by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Primary ovarian insufficiency' panel V1.69, with all discrepancies reviewed and resolved (October 2025). \r\n\r\nWith early onset premature ovarian insufficiency, the following should be considered:\r\n• X chromosome abnormality such as Turner syndrome\r\n• Presence of FMR1 premutation\r\n• Iatrogenic cause (bilateral oophorectomy, chemotherapy, radiotherapy or any other iatrogenic cause)\r\n• Presence of thyroid or adrenal auto-antibodies\r\n\r\nTesting for fragile X premutation and chromosome abnormalities are strongly recommended prior to genomic testing.\r\n\r\nThis panel should be used for individuals with raised FSH. If FSH is low, the Hypogonadotropic hypogonadism panel should be used.\r\n\r\nPlease also consider the Differences of Sex Development panel where appropriate depending on clinical features.", "status": "public", "version": "0.414", "version_created": "2026-04-13T17:24:24.650771+10:00", "relevant_disorders": [ "Premature ovarian insufficiency", "HP:0008209" ], "stats": { "number_of_genes": 164, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "P2Y5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15520", "gene_name": "lysophosphatidic acid receptor 6", "omim_gene": [ "609239" ], "alias_name": null, "gene_symbol": "LPAR6", "hgnc_symbol": "LPAR6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:48963707-49018840", "ensembl_id": "ENSG00000139679" } }, "GRch38": { "90": { "location": "13:48389567-48444704", "ensembl_id": "ENSG00000139679" } } }, "hgnc_date_symbol_changed": "2009-06-23" }, "entity_type": "gene", "entity_name": "LPAR6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "NHS GMS" ], "phenotypes": [ "Woolly hair, autosomal recessive 1, with or without hypotrichosis, 278150", "Hypotrichosis 8, 278150" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3269, "hash_id": null, "name": "Hair disorders", "disease_group": "Dermatological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause syndromic and non-syndromic disorders that have hair abnormalities as a prominent feature of the condition. \r\n\r\nThe conditions include: hypotrichosis, hair shaft disorders with/without hair fragility, ectodermal dysplasias, trichorhinophalangeal syndrome, and atrichia with papular lesions.\r\nFor hypertrichosis the Hypertrichosis syndromes gene panel is more suitable.\r\n\r\nThe panel was developed and is maintained by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.84", "version_created": "2026-03-30T12:08:41.487037+11:00", "relevant_disorders": [ "Abnormal hair morphology", "HP:0001595" ], "stats": { "number_of_genes": 60, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "H_DJ0042M02.9", "HNPCC4", "MLH4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9122", "gene_name": "PMS1 homolog 2, mismatch repair system component", "omim_gene": [ "600259" ], "alias_name": null, "gene_symbol": "PMS2", "hgnc_symbol": "PMS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:6012870-6048756", "ensembl_id": "ENSG00000122512" } }, "GRch38": { "90": { "location": "7:5973239-6009125", "ensembl_id": "ENSG00000122512" } } }, "hgnc_date_symbol_changed": "1994-12-13" }, "entity_type": "gene", "entity_name": "PMS2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert Review", "Expert list" ], "phenotypes": [ "Medulloblastoma, MONDO:0007959", "Lynch syndrome 4, MONDO:0013699", "Mismatch repair cancer syndrome 4, MONDO:0030843", "Lynch syndrome 4, MIM#614337", "Mismatch repair cancer syndrome 4, MIM#619101" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3280, "hash_id": null, "name": "Medulloblastoma", "disease_group": "Cancer Predisposition", "disease_sub_group": "", "description": "This panel contains genes associated with medulloblastoma. \r\n\r\nFurther information on the testing criteria for medulloblastoma can be found at eviQ: \r\nhttps://www.eviq.org.au/cancer-genetics/paediatric/genetic-testing-using-cancer-gene-panels/3654-medulloblastoma-panel-testing\r\n\r\nOnly ‘Green’ genes should be tested and analysed for clinical testing, as they have sufficient peer-reviewed published evidence of association with medulloblastoma and are clinically actionable for diagnostic and/or predictive genetic testing.\r\n\r\nEnsure testing includes copy number variant (CNV) analysis, as CNVs contribute to a clinically significant proportion of pathogenic variants associated with familial risk of cancer.\r\n\r\nThis panel has been compared against the Genomics England PanelApp and aligned with any assessments by ClinGen.\r\n\r\n\r\nThis panel was developed by the Adult Genetics Unit, Royal Adelaide Hospital and SA Pathology. This panel has been updated under the guidance of experts in cancer genetics (Dr Helen Mar Fan and Dr Nicola Poplawski).", "status": "public", "version": "1.1", "version_created": "2024-11-01T16:31:30.977610+11:00", "relevant_disorders": [ "Medulloblastoma", "HP:0002885" ], "stats": { "number_of_genes": 12, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Cancer Germline", "slug": "cancer-germline", "description": "Germline cancer panel" }, { "name": "SA Pathology", "slug": "sa-pathology", "description": "SA Pathology" }, { "name": "Adult Genetics Unit, Royal Adelaide Hospital", "slug": "adult-genetics-unit-royal-adelaide-hospital", "description": "Adult Genetics Unit, Royal Adelaide Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CMT2N", "AlaRS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20", "gene_name": "alanyl-tRNA synthetase", "omim_gene": [ "601065" ], "alias_name": [ "alanine tRNA ligase 1, cytoplasmic" ], "gene_symbol": "AARS", "hgnc_symbol": "AARS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:70286198-70323446", "ensembl_id": "ENSG00000090861" } }, "GRch38": { "90": { "location": "16:70252295-70289543", "ensembl_id": "ENSG00000090861" } } }, "hgnc_date_symbol_changed": "1995-07-11" }, "entity_type": "gene", "entity_name": "AARS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Charcot-Marie-Tooth disease" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GPI3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8957", "gene_name": "phosphatidylinositol glycan anchor biosynthesis class A", "omim_gene": [ "311770" ], "alias_name": [ "paroxysmal nocturnal hemoglobinuria", "phosphatidylinositol N-acetylglucosaminyltransferase" ], "gene_symbol": "PIGA", "hgnc_symbol": "PIGA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:15337573-15353676", "ensembl_id": "ENSG00000165195" } }, "GRch38": { "90": { "location": "X:15319451-15335580", "ensembl_id": "ENSG00000165195" } } }, "hgnc_date_symbol_changed": "1993-10-28" }, "entity_type": "gene", "entity_name": "PIGA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22305531", "24357517", "24706016", "26545172", "33333793", "32694024" ], "evidence": [ "Expert Review Green", "BabySeq Category C gene" ], "phenotypes": [ "Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:164", "gene_name": "actinin alpha 2", "omim_gene": [ "102573" ], "alias_name": null, "gene_symbol": "ACTN2", "hgnc_symbol": "ACTN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:236849754-236927931", "ensembl_id": "ENSG00000077522" } }, "GRch38": { "90": { "location": "1:236686454-236764631", "ensembl_id": "ENSG00000077522" } } }, "hgnc_date_symbol_changed": "1991-07-16" }, "entity_type": "gene", "entity_name": "ACTN2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene", "BabySeq Category B gene" ], "phenotypes": [ "Cardiomyopathy, familial hypertrophic", "Cardiomyopathy, dilated" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ32915" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26558", "gene_name": "HYLS1, centriolar and ciliogenesis associated", "omim_gene": [ "610693" ], "alias_name": null, "gene_symbol": "HYLS1", "hgnc_symbol": "HYLS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:125753509-125770543", "ensembl_id": "ENSG00000198331" } }, "GRch38": { "90": { "location": "11:125883614-125900648", "ensembl_id": "ENSG00000198331" } } }, "hgnc_date_symbol_changed": "2005-05-04" }, "entity_type": "gene", "entity_name": "HYLS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "3296755", "22029171", "8322817", "15843405" ], "evidence": [ "Expert Review Green" ], "phenotypes": [ "Hydrolethalus syndrome, 236680 (includes Cleft palate, Lateral or midline cleft lip, Lower lip cleft)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC33662" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28510", "gene_name": "GLIS family zinc finger 3", "omim_gene": [ "610192" ], "alias_name": null, "gene_symbol": "GLIS3", "hgnc_symbol": "GLIS3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:3824127-4348392", "ensembl_id": "ENSG00000107249" } }, "GRch38": { "90": { "location": "9:3824127-4348392", "ensembl_id": "ENSG00000107249" } } }, "hgnc_date_symbol_changed": "2004-07-16" }, "entity_type": "gene", "entity_name": "GLIS3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26259131", "16715098", "30555422", "28253873" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Diabetes mellitus, neonatal, with congenital hypothyroidism, MIM# 610199" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3471, "hash_id": null, "name": "Congenital hypothyroidism", "disease_group": "Endocrine disorders", "disease_sub_group": "Thyroid disorders", "description": "This panel contains genes associated with congenital hypothyroidism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'congenital hypothyroidism' panel V3.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.120", "version_created": "2026-04-02T11:51:29.895216+11:00", "relevant_disorders": [ "Hypothyroidism HP:0000821" ], "stats": { "number_of_genes": 63, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10387", "SZT2B", "RP11-506B15.1", "FLJ34502", "SZT2A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29040", "gene_name": "SZT2, KICSTOR complex subunit", "omim_gene": [ "615463" ], "alias_name": [ "seizure threshold 2 homolog A (mouse)", "seizure threshold 2 homolog B (mouse)" ], "gene_symbol": "SZT2", "hgnc_symbol": "SZT2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:43855553-43918321", "ensembl_id": "ENSG00000198198" } }, "GRch38": { "90": { "location": "1:43389882-43454247", "ensembl_id": "ENSG00000198198" } } }, "hgnc_date_symbol_changed": "2011-06-10" }, "entity_type": "gene", "entity_name": "SZT2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23932106", "30560016", "30359774", "28556953", "32402703" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Developmental and epileptic encephalopathy 18, MIM #615476" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0968", "CaMKIINalpha" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1460", "gene_name": "calcium/calmodulin dependent protein kinase II alpha", "omim_gene": [ "114078" ], "alias_name": [ "CaM-kinase II alpha chain", "calcium/calmodulin-dependent protein kinase II alpha-B subunit", "CaM kinase II alpha subunit", "CaMK-II alpha subunit", "calcium/calmodulin-dependent protein kinase type II alpha chain" ], "gene_symbol": "CAMK2A", "hgnc_symbol": "CAMK2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:149599054-149669854", "ensembl_id": "ENSG00000070808" } }, "GRch38": { "90": { "location": "5:150219491-150290291", "ensembl_id": "ENSG00000070808" } } }, "hgnc_date_symbol_changed": "1993-11-24" }, "entity_type": "gene", "entity_name": "CAMK2A", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32600977", "29784083", "29560374" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp" ], "phenotypes": [ "Mental retardation, autosomal recessive 63 MIM#618095", "Mental retardation, autosomal dominant 53 MIM#617798" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11603", "gene_name": "T-box 4", "omim_gene": [ "601719" ], "alias_name": null, "gene_symbol": "TBX4", "hgnc_symbol": "TBX4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:59529765-59562471", "ensembl_id": "ENSG00000121075" } }, "GRch38": { "90": { "location": "17:61452404-61485110", "ensembl_id": "ENSG00000121075" } } }, "hgnc_date_symbol_changed": "1999-04-16" }, "entity_type": "gene", "entity_name": "TBX4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23592887", "31151956", "31761294", "31965066" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Amelia, posterior, with pelvic and pulmonary hypoplasia syndrome, MIM# 601360", "Ischiocoxopodopatellar syndrome with or without pulmonary arterial hypertension, MIM# 147891" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZP586P0123" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24564", "gene_name": "C2 calcium dependent domain containing 3", "omim_gene": [ "615944" ], "alias_name": null, "gene_symbol": "C2CD3", "hgnc_symbol": "C2CD3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:73723763-73882255", "ensembl_id": "ENSG00000168014" } }, "GRch38": { "90": { "location": "11:74012714-74171210", "ensembl_id": "ENSG00000168014" } } }, "hgnc_date_symbol_changed": "2007-10-17" }, "entity_type": "gene", "entity_name": "C2CD3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24997988", "26477546", "27094867", "30097616", "33875766" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Expert list", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Melbourne Genomics Health Alliance Perinatal Autopsy Flagship" ], "phenotypes": [ "Orofaciodigital syndrome XIV, MIM# 615948", "MONDO:0014413" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CAB56184", "c316G12.3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23026", "gene_name": "N-acetylglucosamine-1-phosphate transferase gamma subunit", "omim_gene": [ "607838" ], "alias_name": [ "GlcNAc-phosphotransferase gamma-subunit" ], "gene_symbol": "GNPTG", "hgnc_symbol": "GNPTG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:1401924-1413352", "ensembl_id": "ENSG00000090581" } }, "GRch38": { "90": { "location": "16:1351923-1364113", "ensembl_id": "ENSG00000090581" } } }, "hgnc_date_symbol_changed": "2004-10-01" }, "entity_type": "gene", "entity_name": "GNPTG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10712439", "19370764:19659762", "33507475", "33023972", "32651481" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Mucolipidosis III gamma, MIM# 252605" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ARGP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2843", "gene_name": "diacylglycerol O-acyltransferase 1", "omim_gene": [ "604900" ], "alias_name": null, "gene_symbol": "DGAT1", "hgnc_symbol": "DGAT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:145539954-145550573", "ensembl_id": "ENSG00000185000" } }, "GRch38": { "90": { "location": "8:144314584-144326910", "ensembl_id": "ENSG00000185000" } } }, "hgnc_date_symbol_changed": "2001-11-09" }, "entity_type": "gene", "entity_name": "DGAT1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "33261563", "32786057", "31778854", "28373485", "29604290", "31778854" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Diarrhoea 7, protein-losing enteropathy type, MIM# 615863", "congenital diarrhoea 7 with exudative enteropathy MONDO:0014375" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11474", "gene_name": "SURF1, cytochrome c oxidase assembly factor", "omim_gene": [ "185620" ], "alias_name": [ "surfeit locus protein 1" ], "gene_symbol": "SURF1", "hgnc_symbol": "SURF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:136218610-136223552", "ensembl_id": "ENSG00000148290" } }, "GRch38": { "90": { "location": "9:133351755-133356676", "ensembl_id": "ENSG00000148290" } } }, "hgnc_date_symbol_changed": "1989-11-29" }, "entity_type": "gene", "entity_name": "SURF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19780766", "23829769", "22488715" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Mitochondrial complex IV deficiency, nuclear type 1, MIM# 220110" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ39417" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2079", "gene_name": "CLN8, transmembrane ER and ERGIC protein", "omim_gene": [ "607837" ], "alias_name": null, "gene_symbol": "CLN8", "hgnc_symbol": "CLN8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:1703944-1734738", "ensembl_id": "ENSG00000182372" } }, "GRch38": { "90": { "location": "8:1755778-1801711", "ensembl_id": "ENSG00000182372" } } }, "hgnc_date_symbol_changed": "1993-12-15" }, "entity_type": "gene", "entity_name": "CLN8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Ceroid lipofuscinosis, neuronal, 8, 600143 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11073", "gene_name": "solute carrier family 9 member A3", "omim_gene": [ "182307" ], "alias_name": null, "gene_symbol": "SLC9A3", "hgnc_symbol": "SLC9A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:473425-524447", "ensembl_id": "ENSG00000066230" } }, "GRch38": { "90": { "location": "5:473310-524332", "ensembl_id": "ENSG00000066230" } } }, "hgnc_date_symbol_changed": "1992-06-12" }, "entity_type": "gene", "entity_name": "SLC9A3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30633106", "31276831", "26358773", "32227118", "35775128" ], "evidence": [ "Expert Review Amber", "Mackenzie's Mission" ], "phenotypes": [ "Diarrhea 8, secretory sodium, congenital, 616868 (3), Autosomal recessive" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MSU" ], "biotype": "protein_coding", "hgnc_id": "HGNC:986", "gene_name": "branched chain keto acid dehydrogenase E1, alpha polypeptide", "omim_gene": [ "608348" ], "alias_name": [ "maple syrup urine disease" ], "gene_symbol": "BCKDHA", "hgnc_symbol": "BCKDHA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:41884215-41930910", "ensembl_id": "ENSG00000248098" } }, "GRch38": { "90": { "location": "19:41397460-41425005", "ensembl_id": "ENSG00000248098" } } }, "hgnc_date_symbol_changed": "1989-06-30" }, "entity_type": "gene", "entity_name": "BCKDHA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29152456", "34883003", "34556729", "34288399" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "maple syrup urine disease type 1A MONDO:0023691" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 3929, "hash_id": null, "name": "Aminoacidopathy", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes associated with inborn errors in the metabolism of amino acids. It has been aligned with the classifications by the ClinGen Aminoacidopathy GCEP.\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.143", "version_created": "2026-04-01T10:30:06.755640+11:00", "relevant_disorders": [ "Abnormality of amino acid metabolism", "HP:0004337" ], "stats": { "number_of_genes": 134, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RPL10", "RPLY10", "RPYL10", "EC45", "L15" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10306", "gene_name": "ribosomal protein L15", "omim_gene": [ "604174" ], "alias_name": null, "gene_symbol": "RPL15", "hgnc_symbol": "RPL15", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:23958036-23965183", "ensembl_id": "ENSG00000174748" } }, "GRch38": { "90": { "location": "3:23916545-23923692", "ensembl_id": "ENSG00000174748" } } }, "hgnc_date_symbol_changed": "1998-07-23" }, "entity_type": "gene", "entity_name": "RPL15", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BeginNGS" ], "phenotypes": [ "Diamond-Blackfan anaemia 12 , MIM#\t615550" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "treatable", "haematological" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SEB", "KIAA0437" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15573", "gene_name": "SET binding protein 1", "omim_gene": [ "611060" ], "alias_name": null, "gene_symbol": "SETBP1", "hgnc_symbol": "SETBP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:42260138-42648475", "ensembl_id": "ENSG00000152217" } }, "GRch38": { "90": { "location": "18:44680173-45068510", "ensembl_id": "ENSG00000152217" } } }, "hgnc_date_symbol_changed": "2001-06-05" }, "entity_type": "gene", "entity_name": "SETBP1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category A gene" ], "phenotypes": [ "Schinzel-Giedion midface retraction syndrome, MIM# 269150" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ11457", "JBTS11", "NPHP12", "IFT139B", "THM1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25660", "gene_name": "tetratricopeptide repeat domain 21B", "omim_gene": [ "612014" ], "alias_name": null, "gene_symbol": "TTC21B", "hgnc_symbol": "TTC21B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:166713985-166810353", "ensembl_id": "ENSG00000123607" } }, "GRch38": { "90": { "location": "2:165857475-165953843", "ensembl_id": "ENSG00000123607" } } }, "hgnc_date_symbol_changed": "2005-01-26" }, "entity_type": "gene", "entity_name": "TTC21B", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25492405", "33875766", "18327258", "21258341", "33547761" ], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Short-rib thoracic dysplasia 4 with or without polydactyly, MIM# 613819", "Nephronophthisis 12, MIM# 613820" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4208", "gene_name": "glycine cleavage system protein H", "omim_gene": [ "238330" ], "alias_name": [ "lipoic acid-containing protein" ], "gene_symbol": "GCSH", "hgnc_symbol": "GCSH", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:81115566-81130008", "ensembl_id": "ENSG00000140905" } }, "GRch38": { "90": { "location": "16:81081938-81096425", "ensembl_id": "ENSG00000140905" } } }, "hgnc_date_symbol_changed": "1992-04-08" }, "entity_type": "gene", "entity_name": "GCSH", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category C gene", "Expert Review Red" ], "phenotypes": [ "Glycine encephalopathy" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "cblG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7468", "gene_name": "5-methyltetrahydrofolate-homocysteine methyltransferase", "omim_gene": [ "156570" ], "alias_name": null, "gene_symbol": "MTR", "hgnc_symbol": "MTR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:236958610-237067281", "ensembl_id": "ENSG00000116984" } }, "GRch38": { "90": { "location": "1:236795281-236903981", "ensembl_id": "ENSG00000116984" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "MTR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25526710" ], "evidence": [ "Expert Review Green", "BabySeq Category A gene", "BeginNGS" ], "phenotypes": [ "Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "haematological" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0028", "LEURS", "MGC26121", "mtLeuRS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17095", "gene_name": "leucyl-tRNA synthetase 2, mitochondrial", "omim_gene": [ "604544" ], "alias_name": [ "leucine tRNA ligase 2, mitochondrial" ], "gene_symbol": "LARS2", "hgnc_symbol": "LARS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:45429998-45590913", "ensembl_id": "ENSG00000011376" } }, "GRch38": { "90": { "location": "3:45388506-45549421", "ensembl_id": "ENSG00000011376" } } }, "hgnc_date_symbol_changed": "2003-09-01" }, "entity_type": "gene", "entity_name": "LARS2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021", "Perrault syndrome 4, MIM#\t615300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11773", "gene_name": "transforming growth factor beta receptor 2", "omim_gene": [ "190182" ], "alias_name": null, "gene_symbol": "TGFBR2", "hgnc_symbol": "TGFBR2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:30647994-30735634", "ensembl_id": "ENSG00000163513" } }, "GRch38": { "90": { "location": "3:30606502-30694142", "ensembl_id": "ENSG00000163513" } } }, "hgnc_date_symbol_changed": "1993-09-30" }, "entity_type": "gene", "entity_name": "TGFBR2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25006744", "26493799", "15591413", "23161884" ], "evidence": [ "NHS GMS", "Expert Review Green", "Expert list" ], "phenotypes": [ "Pulmonary emphysema, MONDO:0004849", "Loeys-Dietz syndrome type 2, OMIM:610168" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3960, "hash_id": null, "name": "Pneumothorax", "disease_group": "Respiratory disorders", "disease_sub_group": "Structural lung disorders", "description": "This panel contains genes that are reported causes of familial/sporadic spontaneous pneumothorax, or conditions where spontaneous pneumothorax is a differential diagnosis.\r\n\r\nThis panel is based on the Genomics England Pneumothorax - familial v2.38 gene panel.", "status": "public", "version": "1.1", "version_created": "2025-04-24T14:31:41.408160+10:00", "relevant_disorders": [ "Pneumothorax", "HP:0002107" ], "stats": { "number_of_genes": 18, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1074" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29186", "gene_name": "ankyrin repeat domain 26", "omim_gene": [ "610855" ], "alias_name": null, "gene_symbol": "ANKRD26", "hgnc_symbol": "ANKRD26", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:27280843-27389421", "ensembl_id": "ENSG00000107890" } }, "GRch38": { "90": { "location": "10:26991914-27100498", "ensembl_id": "ENSG00000107890" } } }, "hgnc_date_symbol_changed": "2004-02-04" }, "entity_type": "gene", "entity_name": "ANKRD26", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21211618" ], "evidence": [ "Expert list", "Expert Review Green" ], "phenotypes": [ "Thrombocytopaenia 2, MIM# 188000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HCS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4976", "gene_name": "holocarboxylase synthetase", "omim_gene": [ "609018" ], "alias_name": null, "gene_symbol": "HLCS", "hgnc_symbol": "HLCS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:38123189-38362536", "ensembl_id": "ENSG00000159267" } }, "GRch38": { "90": { "location": "21:36750888-36990236", "ensembl_id": "ENSG00000159267" } } }, "hgnc_date_symbol_changed": "1994-12-15" }, "entity_type": "gene", "entity_name": "HLCS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Holocarboxylase synthetase deficiency MIM#253270" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FHH", "NSHPT", "GPRC2A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1514", "gene_name": "calcium sensing receptor", "omim_gene": [ "601199" ], "alias_name": [ "severe neonatal hyperparathyroidism" ], "gene_symbol": "CASR", "hgnc_symbol": "CASR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:121902530-122005342", "ensembl_id": "ENSG00000036828" } }, "GRch38": { "90": { "location": "3:122183683-122291629", "ensembl_id": "ENSG00000036828" } } }, "hgnc_date_symbol_changed": "1992-12-04" }, "entity_type": "gene", "entity_name": "CASR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert Review", "Expert list" ], "phenotypes": [ "Tumor of parathyroid gland, MONDO:0021360", "Familial hypocalciuric hypercalcemia 1, MONDO:0007791", "Hypocalciuric hypercalcemia, type I, MIM#145980", "Hypocalcemia, autosomal dominant, MIM#601198" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4363, "hash_id": null, "name": "Parathyroid Tumour", "disease_group": "Cancer Predisposition", "disease_sub_group": "", "description": "This panel contains genes associated with parathyroid tumour. \r\n\r\nOnly ‘Green’ genes should be tested and analysed for clinical testing, as they have sufficient peer-reviewed published evidence of association with parathyroid tumour and are clinically actionable for diagnostic and/or predictive genetic testing.\r\n\r\nEnsure testing includes copy number variant (CNV) analysis, as CNVs contribute to a clinically significant proportion of pathogenic variants associated with familial risk of cancer.\r\n\r\nThis panel has been compared against the Genomics England PanelApp and aligned with any assessments by ClinGen.\r\n\r\nThis panel has been developed under the guidance of experts in cancer genetics (Dr Helen Mar Fan and Dr Nicola Poplawski).", "status": "public", "version": "1.2", "version_created": "2024-11-01T16:33:54.194345+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Cancer Germline", "slug": "cancer-germline", "description": "Germline cancer panel" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Adult Genetics Unit, Royal Adelaide Hospital", "slug": "adult-genetics-unit-royal-adelaide-hospital", "description": "Adult Genetics Unit, Royal Adelaide Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CNC1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9388", "gene_name": "protein kinase cAMP-dependent type I regulatory subunit alpha", "omim_gene": [ "188830" ], "alias_name": [ "Carney complex type 1" ], "gene_symbol": "PRKAR1A", "hgnc_symbol": "PRKAR1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:66507921-66547460", "ensembl_id": "ENSG00000108946" } }, "GRch38": { "90": { "location": "17:68511780-68551319", "ensembl_id": "ENSG00000108946" } } }, "hgnc_date_symbol_changed": "1988-05-11" }, "entity_type": "gene", "entity_name": "PRKAR1A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert Review", "Expert list" ], "phenotypes": [ "Pituitary tumor, MONDO:0017611", "Pituitary gland adenoma, MONDO:0006373", "Carney complex type 1, MONDO:0008057", "Carney complex, type 1, MIM#160980" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4364, "hash_id": null, "name": "Pituitary Tumour", "disease_group": "Cancer Predisposition", "disease_sub_group": "", "description": "This panel contains genes associated with pituitary tumour. \r\n\r\nOnly ‘Green’ genes should be tested and analysed for clinical testing, as they have sufficient peer-reviewed published evidence of association with pituitary tumour and are clinically actionable for diagnostic and/or predictive genetic testing.\r\n\r\nEnsure testing includes copy number variant (CNV) analysis, as CNVs contribute to a clinically significant proportion of pathogenic variants associated with familial risk of cancer.\r\n\r\nThis panel has been compared against the Genomics England PanelApp and aligned with any assessments by ClinGen.\r\n\r\nThis panel has been developed under the guidance of experts in cancer genetics (Dr Helen Mar Fan and Dr Nicola Poplawski).", "status": "public", "version": "1.1", "version_created": "2024-11-01T16:34:15.754213+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 8, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Cancer Germline", "slug": "cancer-germline", "description": "Germline cancer panel" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Adult Genetics Unit, Royal Adelaide Hospital", "slug": "adult-genetics-unit-royal-adelaide-hospital", "description": "Adult Genetics Unit, Royal Adelaide Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "Rec8p", "kleisin-alpha" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16879", "gene_name": "REC8 meiotic recombination protein", "omim_gene": [ "608193" ], "alias_name": null, "gene_symbol": "REC8", "hgnc_symbol": "REC8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:24641062-24649463", "ensembl_id": "ENSG00000100918" } }, "GRch38": { "90": { "location": "14:24171853-24180257", "ensembl_id": "ENSG00000100918" } } }, "hgnc_date_symbol_changed": "2007-04-03" }, "entity_type": "gene", "entity_name": "REC8", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34794894", "15515002", "34707299", "35172124", "31479588" ], "evidence": [ "Expert Review Amber", "Literature", "Literature" ], "phenotypes": [ "Infertility disorder, MONDO:0005047, REC8-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.148", "version_created": "2026-04-21T17:36:51.081048+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 266, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0111", "EIF4AIII", "Fal1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18683", "gene_name": "eukaryotic translation initiation factor 4A3", "omim_gene": [ "608546" ], "alias_name": null, "gene_symbol": "EIF4A3", "hgnc_symbol": "EIF4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78109013-78120982", "ensembl_id": "ENSG00000141543" } }, "GRch38": { "90": { "location": "17:80135214-80147183", "ensembl_id": "ENSG00000141543" } } }, "hgnc_date_symbol_changed": "2006-11-27" }, "entity_type": "str", "entity_name": "EIF4A3_RCPS_complex", "confidence_level": "3", "penetrance": null, "publications": [ "24360810", "29112243" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Robin sequence with cleft mandible and limb anomalies MIM#268305", "Richieri-Costa-Pereira syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "TCGGCAGCGGCGCAGCGAGG", "chromosome": "17", "grch37_coordinates": [ 78120803, 78120938 ], "grch38_coordinates": [ 80147004, 80147139 ], "normal_repeats": 21, "pathogenic_repeats": 14, "tags": [], "panel": { "id": 136, "hash_id": null, "name": "Mandibulofacial Acrofacial dysostosis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel contains genes associated with the facial dysostoses, which can be subdivided into mandibulofacial dysostoses, which present with craniofacial defects only, and acrofacial dysostoses, which encompass both craniofacial and limb anomalies. Facial dysostoses arise as a consequence of abnormal development of the first and second pharyngeal arches and their derivatives, including the upper and lower jaw and their hyoid support structures.", "status": "public", "version": "1.22", "version_created": "2026-03-25T17:21:58.910310+11:00", "relevant_disorders": [ "Craniofacial dysostosis", "HP:0004439" ], "stats": { "number_of_genes": 35, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } } ] }