Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=213
{ "count": 36052, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=214", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=212", "results": [ { "gene_data": { "alias": [ "RNMX", "hnRNP-G", "HNRNPG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9910", "gene_name": "RNA binding motif protein, X-linked", "omim_gene": [ "300199" ], "alias_name": [ "heterogeneous nuclear ribonucleoprotein G" ], "gene_symbol": "RBMX", "hgnc_symbol": "RBMX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:135930163-135962923", "ensembl_id": "ENSG00000147274" } }, "GRch38": { "90": { "location": "X:136848004-136880764", "ensembl_id": "ENSG00000147274" } } }, "hgnc_date_symbol_changed": "2000-01-31" }, "entity_type": "gene", "entity_name": "RBMX", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "39263607" ], "evidence": [ "Expert Review", "Expert Review Amber" ], "phenotypes": [ "Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 25, "hash_id": null, "name": "Motor Neurone Disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause motor neurone disease, including amyotrophic lateral sclerosis and genes causing spinal muscular atrophies (SMAs) with adult onset. It is maintained by VCGS and RMH.\r\n\r\nGenes causing spinal muscular atrophies (SMAs) with congenital/childhood onset are not included in this panel but can be found in the Hereditary Neuropathy panels.\r\n\r\nThe original panel (as 17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.48", "version_created": "2026-03-31T16:37:58.241144+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 79, "number_of_strs": 4, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA1302", "Ten-M4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29945", "gene_name": "teneurin transmembrane protein 4", "omim_gene": [ "610084" ], "alias_name": null, "gene_symbol": "TENM4", "hgnc_symbol": "TENM4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:78363876-79151992", "ensembl_id": "ENSG00000149256" } }, "GRch38": { "90": { "location": "11:78652831-79440948", "ensembl_id": "ENSG00000149256" } } }, "hgnc_date_symbol_changed": "2012-10-02" }, "entity_type": "gene", "entity_name": "TENM4", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "41449293", "36689009", "26188006", "29249217", "34589676", "22915103" ], "evidence": [ "Literature", "Expert Review Amber", "Expert Review Amber", "Literature" ], "phenotypes": [ "tremor, hereditary essential, 5 MONDO:0014756" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.55", "version_created": "2026-04-17T16:01:21.596122+10:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DBX", "HLP2", "DDX14" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2745", "gene_name": "DEAD-box helicase 3, X-linked", "omim_gene": [ "300160" ], "alias_name": null, "gene_symbol": "DDX3X", "hgnc_symbol": "DDX3X", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:41192651-41223725", "ensembl_id": "ENSG00000215301" } }, "GRch38": { "90": { "location": "X:41333348-41364472", "ensembl_id": "ENSG00000215301" } } }, "hgnc_date_symbol_changed": "2003-06-20" }, "entity_type": "gene", "entity_name": "DDX3X", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 51, "hash_id": null, "name": "Autism", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.249", "version_created": "2026-04-18T18:49:11.555064+10:00", "relevant_disorders": [ "Autism", "HP:0000717" ], "stats": { "number_of_genes": 157, "number_of_strs": 0, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BB1", "hMBOA-7", "LPIAT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15505", "gene_name": "membrane bound O-acyltransferase domain containing 7", "omim_gene": [ "606048" ], "alias_name": [ "lysophosphatidylinositol acyltransferase" ], "gene_symbol": "MBOAT7", "hgnc_symbol": "MBOAT7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:54677107-54693733", "ensembl_id": "ENSG00000125505" } }, "GRch38": { "90": { "location": "19:54173412-54189882", "ensembl_id": "ENSG00000125505" } } }, "hgnc_date_symbol_changed": "2008-01-17" }, "entity_type": "gene", "entity_name": "MBOAT7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 51, "hash_id": null, "name": "Autism", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.249", "version_created": "2026-04-18T18:49:11.555064+10:00", "relevant_disorders": [ "Autism", "HP:0000717" ], "stats": { "number_of_genes": 157, "number_of_strs": 0, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1010", "Tuba", "ARHGEF36" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30373", "gene_name": "dynamin binding protein", "omim_gene": [ "611282" ], "alias_name": [ "scaffold protein TUBA" ], "gene_symbol": "DNMBP", "hgnc_symbol": "DNMBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:101635334-101769676", "ensembl_id": "ENSG00000107554" } }, "GRch38": { "90": { "location": "10:99875577-100009919", "ensembl_id": "ENSG00000107554" } } }, "hgnc_date_symbol_changed": "2004-04-05" }, "entity_type": "gene", "entity_name": "DNMBP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30290152" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Cataract 48, MIM#618415" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MGC71996", "NBIA3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3999", "gene_name": "ferritin light chain", "omim_gene": [ "134790" ], "alias_name": [ "ferritin light polypeptide-like 3", "L apoferritin", "ferritin L subunit", "ferritin light chain", "ferritin L-chain", "neurodegeneration with brain iron accumulation 3" ], "gene_symbol": "FTL", "hgnc_symbol": "FTL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:49468558-49470135", "ensembl_id": "ENSG00000087086" } }, "GRch38": { "90": { "location": "19:48965301-48966878", "ensembl_id": "ENSG00000087086" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "FTL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hyperferritinemia-cataract syndrome, MIM# 600886" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CAGH45", "HOPA", "OPA1", "TRAP230", "KIAA0192", "OKS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11957", "gene_name": "mediator complex subunit 12", "omim_gene": [ "300188" ], "alias_name": null, "gene_symbol": "MED12", "hgnc_symbol": "MED12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:70338406-70362303", "ensembl_id": "ENSG00000184634" } }, "GRch38": { "90": { "location": "X:71118556-71142454", "ensembl_id": "ENSG00000184634" } } }, "hgnc_date_symbol_changed": "2004-11-26" }, "entity_type": "gene", "entity_name": "MED12", "confidence_level": "3", "penetrance": "unknown", "mode_of_pathogenicity": "Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments", "publications": [ "32682435", "18973276", "31255603", "28724790", "20301719" ], "evidence": [ "Expert Review Green", "Other" ], "phenotypes": [ "Hardikar syndrome, MIM# 301068", "Lujan-Fryns syndrome, MIM# 309520", "Ohdo syndrome, X-linked, MIM# 300895" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.535", "version_created": "2026-04-21T11:25:32.018166+10:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 254, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0569", "SIP-1", "SIP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14881", "gene_name": "zinc finger E-box binding homeobox 2", "omim_gene": [ "605802" ], "alias_name": [ "SMAD interacting protein 1" ], "gene_symbol": "ZEB2", "hgnc_symbol": "ZEB2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:145141648-145282147", "ensembl_id": "ENSG00000169554" } }, "GRch38": { "90": { "location": "2:144364364-144524583", "ensembl_id": "ENSG00000169554" } } }, "hgnc_date_symbol_changed": "2007-02-15" }, "entity_type": "gene", "entity_name": "ZEB2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "25123255", "18076118" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Mowat-Wilson syndrome MIM#235730" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 93, "hash_id": null, "name": "Craniosynostosis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It is a consensus panel used by RMH. It contains genes that cause isolated craniosynostosis, as well as those that cause complex syndromic or other multi-system disorders where craniosynostosis is a prominent feature.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Craniosynostosis panel and all differences have been resolved, with reciprocal feedback provided to Genomics England 3/7/2020.", "status": "public", "version": "1.85", "version_created": "2026-04-07T13:46:55.940488+10:00", "relevant_disorders": [ "Craniosynostosis HP:0001363" ], "stats": { "number_of_genes": 105, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ25461", "C9orf145", "C9orf143", "DKFZp686M16108", "TILRR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23399", "gene_name": "FRAS1 related extracellular matrix 1", "omim_gene": [ "608944" ], "alias_name": null, "gene_symbol": "FREM1", "hgnc_symbol": "FREM1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:14734664-14910993", "ensembl_id": "ENSG00000164946" } }, "GRch38": { "90": { "location": "9:14734666-14910995", "ensembl_id": "ENSG00000164946" } } }, "hgnc_date_symbol_changed": "2004-12-15" }, "entity_type": "gene", "entity_name": "FREM1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21931569" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Trigonocephaly 2, MIM# 614485" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "disputed" ], "panel": { "id": 93, "hash_id": null, "name": "Craniosynostosis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It is a consensus panel used by RMH. It contains genes that cause isolated craniosynostosis, as well as those that cause complex syndromic or other multi-system disorders where craniosynostosis is a prominent feature.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Craniosynostosis panel and all differences have been resolved, with reciprocal feedback provided to Genomics England 3/7/2020.", "status": "public", "version": "1.85", "version_created": "2026-04-07T13:46:55.940488+10:00", "relevant_disorders": [ "Craniosynostosis HP:0001363" ], "stats": { "number_of_genes": 105, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "A20", "OTUD7C" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11896", "gene_name": "TNF alpha induced protein 3", "omim_gene": [ "191163" ], "alias_name": null, "gene_symbol": "TNFAIP3", "hgnc_symbol": "TNFAIP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:138188351-138204449", "ensembl_id": "ENSG00000118503" } }, "GRch38": { "90": { "location": "6:137867188-137883312", "ensembl_id": "ENSG00000118503" } } }, "hgnc_date_symbol_changed": "1992-10-20" }, "entity_type": "gene", "entity_name": "TNFAIP3", "confidence_level": "3", "penetrance": "unknown", "mode_of_pathogenicity": null, "publications": [ "34030699", "33446651", "32521965", "31299923" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Inflammatory bowel disease", "Crohn's disease", "Autoinflammatory syndrome, familial, Behcet-like" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 123, "hash_id": null, "name": "Inflammatory bowel disease", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.126", "version_created": "2025-10-16T15:50:33.114198+11:00", "relevant_disorders": [ "Gastrointestinal inflammation", "HP:0004386" ], "stats": { "number_of_genes": 85, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RNASE5", "RAA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:483", "gene_name": "angiogenin", "omim_gene": [ "105850" ], "alias_name": [ "ribonuclease A family member 5" ], "gene_symbol": "ANG", "hgnc_symbol": "ANG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:21152336-21167130", "ensembl_id": "ENSG00000214274" } }, "GRch38": { "90": { "location": "14:20684177-20698971", "ensembl_id": "ENSG00000214274" } } }, "hgnc_date_symbol_changed": "1989-05-23" }, "entity_type": "gene", "entity_name": "ANG", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17886298", "16501576", "18087731", "20301623", "19153377" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Amyotrophic Lateral Sclerosis (MONDO: 0012753", "MIM#611895)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "neurological" ], "panel": { "id": 126, "hash_id": null, "name": "Incidentalome", "disease_group": "", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with adult-onset cardiac, cancer and neurodegenerative disorders.\r\n\r\nThese genes are excluded from the Mendeliome panel to enable the use of the Mendeliome for panel-agnostic analysis in complex paediatric cases, while minimising the chance of incidental findings related to adult-onset conditions.\r\n\r\nIf analysis of these genes is required, the relevant panel should be requested (e.g. Adult Additional Findings; Neurodegenerative Disease_Adult Onset; Breast Cancer etc).", "status": "public", "version": "0.433", "version_created": "2026-03-25T17:03:27.624542+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 161, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CSB", "RAD26", "ARMD5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3438", "gene_name": "ERCC excision repair 6, chromatin remodeling factor", "omim_gene": [ "609413" ], "alias_name": [ "Cockayne syndrome B protein" ], "gene_symbol": "ERCC6", "hgnc_symbol": "ERCC6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:50663414-50747584", "ensembl_id": "ENSG00000225830" } }, "GRch38": { "90": { "location": "10:49455368-49539538", "ensembl_id": "ENSG00000225830" } } }, "hgnc_date_symbol_changed": "1989-06-30" }, "entity_type": "gene", "entity_name": "ERCC6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28476236" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cockayne syndrome, type B, MIM# 133540" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 130, "hash_id": null, "name": "Lipodystrophy_Lipoatrophy", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nLipodystrophy syndromes comprise a heterogeneous group of disorders characterized by either generalized or partial lack of adipose tissue.\r\n\r\nLipodystrophy can be congenital or acquired. Individuals with partial lipodystrophy may exhibit excess adipose tissue accumulation in other areas of the body. Lipodystrophy syndromes usually manifest with several metabolic abnormalities associated with severe insulin resistance that include diabetes mellitus, hypertriglyceridaemia, and hepatic steatosis which can progress to steatohepatitis. Other common manifestations are acanthosis nigricans, polycystic ovarian syndrome (PCOS), and eruptive xanthomas.\r\n\r\nThis panel contains conditions associated with both isolated and syndromic lipodystrophy.", "status": "public", "version": "1.42", "version_created": "2026-02-17T18:29:33.924527+11:00", "relevant_disorders": [ "Lipodystrophy", "HP:0009125" ], "stats": { "number_of_genes": 39, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "87U6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4387", "gene_name": "G protein subunit alpha i3", "omim_gene": [ "139370" ], "alias_name": null, "gene_symbol": "GNAI3", "hgnc_symbol": "GNAI3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:110091233-110136975", "ensembl_id": "ENSG00000065135" } }, "GRch38": { "90": { "location": "1:109548611-109618321", "ensembl_id": "ENSG00000065135" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "GNAI3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22560091" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Auriculocondylar syndrome 1, OMIM #602483" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 136, "hash_id": null, "name": "Mandibulofacial Acrofacial dysostosis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel contains genes associated with the facial dysostoses, which can be subdivided into mandibulofacial dysostoses, which present with craniofacial defects only, and acrofacial dysostoses, which encompass both craniofacial and limb anomalies. Facial dysostoses arise as a consequence of abnormal development of the first and second pharyngeal arches and their derivatives, including the upper and lower jaw and their hyoid support structures.", "status": "public", "version": "1.22", "version_created": "2026-03-25T17:21:58.910310+11:00", "relevant_disorders": [ "Craniofacial dysostosis", "HP:0004439" ], "stats": { "number_of_genes": 35, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10879", "StIP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18248", "gene_name": "elongator acetyltransferase complex subunit 2", "omim_gene": [ "616054" ], "alias_name": null, "gene_symbol": "ELP2", "hgnc_symbol": "ELP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:33709407-33757909", "ensembl_id": "ENSG00000134759" } }, "GRch38": { "90": { "location": "18:36129444-36180556", "ensembl_id": "ENSG00000134759" } } }, "hgnc_date_symbol_changed": "2007-04-20" }, "entity_type": "gene", "entity_name": "ELP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21937992", "25847581", "32573669", "34653680" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "intellectual disability, autosomal recessive 58 MONDO:0014996" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AC", "PHP32", "FLJ21558", "ACDase" ], "biotype": "protein_coding", "hgnc_id": "HGNC:735", "gene_name": "N-acylsphingosine amidohydrolase 1", "omim_gene": [ "613468" ], "alias_name": [ "acylsphingosine deacylase", "acid ceramidase" ], "gene_symbol": "ASAH1", "hgnc_symbol": "ASAH1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:17913934-17942494", "ensembl_id": "ENSG00000104763" } }, "GRch38": { "90": { "location": "8:18055992-18084998", "ensembl_id": "ENSG00000104763" } } }, "hgnc_date_symbol_changed": "2002-09-13" }, "entity_type": "gene", "entity_name": "ASAH1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Spinal muscular atrophy with progressive myoclonic epilepsy, MIM# 159950", "Farber lipogranulomatosis, MIM# 228000" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BRK-3", "T-ALK", "BMPR3", "BMPR-II" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1078", "gene_name": "bone morphogenetic protein receptor type 2", "omim_gene": [ "600799" ], "alias_name": null, "gene_symbol": "BMPR2", "hgnc_symbol": "BMPR2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:203241659-203432474", "ensembl_id": "ENSG00000204217" } }, "GRch38": { "90": { "location": "2:202376936-202567751", "ensembl_id": "ENSG00000204217" } } }, "hgnc_date_symbol_changed": "1997-03-19" }, "entity_type": "gene", "entity_name": "BMPR2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "33380512" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Pulmonary venoocclusive disease 1 MIM#265450", "Pulmonary hypertension, familial primary, 1, with or without HHT MIM#178600", "Pulmonary hypertension, primary, fenfluramine or dexfenfluramine-associated MIM#178600" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CGI-10" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20233", "gene_name": "coenzyme Q6, monooxygenase", "omim_gene": [ "614647" ], "alias_name": null, "gene_symbol": "COQ6", "hgnc_symbol": "COQ6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:74416629-74430373", "ensembl_id": "ENSG00000119723" } }, "GRch38": { "90": { "location": "14:73949926-73963670", "ensembl_id": "ENSG00000119723" } } }, "hgnc_date_symbol_changed": "2003-01-10" }, "entity_type": "gene", "entity_name": "COQ6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28125198" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Coenzyme Q10 deficiency, primary, 6 MIM#614650" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "S1-5", "FBLN3", "MTLV" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3218", "gene_name": "EGF containing fibulin extracellular matrix protein 1", "omim_gene": [ "601548" ], "alias_name": [ "fibulin 3" ], "gene_symbol": "EFEMP1", "hgnc_symbol": "EFEMP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:56093102-56151274", "ensembl_id": "ENSG00000115380" } }, "GRch38": { "90": { "location": "2:55865967-55924139", "ensembl_id": "ENSG00000115380" } } }, "hgnc_date_symbol_changed": "1996-04-30" }, "entity_type": "gene", "entity_name": "EFEMP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32006683", "31792352", "33807164", "34923728" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Doyne honeycomb degeneration of retina, MIM# 126600", "Cutis laxa, autosomal recessive, type ID, MIM# 620780", "Glaucoma 1, open angle, H, MIM# 611276" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ11005", "PNG1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17646", "gene_name": "N-glycanase 1", "omim_gene": [ "610661" ], "alias_name": [ "peptide-N(4)-(N-acetyl-beta-glucosaminyl)asparagine amidase" ], "gene_symbol": "NGLY1", "hgnc_symbol": "NGLY1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:25760435-25831530", "ensembl_id": "ENSG00000151092" } }, "GRch38": { "90": { "location": "3:25718944-25790039", "ensembl_id": "ENSG00000151092" } } }, "hgnc_date_symbol_changed": "2002-06-07" }, "entity_type": "gene", "entity_name": "NGLY1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24651605", "27388694", "32259258" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Congenital disorder of deglycosylation, MIM# 615273" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC14156" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28213", "gene_name": "phosphatidylinositol glycan anchor biosynthesis class Y", "omim_gene": [ "610662" ], "alias_name": null, "gene_symbol": "PIGY", "hgnc_symbol": "PIGY", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:89442724-89442940", "ensembl_id": "ENSG00000255072" } }, "GRch38": { "90": { "location": "4:88521573-88521789", "ensembl_id": "ENSG00000255072" } } }, "hgnc_date_symbol_changed": "2006-01-31" }, "entity_type": "gene", "entity_name": "PIGY", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26293662" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hyperphosphatasia with mental retardation syndrome 6, MIM# 616809" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "rubicon", "rundataxin" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28991", "gene_name": "RUN and cysteine rich domain containing beclin 1 interacting protein", "omim_gene": [ "613516" ], "alias_name": [ "RUN domain and cysteine-rich domain containing", "Beclin 1-interacting protein" ], "gene_symbol": "RUBCN", "hgnc_symbol": "RUBCN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:197398264-197476598", "ensembl_id": "ENSG00000145016" } }, "GRch38": { "90": { "location": "3:197671393-197749727", "ensembl_id": "ENSG00000145016" } } }, "hgnc_date_symbol_changed": "2015-10-16" }, "entity_type": "gene", "entity_name": "RUBCN", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20826435", "30237576" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Royal Melbourne Hospital Clinical Genetics Department" ], "phenotypes": [ "Spinocerebellar ataxia, autosomal recessive 15, MIM#615705" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC33196", "KIAA1336", "IFT121", "IFTA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29250", "gene_name": "WD repeat domain 35", "omim_gene": [ "613602" ], "alias_name": null, "gene_symbol": "WDR35", "hgnc_symbol": "WDR35", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:20110021-20189892", "ensembl_id": "ENSG00000118965" } }, "GRch38": { "90": { "location": "2:19910260-19990131", "ensembl_id": "ENSG00000118965" } } }, "hgnc_date_symbol_changed": "2004-03-02" }, "entity_type": "gene", "entity_name": "WDR35", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cranioectodermal dysplasia 2, MIM#613610", "MONDO:0013323", "Short-rib thoracic dysplasia 7 with or without polydactyly, MIM#614091", "MONDO:0013569" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MCLC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29675", "gene_name": "chloride channel CLIC like 1", "omim_gene": [ "617539" ], "alias_name": [ "Mid1-related chloride channel (yeast)" ], "gene_symbol": "CLCC1", "hgnc_symbol": "CLCC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:109472130-109506111", "ensembl_id": "ENSG00000121940" } }, "GRch38": { "90": { "location": "1:108929508-108963457", "ensembl_id": "ENSG00000121940" } } }, "hgnc_date_symbol_changed": "2005-08-04" }, "entity_type": "gene", "entity_name": "CLCC1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30157172" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Retinitis pigmentosa 32, MIM# 609913" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DKFZP761L0424", "SKT", "ETL4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25428", "gene_name": "KIAA1217", "omim_gene": [ "617367" ], "alias_name": [ "sickle tail" ], "gene_symbol": "KIAA1217", "hgnc_symbol": "KIAA1217", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:23983675-24836772", "ensembl_id": "ENSG00000120549" } }, "GRch38": { "90": { "location": "10:23694746-24547848", "ensembl_id": "ENSG00000120549" } } }, "hgnc_date_symbol_changed": "2004-02-04" }, "entity_type": "gene", "entity_name": "KIAA1217", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32369272" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Skeletal system disorder MONDO:0005172, KIAA1217-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "h-mtRPOL", "APOLMT", "MTRNAP", "MTRPOL" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9200", "gene_name": "RNA polymerase mitochondrial", "omim_gene": [ "601778" ], "alias_name": null, "gene_symbol": "POLRMT", "hgnc_symbol": "POLRMT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:617223-633597", "ensembl_id": "ENSG00000099821" } }, "GRch38": { "90": { "location": "19:617224-633604", "ensembl_id": "ENSG00000099821" } } }, "hgnc_date_symbol_changed": "1997-07-11" }, "entity_type": "gene", "entity_name": "POLRMT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33602924" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Combined oxidative phosphorylation deficiency 55, MIM# 619743", "intellectual disability", "hypotonia" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4756", "version_created": "2026-04-21T17:26:37.026127+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ33496", "KIAA1843", "UNC-80" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26582", "gene_name": "unc-80 homolog, NALCN channel complex subunit", "omim_gene": [ "612636" ], "alias_name": null, "gene_symbol": "UNC80", "hgnc_symbol": "UNC80", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:210636717-210864024", "ensembl_id": "ENSG00000144406" } }, "GRch38": { "90": { "location": "2:209771993-209999300", "ensembl_id": "ENSG00000144406" } } }, "hgnc_date_symbol_changed": "2009-08-17" }, "entity_type": "gene", "entity_name": "UNC80", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26708751", "26708753", "26545877", "29572195" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hypotonia, infantile, with psychomotor retardation and characteristic facies 2, MIM# 616801", "MONDO:0014777" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.427", "version_created": "2026-04-02T17:28:09.565635+11:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 383, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10724", "MART-2", "MART2", "Skn", "ski", "rasp", "sit", "GUP2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18270", "gene_name": "hedgehog acyltransferase", "omim_gene": [ "605743" ], "alias_name": null, "gene_symbol": "HHAT", "hgnc_symbol": "HHAT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:210501596-210849638", "ensembl_id": "ENSG00000054392" } }, "GRch38": { "90": { "location": "1:210328252-210676296", "ensembl_id": "ENSG00000054392" } } }, "hgnc_date_symbol_changed": "2004-09-15" }, "entity_type": "gene", "entity_name": "HHAT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "24784881", "30912300", "33749989" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Nivelon-Nivelon-Mabille syndrome 600092" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.427", "version_created": "2026-04-02T17:28:09.565635+11:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 383, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ADHAPS", "ADAS", "ALDHPSY", "ADPS", "ADAP-S" ], "biotype": "protein_coding", "hgnc_id": "HGNC:327", "gene_name": "alkylglycerone phosphate synthase", "omim_gene": [ "603051" ], "alias_name": null, "gene_symbol": "AGPS", "hgnc_symbol": "AGPS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:178257372-178408564", "ensembl_id": "ENSG00000018510" } }, "GRch38": { "90": { "location": "2:177392644-177559299", "ensembl_id": "ENSG00000018510" } } }, "hgnc_date_symbol_changed": "1998-10-14" }, "entity_type": "gene", "entity_name": "AGPS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 155, "hash_id": null, "name": "Peroxisomal Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.61", "version_created": "2025-12-31T14:23:29.190009+11:00", "relevant_disorders": [ "Peroxisomal disease", "MONDO:0019053" ], "stats": { "number_of_genes": 32, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "M-RAs", "R-RAS3", "RRAS3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7227", "gene_name": "muscle RAS oncogene homolog", "omim_gene": [ "608435" ], "alias_name": null, "gene_symbol": "MRAS", "hgnc_symbol": "MRAS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:138066539-138124375", "ensembl_id": "ENSG00000158186" } }, "GRch38": { "90": { "location": "3:138347648-138405534", "ensembl_id": "ENSG00000158186" } } }, "hgnc_date_symbol_changed": "1999-09-29" }, "entity_type": "gene", "entity_name": "MRAS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "28289718", "1173466", "31108500", "31173466" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Noonan syndrome 11, MIM#618499" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 164, "hash_id": null, "name": "Rasopathy", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the ClinGen Rasopathy Working Group gene-disease validity assessments (PMID: 30311384) and against the Genomics England PanelApp Rasopathies panel, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "0.113", "version_created": "2026-01-26T17:08:48.260163+11:00", "relevant_disorders": [ "Rasopathy", "MONDO:0021060" ], "stats": { "number_of_genes": 32, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0373", "FLJ13615", "3H11Ag", "rd16", "NPHP6", "JBTS5", "SLSN6", "LCA10", "MKS4", "BBS14", "CT87", "POC3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29021", "gene_name": "centrosomal protein 290", "omim_gene": [ "610142" ], "alias_name": [ "Joubert syndrome 5", "nephrocystin-6", "cancer/testis antigen 87", "POC3 centriolar protein homolog (Chlamydomonas)", "Meckel syndrome, type 4", "Bardet-Biedl syndrome 14" ], "gene_symbol": "CEP290", "hgnc_symbol": "CEP290", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:88442793-88535993", "ensembl_id": "ENSG00000198707" } }, "GRch38": { "90": { "location": "12:88049014-88142216", "ensembl_id": "ENSG00000198707" } } }, "hgnc_date_symbol_changed": "2006-02-20" }, "entity_type": "gene", "entity_name": "CEP290", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18327255", "20690115", "16682973", "32208788" ], "evidence": [ "Expert Review Green", "KidGen_CilioNephronop v38.1.0", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Senior-Loken syndrome 6, MIM# 610189" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 193, "hash_id": null, "name": "Renal Ciliopathies and Nephronophthisis", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel was created by the KidGen consortium and is a consensus panel used by VCGS and KidGen", "status": "public", "version": "1.53", "version_created": "2026-03-19T17:14:29.802874+11:00", "relevant_disorders": [ "Abnormality of renal medullary morphology", "HP:0025361; Renal cyst", "HP:0000107" ], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NY-REN-58", "NPHP18" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17966", "gene_name": "centrosomal protein 83", "omim_gene": [ "615847" ], "alias_name": null, "gene_symbol": "CEP83", "hgnc_symbol": "CEP83", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:94700225-94853764", "ensembl_id": "ENSG00000173588" } }, "GRch38": { "90": { "location": "12:94306449-94459988", "ensembl_id": "ENSG00000173588" } } }, "hgnc_date_symbol_changed": "2014-03-06" }, "entity_type": "gene", "entity_name": "CEP83", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24882706", "33938610" ], "evidence": [ "Expert Review Green", "KidGen_CilioNephronop v38.1.0" ], "phenotypes": [ "Nephronophthisis 18, MIM# 615862", "MONDO:0014374", "Retinal dystrophy", "ID" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 193, "hash_id": null, "name": "Renal Ciliopathies and Nephronophthisis", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel was created by the KidGen consortium and is a consensus panel used by VCGS and KidGen", "status": "public", "version": "1.53", "version_created": "2026-03-19T17:14:29.802874+11:00", "relevant_disorders": [ "Abnormality of renal medullary morphology", "HP:0025361; Renal cyst", "HP:0000107" ], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC22014", "hCG_40738" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28313", "gene_name": "tet methylcytosine dioxygenase 3", "omim_gene": [ "613555" ], "alias_name": null, "gene_symbol": "TET3", "hgnc_symbol": "TET3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:74229840-74335303", "ensembl_id": "ENSG00000187605" } }, "GRch38": { "90": { "location": "2:73986404-74108176", "ensembl_id": "ENSG00000187605" } } }, "hgnc_date_symbol_changed": "2008-03-12" }, "entity_type": "gene", "entity_name": "TET3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "36192301" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Beck-Fahrner syndrome MIM#618798" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.409", "version_created": "2026-04-18T18:50:54.267331+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "UBF", "NOR-90", "UBF1", "UBF2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12511", "gene_name": "upstream binding transcription factor, RNA polymerase I", "omim_gene": [ "600673" ], "alias_name": null, "gene_symbol": "UBTF", "hgnc_symbol": "UBTF", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:42282401-42298994", "ensembl_id": "ENSG00000108312" } }, "GRch38": { "90": { "location": "17:44205033-44221626", "ensembl_id": "ENSG00000108312" } } }, "hgnc_date_symbol_changed": "1993-11-25" }, "entity_type": "gene", "entity_name": "UBTF", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 30517966" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Neurodegeneration, childhood-onset, with brain atrophy MIM#617672" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.409", "version_created": "2026-04-18T18:50:54.267331+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "RCD1", "RCD1+", "CT129", "CAF40" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10445", "gene_name": "CCR4-NOT transcription complex subunit 9", "omim_gene": [ "612054" ], "alias_name": [ "cancer/testis antigen 129" ], "gene_symbol": "CNOT9", "hgnc_symbol": "CNOT9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:219433303-219461803", "ensembl_id": "ENSG00000144580" } }, "GRch38": { "90": { "location": "2:218568580-218597080", "ensembl_id": "ENSG00000144580" } } }, "hgnc_date_symbol_changed": "2016-04-12" }, "entity_type": "gene", "entity_name": "CNOT9", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 37092538" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.409", "version_created": "2026-04-18T18:50:54.267331+10:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10486", "mtPAP", "SPAX4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25532", "gene_name": "mitochondrial poly(A) polymerase", "omim_gene": [ "613669" ], "alias_name": [ "TUTase1" ], "gene_symbol": "MTPAP", "hgnc_symbol": "MTPAP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:30598730-30663377", "ensembl_id": "ENSG00000107951" } }, "GRch38": { "90": { "location": "10:30309801-30374448", "ensembl_id": "ENSG00000107951" } } }, "hgnc_date_symbol_changed": "2009-01-12" }, "entity_type": "gene", "entity_name": "MTPAP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20970105", "25008111", "26319014", "31779033" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Mitochondrial Flagship" ], "phenotypes": [ "Spastic ataxia 4, autosomal recessive 613672", "Lethal encephalopathy" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "founder" ], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EAP30", "VPS22", "Dot3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17028", "gene_name": "SNF8, ESCRT-II complex subunit", "omim_gene": [ "610904" ], "alias_name": null, "gene_symbol": "SNF8", "hgnc_symbol": "SNF8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:47006678-47022479", "ensembl_id": "ENSG00000159210" } }, "GRch38": { "90": { "location": "17:48929316-48945117", "ensembl_id": "ENSG00000159210" } } }, "hgnc_date_symbol_changed": "2005-08-02" }, "entity_type": "gene", "entity_name": "SNF8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "38423010" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Developmental and epileptic encephalopathy 115, MIM#620783" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ14566", "AGO61" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25902", "gene_name": "protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)", "omim_gene": [ "614828" ], "alias_name": null, "gene_symbol": "POMGNT2", "hgnc_symbol": "POMGNT2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:43120724-43147568", "ensembl_id": "ENSG00000144647" } }, "GRch38": { "90": { "location": "3:43079232-43106076", "ensembl_id": "ENSG00000144647" } } }, "hgnc_date_symbol_changed": "2013-08-22" }, "entity_type": "gene", "entity_name": "POMGNT2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1350" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29255", "gene_name": "ubiquitin specific peptidase 53", "omim_gene": [ "617431" ], "alias_name": null, "gene_symbol": "USP53", "hgnc_symbol": "USP53", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:120133742-120216672", "ensembl_id": "ENSG00000145390" } }, "GRch38": { "90": { "location": "4:119212587-119295517", "ensembl_id": "ENSG00000145390" } } }, "hgnc_date_symbol_changed": "2004-01-28" }, "entity_type": "gene", "entity_name": "USP53", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30250217", "32124521", "33075013" ], "evidence": [ "Expert Review Amber", "Expert Review" ], "phenotypes": [ "Cholestasis, progressive familial intrahepatic, 7, with or without hearing loss, MIM# 619658" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "RNO2", "PYPAF7", "Monarch1", "PAN6", "CLR19.3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:22938", "gene_name": "NLR family pyrin domain containing 12", "omim_gene": [ "609648" ], "alias_name": [ "nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12" ], "gene_symbol": "NLRP12", "hgnc_symbol": "NLRP12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:54296857-54327648", "ensembl_id": "ENSG00000142405" } }, "GRch38": { "90": { "location": "19:53793603-53824394", "ensembl_id": "ENSG00000142405" } } }, "hgnc_date_symbol_changed": "2006-12-08" }, "entity_type": "gene", "entity_name": "NLRP12", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18230725", "21360512", "24064030", "27633793", "38343435" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Familial cold autoinflammatory syndrome 2 - MIM#611762" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Hs.6719", "BCS", "h-BCS", "BJS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1020", "gene_name": "BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone", "omim_gene": [ "603647" ], "alias_name": [ "GRACILE syndrome", "Bjornstad syndrome" ], "gene_symbol": "BCS1L", "hgnc_symbol": "BCS1L", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:219523487-219528166", "ensembl_id": "ENSG00000074582" } }, "GRch38": { "90": { "location": "2:218658764-218663443", "ensembl_id": "ENSG00000074582" } } }, "hgnc_date_symbol_changed": "1998-07-03" }, "entity_type": "gene", "entity_name": "BCS1L", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26563427", "24172246", "17314340" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Deafness Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bjornstad syndrome, MIM# 262000", "Leigh syndrome, MIM# 256000", "BCS1L-related mitochondrial disease" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AT-1", "AT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:95", "gene_name": "solute carrier family 33 member 1", "omim_gene": [ "603690" ], "alias_name": null, "gene_symbol": "SLC33A1", "hgnc_symbol": "SLC33A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:155538813-155572218", "ensembl_id": "ENSG00000169359" } }, "GRch38": { "90": { "location": "3:155821024-155854429", "ensembl_id": "ENSG00000169359" } } }, "hgnc_date_symbol_changed": "2002-12-06" }, "entity_type": "gene", "entity_name": "SLC33A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31194315" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Congenital cataracts, hearing loss, and neurodegeneration, MIM# 614482" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "WBP-2", "GRAMD6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12738", "gene_name": "WW domain binding protein 2", "omim_gene": [ "606962" ], "alias_name": null, "gene_symbol": "WBP2", "hgnc_symbol": "WBP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:73841780-73852588", "ensembl_id": "ENSG00000132471" } }, "GRch38": { "90": { "location": "17:75845699-75856507", "ensembl_id": "ENSG00000132471" } } }, "hgnc_date_symbol_changed": "1999-11-26" }, "entity_type": "gene", "entity_name": "WBP2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26881968" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Deafness, autosomal recessive 107, MIM#\t617639" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "PDIB2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1513", "gene_name": "calsequestrin 2", "omim_gene": [ "114251" ], "alias_name": null, "gene_symbol": "CASQ2", "hgnc_symbol": "CASQ2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:116242628-116311402", "ensembl_id": "ENSG00000118729" } }, "GRch38": { "90": { "location": "1:115700007-115768781", "ensembl_id": "ENSG00000118729" } } }, "hgnc_date_symbol_changed": "1992-11-05" }, "entity_type": "gene", "entity_name": "CASQ2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34012068" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Ventricular tachycardia, catecholaminergic polymorphic, 2, MIM#\t611938" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 221, "hash_id": null, "name": "Additional findings_Adult", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Additional findings flagship.\r\n\r\nThe framework used considered clinical actionability and public screening principles, for full publication see Martyn M et al 2019, PMID: 30776170. The genes included are associated with conditions that are adult-onset, clinically-actionable, have a known management pathway which is publicly funded in Victoria, and have a population frequency of gene variants greater than 1/100,000.\r\n\r\nThis has been updated with the 2023 ACMG V3.2 Secondary Findings list, PMID: 37347242.\r\n\r\nV1.0 was used for the Australian Genomics Acute Care additional findings study.\r\n\r\nThe panel has been updated with ClinGen Adult Actionability assertions.", "status": "public", "version": "2.0", "version_created": "2026-03-16T10:56:03.168206+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 136, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CLMF", "IL-12B", "NKSF", "CLMF2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5970", "gene_name": "interleukin 12B", "omim_gene": [ "161561" ], "alias_name": [ "natural killer cell stimulatory factor-2", "cytotoxic lymphocyte maturation factor 2, p40", "interleukin 12, p40", "natural killer cell stimulatory factor, 40 kD subunit", "interleukin-12 beta chain", "IL12, subunit p40" ], "gene_symbol": "IL12B", "hgnc_symbol": "IL12B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:158741791-158757895", "ensembl_id": "ENSG00000113302" } }, "GRch38": { "90": { "location": "5:159314783-159330887", "ensembl_id": "ENSG00000113302" } } }, "hgnc_date_symbol_changed": "1991-08-08" }, "entity_type": "gene", "entity_name": "IL12B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9854038", "11753820", "34389021" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Immunodeficiency 29, mycobacteriosis, MIM# 614890" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 231, "hash_id": null, "name": "Defects of intrinsic and innate immunity", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause defects in intrinsic and innate immunity, including the following:\r\n- Mendelian susceptibility to mycobacterial disease (MSMD)\r\n- Epidermodysplasia verruciformis (HPV)\r\n- Predisposition to severe viral infection\r\n- Herpes simplex encephalitis (HSE)\r\n- Predisposition to mucocutaneous candidiasis\r\n- Other inborn errors of immunity related to non-haematopoietic tissues\r\n- Other inborn errors of immunity related to leukocytes\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.39", "version_created": "2026-04-15T16:26:05.053680+10:00", "relevant_disorders": [ "Unusual infections", "HP:0032101" ], "stats": { "number_of_genes": 86, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "JM23", "CDLIV", "SPB1", "TRM7", "TRMT7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13254", "gene_name": "FtsJ RNA methyltransferase homolog 1", "omim_gene": [ "300499" ], "alias_name": [ "tRNA methyltransferase 7 homolog (S. cerevisiae)" ], "gene_symbol": "FTSJ1", "hgnc_symbol": "FTSJ1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:48334541-48344752", "ensembl_id": "ENSG00000068438" } }, "GRch38": { "90": { "location": "X:48476021-48486364", "ensembl_id": "ENSG00000068438" } } }, "hgnc_date_symbol_changed": "2001-11-09" }, "entity_type": "gene", "entity_name": "FTSJ1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "https://search.clinicalgenome.org/CCID:004892" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Intellectual developmental disorder, X-linked 9, MIM#\t309549", "X-linked complex neurodevelopmental disorder MONDO:0100148" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RNASE6PL", "FLJ10907", "bA514O12.3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21686", "gene_name": "ribonuclease T2", "omim_gene": [ "612944" ], "alias_name": null, "gene_symbol": "RNASET2", "hgnc_symbol": "RNASET2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:167342992-167370679", "ensembl_id": "ENSG00000026297" } }, "GRch38": { "90": { "location": "6:166929504-166957191", "ensembl_id": "ENSG00000026297" } } }, "hgnc_date_symbol_changed": "2003-11-26" }, "entity_type": "gene", "entity_name": "RNASET2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31349848", "19525954", "27091087", "29336640", "18545798", "15851732" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DJ159A19.3", "RP1-159A19.1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25230", "gene_name": "AT-hook DNA binding motif containing 1", "omim_gene": [ "615790" ], "alias_name": null, "gene_symbol": "AHDC1", "hgnc_symbol": "AHDC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:27860546-27930942", "ensembl_id": "ENSG00000126705" } }, "GRch38": { "90": { "location": "1:27534035-27604431", "ensembl_id": "ENSG00000126705" } } }, "hgnc_date_symbol_changed": "2005-07-21" }, "entity_type": "gene", "entity_name": "AHDC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24791903", "27148574", "30152016" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Xia-Gibbs syndrome, MIM# 615829", "AHDC1-related intellectual disability, obstructive sleep apnoea, mild dysmorphism syndrome MONDO:0014358" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZp761P1121" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25439", "gene_name": "transport and golgi organization 2 homolog", "omim_gene": [ "616830" ], "alias_name": null, "gene_symbol": "TANGO2", "hgnc_symbol": "TANGO2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:20004537-20053449", "ensembl_id": "ENSG00000183597" } }, "GRch38": { "90": { "location": "22:20017014-20065926", "ensembl_id": "ENSG00000183597" } } }, "hgnc_date_symbol_changed": "2012-12-13" }, "entity_type": "gene", "entity_name": "TANGO2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29369572" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, MIM#\t616878", "metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration MONDO:0014812" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20485" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26033", "gene_name": "pseudouridylate synthase 7 (putative)", "omim_gene": [ "616261" ], "alias_name": null, "gene_symbol": "PUS7", "hgnc_symbol": "PUS7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:105080108-105162714", "ensembl_id": "ENSG00000091127" } }, "GRch38": { "90": { "location": "7:105439661-105522267", "ensembl_id": "ENSG00000091127" } } }, "hgnc_date_symbol_changed": "2006-02-07" }, "entity_type": "gene", "entity_name": "PUS7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 30526862", "30778726", "31583274" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Intellectual developmental disorder with abnormal behavior, microcephaly, and short stature", "OMIM #618342" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "AKA", "Math4C", "ngn1", "bHLHa6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7764", "gene_name": "neurogenin 1", "omim_gene": [ "601726" ], "alias_name": [ "neurogenic differentiation 3" ], "gene_symbol": "NEUROG1", "hgnc_symbol": "NEUROG1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:134869991-134871639", "ensembl_id": "ENSG00000181965" } }, "GRch38": { "90": { "location": "5:135534282-135535949", "ensembl_id": "ENSG00000181965" } } }, "hgnc_date_symbol_changed": "1997-04-10" }, "entity_type": "gene", "entity_name": "NEUROG1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "23419067", "26077850", "33439489", "36647078" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Cranial dysinnervation disorder, congenital, with absent corneal reflex and developmental delay, OMIM:620469" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2198", "gene_name": "collagen type I alpha 2 chain", "omim_gene": [ "120160" ], "alias_name": [ "alpha 2(I)-collagen", "alpha-2 collagen type I", "type I procollagen", "collagen I, alpha-2 polypeptide", "collagen of skin, tendon and bone, alpha-2 chain" ], "gene_symbol": "COL1A2", "hgnc_symbol": "COL1A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:94023873-94060544", "ensembl_id": "ENSG00000164692" } }, "GRch38": { "90": { "location": "7:94394561-94431232", "ensembl_id": "ENSG00000164692" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "COL1A2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "Genetic Health Queensland" ], "phenotypes": [ "Ehlers-Danlos syndrome, arthrochalasia type, 2, MIM# 617821", "Ehlers-Danlos syndrome, cardiac valvular type, MIM# 225320", "Osteogenesis imperfecta, type II, MIM# 166210", "Osteogenesis imperfecta, type III, MIM# 259420", "Osteogenesis imperfecta, type IV, MIM# 166220" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.753", "version_created": "2026-04-20T16:26:20.852704+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2524, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "UGTrel4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16872", "gene_name": "solute carrier family 35 member B2", "omim_gene": [ "610788" ], "alias_name": null, "gene_symbol": "SLC35B2", "hgnc_symbol": "SLC35B2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:44221833-44225291", "ensembl_id": "ENSG00000157593" } }, "GRch38": { "90": { "location": "6:44254096-44257890", "ensembl_id": "ENSG00000157593" } } }, "hgnc_date_symbol_changed": "2003-04-10" }, "entity_type": "gene", "entity_name": "SLC35B2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 35325049" ], "evidence": [ "Expert Review Amber", "Literature", "Literature" ], "phenotypes": [ "Leukodystrophy, hypomyelinating, 26, with chondrodysplasia, MIM# 620269" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ADHAPS", "ADAS", "ALDHPSY", "ADPS", "ADAP-S" ], "biotype": "protein_coding", "hgnc_id": "HGNC:327", "gene_name": "alkylglycerone phosphate synthase", "omim_gene": [ "603051" ], "alias_name": null, "gene_symbol": "AGPS", "hgnc_symbol": "AGPS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:178257372-178408564", "ensembl_id": "ENSG00000018510" } }, "GRch38": { "90": { "location": "2:177392644-177559299", "ensembl_id": "ENSG00000018510" } } }, "hgnc_date_symbol_changed": "1998-10-14" }, "entity_type": "gene", "entity_name": "AGPS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "UKGTN", "Radboud University Medical Center, Nijmegen", "NHS GMS", "Emory Genetics Laboratory", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Foundation Trust)\tRhizomelic chondrodysplasia punctata, type 3 600121", "Rhizomelic chondrodysplasia punctata, type 3 600121" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Nip1", "SEC20" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1082", "gene_name": "BCL2 interacting protein 1", "omim_gene": [ "603291" ], "alias_name": null, "gene_symbol": "BNIP1", "hgnc_symbol": "BNIP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:172571445-172591390", "ensembl_id": "ENSG00000113734" } }, "GRch38": { "90": { "location": "5:173144442-173164387", "ensembl_id": "ENSG00000113734" } } }, "hgnc_date_symbol_changed": "1997-03-19" }, "entity_type": "gene", "entity_name": "BNIP1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35266227", "31344970" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Spondylopeiphyseal dysplasia, Holling type, MIM# 621345" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "Insp3r1", "IP3R1", "ACV", "PPP1R94" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6180", "gene_name": "inositol 1,4,5-trisphosphate receptor type 1", "omim_gene": [ "147265" ], "alias_name": [ "protein phosphatase 1, regulatory subunit 94" ], "gene_symbol": "ITPR1", "hgnc_symbol": "ITPR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:4535032-4889524", "ensembl_id": "ENSG00000150995" } }, "GRch38": { "90": { "location": "3:4493348-4847840", "ensembl_id": "ENSG00000150995" } } }, "hgnc_date_symbol_changed": "1990-03-14" }, "entity_type": "gene", "entity_name": "ITPR1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "Expert list", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Spinocerebellar ataxia 15 MIM#606658", "Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "mer", "RP38", "c-Eyk", "Tyro12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7027", "gene_name": "MER proto-oncogene, tyrosine kinase", "omim_gene": [ "604705" ], "alias_name": null, "gene_symbol": "MERTK", "hgnc_symbol": "MERTK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:112656056-112787138", "ensembl_id": "ENSG00000153208" } }, "GRch38": { "90": { "location": "2:111898479-112029561", "ensembl_id": "ENSG00000153208" } } }, "hgnc_date_symbol_changed": "1998-11-30" }, "entity_type": "gene", "entity_name": "MERTK", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11062461", "17301963", "20300561", "22180149" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Retinitis pigmentosa 38, MIM# 613862" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 277, "hash_id": null, "name": "Retinitis pigmentosa", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause nonsyndromic retinitis pigmentosa and Leber congenital amaurosis. \r\nNote: Exome sequencing may not be a suitable technique for detecting pathogenic variants in RPGR due to regions of low coverage.\r\n\r\nPlease consider the Syndromic Retinopathy and the Retinal Disorders Superpanel when additional features are present.", "status": "public", "version": "0.245", "version_created": "2026-03-28T13:33:23.781842+11:00", "relevant_disorders": [ "Abnormal retinal morphology", "HP:0000479" ], "stats": { "number_of_genes": 159, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "IFP53" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12729", "gene_name": "tryptophanyl-tRNA synthetase", "omim_gene": [ "191050" ], "alias_name": [ "tryptophan tRNA ligase 1, cytoplasmic" ], "gene_symbol": "WARS", "hgnc_symbol": "WARS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:100800125-100843142", "ensembl_id": "ENSG00000140105" } }, "GRch38": { "90": { "location": "14:100333788-100376805", "ensembl_id": "ENSG00000140105" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "WARS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 35815345 PMID: 35790048" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities,MIM# 620317" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.394", "version_created": "2026-04-07T13:49:15.516142+10:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TREM-2", "Trem2a", "Trem2b", "Trem2c" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17761", "gene_name": "triggering receptor expressed on myeloid cells 2", "omim_gene": [ "605086" ], "alias_name": null, "gene_symbol": "TREM2", "hgnc_symbol": "TREM2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:41126244-41130924", "ensembl_id": "ENSG00000095970" } }, "GRch38": { "90": { "location": "6:41158506-41163186", "ensembl_id": "ENSG00000095970" } } }, "hgnc_date_symbol_changed": "2002-08-09" }, "entity_type": "gene", "entity_name": "TREM2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12080485", "15883308" ], "evidence": [ "Royal Melbourne Hospital", "Expert Review Green", "Expert Review Green" ], "phenotypes": [ "Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, 618193" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.394", "version_created": "2026-04-07T13:49:15.516142+10:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FBLN6", "FIBL6", "FIBL-6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19194", "gene_name": "hemicentin 1", "omim_gene": [ "608548" ], "alias_name": [ "fibulin 6" ], "gene_symbol": "HMCN1", "hgnc_symbol": "HMCN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:185703683-186160085", "ensembl_id": "ENSG00000143341" } }, "GRch38": { "90": { "location": "1:185734551-186190949", "ensembl_id": "ENSG00000143341" } } }, "hgnc_date_symbol_changed": "2005-06-03" }, "entity_type": "gene", "entity_name": "HMCN1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "Royal Melbourne Hospital" ], "phenotypes": [ "Macular Degeneration" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 303, "hash_id": null, "name": "Macular Dystrophy/Stargardt Disease", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause macular dystrophy and Stargardt disease. It is maintained by the Royal Melbourne Hospital for use in the ocular genetics clinic. It is a consensus panel used by VCGS.\r\n\r\nConsider using the broader Retinal Disorders superpanel when ophthalmological findings are not specific for this sub-group of disorders, particularly in individuals early in the diagnostic trajectory or where additional features are present.", "status": "public", "version": "0.60", "version_created": "2026-03-31T16:05:02.510211+11:00", "relevant_disorders": [ "Macular dystrophy", "HP:0007754" ], "stats": { "number_of_genes": 39, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ32642", "HCRP1", "SPG53" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24928", "gene_name": "VPS37A, ESCRT-I subunit", "omim_gene": [ "609927" ], "alias_name": [ "hepatocellular carcinoma related protein 1" ], "gene_symbol": "VPS37A", "hgnc_symbol": "VPS37A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:17104080-17159936", "ensembl_id": "ENSG00000155975" } }, "GRch38": { "90": { "location": "8:17246571-17302427", "ensembl_id": "ENSG00000155975" } } }, "hgnc_date_symbol_changed": "2005-09-08" }, "entity_type": "gene", "entity_name": "VPS37A", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22717650" ], "evidence": [ "Expert Review Amber", "Royal Melbourne Hospital" ], "phenotypes": [ "Spastic paraplegia 53, autosomal recessive, MIM# 614898, AR" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HumORF8", "KIAA0055", "UBPY", "SPG59" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12631", "gene_name": "ubiquitin specific peptidase 8", "omim_gene": [ "603158" ], "alias_name": null, "gene_symbol": "USP8", "hgnc_symbol": "USP8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:50716577-50793280", "ensembl_id": "ENSG00000138592" } }, "GRch38": { "90": { "location": "15:50424380-50514419", "ensembl_id": "ENSG00000138592" } } }, "hgnc_date_symbol_changed": "1999-02-01" }, "entity_type": "gene", "entity_name": "USP8", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24482476" ], "evidence": [ "Expert Review Amber", "Royal Melbourne Hospital" ], "phenotypes": [ "Complicated hereditary spastic paraplegia" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC10744" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28128", "gene_name": "transmembrane protein 107", "omim_gene": [ "616183" ], "alias_name": null, "gene_symbol": "TMEM107", "hgnc_symbol": "TMEM107", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:8076555-8079717", "ensembl_id": "ENSG00000179029" } }, "GRch38": { "90": { "location": "17:8173237-8176399", "ensembl_id": "ENSG00000179029" } } }, "hgnc_date_symbol_changed": "2005-12-19" }, "entity_type": "gene", "entity_name": "TMEM107", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26595381" ], "evidence": [ "Expert Review Amber", "Expert list", "Expert Review Green", "Expert Review", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Joubert syndrome 29 MIM#617562", "Orofaciodigital syndrome XVI MIM#617563" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3099, "hash_id": null, "name": "Syndromic Retinopathy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause retinopathy with at least one other consistent extra-ocular feature, forming a syndrome. The panel does NOT include the Bardet-Biedl syndrome, Stickler syndrome, and Usher syndrome genes, which have their own panels and are part of the Retinal Disorders Superpanel.\r\n\r\nConsider using the panel Retinal Disorders Superpanel when ophthalmological findings are not specific for a sub-group of disorders, particularly in individuals early in the diagnostic trajectory or if a dual diagnosis is a possibility.", "status": "public", "version": "0.257", "version_created": "2026-04-21T11:24:13.037194+10:00", "relevant_disorders": [ "Retinopathy", "HP:0000488" ], "stats": { "number_of_genes": 139, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:13869", "gene_name": "lysyl oxidase like 3", "omim_gene": [ "607163" ], "alias_name": null, "gene_symbol": "LOXL3", "hgnc_symbol": "LOXL3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:74759541-74782817", "ensembl_id": "ENSG00000115318" } }, "GRch38": { "90": { "location": "2:74532414-74555690", "ensembl_id": "ENSG00000115318" } } }, "hgnc_date_symbol_changed": "2001-06-27" }, "entity_type": "gene", "entity_name": "LOXL3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30362103", "25663169" ], "evidence": [ "Expert Review Green", "Expert list", "Expert list" ], "phenotypes": [ "Stickler syndrome, MONDO:0019354, LOXL3-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3114, "hash_id": null, "name": "Stickler Syndrome", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This is a consensus panel between VCGS and RMH.\r\n\r\nThis panel contains genes associated with Stickler syndrome, a connective tissue disorder that can include ocular findings of myopia, cataract, and retinal detachment; hearing loss that is both conductive and sensorineural; midfacial underdevelopment and cleft palate (either alone or as part of the Robin sequence); and mild spondyloepiphyseal dysplasia and/or precocious arthritis.\r\n\r\nThe features of Stickler syndrome can be highly variable. Consider applying the Vitreoretinopathy, Deafness, Skeletal Dysplasia and Pierre Robin sequence panels if features are not entirely typical.", "status": "public", "version": "1.12", "version_created": "2025-10-24T18:06:37.494562+11:00", "relevant_disorders": [ "Myopia", "HP:0000545; Retinal detachment", "HP:0000541; Cleft palate", "HP:0000175" ], "stats": { "number_of_genes": 10, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLVCR", "MFSD7B", "PCA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24682", "gene_name": "feline leukemia virus subgroup C cellular receptor 1", "omim_gene": [ "609144" ], "alias_name": null, "gene_symbol": "FLVCR1", "hgnc_symbol": "FLVCR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:213031597-213072705", "ensembl_id": "ENSG00000162769" } }, "GRch38": { "90": { "location": "1:212858255-212899363", "ensembl_id": "ENSG00000162769" } } }, "hgnc_date_symbol_changed": "2007-05-01" }, "entity_type": "gene", "entity_name": "FLVCR1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Ataxia, posterior column, with retinitis pigmentosa, 609033 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CGI-121", "CGI121" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24259", "gene_name": "TP53RK binding protein", "omim_gene": [ "608680" ], "alias_name": null, "gene_symbol": "TPRKB", "hgnc_symbol": "TPRKB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:73956231-73964527", "ensembl_id": "ENSG00000144034" } }, "GRch38": { "90": { "location": "2:73729104-73737400", "ensembl_id": "ENSG00000144034" } } }, "hgnc_date_symbol_changed": "2006-02-02" }, "entity_type": "gene", "entity_name": "TPRKB", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "28805828", "30053862" ], "evidence": [ "Expert Review" ], "phenotypes": [ "Galloway-Mowat syndrome 5, MIM# 617731" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DUP", "RIS2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24576", "gene_name": "chromatin licensing and DNA replication factor 1", "omim_gene": [ "605525" ], "alias_name": null, "gene_symbol": "CDT1", "hgnc_symbol": "CDT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:88869621-88875666", "ensembl_id": "ENSG00000167513" } }, "GRch38": { "90": { "location": "16:88803213-88809258", "ensembl_id": "ENSG00000167513" } } }, "hgnc_date_symbol_changed": "2006-05-25" }, "entity_type": "gene", "entity_name": "CDT1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Meier-Gorlin syndrome 4, 613804 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ13386" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25815", "gene_name": "centrosomal protein 63", "omim_gene": [ "614724" ], "alias_name": null, "gene_symbol": "CEP63", "hgnc_symbol": "CEP63", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:134204585-134293859", "ensembl_id": "ENSG00000182923" } }, "GRch38": { "90": { "location": "3:134485743-134575017", "ensembl_id": "ENSG00000182923" } } }, "hgnc_date_symbol_changed": "2005-12-01" }, "entity_type": "gene", "entity_name": "CEP63", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21983783" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp", "Expert Review Amber", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Seckel syndrome 6 614728" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3144, "hash_id": null, "name": "Cerebral vascular malformations", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes associated with cerebral vascular malformations, including:\r\nVein of Galen malformation\r\nCerebral vascular malformations\r\nMoyamoya disease\r\n\r\nConsider applying the Stroke and Aortopathy_Connective Tissue Disorders panels due to overlap in clinical features.\r\nWith thanks to the Genomics England PanelApp team for the original design.", "status": "public", "version": "1.12", "version_created": "2026-01-22T10:52:30.127872+11:00", "relevant_disorders": [ "Abnormal cerebral vascular morphology HP:0100659" ], "stats": { "number_of_genes": 54, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SEMAK", "Sema4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10728", "gene_name": "semaphorin 3F", "omim_gene": [ "601124" ], "alias_name": [ "sema IV" ], "gene_symbol": "SEMA3F", "hgnc_symbol": "SEMA3F", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:50192478-50226508", "ensembl_id": "ENSG00000001617" } }, "GRch38": { "90": { "location": "3:50155045-50189075", "ensembl_id": "ENSG00000001617" } } }, "hgnc_date_symbol_changed": "1995-12-18" }, "entity_type": "gene", "entity_name": "SEMA3F", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 33495532" ], "evidence": [ "Expert Review Green", "Literature", "Literature", "Literature", "Literature" ], "phenotypes": [ "Hypogonadotropic hypogonadism" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3236, "hash_id": null, "name": "Pituitary hormone deficiency", "disease_group": "Endocrine disorders", "disease_sub_group": "Pituitary disorders", "description": "This panel contains genes associated with pituitary hormone deficiency. \r\nIncludes isolated hormone deficiency, combined hormone deficiencies, and panhypopituitarism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Pituitary hormone deficiency' panel V4.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.208", "version_created": "2026-04-02T15:15:10.893013+11:00", "relevant_disorders": [ "Hypopituitarism", "HP:0040075" ], "stats": { "number_of_genes": 118, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CLP", "MLP", "CMD1M" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2472", "gene_name": "cysteine and glycine rich protein 3", "omim_gene": [ "600824" ], "alias_name": [ "cardiac LIM protein" ], "gene_symbol": "CSRP3", "hgnc_symbol": "CSRP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:19203578-19232120", "ensembl_id": "ENSG00000129170" } }, "GRch38": { "90": { "location": "11:19182030-19210573", "ensembl_id": "ENSG00000129170" } } }, "hgnc_date_symbol_changed": "1999-07-21" }, "entity_type": "gene", "entity_name": "CSRP3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "South West GLH", "NHS GMS", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cardiomyopathy, dilated, 1M", "Cardiomyopathy, familial hypertrophic, 12" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3270, "hash_id": null, "name": "Cardiomyopathy_Paediatric", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "With thanks to Genomics England PanelApp for the original design of this panel.\r\n\r\nThis panel contains genes associated with childhood-onset cardiomyopathy, including as part of syndromic and metabolic conditions. It is maintained by VCGS.", "status": "public", "version": "0.229", "version_created": "2026-03-31T18:53:53.165018+11:00", "relevant_disorders": [ "Cardiomyopathy", "HP:0001638;Abnormality of the myocardium", "HP:0001637" ], "stats": { "number_of_genes": 252, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:20039", "gene_name": "cyclase associated actin cytoskeleton regulatory protein 2", "omim_gene": null, "alias_name": null, "gene_symbol": "CAP2", "hgnc_symbol": "CAP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:17393447-17558023", "ensembl_id": "ENSG00000112186" } }, "GRch38": { "90": { "location": "6:17393216-17557792", "ensembl_id": "ENSG00000112186" } } }, "hgnc_date_symbol_changed": "2003-05-12" }, "entity_type": "gene", "entity_name": "CAP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 30518548", "33083013", "34862840" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Cardiomyopathy, dilated, 2I (MIM#620462)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3270, "hash_id": null, "name": "Cardiomyopathy_Paediatric", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "With thanks to Genomics England PanelApp for the original design of this panel.\r\n\r\nThis panel contains genes associated with childhood-onset cardiomyopathy, including as part of syndromic and metabolic conditions. It is maintained by VCGS.", "status": "public", "version": "0.229", "version_created": "2026-03-31T18:53:53.165018+11:00", "relevant_disorders": [ "Cardiomyopathy", "HP:0001638;Abnormality of the myocardium", "HP:0001637" ], "stats": { "number_of_genes": 252, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MEK2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6842", "gene_name": "mitogen-activated protein kinase kinase 2", "omim_gene": [ "601263" ], "alias_name": null, "gene_symbol": "MAP2K2", "hgnc_symbol": "MAP2K2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:4090319-4124126", "ensembl_id": "ENSG00000126934" } }, "GRch38": { "90": { "location": "19:4090321-4124129", "ensembl_id": "ENSG00000126934" } } }, "hgnc_date_symbol_changed": "1993-11-05" }, "entity_type": "gene", "entity_name": "MAP2K2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Cardiofaciocutaneous syndrome" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NBC1", "HNBC1", "NBC2", "pNBC", "hhNMC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11030", "gene_name": "solute carrier family 4 member 4", "omim_gene": [ "603345" ], "alias_name": null, "gene_symbol": "SLC4A4", "hgnc_symbol": "SLC4A4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:72053003-72437804", "ensembl_id": "ENSG00000080493" } }, "GRch38": { "90": { "location": "4:71186757-71572087", "ensembl_id": "ENSG00000080493" } } }, "hgnc_date_symbol_changed": "1998-12-11" }, "entity_type": "gene", "entity_name": "SLC4A4", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Renal tubular acidosis, proximal, with ocular abnormalities" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "beta4Gal-T1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:924", "gene_name": "beta-1,4-galactosyltransferase 1", "omim_gene": [ "137060" ], "alias_name": null, "gene_symbol": "B4GALT1", "hgnc_symbol": "B4GALT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:33104080-33167354", "ensembl_id": "ENSG00000086062" } }, "GRch38": { "90": { "location": "9:33104082-33167356", "ensembl_id": "ENSG00000086062" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "B4GALT1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "CDG syndrome type IId" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ASP", "ACY2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:756", "gene_name": "aspartoacylase", "omim_gene": [ "608034" ], "alias_name": [ "aminoacylase 2", "Canavan disease" ], "gene_symbol": "ASPA", "hgnc_symbol": "ASPA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:3375668-3406713", "ensembl_id": "ENSG00000108381" } }, "GRch38": { "90": { "location": "17:3472374-3503419", "ensembl_id": "ENSG00000108381" } } }, "hgnc_date_symbol_changed": "1993-12-09" }, "entity_type": "gene", "entity_name": "ASPA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Canavan disease" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TNNC1", "CMH7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11947", "gene_name": "troponin I3, cardiac type", "omim_gene": [ "191044" ], "alias_name": null, "gene_symbol": "TNNI3", "hgnc_symbol": "TNNI3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:55663137-55669141", "ensembl_id": "ENSG00000129991" } }, "GRch38": { "90": { "location": "19:55151767-55157773", "ensembl_id": "ENSG00000129991" } } }, "hgnc_date_symbol_changed": "1989-12-11" }, "entity_type": "gene", "entity_name": "TNNI3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Amber", "BabySeq Category B gene" ], "phenotypes": [ "Familial hypertrophic cardiomyopathy", "Cardiomyopathy, dilated" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "IKBKBBP", "NIBP", "KIAA1882", "T1", "TRS120", "MRT13" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30832", "gene_name": "trafficking protein particle complex 9", "omim_gene": [ "611966" ], "alias_name": [ "TRAPP 120 kDa subunit", "tularik gene 1" ], "gene_symbol": "TRAPPC9", "hgnc_symbol": "TRAPPC9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:140742586-141468678", "ensembl_id": "ENSG00000167632" } }, "GRch38": { "90": { "location": "8:139730343-140458579", "ensembl_id": "ENSG00000167632" } } }, "hgnc_date_symbol_changed": "2008-05-07" }, "entity_type": "gene", "entity_name": "TRAPPC9", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20004764" ], "evidence": [ "Expert Review Green" ], "phenotypes": [ "MENTAL RETARDATION, AUTOSOMAL RECESSIVE 13", "MRT13" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DBP-5", "NREBP", "KIAA1019", "BASS1", "FLJ21099", "FLJ33914" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11183", "gene_name": "SON DNA binding protein", "omim_gene": [ "182465" ], "alias_name": [ "NRE-binding protein", "negative regulatory element-binding protein", "Bax antagonist selected in Saccharomyces 1" ], "gene_symbol": "SON", "hgnc_symbol": "SON", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:34914924-34949812", "ensembl_id": "ENSG00000159140" } }, "GRch38": { "90": { "location": "21:33542618-33577481", "ensembl_id": "ENSG00000159140" } } }, "hgnc_date_symbol_changed": "1994-08-05" }, "entity_type": "gene", "entity_name": "SON", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27545680" ], "evidence": [ "Expert Review Green" ], "phenotypes": [ "ZTTK SYNDROME", "ZTTKS" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PLZF" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12930", "gene_name": "zinc finger and BTB domain containing 16", "omim_gene": [ "176797" ], "alias_name": [ "promyelocytic leukaemia zinc finger" ], "gene_symbol": "ZBTB16", "hgnc_symbol": "ZBTB16", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:113930315-114121398", "ensembl_id": "ENSG00000109906" } }, "GRch38": { "90": { "location": "11:114059593-114250676", "ensembl_id": "ENSG00000109906" } } }, "hgnc_date_symbol_changed": "2004-07-16" }, "entity_type": "gene", "entity_name": "ZBTB16", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "NSW Health Pathology" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 3437, "hash_id": null, "name": "Incidentalome_PREGEN_DRAFT", "disease_group": "", "disease_sub_group": "", "description": "Imported to facilitate update work. Do not use while labeled as DRAFT", "status": "public", "version": "0.43", "version_created": "2021-01-20T16:42:09.286633+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 173, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "P5CS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9722", "gene_name": "aldehyde dehydrogenase 18 family member A1", "omim_gene": [ "138250" ], "alias_name": null, "gene_symbol": "ALDH18A1", "hgnc_symbol": "ALDH18A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:97365696-97416463", "ensembl_id": "ENSG00000059573" } }, "GRch38": { "90": { "location": "10:95605929-95656706", "ensembl_id": "ENSG00000059573" } } }, "hgnc_date_symbol_changed": "2004-08-12" }, "entity_type": "gene", "entity_name": "ALDH18A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32221810", "11092761", "29754261", "26026163" ], "evidence": [ "Expert Review Green", "NHS GMS" ], "phenotypes": [ "Cutis laxa, autosomal recessive, type IIIA MIM#219150", "Spastic paraplegia 9A, autosomal dominant MIM#601162", "Spastic paraplegia 9B, autosomal recessive MIM#616586", "Cutis laxa, autosomal dominant 3 MIM#616603", "disorders of ornithine or proline metabolism" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3468, "hash_id": null, "name": "Miscellaneous Metabolic Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause miscellaneous metabolic disorders, that are not present on any of the more specific metabolic disorders panels (see the Metabolic Disorders Superpanel for the full list of panels). It contains, but is not limited to, the following groups of conditions:\r\n-Disorders of purine and pyrimidine metabolism\r\n-Organic acidurias, and other disorders of amino acid and peptide metabolism\r\n-Disorders of bile acid metabolism and transport, and other disorders of the metabolism of sterols\r\n-Disorders of nucleotide metabolism\r\n-Disorders of glucose transport, and other disorders of carbohydrate metabolism (excluding glycogen storage disorders)\r\n-Disorders of zinc and manganese metabolism\r\n-Disorders of vitamins and cofactors\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.60", "version_created": "2026-01-15T15:39:27.439934+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 149, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ20695" ], "biotype": "protein_coding", "hgnc_id": "HGNC:22965", "gene_name": "peroxisomal biogenesis factor 26", "omim_gene": [ "608666" ], "alias_name": null, "gene_symbol": "PEX26", "hgnc_symbol": "PEX26", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:18560689-18613905", "ensembl_id": "ENSG00000215193" } }, "GRch38": { "90": { "location": "22:18077920-18131138", "ensembl_id": "ENSG00000215193" } } }, "hgnc_date_symbol_changed": "2003-08-05" }, "entity_type": "gene", "entity_name": "PEX26", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28944237", "33926089" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Heimler syndrome", "Amelogenesis imperfecta" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3564, "hash_id": null, "name": "Amelogenesis imperfecta", "disease_group": "Skeletal disorders", "disease_sub_group": "", "description": "This panel contains genes associated with amelogenesis imperfecta, which is characterised by dental hypomineralisation and/or hypoplasia, resulting in discolouration, sensitivity and fragility. Both the primary and secondary dentition are commonly affected. Amelogenesis imperfecta can either be isolated or part of other rare disorders.\r\n\r\nConsider the Ectodermal Dysplasia panel if relevant clinical features are present (skin/hair/nail abnormalities) and dental findings are not typical.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel.", "status": "public", "version": "1.14", "version_created": "2026-01-09T15:02:14.439855+11:00", "relevant_disorders": [ "Amelogenesis imperfecta", "HP:0000705" ], "stats": { "number_of_genes": 41, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GluN2A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4585", "gene_name": "glutamate ionotropic receptor NMDA type subunit 2A", "omim_gene": [ "138253" ], "alias_name": null, "gene_symbol": "GRIN2A", "hgnc_symbol": "GRIN2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:9852376-10276611", "ensembl_id": "ENSG00000183454" } }, "GRch38": { "90": { "location": "16:9753404-10182754", "ensembl_id": "ENSG00000183454" } } }, "hgnc_date_symbol_changed": "1992-09-18" }, "entity_type": "gene", "entity_name": "GRIN2A", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "30544257" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Epilepsy, focal, with speech disorder and with or without mental retardation, MIM# 245570" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NAG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7632", "gene_name": "N-acetyl-alpha-glucosaminidase", "omim_gene": [ "609701" ], "alias_name": [ "Sanfilippo disease IIIB" ], "gene_symbol": "NAGLU", "hgnc_symbol": "NAGLU", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:40688190-40696467", "ensembl_id": "ENSG00000108784" } }, "GRch38": { "90": { "location": "17:42536172-42544449", "ensembl_id": "ENSG00000108784" } } }, "hgnc_date_symbol_changed": "1995-09-15" }, "entity_type": "gene", "entity_name": "NAGLU", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8650226" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp" ], "phenotypes": [ "Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2084", "gene_name": "caseinolytic mitochondrial matrix peptidase proteolytic subunit", "omim_gene": [ "601119" ], "alias_name": [ "ATP-dependent protease ClpAP (E. coli), proteolytic subunit, human" ], "gene_symbol": "CLPP", "hgnc_symbol": "CLPP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:6361463-6368919", "ensembl_id": "ENSG00000125656" } }, "GRch38": { "90": { "location": "19:6361452-6368908", "ensembl_id": "ENSG00000125656" } } }, "hgnc_date_symbol_changed": "1999-09-20" }, "entity_type": "gene", "entity_name": "CLPP", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23541340" ], "evidence": [ "Expert Review Amber", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Perrault syndrome 3, MIM# 614129" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ21404", "FSA", "KIAA1371", "Tweek" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26953", "gene_name": "KIAA1109", "omim_gene": [ "611565" ], "alias_name": [ "fragile site-associated" ], "gene_symbol": "KIAA1109", "hgnc_symbol": "KIAA1109", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:123073488-123283913", "ensembl_id": "ENSG00000138688" } }, "GRch38": { "90": { "location": "4:122152333-122362758", "ensembl_id": "ENSG00000138688" } } }, "hgnc_date_symbol_changed": "2004-07-29" }, "entity_type": "gene", "entity_name": "KIAA1109", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28749478", "30485398", "29290337", "30906834" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Alkuraya-Kucinskas syndrome MIM#617822" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CDC39", "NOT1H", "KIAA1007", "AD-005" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7877", "gene_name": "CCR4-NOT transcription complex subunit 1", "omim_gene": [ "604917" ], "alias_name": null, "gene_symbol": "CNOT1", "hgnc_symbol": "CNOT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:58553855-58663790", "ensembl_id": "ENSG00000125107" } }, "GRch38": { "90": { "location": "16:58519951-58629886", "ensembl_id": "ENSG00000125107" } } }, "hgnc_date_symbol_changed": "1996-07-19" }, "entity_type": "gene", "entity_name": "CNOT1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "Other - please provide details in the comments", "publications": [ "31006510", "21679367", "31006513", "32553196" ], "evidence": [ "Expert Review Amber", "Genomics England PanelApp", "Expert list", "Literature" ], "phenotypes": [ "Holoprosencephaly 12, with or without pancreatic agenesis, 618500", "Vissers-Bodmer syndrome, MIM#619033" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0328" ], "biotype": "protein_coding", "hgnc_id": "HGNC:428", "gene_name": "ALMS1, centrosome and basal body associated protein", "omim_gene": [ "606844" ], "alias_name": null, "gene_symbol": "ALMS1", "hgnc_symbol": "ALMS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:73612886-73837920", "ensembl_id": "ENSG00000116127" } }, "GRch38": { "90": { "location": "2:73385758-73610793", "ensembl_id": "ENSG00000116127" } } }, "hgnc_date_symbol_changed": "1998-10-12" }, "entity_type": "gene", "entity_name": "ALMS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Alstrom syndrome, MIM# 203800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.559", "version_created": "2026-04-21T11:27:49.150143+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2208, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "JCAP", "SZP", "MSF", "HAPO", "bG174L6.2", "FLJ32635" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9364", "gene_name": "proteoglycan 4", "omim_gene": [ "604283" ], "alias_name": [ "lubricin", "megakaryocyte stimulating factor", "articular superficial zone protein", "Jacobs camptodactyly-arthropathy-pericarditis syndrome", "camptodactyly, arthropathy, coxa vara, pericarditis syndrome", "bG174L6.2 (MSF: megakaryocyte stimulating factor )" ], "gene_symbol": "PRG4", "hgnc_symbol": "PRG4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:186265405-186283694", "ensembl_id": "ENSG00000116690" } }, "GRch38": { "90": { "location": "1:186296279-186314562", "ensembl_id": "ENSG00000116690" } } }, "hgnc_date_symbol_changed": "2000-07-31" }, "entity_type": "gene", "entity_name": "PRG4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10545950", "29397575" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Camptodactyly-arthropathy-coxa vara-pericarditis syndrome, 208250 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "botv", "REGR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3518", "gene_name": "exostosin like glycosyltransferase 3", "omim_gene": [ "605744" ], "alias_name": [ "REG receptor", "glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase" ], "gene_symbol": "EXTL3", "hgnc_symbol": "EXTL3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:28457986-28613116", "ensembl_id": "ENSG00000012232" } }, "GRch38": { "90": { "location": "8:28600469-28755599", "ensembl_id": "ENSG00000012232" } } }, "hgnc_date_symbol_changed": "1998-03-20" }, "entity_type": "gene", "entity_name": "EXTL3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28132690", "28148688", "28331220", "38010729", "35114981" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Immunoskeletal dysplasia with neurodevelopmental abnormalities, MIM#617425" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MRP6", "EST349056", "MLP1", "URG7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:57", "gene_name": "ATP binding cassette subfamily C member 6", "omim_gene": [ "603234" ], "alias_name": null, "gene_symbol": "ABCC6", "hgnc_symbol": "ABCC6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:16242785-16317379", "ensembl_id": "ENSG00000091262" } }, "GRch38": { "90": { "location": "16:16148928-16223522", "ensembl_id": "ENSG00000091262" } } }, "hgnc_date_symbol_changed": "1997-10-27" }, "entity_type": "gene", "entity_name": "ABCC6", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "Mackenzie's Mission" ], "phenotypes": [ "Pseudoxanthoma elasticum MIM#264800", "Arterial calcification, generalized, of infancy, 2 MIM#614473" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GCS1", "CWH41", "DER7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24862", "gene_name": "mannosyl-oligosaccharide glucosidase", "omim_gene": [ "601336" ], "alias_name": [ "glucosidase I", "processing A-glucosidase I" ], "gene_symbol": "MOGS", "hgnc_symbol": "MOGS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:74688184-74692537", "ensembl_id": "ENSG00000115275" } }, "GRch38": { "90": { "location": "2:74461057-74465410", "ensembl_id": "ENSG00000115275" } } }, "hgnc_date_symbol_changed": "2009-03-24" }, "entity_type": "gene", "entity_name": "MOGS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31925597", "30587846", "33058492", "38498292", "33261925" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Congenital disorder of glycosylation, type IIb, MIM# 606056" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LCA2", "rd12", "BCO3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10294", "gene_name": "RPE65, retinoid isomerohydrolase", "omim_gene": [ "180069" ], "alias_name": [ "BCO family, member 3", "retinol isomerase", "all-trans-retinyl-palmitate hydrolase" ], "gene_symbol": "RPE65", "hgnc_symbol": "RPE65", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:68894505-68915642", "ensembl_id": "ENSG00000116745" } }, "GRch38": { "90": { "location": "1:68428822-68449959", "ensembl_id": "ENSG00000116745" } } }, "hgnc_date_symbol_changed": "1993-10-04" }, "entity_type": "gene", "entity_name": "RPE65", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Retinitis pigmentosa 20, MIM#613794", "Leber congenital amaurosis 2, MIM#204100" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1140" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19750", "gene_name": "tetratricopeptide repeat domain 7A", "omim_gene": [ "609332" ], "alias_name": null, "gene_symbol": "TTC7A", "hgnc_symbol": "TTC7A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:47143296-47303276", "ensembl_id": "ENSG00000068724" } }, "GRch38": { "90": { "location": "2:46916157-47076137", "ensembl_id": "ENSG00000068724" } } }, "hgnc_date_symbol_changed": "2004-06-02" }, "entity_type": "gene", "entity_name": "TTC7A", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30553809", "34975848", "33746097" ], "evidence": [ "Expert Review Red", "BabySeq Category A gene", "BeginNGS" ], "phenotypes": [ "Immunodeficiency, combined, with intestinal atresias, MIM#243150" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AGTAVPRL", "AII", "AVP", "FCAS", "FCU", "NALP3", "PYPAF1", "MWS", "CLR1.1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16400", "gene_name": "NLR family pyrin domain containing 3", "omim_gene": [ "606416" ], "alias_name": [ "Cryopyrin", "nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3" ], "gene_symbol": "NLRP3", "hgnc_symbol": "NLRP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:247579458-247612410", "ensembl_id": "ENSG00000162711" } }, "GRch38": { "90": { "location": "1:247416156-247449108", "ensembl_id": "ENSG00000162711" } } }, "hgnc_date_symbol_changed": "2006-12-08" }, "entity_type": "gene", "entity_name": "NLRP3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "25038238" ], "evidence": [ "Expert Review Amber", "Expert Review" ], "phenotypes": [ "Familial cold inflammatory syndrome 1, MIM#120100 Muckle-Wells syndrome, MIM#191900 CINCA syndrome, MIM#607115 Deafness, autosomal dominant 34, with or without inflammation, MIM#617772 Keratoendothelitis fugax hereditaria, MIM#148200" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "treatable", "immunological" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CMG2", "CMG-2", "FLJ31074" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21732", "gene_name": "anthrax toxin receptor 2", "omim_gene": [ "608041" ], "alias_name": [ "capillary morphogenesis protein 2" ], "gene_symbol": "ANTXR2", "hgnc_symbol": "ANTXR2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:80822303-81046608", "ensembl_id": "ENSG00000163297" } }, "GRch38": { "90": { "location": "4:79901149-80125454", "ensembl_id": "ENSG00000163297" } } }, "hgnc_date_symbol_changed": "2003-09-25" }, "entity_type": "gene", "entity_name": "ANTXR2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "20301698" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "hyaline fibromatosis syndrome MONDO:0009229" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4093, "hash_id": null, "name": "Facial papules", "disease_group": "Dermatological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with diseases where facial papules and lesions can be a predominant feature of the phenotype, including coarse facies. It was developed by Prof Ingrid Winship from Royal Melbourne Hospital for use in the Genodermatosis clinic.", "status": "public", "version": "1.1", "version_created": "2026-01-12T09:37:15.457047+11:00", "relevant_disorders": [ "Papule HP:0200034" ], "stats": { "number_of_genes": 22, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ABL" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7467", "gene_name": "microsomal triglyceride transfer protein", "omim_gene": [ "157147" ], "alias_name": null, "gene_symbol": "MTTP", "hgnc_symbol": "MTTP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:100484918-100545156", "ensembl_id": "ENSG00000138823" } }, "GRch38": { "90": { "location": "4:99563761-99623999", "ensembl_id": "ENSG00000138823" } } }, "hgnc_date_symbol_changed": "2005-11-04" }, "entity_type": "gene", "entity_name": "MTTP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30720493", "27604308", "8533758" ], "evidence": [ "Expert Review Green", "NHS GMS" ], "phenotypes": [ "Inherited hypolipidaemias", "Abetalipoproteinemia MIM#200100" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ASM" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11120", "gene_name": "sphingomyelin phosphodiesterase 1", "omim_gene": [ "607608" ], "alias_name": [ "acid sphingomyelinase" ], "gene_symbol": "SMPD1", "hgnc_symbol": "SMPD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:6411655-6416228", "ensembl_id": "ENSG00000166311" } }, "GRch38": { "90": { "location": "11:6390431-6394998", "ensembl_id": "ENSG00000166311" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "SMPD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26499107" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Niemann-Pick disease, type A, MIM#257200", "Niemann-Pick disease, type B, MIM#607616" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SWS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26993", "gene_name": "zinc finger SWIM-type containing 7", "omim_gene": [ "614535" ], "alias_name": [ "SWIM domain containing Srs2 interacting protein 1" ], "gene_symbol": "ZSWIM7", "hgnc_symbol": "ZSWIM7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:15879874-15903031", "ensembl_id": "ENSG00000214941" } }, "GRch38": { "90": { "location": "17:15976560-15999717", "ensembl_id": "ENSG00000214941" } } }, "hgnc_date_symbol_changed": "2007-03-27" }, "entity_type": "gene", "entity_name": "ZSWIM7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32719396, 33713115, 40991243, 34402903" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spermatogenic failure 71 MONDO:0030787", "Ovarian dysgenesis 10 MONDO:0030736" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.148", "version_created": "2026-04-21T17:36:51.081048+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 266, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Gsh4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21734", "gene_name": "LIM homeobox 4", "omim_gene": [ "602146" ], "alias_name": null, "gene_symbol": "LHX4", "hgnc_symbol": "LHX4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:180199421-180249380", "ensembl_id": "ENSG00000121454" } }, "GRch38": { "90": { "location": "1:180230286-180278982", "ensembl_id": "ENSG00000121454" } } }, "hgnc_date_symbol_changed": "2003-07-21" }, "entity_type": "gene", "entity_name": "LHX4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18073311", "18445675", "11567216" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Pituitary hormone deficiency, combined, 4 (262700)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [ "treatable" ], "panel": { "id": 4523, "hash_id": null, "name": "Adrenal insufficiency", "disease_group": "Endocrine disorders", "disease_sub_group": "Adrenal disorders", "description": "This panel contains genes associated with adrenal insufficiency.\r\n\r\nIt includes genes from the Genomics England PanelApp 'congenital adrenal hypoplasia' panel V4.5.", "status": "public", "version": "0.76", "version_created": "2026-03-19T16:21:18.336273+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 58, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699424 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "NOTCH2NLC" ], "biotype": "gene with protein product", "hgnc_id": "HGNC:53924", "gene_name": "Notch 2 N-Terminal Like C", "omim_gene": [ "618025" ], "alias_name": [ "notch 2 N-terminal like C" ], "gene_symbol": "NOTCH2NLC", "hgnc_symbol": "NOTCH2NLC", "hgnc_release": "2000-01-01", "ensembl_genes": { "GRch37": { "82": { "location": "1:150077036-150158248", "ensembl_id": "ENSG00000286219" } }, "GRch38": { "90": { "location": "1:149390621-149471833", "ensembl_id": "ENSG00000286219" } } }, "hgnc_date_symbol_changed": "2000-01-01" }, "entity_type": "str", "entity_name": "NOTCH2NLC_NIID_GGC", "confidence_level": "3", "penetrance": null, "publications": [ "31178126", "31332381", "31819945", "33887199", "33943039", "32250060", "31332380", "32852534", "32989102", "34333668" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Neuronal intranuclear inclusion disease MIM#603472", "Oculopharyngodistal myopathy 3 MIM#619473", "Tremor, hereditary essential, 6 MIM#618866" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGC", "chromosome": "1", "grch37_coordinates": [ 145209324, 145209344 ], "grch38_coordinates": [ 149390803, 149390829 ], "normal_repeats": 40, "pathogenic_repeats": 60, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } } ] }