Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=248
{ "count": 36040, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=249", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=247", "results": [ { "gene_data": { "alias": [ "PDIA12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30739", "gene_name": "thioredoxin related transmembrane protein 2", "omim_gene": [ "616715" ], "alias_name": [ "protein disulfide isomerase family A, member 12" ], "gene_symbol": "TMX2", "hgnc_symbol": "TMX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:57480072-57508445", "ensembl_id": "ENSG00000213593" } }, "GRch38": { "90": { "location": "11:57712600-57740973", "ensembl_id": "ENSG00000213593" } } }, "hgnc_date_symbol_changed": "2009-02-23" }, "entity_type": "gene", "entity_name": "TMX2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31735293", "31586943" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with microcephaly, cortical malformations, and spasticity MIM#618730" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 18, "hash_id": null, "name": "Polymicrogyria and Schizencephaly", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and used by the Australian Genomics Brain Malformations Flagship. It is maintained by VCGS.\r\n\r\nPlease consider the broader 'Malformations of cortical development' superpanel, particularly in the presence of complex or atypical imaging findings.", "status": "public", "version": "0.204", "version_created": "2025-12-18T09:49:46.643708+11:00", "relevant_disorders": [ "Polymicrogyria", "HP:0002126;Schizencephaly", "HP:0010636" ], "stats": { "number_of_genes": 88, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BIG2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15853", "gene_name": "ADP ribosylation factor guanine nucleotide exchange factor 2", "omim_gene": [ "605371" ], "alias_name": [ "Brefeldin A-inhibited guanine nucleotide-exchange protein 2" ], "gene_symbol": "ARFGEF2", "hgnc_symbol": "ARFGEF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:47538427-47653230", "ensembl_id": "ENSG00000124198" } }, "GRch38": { "90": { "location": "20:48921890-49036693", "ensembl_id": "ENSG00000124198" } } }, "hgnc_date_symbol_changed": "2001-06-21" }, "entity_type": "gene", "entity_name": "ARFGEF2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25160555", "26126837", "23812912" ], "evidence": [ "Expert Review Green", "Australian Genomics Health Alliance Brain Malformation Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Periventricular heterotopia with microcephaly (MIM#608097)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 19, "hash_id": null, "name": "Periventricular Grey Matter Heterotopia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Periventricular nodular heterotopia is a disorder of neuronal migration in which neurons fail to migrate appropriately from the ventricular zone to the cortex during development, resulting in the formation of nodular brain tissue lining the ventricles.\r\n\r\nThis panel was developed and used by the Australian Genomics Brain Malformations Flagship. It is maintained by VCGS and a consensus panel used by RMH.", "status": "public", "version": "1.2", "version_created": "2023-01-04T20:17:09.749124+11:00", "relevant_disorders": [ "Grey matter heterotopia", "HP:0002282" ], "stats": { "number_of_genes": 12, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KE04", "Erlin-1", "SPG62" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16947", "gene_name": "ER lipid raft associated 1", "omim_gene": [ "611604" ], "alias_name": [ "Band_7 23-211 Keo4 (Interim) similar to C.elegans protein C42C1.9" ], "gene_symbol": "ERLIN1", "hgnc_symbol": "ERLIN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:101909851-101948091", "ensembl_id": "ENSG00000107566" } }, "GRch38": { "90": { "location": "10:100150094-100188334", "ensembl_id": "ENSG00000107566" } } }, "hgnc_date_symbol_changed": "2007-01-26" }, "entity_type": "gene", "entity_name": "ERLIN1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29453415" ], "evidence": [ "Expert Review Red", "Expert list" ], "phenotypes": [ "Amyotrophic lateral sclerosis" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 25, "hash_id": null, "name": "Motor Neurone Disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause motor neurone disease, including amyotrophic lateral sclerosis and genes causing spinal muscular atrophies (SMAs) with adult onset. It is maintained by VCGS and RMH.\r\n\r\nGenes causing spinal muscular atrophies (SMAs) with congenital/childhood onset are not included in this panel but can be found in the Hereditary Neuropathy panels.\r\n\r\nThe original panel (as 17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.48", "version_created": "2026-03-31T16:37:58.241144+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 79, "number_of_strs": 4, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ZFAND7", "SMUBP2", "CATF1", "SMARD1", "HCSA", "HMN6", "CMT2S" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5542", "gene_name": "immunoglobulin mu binding protein 2", "omim_gene": [ "600502" ], "alias_name": [ "cardiac transcription factor 1", "zinc finger, AN1-type domain 7" ], "gene_symbol": "IGHMBP2", "hgnc_symbol": "IGHMBP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:68671310-68708070", "ensembl_id": "ENSG00000132740" } }, "GRch38": { "90": { "location": "11:68903842-68940602", "ensembl_id": "ENSG00000132740" } } }, "hgnc_date_symbol_changed": "1994-12-15" }, "entity_type": "gene", "entity_name": "IGHMBP2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "Expert list", "Melbourne Genomics Health Alliance Complex Neurology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Neuronopathy, distal hereditary motor, type VI 604320" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 25, "hash_id": null, "name": "Motor Neurone Disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause motor neurone disease, including amyotrophic lateral sclerosis and genes causing spinal muscular atrophies (SMAs) with adult onset. It is maintained by VCGS and RMH.\r\n\r\nGenes causing spinal muscular atrophies (SMAs) with congenital/childhood onset are not included in this panel but can be found in the Hereditary Neuropathy panels.\r\n\r\nThe original panel (as 17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.48", "version_created": "2026-03-31T16:37:58.241144+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 79, "number_of_strs": 4, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "B17", "C2TA", "DKFZP434M035" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2993", "gene_name": "downstream neighbor of SON", "omim_gene": [ "611428" ], "alias_name": null, "gene_symbol": "DONSON", "hgnc_symbol": "DONSON", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:34931848-34961014", "ensembl_id": "ENSG00000159147" } }, "GRch38": { "90": { "location": "21:33559542-33588708", "ensembl_id": "ENSG00000159147" } } }, "hgnc_date_symbol_changed": "2000-02-18" }, "entity_type": "gene", "entity_name": "DONSON", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "28191891", "28630177", "28191891" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Microcephaly, short stature, and limb abnormalities, MIM# 617604", "Microcephaly-micromelia syndrome, MIM# 251230", "MONDO:0009619" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 28, "hash_id": null, "name": "Skeletal Dysplasia_Fetal", "disease_group": "Skeletal disorders", "disease_sub_group": "", "description": "This panel was developed and used by the Melbourne Genomics Perinatal Autopsy Flagship. It is maintained by VCGS.\r\n\r\nIt contains genes associated with conditions primarily affecting bone and cartilage that present prenatally.\r\n\r\nPlease consider the larger Fetal Anomalies and Skeletal Dysplasia panels, or other specific panels such as Growth Failure, Craniosynostosis, Radial ray abnormalities, Polydactyly or Limb and Digital Malformations depending on the clinical presentation.", "status": "public", "version": "0.246", "version_created": "2026-03-02T10:22:48.751874+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 157, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "EKLF" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6345", "gene_name": "Kruppel like factor 1", "omim_gene": [ "600599" ], "alias_name": [ "erythroid Kruppel-like factor" ], "gene_symbol": "KLF1", "hgnc_symbol": "KLF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:12995237-12997995", "ensembl_id": "ENSG00000105610" } }, "GRch38": { "90": { "location": "19:12884423-12887181", "ensembl_id": "ENSG00000105610" } } }, "hgnc_date_symbol_changed": "1999-12-14" }, "entity_type": "gene", "entity_name": "KLF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21055716", "33339573", "32815883", "32221653", "32032242", "31818881", "24443441", "25724378", "28361594", "34554218" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Dyserythropoietic anaemia, congenital, type IVa, MIM# 613673", "MONDO:0013355", "Anaemia, congenital dyserythropoietic, type IVb, MIM#620969" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 56, "hash_id": null, "name": "Bone Marrow Failure", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "Bone marrow failure (BMF) refers to the decreased production of one or more major haematopoietic lineages which leads to diminished or absent haematopoietic precursors in the bone marrow and attendant cytopaenias.\r\n\r\nThis panel was developed and is maintained by VCGS. It contains all the genes on the Peter MacCallum Bone Marrow Failure panel, as of 2/3/2020, and includes all the genes associated with telomere disorders (Dysterkeratosis Congenita).\r\n\r\nIt has been updated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.", "status": "public", "version": "1.141", "version_created": "2026-03-17T18:48:23.244194+11:00", "relevant_disorders": [ "Abnormality of multiple cell lineages of the bone marrow", "HP:0012145" ], "stats": { "number_of_genes": 151, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0243", "LAM", "hamartin" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12362", "gene_name": "TSC complex subunit 1", "omim_gene": [ "605284" ], "alias_name": [ "hamartin" ], "gene_symbol": "TSC1", "hgnc_symbol": "TSC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:135766735-135820020", "ensembl_id": "ENSG00000165699" } }, "GRch38": { "90": { "location": "9:132891348-132944633", "ensembl_id": "ENSG00000165699" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "TSC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Tuberous sclerosis 1, MIM# 191100" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 58, "hash_id": null, "name": "Brain Calcification", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Primary brain calcification disorders are characterised by abnormal deposits of calcium in blood vessels within the brain, particularly the basal ganglia. They typically present with movement disorders and psychiatric or behavioural problems. This panel also contains other multi-system conditions where brain calcification can occur as part of the phenotype.\r\n\r\nThis panel was developed and is maintained by VCGS.\r\n\r\nThe panel has been compared against the Genomics England PanelApp Intracerebral Calcifications panel V1.27 with all discrepancies resolved and reciprocal feedback provided to Genomics England.\r\n\r\nUpdated December 2025 following literature review.", "status": "public", "version": "2.6", "version_created": "2026-01-08T18:01:53.861975+11:00", "relevant_disorders": [ "Cerebral calcification", "HP:0002514" ], "stats": { "number_of_genes": 96, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ25461", "C9orf145", "C9orf143", "DKFZp686M16108", "TILRR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23399", "gene_name": "FRAS1 related extracellular matrix 1", "omim_gene": [ "608944" ], "alias_name": null, "gene_symbol": "FREM1", "hgnc_symbol": "FREM1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:14734664-14910993", "ensembl_id": "ENSG00000164946" } }, "GRch38": { "90": { "location": "9:14734666-14910995", "ensembl_id": "ENSG00000164946" } } }, "hgnc_date_symbol_changed": "2004-12-15" }, "entity_type": "gene", "entity_name": "FREM1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 63, "hash_id": null, "name": "Congenital anomalies of the kidney and urinary tract (CAKUT)", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel contains genes associated with nonsyndromic and syndromic congenital anomalies of the kidney and urinary tract (CAKUT).", "status": "public", "version": "0.207", "version_created": "2026-04-15T16:43:07.852176+10:00", "relevant_disorders": [ "Abnormality of the urinary system HP:0000079" ], "stats": { "number_of_genes": 124, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1620" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13797", "gene_name": "periaxin", "omim_gene": [ "605725" ], "alias_name": null, "gene_symbol": "PRX", "hgnc_symbol": "PRX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:40899675-40919273", "ensembl_id": "ENSG00000105227" } }, "GRch38": { "90": { "location": "19:40393768-40413366", "ensembl_id": "ENSG00000105227" } } }, "hgnc_date_symbol_changed": "2001-02-15" }, "entity_type": "gene", "entity_name": "PRX", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "41230902", "36161833", "27081207" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Cataract, MONDO:0005129, PRX-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7882", "gene_name": "notch 2", "omim_gene": [ "600275" ], "alias_name": null, "gene_symbol": "NOTCH2", "hgnc_symbol": "NOTCH2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:120454176-120612240", "ensembl_id": "ENSG00000134250" } }, "GRch38": { "90": { "location": "1:119911553-120069626", "ensembl_id": "ENSG00000134250" } } }, "hgnc_date_symbol_changed": "1994-11-10" }, "entity_type": "gene", "entity_name": "NOTCH2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16773578", "21378985", "21378989" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Alagille syndrome 2 (MIM#610205)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 78, "hash_id": null, "name": "Cholestasis", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel was developed by and is maintained by VCGS.\r\n\r\nIt includes primary liver disorders as well as metabolic and other multi-system disorders that have been reported to cause cholestasis.\r\n\r\nPlease also consider using the Liver Failure_Paediatric panel if clinically indicated.\r\n\r\nThe content of this panel has been compared against the Genomics England PanelApp 'Cholestasis' panel V1.21, with all discrepancies reviewed and resolved, and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.10", "version_created": "2026-03-26T17:26:27.105917+11:00", "relevant_disorders": [ "Cholestasis HP:0001396" ], "stats": { "number_of_genes": 99, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BBS8", "RP51" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20087", "gene_name": "tetratricopeptide repeat domain 8", "omim_gene": [ "608132" ], "alias_name": null, "gene_symbol": "TTC8", "hgnc_symbol": "TTC8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:89290497-89344335", "ensembl_id": "ENSG00000165533" } }, "GRch38": { "90": { "location": "14:88824153-88881078", "ensembl_id": "ENSG00000165533" } } }, "hgnc_date_symbol_changed": "2002-12-17" }, "entity_type": "gene", "entity_name": "TTC8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "14520415", "19797195" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bardet-Biedl syndrome 8, MIM# 615985" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 84, "hash_id": null, "name": "Ciliopathies", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was created by merging the Ciliopathy panels created by VCGS and RMH and is a consensus panel used by both.\r\n\r\nIt covers conditions caused by mutations in the genes encoding non-motile cilia components as well as a small number of conditions that can present as phenocopies.\r\n\r\nPlease note a number of smaller panels are available that cover specific ciliopathy phenotypes such as Bardet-Biedl syndrome, Jeune syndrome and Joubert syndrome.\r\n\r\nPlease refer to the Ciliary Dyskinesia panel for conditions caused by mutations in genes encoding components of the motile cilia, which present with predominantly respiratory phenotypes.", "status": "public", "version": "1.99", "version_created": "2026-02-26T20:47:06.255758+11:00", "relevant_disorders": [ "Ciliopathy", "MONDO:0005308" ], "stats": { "number_of_genes": 158, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NESP55", "NESP", "GNASXL", "GPSA", "SCG6", "SgVI" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4392", "gene_name": "GNAS complex locus", "omim_gene": [ "139320" ], "alias_name": [ "secretogranin VI", "G protein subunit alpha S" ], "gene_symbol": "GNAS", "hgnc_symbol": "GNAS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:57414773-57486247", "ensembl_id": "ENSG00000087460" } }, "GRch38": { "90": { "location": "20:58839718-58911192", "ensembl_id": "ENSG00000087460" } } }, "hgnc_date_symbol_changed": "2001-12-20" }, "entity_type": "gene", "entity_name": "GNAS", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "19530187", "26340332", "26267576" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Pseudohypoparathyroidism type 1a, MIM# 103580", "Craniosynostosis" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 93, "hash_id": null, "name": "Craniosynostosis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It is a consensus panel used by RMH. It contains genes that cause isolated craniosynostosis, as well as those that cause complex syndromic or other multi-system disorders where craniosynostosis is a prominent feature.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Craniosynostosis panel and all differences have been resolved, with reciprocal feedback provided to Genomics England 3/7/2020.", "status": "public", "version": "1.85", "version_created": "2026-04-07T13:46:55.940488+10:00", "relevant_disorders": [ "Craniosynostosis HP:0001363" ], "stats": { "number_of_genes": 105, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2570", "gene_name": "cytochrome b5 type A", "omim_gene": [ "613218" ], "alias_name": null, "gene_symbol": "CYB5A", "hgnc_symbol": "CYB5A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:71920530-71959251", "ensembl_id": "ENSG00000166347" } }, "GRch38": { "90": { "location": "18:74250847-74292016", "ensembl_id": "ENSG00000166347" } } }, "hgnc_date_symbol_changed": "2006-01-30" }, "entity_type": "gene", "entity_name": "CYB5A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 22170710", "32051920" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Methemoglobinemia and ambiguous genitalia, MIM#\t250790" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.50", "version_created": "2026-04-12T14:14:27.453739+10:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 142, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "VAKTI", "LEKTI", "LETKI", "NETS", "NS", "FLJ21544", "FLJ97536", "FLJ97596", "FLJ99794", "DKFZp686K19184" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15464", "gene_name": "serine peptidase inhibitor, Kazal type 5", "omim_gene": [ "605010" ], "alias_name": [ "lymphoepithelial Kazal-type-related inhibitor" ], "gene_symbol": "SPINK5", "hgnc_symbol": "SPINK5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:147405246-147516852", "ensembl_id": "ENSG00000133710" } }, "GRch38": { "90": { "location": "5:148025683-148137289", "ensembl_id": "ENSG00000133710" } } }, "hgnc_date_symbol_changed": "2001-03-30" }, "entity_type": "gene", "entity_name": "SPINK5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "19683336" ], "evidence": [ "Expert Review Green", "Other" ], "phenotypes": [ "Netherton syndrome (MIM#256500)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 101, "hash_id": null, "name": "Epidermolysis bullosa", "disease_group": "Dermatological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause epidermolysis bullosa, as well as genes that cause other blistering and peeling skin disorders. Including those described as EB-related disorders in Has et al 2020 (PMID: 32017015).\r\n\r\nThis panel has been compared against the Genomics England 'Epidermolysis bullosa and congenital skin fragility' with all discrepancies resolved and reciprocal feedback provided to Genomics England, 10/8/2020.\r\n\r\nThis panel was created by merging the panels developed by VCGS and RMH.", "status": "public", "version": "1.27", "version_created": "2026-03-08T22:19:30.435795+11:00", "relevant_disorders": [ "Abnormal blistering of the skin", "HP:0008066" ], "stats": { "number_of_genes": 46, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MPD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7529", "gene_name": "mevalonate diphosphate decarboxylase", "omim_gene": [ "603236" ], "alias_name": [ "mevalonate pyrophosphate decarboxylase", "diphosphomevalonate decarboxylase" ], "gene_symbol": "MVD", "hgnc_symbol": "MVD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:88718343-88729569", "ensembl_id": "ENSG00000167508" } }, "GRch38": { "90": { "location": "16:88651935-88663161", "ensembl_id": "ENSG00000167508" } } }, "hgnc_date_symbol_changed": "1997-12-05" }, "entity_type": "gene", "entity_name": "MVD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30942823", "33491095", "34135477" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Porokeratosis 7, multiple types, MIM# 614714", "Nonsyndromic genetic hearing loss MONDO:0019497, MVD-related, AR" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 124, "hash_id": null, "name": "Ichthyosis and Porokeratosis", "disease_group": "Dermatological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and RMH. It contains genes that cause non-syndromic and syndromic ichthyosis and porokeratosis.", "status": "public", "version": "1.25", "version_created": "2026-03-19T12:26:58.874178+11:00", "relevant_disorders": [ "Ichthyosis", "HP:0008064;Porokeratosis", "HP:0200044" ], "stats": { "number_of_genes": 65, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:14974", "gene_name": "sorting nexin 10", "omim_gene": [ "614780" ], "alias_name": null, "gene_symbol": "SNX10", "hgnc_symbol": "SNX10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:26331541-26413949", "ensembl_id": "ENSG00000086300" } }, "GRch38": { "90": { "location": "7:26291895-26374329", "ensembl_id": "ENSG00000086300" } } }, "hgnc_date_symbol_changed": "2001-04-10" }, "entity_type": "gene", "entity_name": "SNX10", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 135, "hash_id": null, "name": "Macrocephaly_Megalencephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.161", "version_created": "2026-01-12T09:38:37.890372+11:00", "relevant_disorders": [ "Macrocephaly", "HP:0000256; Megalencephaly", "HP:0001355" ], "stats": { "number_of_genes": 151, "number_of_strs": 0, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NLK1", "NEK2A", "RP67", "PPP1R111" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7745", "gene_name": "NIMA related kinase 2", "omim_gene": [ "604043" ], "alias_name": [ "HsPK 21", "protein phosphatase 1, regulatory subunit 111" ], "gene_symbol": "NEK2", "hgnc_symbol": "NEK2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:211836114-211848960", "ensembl_id": "ENSG00000117650" } }, "GRch38": { "90": { "location": "1:211658657-211675630", "ensembl_id": "ENSG00000117650" } } }, "hgnc_date_symbol_changed": "1998-08-26" }, "entity_type": "gene", "entity_name": "NEK2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24043777" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Retinitis pigmentosa 67, MIM#615565" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LH2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9082", "gene_name": "procollagen-lysine,2-oxoglutarate 5-dioxygenase 2", "omim_gene": [ "601865" ], "alias_name": [ "lysyl hydroxlase 2", "procollagen-lysine 5-dioxygenase" ], "gene_symbol": "PLOD2", "hgnc_symbol": "PLOD2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:145787227-145881440", "ensembl_id": "ENSG00000152952" } }, "GRch38": { "90": { "location": "3:146069440-146163653", "ensembl_id": "ENSG00000152952" } } }, "hgnc_date_symbol_changed": "1996-12-18" }, "entity_type": "gene", "entity_name": "PLOD2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22689593", "12881513", "33664768", "33778323", "29178448" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bruck syndrome 2, MIM# 609220" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "frpHE", "FRP-4", "FRPHE", "FRZB-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10778", "gene_name": "secreted frizzled related protein 4", "omim_gene": [ "606570" ], "alias_name": null, "gene_symbol": "SFRP4", "hgnc_symbol": "SFRP4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:37945543-38065297", "ensembl_id": "ENSG00000106483" } }, "GRch38": { "90": { "location": "7:37905932-38025695", "ensembl_id": "ENSG00000106483" } } }, "hgnc_date_symbol_changed": "1998-07-15" }, "entity_type": "gene", "entity_name": "SFRP4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27355534", "31239337" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Pyle disease, MIM#265900" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ13352", "SRD5A2L", "SRD5A2L1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25812", "gene_name": "steroid 5 alpha-reductase 3", "omim_gene": [ "611715" ], "alias_name": null, "gene_symbol": "SRD5A3", "hgnc_symbol": "SRD5A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:56212276-56239263", "ensembl_id": "ENSG00000128039" } }, "GRch38": { "90": { "location": "4:55346109-55373096", "ensembl_id": "ENSG00000128039" } } }, "hgnc_date_symbol_changed": "2007-11-12" }, "entity_type": "gene", "entity_name": "SRD5A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32424323" ], "evidence": [ "Expert Review Green", "Expert list", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Congenital disorder of glycosylation, type Iq, MIM#612379", "Kahrizi syndrome, MIM# 612713" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "D22S676", "D22S750", "TC2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11653", "gene_name": "transcobalamin 2", "omim_gene": [ "613441" ], "alias_name": [ "macrocytic anemia" ], "gene_symbol": "TCN2", "hgnc_symbol": "TCN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:31002825-31023265", "ensembl_id": "ENSG00000185339" } }, "GRch38": { "90": { "location": "22:30606838-30627278", "ensembl_id": "ENSG00000185339" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "TCN2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19373259", "32841161", "33023511", "30124850" ], "evidence": [ "Expert Review Green", "Expert list", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Transcobalamin II deficiency, 275350" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ZO-2", "X104", "ZO2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11828", "gene_name": "tight junction protein 2", "omim_gene": [ "607709" ], "alias_name": [ "Friedreich ataxia region gene X104 (tight junction protein ZO-2)", "zona occludens 2" ], "gene_symbol": "TJP2", "hgnc_symbol": "TJP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71736209-71870124", "ensembl_id": "ENSG00000119139" } }, "GRch38": { "90": { "location": "9:69121264-69255208", "ensembl_id": "ENSG00000119139" } } }, "hgnc_date_symbol_changed": "1999-07-01" }, "entity_type": "gene", "entity_name": "TJP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24614073", "25921221", "31696999", "12704386" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cholestasis, progressive familial intrahepatic 4, MIM# 615878", "Hypercholanemia, familial 1, MIM# 607748" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11356", "gene_name": "stromal antigen 3", "omim_gene": [ "608489" ], "alias_name": null, "gene_symbol": "STAG3", "hgnc_symbol": "STAG3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:99775186-99819111", "ensembl_id": "ENSG00000066923" } }, "GRch38": { "90": { "location": "7:100177563-100221488", "ensembl_id": "ENSG00000066923" } } }, "hgnc_date_symbol_changed": "1999-04-29" }, "entity_type": "gene", "entity_name": "STAG3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "24597867", "26059840", "31803224", "31363903", "31125047", "31682730", "32634216" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Premature ovarian failure 8 MIM#615723", "Spermatogenic failure 61, MIM# 619672" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "bHLHc2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7565", "gene_name": "myogenic factor 5", "omim_gene": [ "159990" ], "alias_name": null, "gene_symbol": "MYF5", "hgnc_symbol": "MYF5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:81110691-81113452", "ensembl_id": "ENSG00000111049" } }, "GRch38": { "90": { "location": "12:80716912-80719673", "ensembl_id": "ENSG00000111049" } } }, "hgnc_date_symbol_changed": "1989-05-25" }, "entity_type": "gene", "entity_name": "MYF5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29887215", "15386014", "1423602", "9268580", "8918877" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Ophthalmoplegia, external, with rib and vertebral anomalies, OMIM 61855" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1131" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20157", "gene_name": "HECT domain E3 ubiquitin protein ligase 1", "omim_gene": null, "alias_name": null, "gene_symbol": "HECTD1", "hgnc_symbol": "HECTD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:31569318-31677010", "ensembl_id": "ENSG00000092148" } }, "GRch38": { "90": { "location": "14:31100112-31207804", "ensembl_id": "ENSG00000092148" } } }, "hgnc_date_symbol_changed": "2002-12-18" }, "entity_type": "gene", "entity_name": "HECTD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 39879987" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder MONDO:0700092" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "RIP3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10021", "gene_name": "receptor interacting serine/threonine kinase 3", "omim_gene": [ "605817" ], "alias_name": null, "gene_symbol": "RIPK3", "hgnc_symbol": "RIPK3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:24805227-24809251", "ensembl_id": "ENSG00000129465" } }, "GRch38": { "90": { "location": "14:24336021-24340045", "ensembl_id": "ENSG00000129465" } } }, "hgnc_date_symbol_changed": "1999-12-17" }, "entity_type": "gene", "entity_name": "RIPK3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "37083451" ], "evidence": [ "Expert Review Amber", "Expert Review" ], "phenotypes": [ "Hereditary susceptibility to infections, MONDO:0015979, RIPK3-related", "Recurrent HSV encephalitis" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4696", "gene_name": "glucuronidase beta", "omim_gene": [ "611499" ], "alias_name": null, "gene_symbol": "GUSB", "hgnc_symbol": "GUSB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:65425671-65447301", "ensembl_id": "ENSG00000169919" } }, "GRch38": { "90": { "location": "7:65960684-65982314", "ensembl_id": "ENSG00000169919" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "GUSB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Mucopolysaccharidosis VII, MIM# 253220", "MONDO:0009662" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ36974", "MGC42174" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28648", "gene_name": "DIS3 like 3'-5' exoribonuclease 2", "omim_gene": [ "614184" ], "alias_name": null, "gene_symbol": "DIS3L2", "hgnc_symbol": "DIS3L2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:232825955-233209060", "ensembl_id": "ENSG00000144535" } }, "GRch38": { "90": { "location": "2:231961245-232344350", "ensembl_id": "ENSG00000144535" } } }, "hgnc_date_symbol_changed": "2007-01-17" }, "entity_type": "gene", "entity_name": "DIS3L2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22306653", "28328139", "29950491" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Perlman syndrome MIM# 267000" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PHKD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1449", "gene_name": "calmodulin 3", "omim_gene": [ "114183" ], "alias_name": [ "prepro-calmodulin 3", "phosphorylase kinase subunit delta" ], "gene_symbol": "CALM3", "hgnc_symbol": "CALM3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:47104331-47114050", "ensembl_id": "ENSG00000160014" } }, "GRch38": { "90": { "location": "19:46601074-46610793", "ensembl_id": "ENSG00000160014" } } }, "hgnc_date_symbol_changed": "1991-06-05" }, "entity_type": "gene", "entity_name": "CALM3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31983240" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Long QT syndrome 16 MIM#618782", "CPVT" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:12013", "gene_name": "tropomyosin 4", "omim_gene": [ "600317" ], "alias_name": null, "gene_symbol": "TPM4", "hgnc_symbol": "TPM4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:16177831-16213813", "ensembl_id": "ENSG00000167460" } }, "GRch38": { "90": { "location": "19:16067021-16103005", "ensembl_id": "ENSG00000167460" } } }, "hgnc_date_symbol_changed": "1991-07-18" }, "entity_type": "gene", "entity_name": "TPM4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "28134622", "31249973", "21153663" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Bleeding disorder, platelet-type, 25, MIM# 620486" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA1312" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13202", "gene_name": "ADAM metallopeptidase with thrombospondin type 1 motif 9", "omim_gene": [ "605421" ], "alias_name": null, "gene_symbol": "ADAMTS9", "hgnc_symbol": "ADAMTS9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:64501333-64673676", "ensembl_id": "ENSG00000163638" } }, "GRch38": { "90": { "location": "3:64515654-64688000", "ensembl_id": "ENSG00000163638" } } }, "hgnc_date_symbol_changed": "2000-11-27" }, "entity_type": "gene", "entity_name": "ADAMTS9", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30609407" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Nephropathy-related ciliopathy, MONDO:0022409, ADAMTS9-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "NPD002", "MGC14452" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21497", "gene_name": "acyl-CoA dehydrogenase family member 9", "omim_gene": [ "611103" ], "alias_name": null, "gene_symbol": "ACAD9", "hgnc_symbol": "ACAD9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:128598439-128634910", "ensembl_id": "ENSG00000177646" } }, "GRch38": { "90": { "location": "3:128879596-128916067", "ensembl_id": "ENSG00000177646" } } }, "hgnc_date_symbol_changed": "2003-06-18" }, "entity_type": "gene", "entity_name": "ACAD9", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30025539" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Mitochondrial complex I deficiency, nuclear type 20 MIM#611126" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "hTid-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11808", "gene_name": "DnaJ heat shock protein family (Hsp40) member A3", "omim_gene": [ "608382" ], "alias_name": null, "gene_symbol": "DNAJA3", "hgnc_symbol": "DNAJA3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:4475806-4506776", "ensembl_id": "ENSG00000103423" } }, "GRch38": { "90": { "location": "16:4425805-4456775", "ensembl_id": "ENSG00000103423" } } }, "hgnc_date_symbol_changed": "1999-01-29" }, "entity_type": "gene", "entity_name": "DNAJA3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34750646", "30770860", "41354729" ], "evidence": [ "Expert Review Amber", "Literature", "Literature" ], "phenotypes": [ "Mitochondrial disease, MONDO:0044970, DNAJA3-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "RAR2", "RLGP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25410", "gene_name": "RAB40A like", "omim_gene": [ "300405" ], "alias_name": [ "Ras like GTPase" ], "gene_symbol": "RAB40AL", "hgnc_symbol": "RAB40AL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:102192200-102193228", "ensembl_id": "ENSG00000102128" } }, "GRch38": { "90": { "location": "X:102937272-102938300", "ensembl_id": "ENSG00000102128" } } }, "hgnc_date_symbol_changed": "2005-04-11" }, "entity_type": "gene", "entity_name": "RAB40AL", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25044830" ], "evidence": [ "Genetic Health Queensland", "Expert Review Red", "Expert Review Red", "Genetic Health Queensland" ], "phenotypes": [ "MENTAL RETARDATION, X-LINKED, SYNDROMIC, MARTIN-PROBST TYPE" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [ "refuted" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "IMAGE:4942737", "DKFZp547D065", "DMP4", "G-CK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:22140", "gene_name": "FAM20C, golgi associated secretory pathway kinase", "omim_gene": [ "611061" ], "alias_name": [ "dentin matrix protein 4", "golgi casein kinase" ], "gene_symbol": "FAM20C", "hgnc_symbol": "FAM20C", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:192969-300711", "ensembl_id": "ENSG00000177706" } }, "GRch38": { "90": { "location": "7:192969-260745", "ensembl_id": "ENSG00000177706" } } }, "hgnc_date_symbol_changed": "2003-09-03" }, "entity_type": "gene", "entity_name": "FAM20C", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34360805" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "lethal osteosclerotic bone dysplasia MONDO:0009821" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.427", "version_created": "2026-04-02T17:28:09.565635+11:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 383, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "A3a", "156DAG", "AGRNR", "DAG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2666", "gene_name": "dystroglycan 1", "omim_gene": [ "128239" ], "alias_name": [ "alpha-dystroglycan", "dystrophin-associated glycoprotein-1", "beta-dystroglycan" ], "gene_symbol": "DAG1", "hgnc_symbol": "DAG1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:49506146-49573048", "ensembl_id": "ENSG00000173402" } }, "GRch38": { "90": { "location": "3:49468703-49535618", "ensembl_id": "ENSG00000173402" } } }, "hgnc_date_symbol_changed": "1997-07-22" }, "entity_type": "gene", "entity_name": "DAG1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21388311", "25934851", "24052401", "25503980", "29337005" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9", "Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9, 613818", "Walker-Warburg syndrome and tectocerebellar dysgraphia" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 141, "hash_id": null, "name": "Muscular dystrophy and myopathy_Paediatric", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and RMH.\r\n\r\nIt contains genes typically associated with congenital muscular dystrophies and myopathies, which are characterised by weakness at birth, muscle biopsy showing dystrophic or myopathic changes, raised CK, and sometimes structural brain abnormalities. It also contains some genes that cause disorders with overlapping clinical features.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.122", "version_created": "2026-04-02T11:45:25.115390+11:00", "relevant_disorders": [ "Muscular dystrophy", "HP:0003560; Elevated circulating creatine kinase concentration", "HP:0003236; Myopathy", "HP:0003198" ], "stats": { "number_of_genes": 146, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "C/EBP-alpha" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1833", "gene_name": "CCAAT/enhancer binding protein alpha", "omim_gene": [ "116897" ], "alias_name": null, "gene_symbol": "CEBPA", "hgnc_symbol": "CEBPA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:33790840-33793470", "ensembl_id": "ENSG00000245848" } }, "GRch38": { "90": { "location": "19:33299934-33302564", "ensembl_id": "ENSG00000245848" } } }, "hgnc_date_symbol_changed": "1991-11-27" }, "entity_type": "gene", "entity_name": "CEBPA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15575056", "32430494", "31309983" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Leukemia, acute myeloid, MIM# 601626" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 152, "hash_id": null, "name": "Cancer Predisposition_Paediatric", "disease_group": "Cancer", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.133", "version_created": "2026-01-12T09:35:45.797477+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 106, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MEK1", "MAPKK1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6840", "gene_name": "mitogen-activated protein kinase kinase 1", "omim_gene": [ "176872" ], "alias_name": null, "gene_symbol": "MAP2K1", "hgnc_symbol": "MAP2K1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:66679155-66784650", "ensembl_id": "ENSG00000169032" } }, "GRch38": { "90": { "location": "15:66386817-66492312", "ensembl_id": "ENSG00000169032" } } }, "hgnc_date_symbol_changed": "1993-11-05" }, "entity_type": "gene", "entity_name": "MAP2K1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 152, "hash_id": null, "name": "Cancer Predisposition_Paediatric", "disease_group": "Cancer", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.133", "version_created": "2026-01-12T09:35:45.797477+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 106, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BUBR1", "MAD3L", "Bub1A", "SSK1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1149", "gene_name": "BUB1 mitotic checkpoint serine/threonine kinase B", "omim_gene": [ "602860" ], "alias_name": null, "gene_symbol": "BUB1B", "hgnc_symbol": "BUB1B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:40453224-40513337", "ensembl_id": "ENSG00000156970" } }, "GRch38": { "90": { "location": "15:40161023-40221136", "ensembl_id": "ENSG00000156970" } } }, "hgnc_date_symbol_changed": "1998-03-25" }, "entity_type": "gene", "entity_name": "BUB1B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31081598", "31053147" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Mosaic variegated aneuploidy syndrome 1, MIM# 257300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 152, "hash_id": null, "name": "Cancer Predisposition_Paediatric", "disease_group": "Cancer", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.133", "version_created": "2026-01-12T09:35:45.797477+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 106, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DHAPAT", "DAPAT", "DAP-AT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4416", "gene_name": "glyceronephosphate O-acyltransferase", "omim_gene": [ "602744" ], "alias_name": [ "glycerone-phosphate O-acyltransferase", "dihydroxyacetone phosphate acyltransferase" ], "gene_symbol": "GNPAT", "hgnc_symbol": "GNPAT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:231376953-231413719", "ensembl_id": "ENSG00000116906" } }, "GRch38": { "90": { "location": "1:231241207-231277973", "ensembl_id": "ENSG00000116906" } } }, "hgnc_date_symbol_changed": "1998-10-29" }, "entity_type": "gene", "entity_name": "GNPAT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 155, "hash_id": null, "name": "Peroxisomal Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.61", "version_created": "2025-12-31T14:23:29.190009+11:00", "relevant_disorders": [ "Peroxisomal disease", "MONDO:0019053" ], "stats": { "number_of_genes": 32, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:12591", "gene_name": "uroporphyrinogen decarboxylase", "omim_gene": [ "613521" ], "alias_name": null, "gene_symbol": "UROD", "hgnc_symbol": "UROD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:45477819-45481247", "ensembl_id": "ENSG00000126088" } }, "GRch38": { "90": { "location": "1:45012147-45015575", "ensembl_id": "ENSG00000126088" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "UROD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "23545314", "30514647" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Porphyria cutanea tarda", "Porphyria, hepatoerythropoietic (MIM#176100)" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "tags": [], "panel": { "id": 156, "hash_id": null, "name": "Photosensitivity Syndromes", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with photosensitivity, in particular DNA repair disorders and porphyrias.", "status": "public", "version": "1.11", "version_created": "2025-12-08T10:32:19.181318+11:00", "relevant_disorders": [ "Cutaneous photosensitivity", "HP:0000992" ], "stats": { "number_of_genes": 28, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BRAF1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1097", "gene_name": "B-Raf proto-oncogene, serine/threonine kinase", "omim_gene": [ "164757" ], "alias_name": null, "gene_symbol": "BRAF", "hgnc_symbol": "BRAF", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:140419127-140624564", "ensembl_id": "ENSG00000157764" } }, "GRch38": { "90": { "location": "7:140719327-140924764", "ensembl_id": "ENSG00000157764" } } }, "hgnc_date_symbol_changed": "1991-07-16" }, "entity_type": "gene", "entity_name": "BRAF", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19206169", "18042262" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Noonan syndrome 7, MIM# 613706", "Cardiofaciocutaneous syndrome, MIM# 115150" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 164, "hash_id": null, "name": "Rasopathy", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the ClinGen Rasopathy Working Group gene-disease validity assessments (PMID: 30311384) and against the Genomics England PanelApp Rasopathies panel, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "0.113", "version_created": "2026-01-26T17:08:48.260163+11:00", "relevant_disorders": [ "Rasopathy", "MONDO:0021060" ], "stats": { "number_of_genes": 32, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CASIL" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7883", "gene_name": "notch 3", "omim_gene": [ "600276" ], "alias_name": null, "gene_symbol": "NOTCH3", "hgnc_symbol": "NOTCH3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:15270444-15311792", "ensembl_id": "ENSG00000074181" } }, "GRch38": { "90": { "location": "19:15159038-15200981", "ensembl_id": "ENSG00000074181" } } }, "hgnc_date_symbol_changed": "1994-07-04" }, "entity_type": "gene", "entity_name": "NOTCH3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33020014", "30776699", "21414809", "30056822", "17675836" ], "evidence": [ "Expert Review Green", "Literature", "Expert list" ], "phenotypes": [ "neurodevelopmental disorder MONDO:0700092, NOTCH3-related", "Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 - 125310" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "hnRNP-R" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5047", "gene_name": "heterogeneous nuclear ribonucleoprotein R", "omim_gene": [ "607201" ], "alias_name": null, "gene_symbol": "HNRNPR", "hgnc_symbol": "HNRNPR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:23630264-23670829", "ensembl_id": "ENSG00000125944" } }, "GRch38": { "90": { "location": "1:23303771-23344336", "ensembl_id": "ENSG00000125944" } } }, "hgnc_date_symbol_changed": "2007-08-16" }, "entity_type": "gene", "entity_name": "HNRNPR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26795593", "31079900" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Neurodevelopmental disorder with dysmorphic facies and skeletal and brain abnormalities, MIM# 620073" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FRAG1", "CWH43-N" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17893", "gene_name": "post-GPI attachment to proteins 2", "omim_gene": [ "615187" ], "alias_name": [ "FGF receptor activating protein 1", "cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)" ], "gene_symbol": "PGAP2", "hgnc_symbol": "PGAP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:3818954-3847601", "ensembl_id": "ENSG00000148985" } }, "GRch38": { "90": { "location": "11:3797724-3826371", "ensembl_id": "ENSG00000148985" } } }, "hgnc_date_symbol_changed": "2009-06-18" }, "entity_type": "gene", "entity_name": "PGAP2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "23561846", "23561847", "31805394", "29119105", "27871432" ], "evidence": [ "Expert Review Amber", "Expert Review" ], "phenotypes": [ "Hyperphosphatasia with mental retardation syndrome 3, MIM# 614207, MONDO:0013628" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ20561", "HsT18960", "nclf" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2077", "gene_name": "CLN6, transmembrane ER protein", "omim_gene": [ "606725" ], "alias_name": null, "gene_symbol": "CLN6", "hgnc_symbol": "CLN6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:68499330-68549549", "ensembl_id": "ENSG00000128973" } }, "GRch38": { "90": { "location": "15:68206992-68257211", "ensembl_id": "ENSG00000128973" } } }, "hgnc_date_symbol_changed": "1996-10-11" }, "entity_type": "gene", "entity_name": "CLN6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "11791207", "11727201", "21549341", "33798445", "33024953" ], "evidence": [ "Expert Review Green", "Expert Review Green", "Expert Review" ], "phenotypes": [ "Ceroid lipofuscinosis, neuronal, 6, MIM# 601780", "Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CAP-R", "CT114" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2510", "gene_name": "catenin alpha 2", "omim_gene": [ "114025" ], "alias_name": [ "cadherin-associated protein, related", "cancer/testis antigen 114", "alpha-N-catenin" ], "gene_symbol": "CTNNA2", "hgnc_symbol": "CTNNA2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:79412357-80875905", "ensembl_id": "ENSG00000066032" } }, "GRch38": { "90": { "location": "2:79185231-80648861", "ensembl_id": "ENSG00000066032" } } }, "hgnc_date_symbol_changed": "1993-07-13" }, "entity_type": "gene", "entity_name": "CTNNA2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30013181" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Brain Malformations Flagship" ], "phenotypes": [ "Cortical dysplasia, complex, with other brain malformations 9, MIM#618174" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PKBG", "RAC-gamma", "PRKBG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:393", "gene_name": "AKT serine/threonine kinase 3", "omim_gene": [ "611223" ], "alias_name": [ "protein kinase B, gamma" ], "gene_symbol": "AKT3", "hgnc_symbol": "AKT3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:243651535-244014381", "ensembl_id": "ENSG00000117020" } }, "GRch38": { "90": { "location": "1:243488233-243851079", "ensembl_id": "ENSG00000117020" } } }, "hgnc_date_symbol_changed": "1999-11-16" }, "entity_type": "gene", "entity_name": "AKT3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:23066", "gene_name": "trafficking protein particle complex 6B", "omim_gene": [ "610397" ], "alias_name": null, "gene_symbol": "TRAPPC6B", "hgnc_symbol": "TRAPPC6B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:39617015-39639736", "ensembl_id": "ENSG00000182400" } }, "GRch38": { "90": { "location": "14:39147811-39170532", "ensembl_id": "ENSG00000182400" } } }, "hgnc_date_symbol_changed": "2003-09-01" }, "entity_type": "gene", "entity_name": "TRAPPC6B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "28626029", "28397838", "31687267" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2323", "gene_name": "carbamoyl-phosphate synthase 1", "omim_gene": [ "608307" ], "alias_name": [ "carbamoyl-phosphate synthase (ammonia)" ], "gene_symbol": "CPS1", "hgnc_symbol": "CPS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:211342406-211543831", "ensembl_id": "ENSG00000021826" } }, "GRch38": { "90": { "location": "2:210477682-210679107", "ensembl_id": "ENSG00000021826" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "CPS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FA", "FARR", "X25", "CyaY" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3951", "gene_name": "frataxin", "omim_gene": [ "606829" ], "alias_name": null, "gene_symbol": "FXN", "hgnc_symbol": "FXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71650175-71715094", "ensembl_id": "ENSG00000165060" } }, "GRch38": { "90": { "location": "9:69035259-69100178", "ensembl_id": "ENSG00000165060" } } }, "hgnc_date_symbol_changed": "2004-08-19" }, "entity_type": "gene", "entity_name": "FXN", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HNF1", "LFB1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11621", "gene_name": "HNF1 homeobox A", "omim_gene": [ "142410" ], "alias_name": null, "gene_symbol": "HNF1A", "hgnc_symbol": "HNF1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:121416346-121440315", "ensembl_id": "ENSG00000135100" } }, "GRch38": { "90": { "location": "12:120978543-121002512", "ensembl_id": "ENSG00000135100" } } }, "hgnc_date_symbol_changed": "2007-08-24" }, "entity_type": "gene", "entity_name": "HNF1A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34012068" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "MODY, type III\t, MIM#600496" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 221, "hash_id": null, "name": "Additional findings_Adult", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Additional findings flagship.\r\n\r\nThe framework used considered clinical actionability and public screening principles, for full publication see Martyn M et al 2019, PMID: 30776170. The genes included are associated with conditions that are adult-onset, clinically-actionable, have a known management pathway which is publicly funded in Victoria, and have a population frequency of gene variants greater than 1/100,000.\r\n\r\nThis has been updated with the 2023 ACMG V3.2 Secondary Findings list, PMID: 37347242.\r\n\r\nV1.0 was used for the Australian Genomics Acute Care additional findings study.\r\n\r\nThe panel has been updated with ClinGen Adult Actionability assertions.", "status": "public", "version": "2.0", "version_created": "2026-03-16T10:56:03.168206+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 136, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "JV15-2", "HsT17436" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6769", "gene_name": "SMAD family member 3", "omim_gene": [ "603109" ], "alias_name": null, "gene_symbol": "SMAD3", "hgnc_symbol": "SMAD3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:67356101-67487533", "ensembl_id": "ENSG00000166949" } }, "GRch38": { "90": { "location": "15:67063763-67195195", "ensembl_id": "ENSG00000166949" } } }, "hgnc_date_symbol_changed": "2004-05-26" }, "entity_type": "gene", "entity_name": "SMAD3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance" ], "phenotypes": [ "Loeys-Dietz syndrome 3, MIM# 613795" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 221, "hash_id": null, "name": "Additional findings_Adult", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Additional findings flagship.\r\n\r\nThe framework used considered clinical actionability and public screening principles, for full publication see Martyn M et al 2019, PMID: 30776170. The genes included are associated with conditions that are adult-onset, clinically-actionable, have a known management pathway which is publicly funded in Victoria, and have a population frequency of gene variants greater than 1/100,000.\r\n\r\nThis has been updated with the 2023 ACMG V3.2 Secondary Findings list, PMID: 37347242.\r\n\r\nV1.0 was used for the Australian Genomics Acute Care additional findings study.\r\n\r\nThe panel has been updated with ClinGen Adult Actionability assertions.", "status": "public", "version": "2.0", "version_created": "2026-03-16T10:56:03.168206+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 136, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3544", "gene_name": "coagulation factor VII", "omim_gene": [ "613878" ], "alias_name": [ "eptacog alfa", "FVII coagulation protein", "factor VII" ], "gene_symbol": "F7", "hgnc_symbol": "F7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:113760105-113774995", "ensembl_id": "ENSG00000057593" } }, "GRch38": { "90": { "location": "13:113105788-113120681", "ensembl_id": "ENSG00000057593" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "F7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Factor VII deficiency, MIM# 227500" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 221, "hash_id": null, "name": "Additional findings_Adult", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Additional findings flagship.\r\n\r\nThe framework used considered clinical actionability and public screening principles, for full publication see Martyn M et al 2019, PMID: 30776170. The genes included are associated with conditions that are adult-onset, clinically-actionable, have a known management pathway which is publicly funded in Victoria, and have a population frequency of gene variants greater than 1/100,000.\r\n\r\nThis has been updated with the 2023 ACMG V3.2 Secondary Findings list, PMID: 37347242.\r\n\r\nV1.0 was used for the Australian Genomics Acute Care additional findings study.\r\n\r\nThe panel has been updated with ClinGen Adult Actionability assertions.", "status": "public", "version": "2.0", "version_created": "2026-03-16T10:56:03.168206+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 136, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "G6PD1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4057", "gene_name": "glucose-6-phosphate dehydrogenase", "omim_gene": [ "305900" ], "alias_name": null, "gene_symbol": "G6PD", "hgnc_symbol": "G6PD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:153759606-153775787", "ensembl_id": "ENSG00000160211" } }, "GRch38": { "90": { "location": "X:154531391-154547572", "ensembl_id": "ENSG00000160211" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "G6PD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Hemolytic anemia, G6PD deficient (favism), MIM#\t300908" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 233, "hash_id": null, "name": "Phagocyte Defects", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with abnormalities in phagocyte number, function or both. Susceptibility to infection from phagocytic dysfunction ranges from mild, recurrent skin infections to overwhelming, fatal systemic infection. Affected individuals are more susceptible to bacterial and fungal infections but have a normal resistance to viral infections. Most are diagnosed in infancy due to the severity of the infection or the unusual presentation of the organism, but some are diagnosed in adulthood. Includes:\r\n- Congenital Neutropenias\r\n- Defects of Motility\r\n- Defects of Respiratory Burst\r\n- Other Non-Lymphoid Defects\r\n\r\nUpdated with the 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications. \r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).\r\n\r\nThis panel was merged with and replaces the Melbourne Genomics Immunology Flagship Neutrophil Defects gene panel (22/03/2021).", "status": "public", "version": "1.45", "version_created": "2025-12-15T10:26:57.519304+11:00", "relevant_disorders": [ "Unusual infection", "HP:0032101" ], "stats": { "number_of_genes": 58, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "PROSC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9457", "gene_name": "pyridoxal phosphate binding protein", "omim_gene": [ "604436" ], "alias_name": [ "proline synthetase co-transcribed (bacterial homolog)", "proline synthetase cotranscribed homolog (bacterial)" ], "gene_symbol": "PLPBP", "hgnc_symbol": "PLPBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:37620111-37637283", "ensembl_id": "ENSG00000147471" } }, "GRch38": { "90": { "location": "8:37762593-37779767", "ensembl_id": "ENSG00000147471" } } }, "hgnc_date_symbol_changed": "2017-02-28" }, "entity_type": "gene", "entity_name": "PLPBP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27912044", "31741821", "30668673" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Epilepsy, early-onset, vitamin B6-dependent, MIM# 617290" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GluA2", "GLURB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4572", "gene_name": "glutamate ionotropic receptor AMPA type subunit 2", "omim_gene": [ "138247" ], "alias_name": null, "gene_symbol": "GRIA2", "hgnc_symbol": "GRIA2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:158125334-158287227", "ensembl_id": "ENSG00000120251" } }, "GRch38": { "90": { "location": "4:157204182-157366075", "ensembl_id": "ENSG00000120251" } } }, "hgnc_date_symbol_changed": "1992-02-26" }, "entity_type": "gene", "entity_name": "GRIA2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 31300657" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with language impairment and behavioral abnormalities, MIM# 618917" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MEL-18" ], "biotype": null, "hgnc_id": "HGNC:12929", "gene_name": "polycomb group ring finger 2", "omim_gene": [ "600346" ], "alias_name": null, "gene_symbol": "PCGF2", "hgnc_symbol": "PCGF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:36890150-36906070", "ensembl_id": "ENSG00000056661" } }, "GRch38": { "90": { "location": "17:38733897-38749817", "ensembl_id": "ENSG00000277258" } } }, "hgnc_date_symbol_changed": "2005-01-19" }, "entity_type": "gene", "entity_name": "PCGF2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30343942" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Turnpenny-Fry syndrome, MIM# 618371" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0609" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6511", "gene_name": "LARGE xylosyl- and glucuronyltransferase 1", "omim_gene": [ "603590" ], "alias_name": [ "like-acetylglucosaminyltransferase" ], "gene_symbol": "LARGE1", "hgnc_symbol": "LARGE1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:33558212-34318829", "ensembl_id": "ENSG00000133424" } }, "GRch38": { "90": { "location": "22:33162226-33922841", "ensembl_id": "ENSG00000133424" } } }, "hgnc_date_symbol_changed": "2016-05-31" }, "entity_type": "gene", "entity_name": "LARGE1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12966029", "19067344", "17436019", "21248746", "19299310" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154", "Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "JBTS26", "KATNIP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29068", "gene_name": "KIAA0556", "omim_gene": [ "616650" ], "alias_name": null, "gene_symbol": "KIAA0556", "hgnc_symbol": "KIAA0556", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:27561454-27791690", "ensembl_id": "ENSG00000047578" } }, "GRch38": { "90": { "location": "16:27550133-27780369", "ensembl_id": "ENSG00000047578" } } }, "hgnc_date_symbol_changed": "2006-08-25" }, "entity_type": "gene", "entity_name": "KIAA0556", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26714646", "27245168" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Joubert syndrome 26, MIM# 616784" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HSP78", "SKD3", "FLJ13152", "ANKCLB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30664", "gene_name": "ClpB homolog, mitochondrial AAA ATPase chaperonin", "omim_gene": [ "616254" ], "alias_name": [ "suppressor of potassium transport defect 3", "ankyrin-repeat containing bacterial clp fusion" ], "gene_symbol": "CLPB", "hgnc_symbol": "CLPB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:72003469-72145692", "ensembl_id": "ENSG00000162129" } }, "GRch38": { "90": { "location": "11:72292425-72434680", "ensembl_id": "ENSG00000162129" } } }, "hgnc_date_symbol_changed": "2005-10-04" }, "entity_type": "gene", "entity_name": "CLPB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25597510", "34140661" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271", "3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:9330", "gene_name": "polyglutamine binding protein 1", "omim_gene": [ "300463" ], "alias_name": null, "gene_symbol": "PQBP1", "hgnc_symbol": "PQBP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:48755195-48760420", "ensembl_id": "ENSG00000102103" } }, "GRch38": { "90": { "location": "X:48897912-48903143", "ensembl_id": "ENSG00000102103" } } }, "hgnc_date_symbol_changed": "1999-01-12" }, "entity_type": "gene", "entity_name": "PQBP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31840929", "14634649", "20410308" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Renpenning syndrome, MIM#309500" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:16959", "gene_name": "YKT6 v-SNARE homolog", "omim_gene": [ "606209" ], "alias_name": [ "R-SNARE" ], "gene_symbol": "YKT6", "hgnc_symbol": "YKT6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:44240567-44253893", "ensembl_id": "ENSG00000106636" } }, "GRch38": { "90": { "location": "7:44200968-44214294", "ensembl_id": "ENSG00000106636" } } }, "hgnc_date_symbol_changed": "2006-04-21" }, "entity_type": "gene", "entity_name": "YKT6", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "38522068" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Syndromic disease, MONDO:0002254, YKT6-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "XAP101", "dyskerin", "NAP57", "NOLA4", "Cbf5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2890", "gene_name": "dyskerin pseudouridine synthase 1", "omim_gene": [ "300126" ], "alias_name": [ "H/ACA ribonucleoprotein complex subunit 4" ], "gene_symbol": "DKC1", "hgnc_symbol": "DKC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:153991031-154005964", "ensembl_id": "ENSG00000130826" } }, "GRch38": { "90": { "location": "X:154762742-154777689", "ensembl_id": "ENSG00000130826" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "DKC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "https://search.clinicalgenome.org/CCID:004651" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "DKC1-related disorder MONDO:0100152" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10633", "FLJ11030", "HELAD1", "KIAA1419", "POMFIL2", "RAINB1", "FLJ23707" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15997", "gene_name": "neuron navigator 2", "omim_gene": [ "607026" ], "alias_name": [ "pore membrane and/or filament interacting like protein 2", "retinoic acid inducible gene in neuroblastoma 1", "helicase, APC down-regulated 1" ], "gene_symbol": "NAV2", "hgnc_symbol": "NAV2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:19372271-20143144", "ensembl_id": "ENSG00000166833" } }, "GRch38": { "90": { "location": "11:19350724-20121598", "ensembl_id": "ENSG00000166833" } } }, "hgnc_date_symbol_changed": "2001-06-29" }, "entity_type": "gene", "entity_name": "NAV2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID:35218524" ], "evidence": [ "Expert Review Amber", "Literature", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, NAV2-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RANK", "CD265", "FEO" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11908", "gene_name": "TNF receptor superfamily member 11a", "omim_gene": [ "603499" ], "alias_name": null, "gene_symbol": "TNFRSF11A", "hgnc_symbol": "TNFRSF11A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:59992520-60058516", "ensembl_id": "ENSG00000141655" } }, "GRch38": { "90": { "location": "18:62325287-62391292", "ensembl_id": "ENSG00000141655" } } }, "hgnc_date_symbol_changed": "1998-12-04" }, "entity_type": "gene", "entity_name": "TNFRSF11A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18606301", "32048120" ], "evidence": [ "Expert Review Green", "NHS GMS", "Emory Genetics Laboratory", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Osteolysis, familial expansile 174810", "Paget disease of bone 2, early-onset 602080", "Osteopetrosis, autosomal recessive 7 612301" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HLC-8", "MIG3", "FLJ20721", "SPEP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29601", "gene_name": "chromosome 17 open reading frame 80", "omim_gene": null, "alias_name": [ "sperm-expressed protein 1", "migration-inducing protein 3" ], "gene_symbol": "C17orf80", "hgnc_symbol": "C17orf80", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:71228372-71245091", "ensembl_id": "ENSG00000141219" } }, "GRch38": { "90": { "location": "17:73232233-73248947", "ensembl_id": "ENSG00000141219" } } }, "hgnc_date_symbol_changed": "2012-02-24" }, "entity_type": "gene", "entity_name": "C17orf80", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "41720819" ], "evidence": [ "Expert Review Amber", "Literature", "Literature" ], "phenotypes": [ "Mitochondrial disease, MONDO:0044970" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "new gene name" ], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA1890", "PPP1R24" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14026", "gene_name": "CUB and Sushi multiple domains 1", "omim_gene": [ "608397" ], "alias_name": [ "protein phosphatase 1, regulatory subunit 24" ], "gene_symbol": "CSMD1", "hgnc_symbol": "CSMD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:2792875-4852494", "ensembl_id": "ENSG00000183117" } }, "GRch38": { "90": { "location": "8:2935353-4994972", "ensembl_id": "ENSG00000183117" } } }, "hgnc_date_symbol_changed": "2000-12-21" }, "entity_type": "gene", "entity_name": "CSMD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID 38816421" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "complex neurodevelopmental disorder MONDO:0100038" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.394", "version_created": "2026-04-07T13:49:15.516142+10:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CD107b" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6501", "gene_name": "lysosomal associated membrane protein 2", "omim_gene": [ "309060" ], "alias_name": null, "gene_symbol": "LAMP2", "hgnc_symbol": "LAMP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:119561682-119603220", "ensembl_id": "ENSG00000005893" } }, "GRch38": { "90": { "location": "X:120427827-120469365", "ensembl_id": "ENSG00000005893" } } }, "hgnc_date_symbol_changed": "1990-08-03" }, "entity_type": "gene", "entity_name": "LAMP2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "27179547", "22541782" ], "evidence": [ "Expert Review Green", "Expert Review Amber", "Expert Review", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Danon disease (MIM#300257)" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:17870", "gene_name": "inversin", "omim_gene": [ "243305" ], "alias_name": [ "nephrocystin 2" ], "gene_symbol": "INVS", "hgnc_symbol": "INVS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:102861538-103063282", "ensembl_id": "ENSG00000119509" } }, "GRch38": { "90": { "location": "9:100099256-100301000", "ensembl_id": "ENSG00000119509" } } }, "hgnc_date_symbol_changed": "2002-06-11" }, "entity_type": "gene", "entity_name": "INVS", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16522655" ], "evidence": [ "Expert Review Amber", "RetNet" ], "phenotypes": [ "Nephronophthisis 2, infantile, MIM#602088" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3099, "hash_id": null, "name": "Syndromic Retinopathy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause retinopathy with at least one other consistent extra-ocular feature, forming a syndrome. The panel does NOT include the Bardet-Biedl syndrome, Stickler syndrome, and Usher syndrome genes, which have their own panels and are part of the Retinal Disorders Superpanel.\r\n\r\nConsider using the panel Retinal Disorders Superpanel when ophthalmological findings are not specific for a sub-group of disorders, particularly in individuals early in the diagnostic trajectory or if a dual diagnosis is a possibility.", "status": "public", "version": "0.256", "version_created": "2026-03-31T19:05:29.271183+11:00", "relevant_disorders": [ "Retinopathy", "HP:0000488" ], "stats": { "number_of_genes": 138, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10385", "TCAB1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25522", "gene_name": "WD repeat containing antisense to TP53", "omim_gene": [ "612661" ], "alias_name": [ "telomerase cajal body protein 1", "WD-encoding RNA antisense to p53" ], "gene_symbol": "WRAP53", "hgnc_symbol": "WRAP53", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:7589389-7606820", "ensembl_id": "ENSG00000141499" } }, "GRch38": { "90": { "location": "17:7686071-7703502", "ensembl_id": "ENSG00000141499" } } }, "hgnc_date_symbol_changed": "2009-02-16" }, "entity_type": "gene", "entity_name": "WRAP53", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Dyskeratosis congenita, autosomal recessive 3, 613988 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZp586C1924", "OPA7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25382", "gene_name": "transmembrane protein 126A", "omim_gene": [ "612988" ], "alias_name": null, "gene_symbol": "TMEM126A", "hgnc_symbol": "TMEM126A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:85359011-85367591", "ensembl_id": "ENSG00000171202" } }, "GRch38": { "90": { "location": "11:85647967-85656547", "ensembl_id": "ENSG00000171202" } } }, "hgnc_date_symbol_changed": "2006-02-13" }, "entity_type": "gene", "entity_name": "TMEM126A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Optic atrophy 7, 612989 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DPD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3012", "gene_name": "dihydropyrimidine dehydrogenase", "omim_gene": [ "612779" ], "alias_name": null, "gene_symbol": "DPYD", "hgnc_symbol": "DPYD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:97543299-98386605", "ensembl_id": "ENSG00000188641" } }, "GRch38": { "90": { "location": "1:97077743-97921049", "ensembl_id": "ENSG00000188641" } } }, "hgnc_date_symbol_changed": "1994-07-07" }, "entity_type": "gene", "entity_name": "DPYD", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "29152729" ], "evidence": [ "Expert Review Amber", "Other" ], "phenotypes": [ "Fluoropyrimidine" ], "mode_of_inheritance": "Other", "tags": [], "panel": { "id": 3271, "hash_id": null, "name": "Pharmacogenomics_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is under development, to be used by the Australian Genomics Acute Care Flagship.", "status": "public", "version": "0.50", "version_created": "2020-08-27T20:53:11.205850+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 17, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MPS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5391", "gene_name": "iduronidase, alpha-L-", "omim_gene": [ "252800" ], "alias_name": null, "gene_symbol": "IDUA", "hgnc_symbol": "IDUA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:980785-998316", "ensembl_id": "ENSG00000127415" } }, "GRch38": { "90": { "location": "4:986997-1004506", "ensembl_id": "ENSG00000127415" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "IDUA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Mucopolysaccharidosis Ih" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SUR2", "CMD1O" ], "biotype": "protein_coding", "hgnc_id": "HGNC:60", "gene_name": "ATP binding cassette subfamily C member 9", "omim_gene": [ "601439" ], "alias_name": [ "sulfonylurea receptor 2" ], "gene_symbol": "ABCC9", "hgnc_symbol": "ABCC9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:21950335-22094336", "ensembl_id": "ENSG00000069431" } }, "GRch38": { "90": { "location": "12:21797401-21942529", "ensembl_id": "ENSG00000069431" } } }, "hgnc_date_symbol_changed": "1999-10-26" }, "entity_type": "gene", "entity_name": "ABCC9", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene", "BabySeq Category B gene", "BabySeq Category A gene" ], "phenotypes": [ "Atrial fibrillation, familial", "Cardiomyopathy, dilated", "Hypertrichotic osteochondrodysplasia" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:359", "gene_name": "aryl hydrocarbon receptor interacting protein like 1", "omim_gene": [ "604392" ], "alias_name": null, "gene_symbol": "AIPL1", "hgnc_symbol": "AIPL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:6297013-6338519", "ensembl_id": "ENSG00000129221" } }, "GRch38": { "90": { "location": "17:6393693-6435199", "ensembl_id": "ENSG00000129221" } } }, "hgnc_date_symbol_changed": "1999-03-18" }, "entity_type": "gene", "entity_name": "AIPL1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10615133" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Leber congenital amaurosis 4, MIM# 604393" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3762, "hash_id": null, "name": "Congenital nystagmus", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with isolated or syndromic nystagmus presenting in infancy or early childhood.", "status": "public", "version": "1.24", "version_created": "2026-01-26T13:26:36.043723+11:00", "relevant_disorders": [ "Nystagmus HP:0000639" ], "stats": { "number_of_genes": 84, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:17870", "gene_name": "inversin", "omim_gene": [ "243305" ], "alias_name": [ "nephrocystin 2" ], "gene_symbol": "INVS", "hgnc_symbol": "INVS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:102861538-103063282", "ensembl_id": "ENSG00000119509" } }, "GRch38": { "90": { "location": "9:100099256-100301000", "ensembl_id": "ENSG00000119509" } } }, "hgnc_date_symbol_changed": "2002-06-11" }, "entity_type": "gene", "entity_name": "INVS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12872123", "19177160" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Nephronophthisis 2, MIM# 602088" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11776", "gene_name": "TGFB induced factor homeobox 1", "omim_gene": [ "602630" ], "alias_name": null, "gene_symbol": "TGIF1", "hgnc_symbol": "TGIF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:3411606-3458409", "ensembl_id": "ENSG00000177426" } }, "GRch38": { "90": { "location": "18:3411608-3459978", "ensembl_id": "ENSG00000177426" } } }, "hgnc_date_symbol_changed": "2007-01-30" }, "entity_type": "gene", "entity_name": "TGIF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10835638", "16323008" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Holoprosencephaly 4, MIM# 142946", "MONDO:0007734" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "D40", "AF15Q14", "CT29", "KIAA1570", "hKNL-1", "hSpc105", "PPP1R55", "Spc7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24054", "gene_name": "kinetochore scaffold 1", "omim_gene": [ "609173" ], "alias_name": [ "cancer/testis antigen 29", "kinetochore null 1 homolog (C. elegans)", "blinkin, bub-linking kinetochore protein", "protein phosphatase 1, regulatory subunit 55" ], "gene_symbol": "KNL1", "hgnc_symbol": "KNL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:40886218-40956540", "ensembl_id": "ENSG00000137812" } }, "GRch38": { "90": { "location": "15:40594020-40664342", "ensembl_id": "ENSG00000137812" } } }, "hgnc_date_symbol_changed": "2016-06-13" }, "entity_type": "gene", "entity_name": "KNL1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26626498", "26621532", "22983954", "27149178", "30304678", "27784895" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Microcephaly 4, primary, autosomal recessive, OMIM:604321", "Microcephaly 4, primary, autosomal recessive, MONDO:0011437" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HSP78", "SKD3", "FLJ13152", "ANKCLB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30664", "gene_name": "ClpB homolog, mitochondrial AAA ATPase chaperonin", "omim_gene": [ "616254" ], "alias_name": [ "suppressor of potassium transport defect 3", "ankyrin-repeat containing bacterial clp fusion" ], "gene_symbol": "CLPB", "hgnc_symbol": "CLPB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:72003469-72145692", "ensembl_id": "ENSG00000162129" } }, "GRch38": { "90": { "location": "11:72292425-72434680", "ensembl_id": "ENSG00000162129" } } }, "hgnc_date_symbol_changed": "2005-10-04" }, "entity_type": "gene", "entity_name": "CLPB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25597510", "34140661" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RAD1", "FANCQ" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3436", "gene_name": "ERCC excision repair 4, endonuclease catalytic subunit", "omim_gene": [ "133520" ], "alias_name": [ "xeroderma pigmentosum, complementation group F" ], "gene_symbol": "ERCC4", "hgnc_symbol": "ERCC4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:14014014-14046202", "ensembl_id": "ENSG00000175595" } }, "GRch38": { "90": { "location": "16:13920157-13952345", "ensembl_id": "ENSG00000175595" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "ERCC4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23623386", "8797827", "23623389", "17183314", "29105242" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Literature", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Fanconi anaemia, complementation group Q, MIM# 615272", "MONDO:0014108", "XFE progeroid syndrome, MIM# 610965" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HH114", "MGC11326", "FLJ22851" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26929", "gene_name": "chromosome 15 open reading frame 41", "omim_gene": [ "615626" ], "alias_name": null, "gene_symbol": "C15orf41", "hgnc_symbol": "C15orf41", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:36871812-37102449", "ensembl_id": "ENSG00000186073" } }, "GRch38": { "90": { "location": "15:36579611-36810248", "ensembl_id": "ENSG00000186073" } } }, "hgnc_date_symbol_changed": "2005-10-24" }, "entity_type": "gene", "entity_name": "C15orf41", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "IBMDx Study", "Expert Review Green", "Expert list" ], "phenotypes": [ "Dyserythropoietic anemia, congenital, type Ib, MIM# 615631" ], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 3829, "hash_id": null, "name": "IBMDx study", "disease_group": "", "disease_sub_group": "", "description": "The inherited bone marrow diseases (IBMD) are a diverse group of diseases featuring single or multi-lineage cytopaenias and numerous potential associated manifestations including multi-organ syndromic features, a predisposition to haematological malignancy and/or a bleeding phenotype.\r\n\r\nThis panel is appropriate to be used for the following phenotypes of IBMD :\r\n-\tFanconi anaemia (excluding BRCA1, BRCA2, BRIP1 due to their more common association with familial breast cancer risk than FA) \r\n-\tDiamond-Blackfan anaemia\r\n-\tDyskeratosis congenita / telomere biology disorders\r\n-\tShwachman-Diamond syndrome\r\n-\tSevere congenital neutropenia\r\n-\tThrombocytopenia-absent radius syndrome\r\n-\tCongenital amegakaryocytic thrombocytopenia\r\n-\tAdenosine deaminase deficiency\r\n-\tGATA2 deficiency syndrome\r\n-\tSAMD9 / SAMD9L related disorders \r\n-\tCongenital dyserythropoietic anaemia\r\n-\tCongenital sideroblastic anaemia\r\n-\tBernard-Soulier syndrome\r\n\r\nThis panel is being used in the IBMDx study (NCT05196789) – “Diagnosis, discovery and novel phenotype characterisation using multimodal genomics in patients with inherited bone marrow failure and related disorders”\r\n\r\nSome heritable diseases associated with cytopaenias and/or bleeding (for example thalassaemia/haemoglobinopathies and haemophilia) are not assessed with this panel.", "status": "public", "version": "0.42", "version_created": "2026-03-19T18:45:41.236506+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Research", "slug": "research", "description": "Research panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:24415", "gene_name": "bolA family member 3", "omim_gene": [ "613183" ], "alias_name": null, "gene_symbol": "BOLA3", "hgnc_symbol": "BOLA3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:74362525-74375121", "ensembl_id": "ENSG00000163170" } }, "GRch38": { "90": { "location": "2:74135398-74147994", "ensembl_id": "ENSG00000163170" } } }, "hgnc_date_symbol_changed": "2005-05-09" }, "entity_type": "gene", "entity_name": "BOLA3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30302924", "29654549", "30302924" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia MIM#614299" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "WASP", "WASPA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12731", "gene_name": "Wiskott-Aldrich syndrome", "omim_gene": [ "300392" ], "alias_name": [ "eczema-thrombocytopenia" ], "gene_symbol": "WAS", "hgnc_symbol": "WAS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:48534985-48549818", "ensembl_id": "ENSG00000015285" } }, "GRch38": { "90": { "location": "X:48676596-48691427", "ensembl_id": "ENSG00000015285" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "WAS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12969986", "23689198", "20301357", "34307257" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Neutropenia, severe congenital, X-linked, MIM#300299", "Thrombocytopenia, X-linked, MIM#313900", "Wiskott-Aldrich syndrome, MIM#301000" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "bA371L19.1", "hRFT2", "RFVT3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16187", "gene_name": "solute carrier family 52 member 3", "omim_gene": [ "613350" ], "alias_name": [ "hypothetical protein LOC113278" ], "gene_symbol": "SLC52A3", "hgnc_symbol": "SLC52A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:740724-749131", "ensembl_id": "ENSG00000101276" } }, "GRch38": { "90": { "location": "20:760080-776015", "ensembl_id": "ENSG00000101276" } } }, "hgnc_date_symbol_changed": "2012-02-29" }, "entity_type": "gene", "entity_name": "SLC52A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20206331", "26976849", "29053833", "25462087" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Brown-Vialetto-Van Laere syndrome 1, MIM#211530" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ABL" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7467", "gene_name": "microsomal triglyceride transfer protein", "omim_gene": [ "157147" ], "alias_name": null, "gene_symbol": "MTTP", "hgnc_symbol": "MTTP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:100484918-100545156", "ensembl_id": "ENSG00000138823" } }, "GRch38": { "90": { "location": "4:99563761-99623999", "ensembl_id": "ENSG00000138823" } } }, "hgnc_date_symbol_changed": "2005-11-04" }, "entity_type": "gene", "entity_name": "MTTP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17275380", "34078172", "34052173", "33258201" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Abetalipoproteinemia MIM#200100" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SemB", "FLJ12287", "CORD10" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10729", "gene_name": "semaphorin 4A", "omim_gene": [ "607292" ], "alias_name": null, "gene_symbol": "SEMA4A", "hgnc_symbol": "SEMA4A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:156117157-156147543", "ensembl_id": "ENSG00000196189" } }, "GRch38": { "90": { "location": "1:156147366-156177752", "ensembl_id": "ENSG00000196189" } } }, "hgnc_date_symbol_changed": "2004-04-22" }, "entity_type": "gene", "entity_name": "SEMA4A", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16199541", "28805479" ], "evidence": [ "Expert Review Red", "Mackenzie's Mission" ], "phenotypes": [ "Cone-rod dystrophy 10, 610283", "Retinitis pigmentosa 35, 610282" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FRRS2", "CYB561A1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2571", "gene_name": "cytochrome b561", "omim_gene": [ "600019" ], "alias_name": [ "ferric-chelate reductase 2", "cytochrome b561 family, member A1" ], "gene_symbol": "CYB561", "hgnc_symbol": "CYB561", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:61509665-61523739", "ensembl_id": "ENSG00000008283" } }, "GRch38": { "90": { "location": "17:63432304-63446378", "ensembl_id": "ENSG00000008283" } } }, "hgnc_date_symbol_changed": "1993-10-14" }, "entity_type": "gene", "entity_name": "CYB561", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29343526", "31822578" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Orthostatic hypotension 2, MIM#\t618182" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "endocrine" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CAGH45", "HOPA", "OPA1", "TRAP230", "KIAA0192", "OKS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11957", "gene_name": "mediator complex subunit 12", "omim_gene": [ "300188" ], "alias_name": null, "gene_symbol": "MED12", "hgnc_symbol": "MED12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:70338406-70362303", "ensembl_id": "ENSG00000184634" } }, "GRch38": { "90": { "location": "X:71118556-71142454", "ensembl_id": "ENSG00000184634" } } }, "hgnc_date_symbol_changed": "2004-11-26" }, "entity_type": "gene", "entity_name": "MED12", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category A gene" ], "phenotypes": [ "Ohdo syndrome, X-linked MIM#300895", "Lujan-Fryns syndrome MIM#309520", "Opitz-Kaveggia syndrome MIM#305450", "Hardikar syndrome, MIM# 301068" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HIL-10R", "CDW210A", "CD210a", "CD210" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5964", "gene_name": "interleukin 10 receptor subunit alpha", "omim_gene": [ "146933" ], "alias_name": null, "gene_symbol": "IL10RA", "hgnc_symbol": "IL10RA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:117857063-117872196", "ensembl_id": "ENSG00000110324" } }, "GRch38": { "90": { "location": "11:117986348-118003037", "ensembl_id": "ENSG00000110324" } } }, "hgnc_date_symbol_changed": "1994-05-12" }, "entity_type": "gene", "entity_name": "IL10RA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BabySeq Category A gene", "BeginNGS" ], "phenotypes": [ "Inflammatory bowel disease 28, early onset, autosomal recessive, MIM# 613148" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "immunological" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "UDG", "UNG1", "UNG2", "HIGM4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12572", "gene_name": "uracil DNA glycosylase", "omim_gene": [ "191525" ], "alias_name": [ "uracil-DNA glycosylase 1, uracil-DNA glycosylase 2" ], "gene_symbol": "UNG", "hgnc_symbol": "UNG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:109535379-109548797", "ensembl_id": "ENSG00000076248" } }, "GRch38": { "90": { "location": "12:109097574-109110992", "ensembl_id": "ENSG00000076248" } } }, "hgnc_date_symbol_changed": "1990-02-22" }, "entity_type": "gene", "entity_name": "UNG", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PubMed: 12958596, PMID: 15967827, PMID: 19202054, PMID: 16860315" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Immunodeficiency with hyper IgM, type 5 MIM#608106" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "immunological" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:20580", "gene_name": "cytochrome P450 family 2 subfamily R member 1", "omim_gene": [ "608713" ], "alias_name": null, "gene_symbol": "CYP2R1", "hgnc_symbol": "CYP2R1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:14899553-14913798", "ensembl_id": "ENSG00000186104" } }, "GRch38": { "90": { "location": "11:14877440-14892252", "ensembl_id": "ENSG00000186104" } } }, "hgnc_date_symbol_changed": "2004-03-11" }, "entity_type": "gene", "entity_name": "CYP2R1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28548312", "15128933" ], "evidence": [ "Expert Review Green", "KidGen_CalcPhos v38.1.0", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Rickets due to defect in vitamin D 25-hydroxylation deficiency MIM#600081" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3993, "hash_id": null, "name": "Renal Tubulopathies and related disorders", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel was developed/updated in Dec'22 and is maintained by the KidGen Collaborative, and is a consensus panel used by VCGS, GHQ, and RMH.\r\n\r\nThis panel contains genes that cause:\r\n-renal tubular disorders\r\n-electrolyte abnormalities (e.g. Na, K, H, Mg, Ca, PO4, Cl, HCO3)\r\n-aldosterone abnormalities\r\n-nephrolithiasis\r\n-metabolic renal diseases \r\n\r\nIt supersedes the following panels: Bartter syndrome, Dent disease, Diabetes Insipidus, Hyperoxaluria, Metabolic renal disease, Nephrolithiasis and Nephrocalcinosis, Renal abnormalities of calcium and phosphate metabolism, Renal Abnormalities of Magnesium Metabolism, Renal Hypertension and Disorders of Aldosterone Metabolism, and Renal Tubulopathies_KidGen.", "status": "public", "version": "1.26", "version_created": "2026-03-30T10:01:51.458813+11:00", "relevant_disorders": [ "Renal tubular dysfunction", "HP:0000124; Nephrolithiasis", "HP:0000787; Abnormal circulating aldosterone", "HP:0040085" ], "stats": { "number_of_genes": 134, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HSP47", "colligen" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1546", "gene_name": "serpin family H member 1", "omim_gene": [ "600943" ], "alias_name": [ "collagen binding protein 1" ], "gene_symbol": "SERPINH1", "hgnc_symbol": "SERPINH1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:75273101-75283828", "ensembl_id": "ENSG00000149257" } }, "GRch38": { "90": { "location": "11:75562056-75572783", "ensembl_id": "ENSG00000149257" } } }, "hgnc_date_symbol_changed": "1994-01-10" }, "entity_type": "gene", "entity_name": "SERPINH1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Osteogenesis imperfecta" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HLA-H" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4886", "gene_name": "hemochromatosis", "omim_gene": [ "613609" ], "alias_name": [ "high Fe" ], "gene_symbol": "HFE", "hgnc_symbol": "HFE", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:26087509-26098571", "ensembl_id": "ENSG00000010704" } }, "GRch38": { "90": { "location": "6:26087281-26098343", "ensembl_id": "ENSG00000010704" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "HFE", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance" ], "phenotypes": [ "Haemochromatosis, MIM# 235200" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BLOS3", "HPS8" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20914", "gene_name": "biogenesis of lysosomal organelles complex 1 subunit 3", "omim_gene": [ "609762" ], "alias_name": [ "BLOC-1 subunit 3", "Biogenesis of Lysosome-related Organelles complex-1 Subunit 3", "Hermansky-Pudlak syndrome 8" ], "gene_symbol": "BLOC1S3", "hgnc_symbol": "BLOC1S3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:45682003-45685059", "ensembl_id": "ENSG00000189114" } }, "GRch38": { "90": { "location": "19:45178745-45181801", "ensembl_id": "ENSG00000189114" } } }, "hgnc_date_symbol_changed": "2004-05-24" }, "entity_type": "gene", "entity_name": "BLOC1S3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32687635", "16385460", "22709368" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hermansky-Pudlak syndrome 8, MIM# 614077", "MONDO:0013560" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CLN10" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2529", "gene_name": "cathepsin D", "omim_gene": [ "116840" ], "alias_name": [ "ceroid-lipofuscinosis, neuronal 10" ], "gene_symbol": "CTSD", "hgnc_symbol": "CTSD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:1773982-1785222", "ensembl_id": "ENSG00000117984" } }, "GRch38": { "90": { "location": "11:1752752-1764573", "ensembl_id": "ENSG00000117984" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "CTSD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission", "Mackenzie's Mission" ], "phenotypes": [ "Ceroid lipofuscinosis, neuronal, 10, MIM# 610127" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HSPC065", "DKFZp434N1418" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25002", "gene_name": "coiled-coil domain containing 113", "omim_gene": [ "616070" ], "alias_name": null, "gene_symbol": "CCDC113", "hgnc_symbol": "CCDC113", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:58265061-58317740", "ensembl_id": "ENSG00000103021" } }, "GRch38": { "90": { "location": "16:58231157-58283836", "ensembl_id": "ENSG00000103021" } } }, "hgnc_date_symbol_changed": "2006-06-13" }, "entity_type": "gene", "entity_name": "CCDC113", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "41645397", "41645397" ], "evidence": [ "Expert Review Amber", "Literature", "Literature" ], "phenotypes": [ "Infertility disorder, MONDO:0005047, CCDC113-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.143", "version_created": "2026-04-13T17:24:02.975530+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 265, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "HI", "PHHI", "SUR1", "MRP8", "ABC36", "HHF1", "TNDM2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:59", "gene_name": "ATP binding cassette subfamily C member 8", "omim_gene": [ "600509" ], "alias_name": [ "sulfonylurea receptor (hyperinsulinemia)" ], "gene_symbol": "ABCC8", "hgnc_symbol": "ABCC8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:17414432-17498449", "ensembl_id": "ENSG00000006071" } }, "GRch38": { "90": { "location": "11:17392885-17476845", "ensembl_id": "ENSG00000006071" } } }, "hgnc_date_symbol_changed": "1995-01-10" }, "entity_type": "gene", "entity_name": "ABCC8", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 20301620", "32027066", "20922570", "16885549" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Diabetes mellitus, permanent neonatal 3 MIM# 618857" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4456, "hash_id": null, "name": "Genomic newborn screening: ICoNS", "disease_group": "Screening", "disease_sub_group": "", "description": "UNDER CONSTRUCTION. DO NOT USE.", "status": "public", "version": "0.35", "version_created": "2026-03-13T07:28:16.180055+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 20, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "S3-12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29393", "gene_name": "perilipin 4", "omim_gene": [ "613247" ], "alias_name": null, "gene_symbol": "PLIN4", "hgnc_symbol": "PLIN4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:4502204-4517716", "ensembl_id": "ENSG00000167676" } }, "GRch38": { "90": { "location": "19:4502180-4518465", "ensembl_id": "ENSG00000167676" } } }, "hgnc_date_symbol_changed": "2009-08-12" }, "entity_type": "str", "entity_name": "PLIN4_MRUPAV_33-mer", "confidence_level": "3", "penetrance": null, "publications": [ "32451610", "37145156", "36151849", "35499779" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "myopathy, distal, with rimmed vacuoles MONDO:0014945" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC", "chromosome": "19", "grch37_coordinates": [ 4510975, 4511073 ], "grch38_coordinates": [ 4510963, 4511061 ], "normal_repeats": 31, "pathogenic_repeats": 39, "tags": [ "STR" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4749", "version_created": "2026-04-17T16:39:03.838514+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6014, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "FA", "FARR", "X25", "CyaY" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3951", "gene_name": "frataxin", "omim_gene": [ "606829" ], "alias_name": null, "gene_symbol": "FXN", "hgnc_symbol": "FXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:71650175-71715094", "ensembl_id": "ENSG00000165060" } }, "GRch38": { "90": { "location": "9:69035259-69100178", "ensembl_id": "ENSG00000165060" } } }, "hgnc_date_symbol_changed": "2004-08-19" }, "entity_type": "str", "entity_name": "FXN_FRDA_GAA", "confidence_level": "3", "penetrance": null, "publications": [ "20301458", "8596916" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Friedreich ataxia MIM#229300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GAA", "chromosome": "9", "grch37_coordinates": [ 71652203, 71652220 ], "grch38_coordinates": [ 69037287, 69037304 ], "normal_repeats": 33, "pathogenic_repeats": 66, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } } ] }