Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=285
{ "count": 36035, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=286", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=284", "results": [ { "gene_data": { "alias": [ "ADTD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:568", "gene_name": "adaptor related protein complex 3 delta 1 subunit", "omim_gene": [ "607246" ], "alias_name": null, "gene_symbol": "AP3D1", "hgnc_symbol": "AP3D1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:2100988-2164464", "ensembl_id": "ENSG00000065000" } }, "GRch38": { "90": { "location": "19:2100988-2164465", "ensembl_id": "ENSG00000065000" } } }, "hgnc_date_symbol_changed": "2000-09-01" }, "entity_type": "gene", "entity_name": "AP3D1", "confidence_level": "2", "penetrance": "unknown", "mode_of_pathogenicity": null, "publications": [ "(PMID: 26744459", "30472485", "19032734", "36445457)" ], "evidence": [ "Expert Review Amber", "NHS GMS", "Literature", "Expert Review" ], "phenotypes": [ "Hermansky-Pudlak syndrome 10, MIM# 617050" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 37, "hash_id": null, "name": "Ocular and Oculocutaneous Albinism", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "1.16", "version_created": "2026-03-27T19:38:01.497264+11:00", "relevant_disorders": [ "Albinism HP:0001022; Ocular albinism", "HP:0001107" ], "stats": { "number_of_genes": 24, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1260", "NLGN", "HLNX" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14287", "gene_name": "neuroligin 4, X-linked", "omim_gene": [ "300427" ], "alias_name": null, "gene_symbol": "NLGN4X", "hgnc_symbol": "NLGN4X", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:5758678-6146904", "ensembl_id": "ENSG00000146938" } }, "GRch38": { "90": { "location": "X:5840637-6228863", "ensembl_id": "ENSG00000146938" } } }, "hgnc_date_symbol_changed": "2004-05-26" }, "entity_type": "gene", "entity_name": "NLGN4X", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID:26350204", "PMID:14963808", "PMID:12669065", "PMID:23352163", "PMID:28263302", "PMID:16648374" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Intellectual developmental disorder, X-linked - MIM#300495" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 51, "hash_id": null, "name": "Autism", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.248", "version_created": "2026-03-19T12:51:18.584438+11:00", "relevant_disorders": [ "Autism", "HP:0000717" ], "stats": { "number_of_genes": 157, "number_of_strs": 0, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FANCU" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12829", "gene_name": "X-ray repair cross complementing 2", "omim_gene": [ "600375" ], "alias_name": [ "RAD51-like" ], "gene_symbol": "XRCC2", "hgnc_symbol": "XRCC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:152341864-152373250", "ensembl_id": "ENSG00000196584" } }, "GRch38": { "90": { "location": "7:152644779-152676165", "ensembl_id": "ENSG00000196584" } } }, "hgnc_date_symbol_changed": "1995-02-07" }, "entity_type": "gene", "entity_name": "XRCC2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27208205", "22232082", "11118202" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Fanconi anemia, complementation group U, MIM# 617247" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 56, "hash_id": null, "name": "Bone Marrow Failure", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "Bone marrow failure (BMF) refers to the decreased production of one or more major haematopoietic lineages which leads to diminished or absent haematopoietic precursors in the bone marrow and attendant cytopaenias.\r\n\r\nThis panel was developed and is maintained by VCGS. It contains all the genes on the Peter MacCallum Bone Marrow Failure panel, as of 2/3/2020, and includes all the genes associated with telomere disorders (Dysterkeratosis Congenita).\r\n\r\nIt has been updated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.", "status": "public", "version": "1.141", "version_created": "2026-03-17T18:48:23.244194+11:00", "relevant_disorders": [ "Abnormality of multiple cell lineages of the bone marrow", "HP:0012145" ], "stats": { "number_of_genes": 151, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BIGM103" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20862", "gene_name": "solute carrier family 39 member 8", "omim_gene": [ "608732" ], "alias_name": null, "gene_symbol": "SLC39A8", "hgnc_symbol": "SLC39A8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:103172198-103352415", "ensembl_id": "ENSG00000138821" } }, "GRch38": { "90": { "location": "4:102251041-102431258", "ensembl_id": "ENSG00000138821" } } }, "hgnc_date_symbol_changed": "2003-10-08" }, "entity_type": "gene", "entity_name": "SLC39A8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26637978", "26637979" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Congenital disorder of glycosylation, type IIn , MIM#616721" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 68, "hash_id": null, "name": "Congenital Disorders of Glycosylation", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Congenital Disorders of Glycosylation' panel v2.4 with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.85", "version_created": "2026-04-02T10:46:27.496905+11:00", "relevant_disorders": [ "Abnormal transferrin saturation", "HP:0040135" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ44734", "IGF-II" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5466", "gene_name": "insulin like growth factor 2", "omim_gene": [ "147470" ], "alias_name": [ "somatomedin A", "preptin" ], "gene_symbol": "IGF2", "hgnc_symbol": "IGF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:2150342-2170833", "ensembl_id": "ENSG00000167244" } }, "GRch38": { "90": { "location": "11:2129112-2141238", "ensembl_id": "ENSG00000167244" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "IGF2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 31544945" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Silver-Russell syndrome 3 MIM#616489" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.534", "version_created": "2026-03-30T13:14:35.719896+11:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 253, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0944" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18661", "gene_name": "dynein axonemal heavy chain 7", "omim_gene": [ "610061" ], "alias_name": null, "gene_symbol": "DNAH7", "hgnc_symbol": "DNAH7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:196602427-196933536", "ensembl_id": "ENSG00000118997" } }, "GRch38": { "90": { "location": "2:195737703-196068812", "ensembl_id": "ENSG00000118997" } } }, "hgnc_date_symbol_changed": "2002-05-22" }, "entity_type": "gene", "entity_name": "DNAH7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34476482", "35543642" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Primary ciliary dyskinesia, MONDO:0016575, DNAH7-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 82, "hash_id": null, "name": "Ciliary Dyskinesia", "disease_group": "Respiratory disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It contains conditions caused by defects in the motile cilia, primarily those presenting with respiratory phenotypes. It also contains a small number of other genes that cause conditions with significant phenotypic overlap.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Respiratory Ciliopathies including non-CF bronchiectasis' panel V1.3, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.75", "version_created": "2026-03-30T10:17:46.701193+11:00", "relevant_disorders": [ "Ciliary dyskinesia HP:0012265;Recurrent respiratory infections HP:0002205" ], "stats": { "number_of_genes": 77, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LHRHR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4421", "gene_name": "gonadotropin releasing hormone receptor", "omim_gene": [ "138850" ], "alias_name": null, "gene_symbol": "GNRHR", "hgnc_symbol": "GNRHR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:68605046-68620078", "ensembl_id": "ENSG00000109163" } }, "GRch38": { "90": { "location": "4:67739328-67754360", "ensembl_id": "ENSG00000109163" } } }, "hgnc_date_symbol_changed": "1994-01-15" }, "entity_type": "gene", "entity_name": "GNRHR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28348023", "9371856" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hypogonadotropic hypogonadism 7 without anosmia, MIM#146110" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.47", "version_created": "2026-04-06T10:50:25.990411+10:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MASS", "OCTD", "SGS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3603", "gene_name": "fibrillin 1", "omim_gene": [ "134797" ], "alias_name": [ "Marfan syndrome", "asprosin" ], "gene_symbol": "FBN1", "hgnc_symbol": "FBN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:48700503-48938046", "ensembl_id": "ENSG00000166147" } }, "GRch38": { "90": { "location": "15:48408306-48645849", "ensembl_id": "ENSG00000166147" } } }, "hgnc_date_symbol_changed": "1987-09-11" }, "entity_type": "gene", "entity_name": "FBN1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23897642", "12525539" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Weill-Marchesani syndrome 2, dominant, MIM# 608328" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 105, "hash_id": null, "name": "Glaucoma congenital", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the Genomics England 'Glaucoma (developmental)' panel with all discrepancies resolved and reciprocal feedback provided to Genomics England, 7/8/2020.", "status": "public", "version": "1.12", "version_created": "2026-04-07T13:50:17.268940+10:00", "relevant_disorders": [ "Glaucoma", "HP:0000501" ], "stats": { "number_of_genes": 28, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11480", "gene_name": "supervillin", "omim_gene": [ "604126" ], "alias_name": [ "archvillin" ], "gene_symbol": "SVIL", "hgnc_symbol": "SVIL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:29746267-30025710", "ensembl_id": "ENSG00000197321" } }, "GRch38": { "90": { "location": "10:29457338-29736781", "ensembl_id": "ENSG00000197321" } } }, "hgnc_date_symbol_changed": "1998-05-07" }, "entity_type": "gene", "entity_name": "SVIL", "confidence_level": "2", "penetrance": "unknown", "mode_of_pathogenicity": null, "publications": [ "32779703" ], "evidence": [ "Literature", "Expert Review Amber" ], "phenotypes": [ "Myofibrillar myopathy, MIM#619040" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 111, "hash_id": null, "name": "Hypertrophic cardiomyopathy", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel contains genes associated with hypertrophic cardiomyopathy or isolated left ventricular hypertrophy (including sarcomere, sarcomere-associated and syndromic conditions), typically with onset in adolescence or adulthood. For early-onset hypertrophic cardiomyopathy, or in the presence of additional features suggestive of an underlying metabolic or syndromic disorder please consider the Cardiomyopathy_Paediatric panel. Where the type of cardiomyopathy is unclear, consider using the Cardiomyopathy Superpanel.\r\n\r\nThis panel was developed by VCGS and is maintained by VCGS and RMH. It has been compared against the Genomics England 'Hypertrophic Cardiomyopathy - teen and adult' panel and incorporates gene-disease validity assessments by the ClinGen HCM working group (PMID: 30681346), 5/8/2020 and Hereditary Cardiovascular Disorders Gene Curation Expert Panel (PMID: 39132495).", "status": "public", "version": "1.25", "version_created": "2026-03-11T18:45:28.302854+11:00", "relevant_disorders": [ "Hypertrophic cardiomyopathy", "HP:0001639" ], "stats": { "number_of_genes": 64, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "N-ras" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7989", "gene_name": "NRAS proto-oncogene, GTPase", "omim_gene": [ "164790" ], "alias_name": null, "gene_symbol": "NRAS", "hgnc_symbol": "NRAS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:115247090-115259515", "ensembl_id": "ENSG00000213281" } }, "GRch38": { "90": { "location": "1:114704469-114716894", "ensembl_id": "ENSG00000213281" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "NRAS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 116, "hash_id": null, "name": "Hydrops fetalis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared with the Genomics England 100K Genomes Fetal Hydrops panel. All discrepancies have been resolved by George McGillivray and Zornitza Stark (30/12/2019), with reciprocal reviews provided to Genomics England PanelApp.", "status": "public", "version": "0.328", "version_created": "2025-07-08T23:27:02.854141+10:00", "relevant_disorders": [ "Hydrops fetalis", "HP:0001789" ], "stats": { "number_of_genes": 169, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SHAPY", "SCAN-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19721", "gene_name": "calcium activated nucleotidase 1", "omim_gene": [ "613165" ], "alias_name": [ "Soluble Ca-Activated Nucleotidase, isozyme 1" ], "gene_symbol": "CANT1", "hgnc_symbol": "CANT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:76987799-77005949", "ensembl_id": "ENSG00000171302" } }, "GRch38": { "90": { "location": "17:78991717-79009867", "ensembl_id": "ENSG00000171302" } } }, "hgnc_date_symbol_changed": "2004-10-15" }, "entity_type": "gene", "entity_name": "CANT1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "21654728", "20358610" ], "evidence": [ "Expert Review Red", "Expert list" ], "phenotypes": [ "Desbuquois dysplasia 1, MIM#251450" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 116, "hash_id": null, "name": "Hydrops fetalis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared with the Genomics England 100K Genomes Fetal Hydrops panel. All discrepancies have been resolved by George McGillivray and Zornitza Stark (30/12/2019), with reciprocal reviews provided to Genomics England PanelApp.", "status": "public", "version": "0.328", "version_created": "2025-07-08T23:27:02.854141+10:00", "relevant_disorders": [ "Hydrops fetalis", "HP:0001789" ], "stats": { "number_of_genes": 169, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7128", "gene_name": "mutL homolog 3", "omim_gene": [ "604395" ], "alias_name": null, "gene_symbol": "MLH3", "hgnc_symbol": "MLH3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:75480467-75518235", "ensembl_id": "ENSG00000119684" } }, "GRch38": { "90": { "location": "14:75013764-75051532", "ensembl_id": "ENSG00000119684" } } }, "hgnc_date_symbol_changed": "2000-01-07" }, "entity_type": "gene", "entity_name": "MLH3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [ "cancer" ], "panel": { "id": 126, "hash_id": null, "name": "Incidentalome", "disease_group": "", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with adult-onset cardiac, cancer and neurodegenerative disorders.\r\n\r\nThese genes are excluded from the Mendeliome panel to enable the use of the Mendeliome for panel-agnostic analysis in complex paediatric cases, while minimising the chance of incidental findings related to adult-onset conditions.\r\n\r\nIf analysis of these genes is required, the relevant panel should be requested (e.g. Adult Additional Findings; Neurodegenerative Disease_Adult Onset; Breast Cancer etc).", "status": "public", "version": "0.433", "version_created": "2026-03-25T17:03:27.624542+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 161, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DRE1", "FLJ20059" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25947", "gene_name": "kelch like family member 24", "omim_gene": [ "611295" ], "alias_name": null, "gene_symbol": "KLHL24", "hgnc_symbol": "KLHL24", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:183353356-183402265", "ensembl_id": "ENSG00000114796" } }, "GRch38": { "90": { "location": "3:183635568-183684477", "ensembl_id": "ENSG00000114796" } } }, "hgnc_date_symbol_changed": "2005-09-10" }, "entity_type": "gene", "entity_name": "KLHL24", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29779254", "30120936", "30715372" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Epidermolysis bullosa simplex 6, generalized intermediate, with or without cardiomyopathy MIM# 617294", "Cardiomyopathy, familial hypertrophic, 29, with polyglucosan bodies, MIM#\t620236" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FFM", "ARMD2", "CORD3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:34", "gene_name": "ATP binding cassette subfamily A member 4", "omim_gene": [ "601691" ], "alias_name": [ "Stargardt disease" ], "gene_symbol": "ABCA4", "hgnc_symbol": "ABCA4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:94458393-94586688", "ensembl_id": "ENSG00000198691" } }, "GRch38": { "90": { "location": "1:93992835-94121132", "ensembl_id": "ENSG00000198691" } } }, "hgnc_date_symbol_changed": "1994-07-14" }, "entity_type": "gene", "entity_name": "ABCA4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9054934", "30480703", "29847635", "29971439", "16103129", "30643219" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cone-rod dystrophy 3, 604116", "Fundus flavimaculatus, 248200", "Retinal dystrophy, early-onset severe, 248200", "Retinitis pigmentosa 19, 601718", "Stargardt disease 1, 248200" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "deep intronic" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:27288", "gene_name": "acyl-CoA synthetase family member 3", "omim_gene": [ "614245" ], "alias_name": [ "malonyl-CoA synthetase" ], "gene_symbol": "ACSF3", "hgnc_symbol": "ACSF3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:89154783-89222254", "ensembl_id": "ENSG00000176715" } }, "GRch38": { "90": { "location": "16:89088375-89155846", "ensembl_id": "ENSG00000176715" } } }, "hgnc_date_symbol_changed": "2007-10-17" }, "entity_type": "gene", "entity_name": "ACSF3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21841779", "30740739" ], "evidence": [ "Expert Review Amber", "NHS GMS", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Combined malonic and methylmalonic aciduria MIM#614265" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FALDH" ], "biotype": "protein_coding", "hgnc_id": "HGNC:403", "gene_name": "aldehyde dehydrogenase 3 family member A2", "omim_gene": [ "609523" ], "alias_name": [ "fatty aldehyde dehydrogenase" ], "gene_symbol": "ALDH3A2", "hgnc_symbol": "ALDH3A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:19551449-19580911", "ensembl_id": "ENSG00000072210" } }, "GRch38": { "90": { "location": "17:19648136-19677598", "ensembl_id": "ENSG00000072210" } } }, "hgnc_date_symbol_changed": "1996-06-14" }, "entity_type": "gene", "entity_name": "ALDH3A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31273323" ], "evidence": [ "Expert Review Green", "NHS GMS", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Sjogren-Larsson syndrome MIM#270200", "spasticity", "ichthyosis", "intellectual disability" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TAPA-1", "TSPAN28" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1701", "gene_name": "CD81 molecule", "omim_gene": [ "186845" ], "alias_name": null, "gene_symbol": "CD81", "hgnc_symbol": "CD81", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:2397407-2418649", "ensembl_id": "ENSG00000110651" } }, "GRch38": { "90": { "location": "11:2376177-2397419", "ensembl_id": "ENSG00000110651" } } }, "hgnc_date_symbol_changed": "1992-10-21" }, "entity_type": "gene", "entity_name": "CD81", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20237408", "35849269" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Immunodeficiency, common variable, 6, MIM# 613496" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:1706", "gene_name": "CD8a molecule", "omim_gene": [ "186910" ], "alias_name": null, "gene_symbol": "CD8A", "hgnc_symbol": "CD8A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:87011729-87035519", "ensembl_id": "ENSG00000153563" } }, "GRch38": { "90": { "location": "2:86784610-86808396", "ensembl_id": "ENSG00000153563" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "CD8A", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11435463", "17658607", "26563160" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "CD8 deficiency, familial, MIM# 608957" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4796", "gene_name": "3-hydroxyanthranilate 3,4-dioxygenase", "omim_gene": [ "604521" ], "alias_name": null, "gene_symbol": "HAAO", "hgnc_symbol": "HAAO", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:42994229-43019733", "ensembl_id": "ENSG00000162882" } }, "GRch38": { "90": { "location": "2:42767089-42792593", "ensembl_id": "ENSG00000162882" } } }, "hgnc_date_symbol_changed": "1999-12-14" }, "entity_type": "gene", "entity_name": "HAAO", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28792876" ], "evidence": [ "Expert Review Green", "NHS GMS", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Vertebral, cardiac, renal, and limb defects syndrome 1 MIM#617660", "NAD deficiency" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MRP-S22", "GK002", "C3orf5", "GIBT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14508", "gene_name": "mitochondrial ribosomal protein S22", "omim_gene": [ "605810" ], "alias_name": null, "gene_symbol": "MRPS22", "hgnc_symbol": "MRPS22", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:138724648-139076065", "ensembl_id": "ENSG00000175110" } }, "GRch38": { "90": { "location": "3:139005806-139357223", "ensembl_id": "ENSG00000175110" } } }, "hgnc_date_symbol_changed": "2001-01-26" }, "entity_type": "gene", "entity_name": "MRPS22", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29566152" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Combined oxidative phosphorylation deficiency 5 MIM#611719", "Ovarian dysgenesis 7 MIM#618117" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PTS1R" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9719", "gene_name": "peroxisomal biogenesis factor 5", "omim_gene": [ "600414" ], "alias_name": [ "peroxisomal targeting signal 1 receptor", "peroxisomal import receptor 5" ], "gene_symbol": "PEX5", "hgnc_symbol": "PEX5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:7341281-7371170", "ensembl_id": "ENSG00000139197" } }, "GRch38": { "90": { "location": "12:7188685-7218574", "ensembl_id": "ENSG00000139197" } } }, "hgnc_date_symbol_changed": "2004-03-19" }, "entity_type": "gene", "entity_name": "PEX5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "7719337", "26220973", "20301621" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Peroxisome biogenesis disorder 2A (Zellweger), MIM# 214110", "Peroxisome biogenesis disorder 2B, MIM# 202370", "Rhizomelic chondrodysplasia punctata, type 5, MIM# 616716" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC2793" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28423", "gene_name": "SH3 and cysteine rich domain 3", "omim_gene": [ "615521" ], "alias_name": null, "gene_symbol": "STAC3", "hgnc_symbol": "STAC3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:57637236-57644976", "ensembl_id": "ENSG00000185482" } }, "GRch38": { "90": { "location": "12:57243453-57251193", "ensembl_id": "ENSG00000185482" } } }, "hgnc_date_symbol_changed": "2004-05-19" }, "entity_type": "gene", "entity_name": "STAC3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23736855", "28411587", "28777491", "30168660", "32898259" ], "evidence": [ "Expert Review Green", "Expert list", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Myopathy, congenital, Baily-Bloch, MIM# 255995" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "founder" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1066", "JSAP1", "JIP3", "syd" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6884", "gene_name": "mitogen-activated protein kinase 8 interacting protein 3", "omim_gene": [ "605431" ], "alias_name": [ "homolog of Drosophila Sunday driver 2" ], "gene_symbol": "MAPK8IP3", "hgnc_symbol": "MAPK8IP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:1756184-1820318", "ensembl_id": "ENSG00000138834" } }, "GRch38": { "90": { "location": "16:1706183-1770317", "ensembl_id": "ENSG00000138834" } } }, "hgnc_date_symbol_changed": "2000-08-22" }, "entity_type": "gene", "entity_name": "MAPK8IP3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30612693", "30945334", "37462082" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "IP3KB", "IP3-3KB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6179", "gene_name": "inositol-trisphosphate 3-kinase B", "omim_gene": [ "147522" ], "alias_name": null, "gene_symbol": "ITPKB", "hgnc_symbol": "ITPKB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:226819391-226927024", "ensembl_id": "ENSG00000143772" } }, "GRch38": { "90": { "location": "1:226631690-226739323", "ensembl_id": "ENSG00000143772" } } }, "hgnc_date_symbol_changed": "1992-04-15" }, "entity_type": "gene", "entity_name": "ITPKB", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31987846" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Severe combined immunodeficiency MONDO:0015974, absent T cells, present B cells and NK cells" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA1172", "DKFZp434E098", "SRA4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19304", "gene_name": "SR-related CTD associated factor 4", "omim_gene": [ "616023" ], "alias_name": null, "gene_symbol": "SCAF4", "hgnc_symbol": "SCAF4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:33043346-33104388", "ensembl_id": "ENSG00000156304" } }, "GRch38": { "90": { "location": "21:31671033-31732075", "ensembl_id": "ENSG00000156304" } } }, "hgnc_date_symbol_changed": "2011-01-10" }, "entity_type": "gene", "entity_name": "SCAF4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32730804" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Fliedner-Zweier syndrome, MIM#620511" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PRO2249", "CNA43", "DNA43" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18043", "gene_name": "minichromosome maintenance 10 replication initiation factor", "omim_gene": [ "609357" ], "alias_name": null, "gene_symbol": "MCM10", "hgnc_symbol": "MCM10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:13203554-13253104", "ensembl_id": "ENSG00000065328" } }, "GRch38": { "90": { "location": "10:13161554-13211104", "ensembl_id": "ENSG00000065328" } } }, "hgnc_date_symbol_changed": "2002-01-22" }, "entity_type": "gene", "entity_name": "MCM10", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32865517", "33712616" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Immunodeficiency-80 with or without congenital cardiomyopathy (IMD80), MIM#619313", "Susceptibility to CMV", "Restrictive cardiomyopathy" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0929", "MINT", "SHARP", "RBM15C" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17575", "gene_name": "spen family transcriptional repressor", "omim_gene": [ "613484" ], "alias_name": null, "gene_symbol": "SPEN", "hgnc_symbol": "SPEN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:16174359-16266955", "ensembl_id": "ENSG00000065526" } }, "GRch38": { "90": { "location": "1:15847864-15940460", "ensembl_id": "ENSG00000065526" } } }, "hgnc_date_symbol_changed": "2004-12-13" }, "entity_type": "gene", "entity_name": "SPEN", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33057194", "33596411" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Radio-Tartaglia syndrome, MIM# 619312", "Intellectual disability", "autism", "congenital anomalies" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "bA50D16.2", "FLJ12661" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20291", "gene_name": "proline and serine rich 1", "omim_gene": null, "alias_name": null, "gene_symbol": "PROSER1", "hgnc_symbol": "PROSER1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:39584003-39612252", "ensembl_id": "ENSG00000120685" } }, "GRch38": { "90": { "location": "13:39009866-39038076", "ensembl_id": "ENSG00000120685" } } }, "hgnc_date_symbol_changed": "2011-08-09" }, "entity_type": "gene", "entity_name": "PROSER1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35229282" ], "evidence": [ "Expert Review Red", "Expert Review" ], "phenotypes": [ "Syndromic disease MONDO:0002254, PROSER1-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "founder" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "L-SOX5", "MGC35153" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11201", "gene_name": "SRY-box 5", "omim_gene": [ "604975" ], "alias_name": null, "gene_symbol": "SOX5", "hgnc_symbol": "SOX5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:23682440-24103966", "ensembl_id": "ENSG00000134532" } }, "GRch38": { "90": { "location": "12:23529500-23951032", "ensembl_id": "ENSG00000134532" } } }, "hgnc_date_symbol_changed": "1997-07-07" }, "entity_type": "gene", "entity_name": "SOX5", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 36861937" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Lamb-Shaffer syndrome, MIM#616803" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.427", "version_created": "2026-04-02T17:28:09.565635+11:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 383, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AIP1", "ARIP1", "KIAA0705", "ACVRIP1", "MAGI-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18957", "gene_name": "membrane associated guanylate kinase, WW and PDZ domain containing 2", "omim_gene": [ "606382" ], "alias_name": null, "gene_symbol": "MAGI2", "hgnc_symbol": "MAGI2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:77646393-79082890", "ensembl_id": "ENSG00000187391" } }, "GRch38": { "90": { "location": "7:78017057-79453574", "ensembl_id": "ENSG00000187391" } } }, "hgnc_date_symbol_changed": "2005-05-10" }, "entity_type": "gene", "entity_name": "MAGI2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27932480", "25108225", "25271328", "31171376", "31010479" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Nephrotic syndrome, type 15, MIM# 617609" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 144, "hash_id": null, "name": "Proteinuria", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "To be used in individuals with suspected nephrotic syndrome and related conditions, part of the Renal Glomerular Disease Superpanel.\r\n\r\n09/01/2020: This panel has been compared with the Genomics England PanelApp Proteinuric Renal Disease panel and all discrepancies have been reviewed and resolved by Chirag Patel and Zornitza Stark, with reciprocal reviews provided to Genomics England.", "status": "public", "version": "0.239", "version_created": "2026-03-12T18:51:41.043263+11:00", "relevant_disorders": [ "Proteinuria HP:0000093" ], "stats": { "number_of_genes": 88, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3661", "gene_name": "fibrinogen alpha chain", "omim_gene": [ "134820" ], "alias_name": null, "gene_symbol": "FGA", "hgnc_symbol": "FGA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:155504278-155511918", "ensembl_id": "ENSG00000171560" } }, "GRch38": { "90": { "location": "4:154583126-154590766", "ensembl_id": "ENSG00000171560" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "FGA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "PubMed: 8097946", "8639778", "12050338", "31064749", "17295221", "19073821", "11739173" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Amyloidosis, familial visceral, MIM#105200" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 191, "hash_id": null, "name": "Amyloidosis", "disease_group": "", "disease_sub_group": "", "description": "This panel contains genes that cause amyloidosis, characterised by a buildup of abnormal amyloid deposits in the heart, brain, kidneys, spleen and other parts of the body.\r\n\r\nThe panel was originally named \"Renal Amyloidosis\" and was developed by the KidGen Collaborative. It is also a consensus panel used by VCGS and RMH.", "status": "public", "version": "1.1", "version_created": "2025-07-04T20:21:06.835536+10:00", "relevant_disorders": [ "Renal amyloidosis", "HP:0001917; Amyloidosis", "HP:0011034" ], "stats": { "number_of_genes": 11, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZP434G145" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18654", "gene_name": "rotatin", "omim_gene": [ "610436" ], "alias_name": null, "gene_symbol": "RTTN", "hgnc_symbol": "RTTN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:67671029-67873181", "ensembl_id": "ENSG00000176225" } }, "GRch38": { "90": { "location": "18:70003031-70205945", "ensembl_id": "ENSG00000176225" } } }, "hgnc_date_symbol_changed": "2002-07-11" }, "entity_type": "gene", "entity_name": "RTTN", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30879067" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship" ], "phenotypes": [ "Microcephaly, short stature, and polymicrogyria with seizures, MIM# 614833" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3341", "gene_name": "empty spiracles homeobox 2", "omim_gene": [ "600035" ], "alias_name": null, "gene_symbol": "EMX2", "hgnc_symbol": "EMX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:119301955-119309056", "ensembl_id": "ENSG00000170370" } }, "GRch38": { "90": { "location": "10:117542444-117549546", "ensembl_id": "ENSG00000170370" } } }, "hgnc_date_symbol_changed": "1994-02-08" }, "entity_type": "gene", "entity_name": "EMX2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8528262", "9359037", "9153481", "9153481", "18409201" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship" ], "phenotypes": [ "Schizencephaly, MIM# 269160" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "disputed" ], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:28957", "gene_name": "ER membrane protein complex subunit 1", "omim_gene": [ "616846" ], "alias_name": null, "gene_symbol": "EMC1", "hgnc_symbol": "EMC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:19542158-19578046", "ensembl_id": "ENSG00000127463" } }, "GRch38": { "90": { "location": "1:19215664-19251552", "ensembl_id": "ENSG00000127463" } } }, "hgnc_date_symbol_changed": "2012-05-23" }, "entity_type": "gene", "entity_name": "EMC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35234901", "26942288" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, EMC1-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MEK2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6842", "gene_name": "mitogen-activated protein kinase kinase 2", "omim_gene": [ "601263" ], "alias_name": null, "gene_symbol": "MAP2K2", "hgnc_symbol": "MAP2K2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:4090319-4124126", "ensembl_id": "ENSG00000126934" } }, "GRch38": { "90": { "location": "19:4090321-4124129", "ensembl_id": "ENSG00000126934" } } }, "hgnc_date_symbol_changed": "1993-11-05" }, "entity_type": "gene", "entity_name": "MAP2K2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Hek5", "Tyro5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3393", "gene_name": "EPH receptor B2", "omim_gene": [ "600997" ], "alias_name": null, "gene_symbol": "EPHB2", "hgnc_symbol": "EPHB2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:23037332-23241818", "ensembl_id": "ENSG00000133216" } }, "GRch38": { "90": { "location": "1:22710839-22921500", "ensembl_id": "ENSG00000133216" } } }, "hgnc_date_symbol_changed": "1995-05-09" }, "entity_type": "gene", "entity_name": "EPHB2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26148571" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AQDQ", "CI-18" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7711", "gene_name": "NADH:ubiquinone oxidoreductase subunit S4", "omim_gene": [ "602694" ], "alias_name": [ "complex I 18kDa subunit" ], "gene_symbol": "NDUFS4", "hgnc_symbol": "NDUFS4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:52856463-52979168", "ensembl_id": "ENSG00000164258" } }, "GRch38": { "90": { "location": "5:53560633-53683340", "ensembl_id": "ENSG00000164258" } } }, "hgnc_date_symbol_changed": "1995-11-08" }, "entity_type": "gene", "entity_name": "NDUFS4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "trnV" ], "biotype": "Mt_tRNA", "hgnc_id": "HGNC:7500", "gene_name": "mitochondrially encoded tRNA valine", "omim_gene": [ "590105" ], "alias_name": null, "gene_symbol": "MT-TV", "hgnc_symbol": "MT-TV", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "MT:1602-1670", "ensembl_id": "ENSG00000210077" } }, "GRch38": { "90": { "location": "MT:1602-1670", "ensembl_id": "ENSG00000210077" } } }, "hgnc_date_symbol_changed": "2005-02-16" }, "entity_type": "gene", "entity_name": "MT-TV", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "9450773", "12056939", "19252805", "15320572", "18314141", "24691472", "39468830" ], "evidence": [ "Expert Review Green", "Expert list", "Expert list" ], "phenotypes": [ "Mitochondrial disease (MONDO:0044970), MT-TV-related" ], "mode_of_inheritance": "MITOCHONDRIAL", "tags": [ "mtDNA" ], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:1246", "gene_name": "complement C1r", "omim_gene": [ "613785" ], "alias_name": null, "gene_symbol": "C1R", "hgnc_symbol": "C1R", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:7187513-7245203", "ensembl_id": "ENSG00000159403" } }, "GRch38": { "90": { "location": "12:7080209-7092607", "ensembl_id": "ENSG00000159403" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "C1R", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 224, "hash_id": null, "name": "Complement Deficiencies", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains all the genes that are associated with complement deficiencies.\r\n\r\nIt has been updated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.2", "version_created": "2025-10-30T13:50:05.331358+11:00", "relevant_disorders": [ "Abnormality of complement system", "HP:0005339" ], "stats": { "number_of_genes": 34, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "L-JAK", "JAKL", "LJAK", "JAK3_HUMAN", "JAK-3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6193", "gene_name": "Janus kinase 3", "omim_gene": [ "600173" ], "alias_name": [ "tyrosine-protein kinase JAK3", "leukocyte Janus kinase" ], "gene_symbol": "JAK3", "hgnc_symbol": "JAK3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:17935589-17958880", "ensembl_id": "ENSG00000105639" } }, "GRch38": { "90": { "location": "19:17824780-17848071", "ensembl_id": "ENSG00000105639" } } }, "hgnc_date_symbol_changed": "1994-12-19" }, "entity_type": "gene", "entity_name": "JAK3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "14615376", "11668610" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "SCID, autosomal recessive, T-negative/B-positive type MIM# 600802" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 235, "hash_id": null, "name": "Severe Combined Immunodeficiency", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with severe combined immunodeficiency (SCID), including the following:\r\n- SCID with absent T present B cells\r\n- SCID with absent T absent B cells\r\n\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.30", "version_created": "2026-03-02T10:27:29.970169+11:00", "relevant_disorders": [ "Severe combined immunodeficiency", "HP:0004430" ], "stats": { "number_of_genes": 28, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DNMAP1", "FLJ11543", "KIAA1425", "DNMTAP1", "EAF2", "MEAF2", "SWC4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18291", "gene_name": "DNA methyltransferase 1 associated protein 1", "omim_gene": [ "605077" ], "alias_name": null, "gene_symbol": "DMAP1", "hgnc_symbol": "DMAP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:44679127-44686353", "ensembl_id": "ENSG00000178028" } }, "GRch38": { "90": { "location": "1:44213455-44220681", "ensembl_id": "ENSG00000178028" } } }, "hgnc_date_symbol_changed": "2003-03-12" }, "entity_type": "gene", "entity_name": "DMAP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Other" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, DMAP1-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "mtMetRS", "SPAX3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25133", "gene_name": "methionyl-tRNA synthetase 2, mitochondrial", "omim_gene": [ "609728" ], "alias_name": [ "methionine tRNA ligase 2, mitochondrial" ], "gene_symbol": "MARS2", "hgnc_symbol": "MARS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:198570087-198573113", "ensembl_id": "ENSG00000247626" } }, "GRch38": { "90": { "location": "2:197705369-197708387", "ensembl_id": "ENSG00000247626" } } }, "hgnc_date_symbol_changed": "2004-12-02" }, "entity_type": "gene", "entity_name": "MARS2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "PMID: 25754315" ], "evidence": [ "Expert Review Red", "Expert list" ], "phenotypes": [ "?Combined oxidative phosphorylation deficiency 25, OMIM #616430", "Spastic ataxia 3, autosomal recessive, OMIM #611390" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GRIPE", "DKFZp667F074", "KIAA0884", "Tulip1", "RalGAPalpha1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17770", "gene_name": "Ral GTPase activating protein catalytic alpha subunit 1", "omim_gene": [ "608884" ], "alias_name": [ "tuberin-like protein 1", "GAP-related interacting protein to E12" ], "gene_symbol": "RALGAPA1", "hgnc_symbol": "RALGAPA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:36007558-36278510", "ensembl_id": "ENSG00000174373" } }, "GRch38": { "90": { "location": "14:35538352-35809304", "ensembl_id": "ENSG00000174373" } } }, "hgnc_date_symbol_changed": "2009-09-09" }, "entity_type": "gene", "entity_name": "RALGAPA1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32004447" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with hypotonia, neonatal respiratory insufficiency, and thermodysregulation MIM#618797" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:37216", "gene_name": "lipoyl(octanoyl) transferase 2", "omim_gene": [ "617659" ], "alias_name": null, "gene_symbol": "LIPT2", "hgnc_symbol": "LIPT2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:74202757-74204778", "ensembl_id": "ENSG00000175536" } }, "GRch38": { "90": { "location": "11:74491712-74493733", "ensembl_id": "ENSG00000175536" } } }, "hgnc_date_symbol_changed": "2009-09-09" }, "entity_type": "gene", "entity_name": "LIPT2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "28757203" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM#617668" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "Cka1", "Cka2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2457", "gene_name": "casein kinase 2 alpha 1", "omim_gene": [ "115440" ], "alias_name": null, "gene_symbol": "CSNK2A1", "hgnc_symbol": "CSNK2A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:459116-524465", "ensembl_id": "ENSG00000101266" } }, "GRch38": { "90": { "location": "20:473591-543821", "ensembl_id": "ENSG00000101266" } } }, "hgnc_date_symbol_changed": "1992-02-13" }, "entity_type": "gene", "entity_name": "CSNK2A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27048600", "29240241", "29383814" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Okur-Chung neurodevelopmental syndrome, MIM# 617062" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "msk" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11142", "gene_name": "salt inducible kinase 1", "omim_gene": [ "605705" ], "alias_name": [ "myocardial SNF1-like kinase" ], "gene_symbol": "SIK1", "hgnc_symbol": "SIK1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:44834395-44847008", "ensembl_id": "ENSG00000142178" } }, "GRch38": { "90": { "location": "21:43414515-43427128", "ensembl_id": "ENSG00000142178" } } }, "hgnc_date_symbol_changed": "2008-12-23" }, "entity_type": "gene", "entity_name": "SIK1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25839329", "27966542", "35267137" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Developmental and epileptic encephalopathy 30, MIM#616341", "developmental and epileptic encephalopathy, MONDO#0100062" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:8590", "gene_name": "p21 (RAC1) activated kinase 1", "omim_gene": [ "602590" ], "alias_name": [ "STE20 homolog, yeast" ], "gene_symbol": "PAK1", "hgnc_symbol": "PAK1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:77032752-77185680", "ensembl_id": "ENSG00000149269" } }, "GRch38": { "90": { "location": "11:77321707-77474635", "ensembl_id": "ENSG00000149269" } } }, "hgnc_date_symbol_changed": "1997-12-05" }, "entity_type": "gene", "entity_name": "PAK1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 31504246", "30290153" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Intellectual developmental disorder with macrocephaly, seizures, and speech delay", "OMIM #618158" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SDR38C1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11257", "gene_name": "sepiapterin reductase", "omim_gene": [ "182125" ], "alias_name": [ "short chain dehydrogenase/reductase family 38C, member 1", "Sepiapterin reductase (L-erythro-7,8-dihydrobiopterin forming)" ], "gene_symbol": "SPR", "hgnc_symbol": "SPR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:73114489-73119287", "ensembl_id": "ENSG00000116096" } }, "GRch38": { "90": { "location": "2:72887360-72892158", "ensembl_id": "ENSG00000116096" } } }, "hgnc_date_symbol_changed": "1991-12-05" }, "entity_type": "gene", "entity_name": "SPR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29302074", "16049044", "17188538" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0288", "HDAC-A", "HDACA", "HD4", "HA6116", "HDAC-4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14063", "gene_name": "histone deacetylase 4", "omim_gene": [ "605314" ], "alias_name": null, "gene_symbol": "HDAC4", "hgnc_symbol": "HDAC4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:239969864-240323348", "ensembl_id": "ENSG00000068024" } }, "GRch38": { "90": { "location": "2:239048168-239401654", "ensembl_id": "ENSG00000068024" } } }, "hgnc_date_symbol_changed": "2000-11-28" }, "entity_type": "gene", "entity_name": "HDAC4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24715439", "20691407", "31209962", "33537682" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Neurodevelopmental disorder with central hypotonia and dysmorphic facies MIM#619797", "Brachydactyly mental retardation syndrome", "Brachydactyly without intellectual disability" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ORCAM", "CDO", "CDON1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17104", "gene_name": "cell adhesion associated, oncogene regulated", "omim_gene": [ "608707" ], "alias_name": [ "cell adhesion molecule-related/down-regulated by oncogenes" ], "gene_symbol": "CDON", "hgnc_symbol": "CDON", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:125825691-125933230", "ensembl_id": "ENSG00000064309" } }, "GRch38": { "90": { "location": "11:125955796-126063335", "ensembl_id": "ENSG00000064309" } } }, "hgnc_date_symbol_changed": "2001-11-02" }, "entity_type": "gene", "entity_name": "CDON", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21802063", "26728615", "31502381", "32729136", "26529631" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "holoprosencephaly 11 MONDO:0013642" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "XH2", "XNP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:886", "gene_name": "ATRX, chromatin remodeler", "omim_gene": [ "300032", "300504" ], "alias_name": [ "RAD54 homolog (S. cerevisiae)" ], "gene_symbol": "ATRX", "hgnc_symbol": "ATRX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:76760356-77041702", "ensembl_id": "ENSG00000085224" } }, "GRch38": { "90": { "location": "X:77504878-77786269", "ensembl_id": "ENSG00000085224" } } }, "hgnc_date_symbol_changed": "1992-11-27" }, "entity_type": "gene", "entity_name": "ATRX", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "ATR-X-related syndrome MONDO:0016980" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RPC1", "RPC155", "hRPC155" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30074", "gene_name": "RNA polymerase III subunit A", "omim_gene": [ "614258" ], "alias_name": null, "gene_symbol": "POLR3A", "hgnc_symbol": "POLR3A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:79734907-79789303", "ensembl_id": "ENSG00000148606" } }, "GRch38": { "90": { "location": "10:77969251-78029545", "ensembl_id": "ENSG00000148606" } } }, "hgnc_date_symbol_changed": "2004-09-16" }, "entity_type": "gene", "entity_name": "POLR3A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital", "Victorian Clinical Genetics Services" ], "phenotypes": [ "POLR3A-related disorder MONDO:0700276" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SNAP190", "PTFalpha", "FLJ13451" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11137", "gene_name": "small nuclear RNA activating complex polypeptide 4", "omim_gene": [ "602777" ], "alias_name": null, "gene_symbol": "SNAPC4", "hgnc_symbol": "SNAPC4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:139270029-139293249", "ensembl_id": "ENSG00000165684" } }, "GRch38": { "90": { "location": "9:136375577-136400168", "ensembl_id": "ENSG00000165684" } } }, "hgnc_date_symbol_changed": "1998-02-17" }, "entity_type": "gene", "entity_name": "SNAPC4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "36965478" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with motor regression, progressive spastic paraplegia, and oromotor dysfunction, MIM# 620515" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AP19", "SIGMA1A", "WUGSC:H_DJ0747G18.2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:559", "gene_name": "adaptor related protein complex 1 sigma 1 subunit", "omim_gene": [ "603531" ], "alias_name": [ "clathrin-associated/assembly/adaptor protein, small 1 (19kD)", "clathrin coat assembly protein AP19", "sigma1A subunit of AP-1 clathrin adaptor complex", "AP-1 complex subunit sigma-1A", "sigma1A-adaptin", "golgi adaptor HA1/AP1 adaptin sigma-1A subunit", "clathrin assembly protein complex 1 sigma-1A small chain", "HA1 19 kDa subunit" ], "gene_symbol": "AP1S1", "hgnc_symbol": "AP1S1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:100797678-100804877", "ensembl_id": "ENSG00000106367" } }, "GRch38": { "90": { "location": "7:101154397-101161596", "ensembl_id": "ENSG00000106367" } } }, "hgnc_date_symbol_changed": "2000-09-01" }, "entity_type": "gene", "entity_name": "AP1S1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30244301", "23423674" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "MEDNIK Syndrome (MONDO:0012251, MIM#609313)", "Congenital-onset, Mental retardation, Enteropathy (severe congenital diarrhoea), Deafness, sensory-motor Neuropathy with intermediate conduction velocities, Ichthyosis, Keratoderma" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "beta1-4GalNAc-T" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4117", "gene_name": "beta-1,4-N-acetyl-galactosaminyltransferase 1", "omim_gene": [ "601873" ], "alias_name": [ "GD2 synthase, GM2 synthase" ], "gene_symbol": "B4GALNT1", "hgnc_symbol": "B4GALNT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:58017193-58027138", "ensembl_id": "ENSG00000135454" } }, "GRch38": { "90": { "location": "12:57623410-57633355", "ensembl_id": "ENSG00000135454" } } }, "hgnc_date_symbol_changed": "2006-01-08" }, "entity_type": "gene", "entity_name": "B4GALNT1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20301682", "23746551" ], "evidence": [ "Expert Review Amber", "Royal Melbourne Hospital" ], "phenotypes": [ "Spastic paraplegia 26, autosomal recessive (MIM#609195", "MONDO:0012213)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC16471", "DKFZp434E0519" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25187", "gene_name": "TAM41 mitochondrial translocator assembly and maintenance homolog", "omim_gene": [ "614948" ], "alias_name": null, "gene_symbol": "TAMM41", "hgnc_symbol": "TAMM41", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:11831916-11888393", "ensembl_id": "ENSG00000144559" } }, "GRch38": { "90": { "location": "3:11790442-11846919", "ensembl_id": "ENSG00000144559" } } }, "hgnc_date_symbol_changed": "2011-08-09" }, "entity_type": "gene", "entity_name": "TAMM41", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35321494", "29253589" ], "evidence": [ "Expert Review Green", "Other", "Expert Review Green", "Literature" ], "phenotypes": [ "Combined oxidative phosphorylation deficiency-56 (COXPD56), MIM#620139" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3084, "hash_id": null, "name": "Rhabdomyolysis and Metabolic Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where rhabdomyolysis, exercise intolerance, and metabolic myopathy are a presenting or prominent feature. It was developed and maintained by the Royal Melbourne Hospital. It is a consensus panel used by VCGS.\r\n\r\nDepending on the clinical features present, consider applying additional panels such as Mitochondrial Disorders or the Myopathy Superpanel.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Rhabdomyolysis and metabolic muscle disorders' panel V1.42 on 8/10/2020, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.46", "version_created": "2026-03-31T19:05:14.301918+11:00", "relevant_disorders": [ "Rhabdomyolysis", "HP:0003201;Exercise intolerance", "HP:0003546;Metabolic myopathy", "MONDO:0020123" ], "stats": { "number_of_genes": 124, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ZCW3", "KIAA0852", "AC004542.C22.1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23573", "gene_name": "MORC family CW-type zinc finger 2", "omim_gene": [ "616661" ], "alias_name": null, "gene_symbol": "MORC2", "hgnc_symbol": "MORC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:31321117-31364284", "ensembl_id": "ENSG00000133422" } }, "GRch38": { "90": { "location": "22:30925130-30968298", "ensembl_id": "ENSG00000133422" } } }, "hgnc_date_symbol_changed": "2005-06-15" }, "entity_type": "gene", "entity_name": "MORC2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32693025" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3099, "hash_id": null, "name": "Syndromic Retinopathy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause retinopathy with at least one other consistent extra-ocular feature, forming a syndrome. The panel does NOT include the Bardet-Biedl syndrome, Stickler syndrome, and Usher syndrome genes, which have their own panels and are part of the Retinal Disorders Superpanel.\r\n\r\nConsider using the panel Retinal Disorders Superpanel when ophthalmological findings are not specific for a sub-group of disorders, particularly in individuals early in the diagnostic trajectory or if a dual diagnosis is a possibility.", "status": "public", "version": "0.256", "version_created": "2026-03-31T19:05:29.271183+11:00", "relevant_disorders": [ "Retinopathy", "HP:0000488" ], "stats": { "number_of_genes": 138, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "gs114", "KIAA0590" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29077", "gene_name": "intraflagellar transport 140", "omim_gene": [ "614620" ], "alias_name": null, "gene_symbol": "IFT140", "hgnc_symbol": "IFT140", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:1560428-1662111", "ensembl_id": "ENSG00000187535" } }, "GRch38": { "90": { "location": "16:1510427-1612110", "ensembl_id": "ENSG00000187535" } } }, "hgnc_date_symbol_changed": "2005-11-02" }, "entity_type": "gene", "entity_name": "IFT140", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Short-rib thoracic dysplasia 9 with or without polydactyly, 266920 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:1242", "gene_name": "complement C1q B chain", "omim_gene": [ "120570" ], "alias_name": null, "gene_symbol": "C1QB", "hgnc_symbol": "C1QB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:22979255-22988031", "ensembl_id": "ENSG00000173369" } }, "GRch38": { "90": { "location": "1:22652762-22661538", "ensembl_id": "ENSG00000173369" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "C1QB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "C1q deficiency, 613652 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CDHP", "PCAD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1762", "gene_name": "cadherin 3", "omim_gene": [ "114021" ], "alias_name": [ "P-cadherin" ], "gene_symbol": "CDH3", "hgnc_symbol": "CDH3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:68670092-68756519", "ensembl_id": "ENSG00000062038" } }, "GRch38": { "90": { "location": "16:68636189-68722616", "ensembl_id": "ENSG00000062038" } } }, "hgnc_date_symbol_changed": "1992-07-10" }, "entity_type": "gene", "entity_name": "CDH3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Ectodermal dysplasia, ectrodactyly, and macular dystrophy, 225280 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CCNC1", "CCNCa", "CNG3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2150", "gene_name": "cyclic nucleotide gated channel alpha 3", "omim_gene": [ "600053" ], "alias_name": null, "gene_symbol": "CNGA3", "hgnc_symbol": "CNGA3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:98962618-99015064", "ensembl_id": "ENSG00000144191" } }, "GRch38": { "90": { "location": "2:98346155-98398601", "ensembl_id": "ENSG00000144191" } } }, "hgnc_date_symbol_changed": "1994-12-20" }, "entity_type": "gene", "entity_name": "CNGA3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Achromatopsia-2, 216900 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AER61", "FLJ33770" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28526", "gene_name": "EGF domain specific O-linked N-acetylglucosamine transferase", "omim_gene": [ "614789" ], "alias_name": [ "AER61 glycosyltransferase" ], "gene_symbol": "EOGT", "hgnc_symbol": "EOGT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:69024365-69063112", "ensembl_id": "ENSG00000163378" } }, "GRch38": { "90": { "location": "3:68975214-69013961", "ensembl_id": "ENSG00000163378" } } }, "hgnc_date_symbol_changed": "2012-05-21" }, "entity_type": "gene", "entity_name": "EOGT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Adams-Oliver syndrome 4, 615297 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KEN", "KIAA0402", "PCN", "PCNTB", "SCKL4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16068", "gene_name": "pericentrin", "omim_gene": [ "605925" ], "alias_name": [ "kendrin", "Seckel syndrome 4" ], "gene_symbol": "PCNT", "hgnc_symbol": "PCNT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:47744036-47865682", "ensembl_id": "ENSG00000160299" } }, "GRch38": { "90": { "location": "21:46324122-46445769", "ensembl_id": "ENSG00000160299" } } }, "hgnc_date_symbol_changed": "2005-11-03" }, "entity_type": "gene", "entity_name": "PCNT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Microcephalic osteodysplastic primordial dwarfism, type II, 210720 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ENaCbeta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10600", "gene_name": "sodium channel epithelial 1 beta subunit", "omim_gene": [ "600760" ], "alias_name": [ "Liddle syndrome" ], "gene_symbol": "SCNN1B", "hgnc_symbol": "SCNN1B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:23289552-23392620", "ensembl_id": "ENSG00000168447" } }, "GRch38": { "90": { "location": "16:23278231-23381299", "ensembl_id": "ENSG00000168447" } } }, "hgnc_date_symbol_changed": "1994-12-20" }, "entity_type": "gene", "entity_name": "SCNN1B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Pseudohypoaldosteronism, type I, 264350 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "XT-I", "PXYLT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15516", "gene_name": "xylosyltransferase 1", "omim_gene": [ "608124" ], "alias_name": [ "protein xylosyltransferase 1" ], "gene_symbol": "XYLT1", "hgnc_symbol": "XYLT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:17195626-17564738", "ensembl_id": "ENSG00000103489" } }, "GRch38": { "90": { "location": "16:17101769-17470881", "ensembl_id": "ENSG00000103489" } } }, "hgnc_date_symbol_changed": "2001-04-06" }, "entity_type": "gene", "entity_name": "XYLT1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Desbuquois dysplasia 2, 615777 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:29160", "gene_name": "FAST kinase domains 2", "omim_gene": [ "612322" ], "alias_name": null, "gene_symbol": "FASTKD2", "hgnc_symbol": "FASTKD2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:207630081-207657233", "ensembl_id": "ENSG00000118246" } }, "GRch38": { "90": { "location": "2:206765357-206792509", "ensembl_id": "ENSG00000118246" } } }, "hgnc_date_symbol_changed": "2006-07-07" }, "entity_type": "gene", "entity_name": "FASTKD2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28499982" ], "evidence": [ "MetBioNet", "Expert Review Amber", "NHS GMS" ], "phenotypes": [ "?Mitochondrial complex IV deficiency, 220110" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3270, "hash_id": null, "name": "Cardiomyopathy_Paediatric", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "With thanks to Genomics England PanelApp for the original design of this panel.\r\n\r\nThis panel contains genes associated with childhood-onset cardiomyopathy, including as part of syndromic and metabolic conditions. It is maintained by VCGS.", "status": "public", "version": "0.229", "version_created": "2026-03-31T18:53:53.165018+11:00", "relevant_disorders": [ "Cardiomyopathy", "HP:0001638;Abnormality of the myocardium", "HP:0001637" ], "stats": { "number_of_genes": 252, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:753", "gene_name": "asparagine synthetase (glutamine-hydrolyzing)", "omim_gene": [ "108370" ], "alias_name": null, "gene_symbol": "ASNS", "hgnc_symbol": "ASNS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:97481430-97501854", "ensembl_id": "ENSG00000070669" } }, "GRch38": { "90": { "location": "7:97852118-97872542", "ensembl_id": "ENSG00000070669" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "ASNS", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Microcephaly, intellectual disability, cerebral atrophy & intractable seizures" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SNAP-29", "CEDNIK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11133", "gene_name": "synaptosome associated protein 29", "omim_gene": [ "604202" ], "alias_name": [ "soluble 29 kDa NSF attachment protein" ], "gene_symbol": "SNAP29", "hgnc_symbol": "SNAP29", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:21213271-21245506", "ensembl_id": "ENSG00000099940" } }, "GRch38": { "90": { "location": "22:20858983-20891218", "ensembl_id": "ENSG00000099940" } } }, "hgnc_date_symbol_changed": "1998-12-17" }, "entity_type": "gene", "entity_name": "SNAP29", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "iPLA2", "PNPLA9", "PARK14", "iPLA2beta", "NBIA2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9039", "gene_name": "phospholipase A2 group VI", "omim_gene": [ "603604" ], "alias_name": [ "neurodegeneration with brain iron accumulation 2" ], "gene_symbol": "PLA2G6", "hgnc_symbol": "PLA2G6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:38507502-38601697", "ensembl_id": "ENSG00000184381" } }, "GRch38": { "90": { "location": "22:38111495-38205690", "ensembl_id": "ENSG00000184381" } } }, "hgnc_date_symbol_changed": "1998-09-07" }, "entity_type": "gene", "entity_name": "PLA2G6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Infantile neuroaxonal dystrophy 1" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NCCT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10912", "gene_name": "solute carrier family 12 member 3", "omim_gene": [ "600968" ], "alias_name": null, "gene_symbol": "SLC12A3", "hgnc_symbol": "SLC12A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:56899119-56949762", "ensembl_id": "ENSG00000070915" } }, "GRch38": { "90": { "location": "16:56865207-56915850", "ensembl_id": "ENSG00000070915" } } }, "hgnc_date_symbol_changed": "1995-10-02" }, "entity_type": "gene", "entity_name": "SLC12A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Gitelman syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "THTR2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16266", "gene_name": "solute carrier family 19 member 3", "omim_gene": [ "606152" ], "alias_name": [ "thiamine transporter 2" ], "gene_symbol": "SLC19A3", "hgnc_symbol": "SLC19A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:228549926-228582728", "ensembl_id": "ENSG00000135917" } }, "GRch38": { "90": { "location": "2:227685210-227718012", "ensembl_id": "ENSG00000135917" } } }, "hgnc_date_symbol_changed": "2001-07-19" }, "entity_type": "gene", "entity_name": "SLC19A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Basal ganglia disease, biotin-responsive" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20551" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26054", "gene_name": "solute carrier family 25 member 38", "omim_gene": [ "610819" ], "alias_name": null, "gene_symbol": "SLC25A38", "hgnc_symbol": "SLC25A38", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:39424839-39438842", "ensembl_id": "ENSG00000144659" } }, "GRch38": { "90": { "location": "3:39383348-39397351", "ensembl_id": "ENSG00000144659" } } }, "hgnc_date_symbol_changed": "2006-09-21" }, "entity_type": "gene", "entity_name": "SLC25A38", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19412178" ], "evidence": [ "Expert Review Green", "Yorkshire and North East GLH", "NHS GMS", "Wessex and West Midlands GLH", "North West GLH", "London South GLH", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Anaemia, sideroblastic, 2, pyridoxine-refractory, MIM# 205950" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3366, "hash_id": null, "name": "Red cell disorders", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with red cell disorders, including anaemias and erythrocytosis.\r\n\r\nPlease refer to the Bone Marrow Failure panel if there is suspicion of pancytopaenia, and to the Diamond Blackfan Anaemia panel if specific features of DBA are present.\r\n\r\nWith thanks to Genomics England PanelApp/NHS Genomic Medicine Service for the original design of this panel.", "status": "public", "version": "1.52", "version_created": "2026-03-28T15:18:36.006857+11:00", "relevant_disorders": [ "Abnormal erythrocyte morphology", "HP:0001877" ], "stats": { "number_of_genes": 116, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DYT18", "DYT9" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11005", "gene_name": "solute carrier family 2 member 1", "omim_gene": [ "138140" ], "alias_name": null, "gene_symbol": "SLC2A1", "hgnc_symbol": "SLC2A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:43391052-43424530", "ensembl_id": "ENSG00000117394" } }, "GRch38": { "90": { "location": "1:42925375-42959173", "ensembl_id": "ENSG00000117394" } } }, "hgnc_date_symbol_changed": "1994-11-18" }, "entity_type": "gene", "entity_name": "SLC2A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22492876", "21791420", "27353637" ], "evidence": [ "Expert Review Green", "Yorkshire and North East GLH", "NHS GMS", "Wessex and West Midlands GLH", "North West GLH", "London South GLH" ], "phenotypes": [ "Stomatin-deficient cryohydrocytosis with neurologic defects MIM# 608885", "delayed psychomotor development, seizures, cataracts, pseudohyperkalaemia", "haemolytic anaemia" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3366, "hash_id": null, "name": "Red cell disorders", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with red cell disorders, including anaemias and erythrocytosis.\r\n\r\nPlease refer to the Bone Marrow Failure panel if there is suspicion of pancytopaenia, and to the Diamond Blackfan Anaemia panel if specific features of DBA are present.\r\n\r\nWith thanks to Genomics England PanelApp/NHS Genomic Medicine Service for the original design of this panel.", "status": "public", "version": "1.52", "version_created": "2026-03-28T15:18:36.006857+11:00", "relevant_disorders": [ "Abnormal erythrocyte morphology", "HP:0001877" ], "stats": { "number_of_genes": 116, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "THTR1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10938", "gene_name": "solute carrier family 19 member 2", "omim_gene": [ "603941" ], "alias_name": null, "gene_symbol": "SLC19A2", "hgnc_symbol": "SLC19A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:169433147-169455241", "ensembl_id": "ENSG00000117479" } }, "GRch38": { "90": { "location": "1:169463909-169486003", "ensembl_id": "ENSG00000117479" } } }, "hgnc_date_symbol_changed": "1999-04-09" }, "entity_type": "gene", "entity_name": "SLC19A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10391221", "10978358" ], "evidence": [ "Expert Review Green", "Yorkshire and North East GLH", "NHS GMS", "Wessex and West Midlands GLH", "North West GLH", "London South GLH", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Thiamine-responsive megaloblastic anaemia syndrome, MIM# 249270" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3366, "hash_id": null, "name": "Red cell disorders", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with red cell disorders, including anaemias and erythrocytosis.\r\n\r\nPlease refer to the Bone Marrow Failure panel if there is suspicion of pancytopaenia, and to the Diamond Blackfan Anaemia panel if specific features of DBA are present.\r\n\r\nWith thanks to Genomics England PanelApp/NHS Genomic Medicine Service for the original design of this panel.", "status": "public", "version": "1.52", "version_created": "2026-03-28T15:18:36.006857+11:00", "relevant_disorders": [ "Abnormal erythrocyte morphology", "HP:0001877" ], "stats": { "number_of_genes": 116, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:10891", "gene_name": "SIX homeobox 5", "omim_gene": [ "600963" ], "alias_name": null, "gene_symbol": "SIX5", "hgnc_symbol": "SIX5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:46268043-46272484", "ensembl_id": "ENSG00000177045" } }, "GRch38": { "90": { "location": "19:45764785-45769226", "ensembl_id": "ENSG00000177045" } } }, "hgnc_date_symbol_changed": "1997-05-29" }, "entity_type": "gene", "entity_name": "SIX5", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17357085", "33624842", "20301554", "24730701", "22447252", "21280147", "14704431", "11950062", "10802667", "10802668" ], "evidence": [ "Expert Review Red" ], "phenotypes": [ "Branchiootorenal syndrome 2, MIM# 610896" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "disputed" ], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CMTX5", "DFNX1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9462", "gene_name": "phosphoribosyl pyrophosphate synthetase 1", "omim_gene": [ "311850" ], "alias_name": [ "PRS I", "ribose-phosphate diphosphokinase 1" ], "gene_symbol": "PRPS1", "hgnc_symbol": "PRPS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:106871737-106894256", "ensembl_id": "ENSG00000147224" } }, "GRch38": { "90": { "location": "X:107628424-107651026", "ensembl_id": "ENSG00000147224" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "PRPS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Arts syndrome 301835", "Charcot-Marie-Tooth disease, X-linked recessive, 5 311070", "Deafness, X-linked 1 304500", "Gout, PRPS-related 300661", "Phosphoribosylpyrophosphate synthetase superactivity 300661" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3468, "hash_id": null, "name": "Miscellaneous Metabolic Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause miscellaneous metabolic disorders, that are not present on any of the more specific metabolic disorders panels (see the Metabolic Disorders Superpanel for the full list of panels). It contains, but is not limited to, the following groups of conditions:\r\n-Disorders of purine and pyrimidine metabolism\r\n-Organic acidurias, and other disorders of amino acid and peptide metabolism\r\n-Disorders of bile acid metabolism and transport, and other disorders of the metabolism of sterols\r\n-Disorders of nucleotide metabolism\r\n-Disorders of glucose transport, and other disorders of carbohydrate metabolism (excluding glycogen storage disorders)\r\n-Disorders of zinc and manganese metabolism\r\n-Disorders of vitamins and cofactors\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.60", "version_created": "2026-01-15T15:39:27.439934+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 149, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA1630", "MGC3090", "DKFZP762M115", "CMT2Q" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23537", "gene_name": "dehydrogenase E1 and transketolase domain containing 1", "omim_gene": [ "614984" ], "alias_name": null, "gene_symbol": "DHTKD1", "hgnc_symbol": "DHTKD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:12110971-12165224", "ensembl_id": "ENSG00000181192" } }, "GRch38": { "90": { "location": "10:12068972-12123225", "ensembl_id": "ENSG00000181192" } } }, "hgnc_date_symbol_changed": "2003-11-24" }, "entity_type": "gene", "entity_name": "DHTKD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26141459, 25860818, 23141293" ], "evidence": [ "Expert Review Green", "NHS GMS" ], "phenotypes": [ "2-aminoadipic 2-oxoadipic aciduria MONDO:0008774" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3468, "hash_id": null, "name": "Miscellaneous Metabolic Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause miscellaneous metabolic disorders, that are not present on any of the more specific metabolic disorders panels (see the Metabolic Disorders Superpanel for the full list of panels). It contains, but is not limited to, the following groups of conditions:\r\n-Disorders of purine and pyrimidine metabolism\r\n-Organic acidurias, and other disorders of amino acid and peptide metabolism\r\n-Disorders of bile acid metabolism and transport, and other disorders of the metabolism of sterols\r\n-Disorders of nucleotide metabolism\r\n-Disorders of glucose transport, and other disorders of carbohydrate metabolism (excluding glycogen storage disorders)\r\n-Disorders of zinc and manganese metabolism\r\n-Disorders of vitamins and cofactors\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.60", "version_created": "2026-01-15T15:39:27.439934+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 149, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MTP1", "IREG1", "FPN1", "HFE4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10909", "gene_name": "solute carrier family 40 member 1", "omim_gene": [ "604653" ], "alias_name": [ "ferroportin 1" ], "gene_symbol": "SLC40A1", "hgnc_symbol": "SLC40A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:190425305-190448484", "ensembl_id": "ENSG00000138449" } }, "GRch38": { "90": { "location": "2:189560579-189583758", "ensembl_id": "ENSG00000138449" } } }, "hgnc_date_symbol_changed": "2003-06-05" }, "entity_type": "gene", "entity_name": "SLC40A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16351644", "11431687" ], "evidence": [ "NHS Genomic Medicine Service", "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "606069 HEMOCHROMATOSIS, TYPE 4", "HFE4", "606069 Hemochromatosis, type 4" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3469, "hash_id": null, "name": "Metal Metabolism Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause inborn errors of molybdenum, copper, iron, manganese, zinc, selenium, and magnesium metabolism. \r\nThis panel was based on the Genomics England/NHS Genomics Medicine Service 'Iron metabolism disorders' panel. It is part of the Metabolic Disorders Superpanel.", "status": "public", "version": "0.54", "version_created": "2026-02-17T14:35:14.331246+11:00", "relevant_disorders": [ "Abnormality of iron homeostasis", "HP:0011031;Abnormal blood transition element cation concentration", "HP:0011030" ], "stats": { "number_of_genes": 51, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MCAD", "MCADH", "ACAD1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:89", "gene_name": "acyl-CoA dehydrogenase medium chain", "omim_gene": [ "607008" ], "alias_name": [ "medium-chain acyl-CoA dehydrogenase" ], "gene_symbol": "ACADM", "hgnc_symbol": "ACADM", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:76190036-76253260", "ensembl_id": "ENSG00000117054" } }, "GRch38": { "90": { "location": "1:75724347-75787575", "ensembl_id": "ENSG00000117054" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "ACADM", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "Genomics England PanelApp", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Acyl-CoA dehydrogenase, medium chain, deficiency of\t201450" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 3470, "hash_id": null, "name": "Hyperammonaemia", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes associated with urea cycle disorders and other metabolic conditions that cause hyperammonaemia.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel.", "status": "public", "version": "0.10", "version_created": "2023-03-02T14:41:08.610876+11:00", "relevant_disorders": [ "Hyperammonaemia", "HP:0001987" ], "stats": { "number_of_genes": 43, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ12614", "NRX" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18008", "gene_name": "nucleoredoxin", "omim_gene": [ "612895" ], "alias_name": null, "gene_symbol": "NXN", "hgnc_symbol": "NXN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:702553-883010", "ensembl_id": "ENSG00000167693" } }, "GRch38": { "90": { "location": "17:799313-979770", "ensembl_id": "ENSG00000167693" } } }, "hgnc_date_symbol_changed": "2002-01-16" }, "entity_type": "gene", "entity_name": "NXN", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29276006" ], "evidence": [ "Expert Review Green", "Expert list", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Robinow syndrome, autosomal recessive 2 MIM#618529" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3729, "hash_id": null, "name": "Hand and foot malformations", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel contains non-syndromic and syndromic causes of hand and foot malformations, including: brachydactyly, syndactyly, clinodactyly, ectrodactyly, and oligodactyly. Genes that cause polydactyly and synpolydactyly are excluded and can be found on the Polydactyly panel.", "status": "public", "version": "0.89", "version_created": "2026-04-07T13:49:34.993963+10:00", "relevant_disorders": [ "Abnormal hand morphology", "HP:0005922; Abnormal foot morphology", "HP:0001760" ], "stats": { "number_of_genes": 101, "number_of_strs": 1, "number_of_regions": 5 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:6595", "gene_name": "LIM homeobox 3", "omim_gene": [ "600577" ], "alias_name": null, "gene_symbol": "LHX3", "hgnc_symbol": "LHX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:139088096-139096955", "ensembl_id": "ENSG00000107187" } }, "GRch38": { "90": { "location": "9:136196250-136205109", "ensembl_id": "ENSG00000107187" } } }, "hgnc_date_symbol_changed": "2000-03-22" }, "entity_type": "gene", "entity_name": "LHX3", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28302169" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp" ], "phenotypes": [ "Pituitary hormone deficiency, combined, 3 (MIM#221750)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Cav2.3", "BII", "CACH6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1392", "gene_name": "calcium voltage-gated channel subunit alpha1 E", "omim_gene": [ "601013" ], "alias_name": null, "gene_symbol": "CACNA1E", "hgnc_symbol": "CACNA1E", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:181382238-181777219", "ensembl_id": "ENSG00000198216" } }, "GRch38": { "90": { "location": "1:181413102-181808084", "ensembl_id": "ENSG00000198216" } } }, "hgnc_date_symbol_changed": "1994-12-20" }, "entity_type": "gene", "entity_name": "CACNA1E", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other - please provide details in the comments", "publications": [ "30849329", "30343943" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Literature", "Expert list" ], "phenotypes": [ "Epileptic encephalopathy, early infantile, 69, MIM#618285" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "K-FGF", "HBGF-4", "HST", "HST-1", "KFGF" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3682", "gene_name": "fibroblast growth factor 4", "omim_gene": [ "164980" ], "alias_name": [ "human stomach cancer, transforming factor from FGF-related oncogene", "kaposi sarcoma oncogene", "transforming protein KS3" ], "gene_symbol": "FGF4", "hgnc_symbol": "FGF4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:69587797-69590171", "ensembl_id": "ENSG00000075388" } }, "GRch38": { "90": { "location": "11:69771016-69775403", "ensembl_id": "ENSG00000075388" } } }, "hgnc_date_symbol_changed": "1988-04-20" }, "entity_type": "gene", "entity_name": "FGF4", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40259859" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Jeune Syndrome, FGF4-related, MONDO:0018770" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:14357", "gene_name": "matrix metallopeptidase 21", "omim_gene": [ "608416" ], "alias_name": null, "gene_symbol": "MMP21", "hgnc_symbol": "MMP21", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:127455022-127464390", "ensembl_id": "ENSG00000154485" } }, "GRch38": { "90": { "location": "10:125766453-125775821", "ensembl_id": "ENSG00000154485" } } }, "hgnc_date_symbol_changed": "2001-01-25" }, "entity_type": "gene", "entity_name": "MMP21", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26429889", "26437028", "26437029" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Heterotaxy, visceral, 7, autosomal, MIM# 616749" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DPCK", "NBP", "CoASY", "PPAT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29932", "gene_name": "Coenzyme A synthase", "omim_gene": [ "609855" ], "alias_name": null, "gene_symbol": "COASY", "hgnc_symbol": "COASY", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:40713485-40718295", "ensembl_id": "ENSG00000068120" } }, "GRch38": { "90": { "location": "17:42561467-42566277", "ensembl_id": "ENSG00000068120" } } }, "hgnc_date_symbol_changed": "2004-03-22" }, "entity_type": "gene", "entity_name": "COASY", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30089828", "35499143" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Literature", "Expert list" ], "phenotypes": [ "Pontocerebellar hypoplasia", "microcephaly", "arthrogryposis" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GRCC10", "C10" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29521", "gene_name": "chromosome 12 open reading frame 57", "omim_gene": [ "615140" ], "alias_name": [ "gene rich cluster C10 gene" ], "gene_symbol": "C12orf57", "hgnc_symbol": "C12orf57", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:7052141-7055166", "ensembl_id": "ENSG00000111678" } }, "GRch38": { "90": { "location": "12:6942978-6946003", "ensembl_id": "ENSG00000111678" } } }, "hgnc_date_symbol_changed": "2006-01-27" }, "entity_type": "gene", "entity_name": "C12orf57", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23453666", "29383837", "31853307" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Temtamy syndrome, MIM # 218340" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "founder" ], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Cv2", "CRIM3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24154", "gene_name": "BMP binding endothelial regulator", "omim_gene": [ "608699" ], "alias_name": [ "crossveinless-2" ], "gene_symbol": "BMPER", "hgnc_symbol": "BMPER", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:33944523-34195484", "ensembl_id": "ENSG00000164619" } }, "GRch38": { "90": { "location": "7:33904911-34155872", "ensembl_id": "ENSG00000164619" } } }, "hgnc_date_symbol_changed": "2005-07-25" }, "entity_type": "gene", "entity_name": "BMPER", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20869035", "30006055", "15988748", "17764081" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Diaphanospondylodysostosis, 608022 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CYPB", "OI9" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9255", "gene_name": "peptidylprolyl isomerase B", "omim_gene": [ "123841" ], "alias_name": [ "cyclophilin B" ], "gene_symbol": "PPIB", "hgnc_symbol": "PPIB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:64448011-64455404", "ensembl_id": "ENSG00000166794" } }, "GRch38": { "90": { "location": "15:64155812-64163205", "ensembl_id": "ENSG00000166794" } } }, "hgnc_date_symbol_changed": "1991-11-25" }, "entity_type": "gene", "entity_name": "PPIB", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "19781681", "32392875" ], "evidence": [ "Expert Review Red", "Expert list" ], "phenotypes": [ "Osteogenesis imperfecta, type IX, MIM# 259440" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "skeletal" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "S7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10440", "gene_name": "ribosomal protein S7", "omim_gene": [ "603658" ], "alias_name": null, "gene_symbol": "RPS7", "hgnc_symbol": "RPS7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:3622795-3628509", "ensembl_id": "ENSG00000171863" } }, "GRch38": { "90": { "location": "2:3575205-3580919", "ensembl_id": "ENSG00000171863" } } }, "hgnc_date_symbol_changed": "1997-07-07" }, "entity_type": "gene", "entity_name": "RPS7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19061985", "23718193", "27882484", "32772263" ], "evidence": [ "Expert Review Green", "BabySeq Category C gene", "BeginNGS" ], "phenotypes": [ "Diamond-Blackfan anaemia 8, MIM#\t612563" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "treatable", "haematological" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BLS", "RFX-B", "ANKRA1", "F14150_1", "MGC138628" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9987", "gene_name": "regulatory factor X associated ankyrin containing protein", "omim_gene": [ "603200" ], "alias_name": [ "ankyrin repeat-containing regulatory factor X-associated protein", "regulatory factor X subunit B", "RFX-Bdelta4", "DNA-binding protein RFXANK" ], "gene_symbol": "RFXANK", "hgnc_symbol": "RFXANK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:19303008-19312678", "ensembl_id": "ENSG00000064490" } }, "GRch38": { "90": { "location": "19:19192229-19201869", "ensembl_id": "ENSG00000064490" } } }, "hgnc_date_symbol_changed": "1998-11-19" }, "entity_type": "gene", "entity_name": "RFXANK", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BeginNGS" ], "phenotypes": [ "MHC class II deficiency, complementation group B\t, MIM#209920" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "immunological" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GP75", "CATB", "TRP", "b-PROTEIN", "OCA3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12450", "gene_name": "tyrosinase related protein 1", "omim_gene": [ "115501" ], "alias_name": null, "gene_symbol": "TYRP1", "hgnc_symbol": "TYRP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:12685439-12710290", "ensembl_id": "ENSG00000107165" } }, "GRch38": { "90": { "location": "9:12685439-12710290", "ensembl_id": "ENSG00000107165" } } }, "hgnc_date_symbol_changed": "1991-09-04" }, "entity_type": "gene", "entity_name": "TYRP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9345097", "25093188" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Albinism, oculocutaneous, type III MIM#203290" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PDIB2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1513", "gene_name": "calsequestrin 2", "omim_gene": [ "114251" ], "alias_name": null, "gene_symbol": "CASQ2", "hgnc_symbol": "CASQ2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:116242628-116311402", "ensembl_id": "ENSG00000118729" } }, "GRch38": { "90": { "location": "1:115700007-115768781", "ensembl_id": "ENSG00000118729" } } }, "hgnc_date_symbol_changed": "1992-11-05" }, "entity_type": "gene", "entity_name": "CASQ2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "34012068" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission", "Mackenzie's Mission" ], "phenotypes": [ "Ventricular tachycardia, catecholaminergic polymorphic, 2 (MIM#611938)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20345", "POC12", "BBS13" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7121", "gene_name": "Meckel syndrome, type 1", "omim_gene": [ "609883" ], "alias_name": [ "POC12 centriolar protein homolog (Chlamydomonas)" ], "gene_symbol": "MKS1", "hgnc_symbol": "MKS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:56282803-56296966", "ensembl_id": "ENSG00000011143" } }, "GRch38": { "90": { "location": "17:58205437-58219605", "ensembl_id": "ENSG00000011143" } } }, "hgnc_date_symbol_changed": "1995-11-07" }, "entity_type": "gene", "entity_name": "MKS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17377820", "24886560", "19776033", "33193692", "27570071", "27377014", "18327255", "24608809" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Bardet-Biedl syndrome 13 MIM#615990", "Joubert syndrome 28 MIM#617121", "Meckel syndrome 1 MIM#249000", "Ciliopathy MONDO:0005308" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3018", "gene_name": "solute carrier family 26 member 3", "omim_gene": [ "126650" ], "alias_name": null, "gene_symbol": "SLC26A3", "hgnc_symbol": "SLC26A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:107405912-107443670", "ensembl_id": "ENSG00000091138" } }, "GRch38": { "90": { "location": "7:107765467-107803225", "ensembl_id": "ENSG00000091138" } } }, "hgnc_date_symbol_changed": "1993-04-01" }, "entity_type": "gene", "entity_name": "SLC26A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31325522", "19861545", "11524734" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Diarrhea 1, secretory chloride, congenital, 214700 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SEB", "KIAA0437" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15573", "gene_name": "SET binding protein 1", "omim_gene": [ "611060" ], "alias_name": null, "gene_symbol": "SETBP1", "hgnc_symbol": "SETBP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:42260138-42648475", "ensembl_id": "ENSG00000152217" } }, "GRch38": { "90": { "location": "18:44680173-45068510", "ensembl_id": "ENSG00000152217" } } }, "hgnc_date_symbol_changed": "2001-06-05" }, "entity_type": "gene", "entity_name": "SETBP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29463886", "33907317" ], "evidence": [ "Expert Review Green", "Expert Review", "Expert list" ], "phenotypes": [ "Intellectual developmental disorder, autosomal dominant 29, MIM# 616078" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4290, "hash_id": null, "name": "Speech apraxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Childhood apraxia of speech (CAS; synonymous with speech apraxia/dyspraxia or verbal apraxia/dyspraxia) is a non-progressive neurodevelopmental disorder with a primary presentation of speech planning and programming disorder.\r\n\r\nCAS involves difficulty producing sequences of sounds with accuracy and correct prosody, resulting in poor speech intelligibility. Individuals with CAS typically have very delayed development of first spoken words. Other common co-occurring features may include fine and gross motor impairment, language impairment, learning difficulties, intellectual disability, autism and attention deficit hyperactivity disorder. Other associated features may include hypotonia, seizures, and facial dysmorphism/dysmorphology.\r\n \r\nPMID: 38366112 summarises three gene discovery cohort studies of individuals with CAS. Diagnostic yield ranged between 26-42%.\r\n\r\nThe aetiology of CAS is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia and Ataxia panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Angela Morgan, Michael Hildebrand, Thomas Scerri, David Amor and team for their contribution to the development of this panel.", "status": "public", "version": "1.28", "version_created": "2026-03-06T16:38:48.591739+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 35, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "VHL1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12687", "gene_name": "von Hippel-Lindau tumor suppressor", "omim_gene": [ "608537" ], "alias_name": null, "gene_symbol": "VHL", "hgnc_symbol": "VHL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:10182692-10193904", "ensembl_id": "ENSG00000134086" } }, "GRch38": { "90": { "location": "3:10141008-10152220", "ensembl_id": "ENSG00000134086" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "VHL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert Review", "Expert list" ], "phenotypes": [ "Renal carcinoma, MONDO:0005206", "Von Hippel-Lindau disease, MONDO:0008667", "von Hippel-Lindau syndrome, MIM#193300", "Pheochromocytoma, susceptibility to, MIM#171300" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4367, "hash_id": null, "name": "Kidney Cancer", "disease_group": "Cancer Predisposition", "disease_sub_group": "", "description": "This panel contains genes associated with kidney cancer. \r\n\r\nFurther information on the testing criteria for kidney cancer can be found at eviQ: \r\nhttps://www.eviq.org.au/cancer-genetics/adult/genetic-testing-using-cancer-gene-panels/3889-renal-cancer-panel-testing\r\n\r\nOnly ‘Green’ genes should be tested and analysed for clinical testing, as they have sufficient peer-reviewed published evidence of association with kidney cancer and are clinically actionable for diagnostic and/or predictive genetic testing.\r\n\r\nEnsure testing includes copy number variant (CNV) analysis, as CNVs contribute to a clinically significant proportion of pathogenic variants associated with familial risk of cancer.\r\n\r\nThis panel has been compared against the Genomics England PanelApp and aligned with any assessments by ClinGen.\r\n\r\nThis panel has been developed under the guidance of experts in cancer genetics (Dr Helen Mar Fan and Dr Nicola Poplawski).", "status": "public", "version": "1.12", "version_created": "2026-02-21T14:02:42.792697+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 14, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Cancer Germline", "slug": "cancer-germline", "description": "Germline cancer panel" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Adult Genetics Unit, Royal Adelaide Hospital", "slug": "adult-genetics-unit-royal-adelaide-hospital", "description": "Adult Genetics Unit, Royal Adelaide Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ11362" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25657", "gene_name": "BCL6 corepressor like 1", "omim_gene": [ "300688" ], "alias_name": null, "gene_symbol": "BCORL1", "hgnc_symbol": "BCORL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:129115083-129192058", "ensembl_id": "ENSG00000085185" } }, "GRch38": { "90": { "location": "X:129981107-130058083", "ensembl_id": "ENSG00000085185" } } }, "hgnc_date_symbol_changed": "2004-07-27" }, "entity_type": "gene", "entity_name": "BCORL1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "38342987", "32376790", "39267058", "39189935" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Spermatogenic failure, MONDO:0004983, BCORL1-related" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.140", "version_created": "2026-04-06T10:51:58.181866+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 264, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PR55-BETA", "PR52B", "B55beta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9305", "gene_name": "protein phosphatase 2 regulatory subunit Bbeta", "omim_gene": [ "604325" ], "alias_name": [ "PP2A subunit B isoform beta" ], "gene_symbol": "PPP2R2B", "hgnc_symbol": "PPP2R2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:145967936-146464347", "ensembl_id": "ENSG00000156475" } }, "GRch38": { "90": { "location": "5:146581146-147084784", "ensembl_id": "ENSG00000156475" } } }, "hgnc_date_symbol_changed": "1993-01-25" }, "entity_type": "str", "entity_name": "PPP2R2B_SCA12_CAG", "confidence_level": "3", "penetrance": null, "publications": [ "27864267", "33811808" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spinocerebellar ataxia 12 MIM#604326" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "CAG", "chromosome": "5", "grch37_coordinates": [ 146258292, 146258321 ], "grch38_coordinates": [ 146878729, 146878758 ], "normal_repeats": 32, "pathogenic_repeats": 51, "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "KIAA0111", "EIF4AIII", "Fal1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18683", "gene_name": "eukaryotic translation initiation factor 4A3", "omim_gene": [ "608546" ], "alias_name": null, "gene_symbol": "EIF4A3", "hgnc_symbol": "EIF4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78109013-78120982", "ensembl_id": "ENSG00000141543" } }, "GRch38": { "90": { "location": "17:80135214-80147183", "ensembl_id": "ENSG00000141543" } } }, "hgnc_date_symbol_changed": "2006-11-27" }, "entity_type": "str", "entity_name": "EIF4A3_RCPS_complex", "confidence_level": "3", "penetrance": null, "publications": [ "24360810", "29112243" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Robin sequence with cleft mandible and limb anomalies MIM#268305", "Richieri-Costa-Pereira syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "TCGGCAGCGGCGCAGCGAGG", "chromosome": "17", "grch37_coordinates": [ 78120803, 78120938 ], "grch38_coordinates": [ 80147004, 80147139 ], "normal_repeats": 12, "pathogenic_repeats": 14, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "AML3", "PEBP2A1", "PEBP2aA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10472", "gene_name": "runt related transcription factor 2", "omim_gene": [ "600211" ], "alias_name": null, "gene_symbol": "RUNX2", "hgnc_symbol": "RUNX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:45295894-45632086", "ensembl_id": "ENSG00000124813" } }, "GRch38": { "90": { "location": "6:45328157-45664349", "ensembl_id": "ENSG00000124813" } } }, "hgnc_date_symbol_changed": "1994-11-02" }, "entity_type": "str", "entity_name": "RUNX2_CCD_GCN", "confidence_level": "2", "penetrance": null, "publications": [ "9182765", "33811808", "20560987", "26220009", "25852448" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Cleidocranial dysplasia MIM#119600" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "6", "grch37_coordinates": [ 45390488, 45390538 ], "grch38_coordinates": [ 45422751, 45422801 ], "normal_repeats": 18, "pathogenic_repeats": 20, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } } ] }