Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=297
{ "count": 36035, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=298", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=296", "results": [ { "gene_data": { "alias": [ "GCP2", "Spc97p", "SPBC97" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18599", "gene_name": "tubulin gamma complex associated protein 2", "omim_gene": null, "alias_name": null, "gene_symbol": "TUBGCP2", "hgnc_symbol": "TUBGCP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:135093135-135125841", "ensembl_id": "ENSG00000130640" } }, "GRch38": { "90": { "location": "10:133278630-133312337", "ensembl_id": "ENSG00000130640" } } }, "hgnc_date_symbol_changed": "2002-08-14" }, "entity_type": "gene", "entity_name": "TUBGCP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31630790" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Lissencephaly", "pachygyria", "subcortical band heterotopia", "microcephaly", "intellectual disability" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 15, "hash_id": null, "name": "Lissencephaly and Band Heterotopia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Brain Malformations flagship, and is maintained by VCGS. It is a consensus panel used by RMH.\r\n\r\nIt contains genes associated with deficient neuronal migration and abnormal formation of cerebral convolutions or gyri, either occurring in isolation or as part of a more complex disorder. The spectrum of lissencephaly ranges from absent (agyria) or decreased (pachygyria) convolutions of the cortex to less severe malformation known as subcortical band heterotopia.\r\n\r\nPlease also consider the Cobblestone Malformations panel and the broader Malformations of cortical development superpanel if features are not entirely typical.", "status": "public", "version": "1.30", "version_created": "2026-01-19T11:50:01.984105+11:00", "relevant_disorders": [ "Lissencephaly HP:0001339;Subcortical band heterotopia HP:0032409" ], "stats": { "number_of_genes": 46, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "HsT2651", "CTS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12405", "gene_name": "transthyretin", "omim_gene": [ "176300" ], "alias_name": null, "gene_symbol": "TTR", "hgnc_symbol": "TTR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:29171689-29178974", "ensembl_id": "ENSG00000118271" } }, "GRch38": { "90": { "location": "18:31591726-31599021", "ensembl_id": "ENSG00000118271" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "TTR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20301373" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Complex Neurology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Amyloidosis, hereditary, transthyretin-related, MIM# 105210" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 24, "hash_id": null, "name": "Early-onset Dementia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.58", "version_created": "2026-03-31T16:43:37.497568+11:00", "relevant_disorders": [ "Cognitive impairment", "HP:0100543" ], "stats": { "number_of_genes": 96, "number_of_strs": 6, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TINUR", "NOT", "RNR1", "HZF-3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7981", "gene_name": "nuclear receptor subfamily 4 group A member 2", "omim_gene": [ "601828" ], "alias_name": null, "gene_symbol": "NR4A2", "hgnc_symbol": "NR4A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:157180944-157198860", "ensembl_id": "ENSG00000153234" } }, "GRch38": { "90": { "location": "2:156324432-156342348", "ensembl_id": "ENSG00000153234" } } }, "hgnc_date_symbol_changed": "1997-07-11" }, "entity_type": "gene", "entity_name": "NR4A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31922365" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "HSPC274" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15876", "gene_name": "transmembrane protein 230", "omim_gene": [ "617019" ], "alias_name": null, "gene_symbol": "TMEM230", "hgnc_symbol": "TMEM230", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:5080486-5093749", "ensembl_id": "ENSG00000089063" } }, "GRch38": { "90": { "location": "20:5068232-5113103", "ensembl_id": "ENSG00000089063" } } }, "hgnc_date_symbol_changed": "2012-03-16" }, "entity_type": "gene", "entity_name": "TMEM230", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30804554", "27270108", "28115417", "28017548", "30804555", "30804556", "31323517" ], "evidence": [ "Expert list" ], "phenotypes": [ "Parkinson disease 21, MIM#616361" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 26, "hash_id": null, "name": "Early-onset Parkinson disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause early-onset Parkinson disease and conditions where parkinsonism is a prominent feature. It is maintained by VCGS and RMH.\r\nThe original panel as of 17/11/2019 was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "2.51", "version_created": "2026-03-30T11:47:22.375379+11:00", "relevant_disorders": [ "Abnormality of extrapyramidal motor function", "HP:0002071" ], "stats": { "number_of_genes": 129, "number_of_strs": 14, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:18712", "gene_name": "leucine rich repeat LGI family member 4", "omim_gene": [ "608303" ], "alias_name": null, "gene_symbol": "LGI4", "hgnc_symbol": "LGI4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:35615417-35633355", "ensembl_id": "ENSG00000153902" } }, "GRch38": { "90": { "location": "19:35124513-35142451", "ensembl_id": "ENSG00000153902" } } }, "hgnc_date_symbol_changed": "2002-05-30" }, "entity_type": "gene", "entity_name": "LGI4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28318499", "34288120" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Arthrogryposis multiplex congenita, neurogenic, with myelin defect, MIM#617468" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 47, "hash_id": null, "name": "Arthrogryposis", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that have been associated with multiple congenital contractures (arthrogryposis). Primary genetic aetiologies include neuropathic processes; myopathic processes; end-plate abnormalities; and syndromic/metabolic disorders that affect the movement of the developing embryo/fetus.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Arthrogryposis' panel with all discrepancies resolved, and reciprocal feedback provided to Genomics England, 1/8/2020.\r\n\r\nUpdated following literature review 25/11/2025.", "status": "public", "version": "1.19", "version_created": "2026-04-02T19:32:17.814766+11:00", "relevant_disorders": [ "Flexion contracture", "HP:0001371" ], "stats": { "number_of_genes": 241, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PMP35", "PAF-1", "RNF72", "ZWS3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9717", "gene_name": "peroxisomal biogenesis factor 2", "omim_gene": [ "170993" ], "alias_name": [ "Zellweger syndrome", "peroxin 2" ], "gene_symbol": "PEX2", "hgnc_symbol": "PEX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:77892494-77913280", "ensembl_id": "ENSG00000164751" } }, "GRch38": { "90": { "location": "8:76980258-77001044", "ensembl_id": "ENSG00000164751" } } }, "hgnc_date_symbol_changed": "2010-01-25" }, "entity_type": "gene", "entity_name": "PEX2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Peroxisome biogenesis disorder 5A (Zellweger) - MIM#614866" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 47, "hash_id": null, "name": "Arthrogryposis", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that have been associated with multiple congenital contractures (arthrogryposis). Primary genetic aetiologies include neuropathic processes; myopathic processes; end-plate abnormalities; and syndromic/metabolic disorders that affect the movement of the developing embryo/fetus.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Arthrogryposis' panel with all discrepancies resolved, and reciprocal feedback provided to Genomics England, 1/8/2020.\r\n\r\nUpdated following literature review 25/11/2025.", "status": "public", "version": "1.19", "version_created": "2026-04-02T19:32:17.814766+11:00", "relevant_disorders": [ "Flexion contracture", "HP:0001371" ], "stats": { "number_of_genes": 241, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD41B", "CD41", "PPP1R93" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6138", "gene_name": "integrin subunit alpha 2b", "omim_gene": [ "607759" ], "alias_name": [ "protein phosphatase 1, regulatory subunit 93", "platelet glycoprotein IIb of IIb/IIIa complex" ], "gene_symbol": "ITGA2B", "hgnc_symbol": "ITGA2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:42449548-42466873", "ensembl_id": "ENSG00000005961" } }, "GRch38": { "90": { "location": "17:44372180-44389505", "ensembl_id": "ENSG00000005961" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "ITGA2B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "1638023", "21454453", "8282784", "16463284" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bleeding disorder, platelet-type, 16, MIM# 187800", "MONDO:000855", "Glanzmann thrombasthaenia 1, MIM# 273800" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 54, "hash_id": null, "name": "Bleeding and Platelet Disorders", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with coagulation, platelet and blood vessel disorders that predispose to bleeding and to thrombosis.", "status": "public", "version": "1.77", "version_created": "2026-04-08T12:32:35.286494+10:00", "relevant_disorders": [ "Abnormal bleeding", "HP:0001892;Abnormal thrombosis", "HP:0001977" ], "stats": { "number_of_genes": 140, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA2004", "FLJ20073" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1348", "gene_name": "sterile alpha motif domain containing 9", "omim_gene": [ "610456" ], "alias_name": null, "gene_symbol": "SAMD9", "hgnc_symbol": "SAMD9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:92728829-92747336", "ensembl_id": "ENSG00000205413" } }, "GRch38": { "90": { "location": "7:93099513-93118023", "ensembl_id": "ENSG00000205413" } } }, "hgnc_date_symbol_changed": "2004-07-16" }, "entity_type": "gene", "entity_name": "SAMD9", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "27182967" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "MIRAGE syndrome, MIM#617053" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 56, "hash_id": null, "name": "Bone Marrow Failure", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "Bone marrow failure (BMF) refers to the decreased production of one or more major haematopoietic lineages which leads to diminished or absent haematopoietic precursors in the bone marrow and attendant cytopaenias.\r\n\r\nThis panel was developed and is maintained by VCGS. It contains all the genes on the Peter MacCallum Bone Marrow Failure panel, as of 2/3/2020, and includes all the genes associated with telomere disorders (Dysterkeratosis Congenita).\r\n\r\nIt has been updated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.", "status": "public", "version": "1.141", "version_created": "2026-03-17T18:48:23.244194+11:00", "relevant_disorders": [ "Abnormality of multiple cell lineages of the bone marrow", "HP:0012145" ], "stats": { "number_of_genes": 151, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FAA", "FA-H", "FAH" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3582", "gene_name": "Fanconi anemia complementation group A", "omim_gene": [ "607139" ], "alias_name": null, "gene_symbol": "FANCA", "hgnc_symbol": "FANCA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:89803957-89883065", "ensembl_id": "ENSG00000187741" } }, "GRch38": { "90": { "location": "16:89737549-89816657", "ensembl_id": "ENSG00000187741" } } }, "hgnc_date_symbol_changed": "1995-12-22" }, "entity_type": "gene", "entity_name": "FANCA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10094191" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Fanconi anaemia, complementation group A, MIM# 227650", "MONDO:0009215" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 56, "hash_id": null, "name": "Bone Marrow Failure", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "Bone marrow failure (BMF) refers to the decreased production of one or more major haematopoietic lineages which leads to diminished or absent haematopoietic precursors in the bone marrow and attendant cytopaenias.\r\n\r\nThis panel was developed and is maintained by VCGS. It contains all the genes on the Peter MacCallum Bone Marrow Failure panel, as of 2/3/2020, and includes all the genes associated with telomere disorders (Dysterkeratosis Congenita).\r\n\r\nIt has been updated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.", "status": "public", "version": "1.141", "version_created": "2026-03-17T18:48:23.244194+11:00", "relevant_disorders": [ "Abnormality of multiple cell lineages of the bone marrow", "HP:0012145" ], "stats": { "number_of_genes": 151, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CX50" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4281", "gene_name": "gap junction protein alpha 8", "omim_gene": [ "600897" ], "alias_name": [ "connexin 50" ], "gene_symbol": "GJA8", "hgnc_symbol": "GJA8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:147374946-147381393", "ensembl_id": "ENSG00000121634" } }, "GRch38": { "90": { "location": "1:147907956-147909257", "ensembl_id": "ENSG00000121634" } } }, "hgnc_date_symbol_changed": "1995-11-29" }, "entity_type": "gene", "entity_name": "GJA8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30498267", "29464339", "10480374", "18006672" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cataract 1, multiple types, MIM# 116200", "Microphthalmia" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CMPST", "hCST" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11021", "gene_name": "solute carrier family 35 member A1", "omim_gene": [ "605634" ], "alias_name": null, "gene_symbol": "SLC35A1", "hgnc_symbol": "SLC35A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:88180341-88222054", "ensembl_id": "ENSG00000164414" } }, "GRch38": { "90": { "location": "6:87470623-87512336", "ensembl_id": "ENSG00000164414" } } }, "hgnc_date_symbol_changed": "1999-10-05" }, "entity_type": "gene", "entity_name": "SLC35A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28856833", "23873973", "11157507" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Congenital disorder of glycosylation, type IIf, MIM# 603585" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 68, "hash_id": null, "name": "Congenital Disorders of Glycosylation", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Congenital Disorders of Glycosylation' panel v2.4 with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.85", "version_created": "2026-04-02T10:46:27.496905+11:00", "relevant_disorders": [ "Abnormal transferrin saturation", "HP:0040135" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HNRBP2", "FOX-2", "HRNBP2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9906", "gene_name": "RNA binding fox-1 homolog 2", "omim_gene": [ "612149" ], "alias_name": [ "hexaribonucleotide binding protein 2" ], "gene_symbol": "RBFOX2", "hgnc_symbol": "RBFOX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:36134783-36424473", "ensembl_id": "ENSG00000100320" } }, "GRch38": { "90": { "location": "22:35738736-36028425", "ensembl_id": "ENSG00000100320" } } }, "hgnc_date_symbol_changed": "2010-09-10" }, "entity_type": "gene", "entity_name": "RBFOX2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26785492", "27670201", "27485310", "25205790", "35137168", "26785492", "37165897" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "RBFOX2-related congenital heart disorder (MONDO:0100557)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.534", "version_created": "2026-03-30T13:14:35.719896+11:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 253, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FAG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3588", "gene_name": "Fanconi anemia complementation group G", "omim_gene": [ "602956" ], "alias_name": [ "DNA repair protein XRCC9", "X-ray repair, complementing defective, in Chinese hamster, 9", "X-ray repair complementing defective repair in Chinese hamster cells 9" ], "gene_symbol": "FANCG", "hgnc_symbol": "FANCG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:35073832-35080013", "ensembl_id": "ENSG00000221829" } }, "GRch38": { "90": { "location": "9:35073835-35080016", "ensembl_id": "ENSG00000221829" } } }, "hgnc_date_symbol_changed": "1998-08-26" }, "entity_type": "gene", "entity_name": "FANCG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9806548", "12552564" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Fanconi anaemia, complementation group G, MIM# 614082", "MONDO:0013565" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 79, "hash_id": null, "name": "Chromosome Breakage Disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was created and is maintained by VCGS.\r\n\r\nChromosomal instability syndromes are a group of inherited disorders associated with chromosomal instability and breakage either spontaneously or in response to DNA damaging agents. They include ataxia telangiectasia, Bloom syndrome, Fanconi anaemia, Nijmegen breakage syndrome, immunodeficiency/centromeric instability/facial anomalies syndrome, Cockayne syndrome, trichothiodystrophy, xeroderma pigmentosum, DNA ligase I deficiency, and DNA recombinase repair defects.\r\n\r\nTypical features include impairment of growth, immunodeficiency, predisposition to infectious disease, and the risk of developing certain types of malignancies.", "status": "public", "version": "1.24", "version_created": "2025-10-16T15:58:38.818741+11:00", "relevant_disorders": [ "Chromosome breakage HP:0040012" ], "stats": { "number_of_genes": 60, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PKACb" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9381", "gene_name": "protein kinase cAMP-activated catalytic subunit beta", "omim_gene": [ "176892" ], "alias_name": null, "gene_symbol": "PRKACB", "hgnc_symbol": "PRKACB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:84543745-84704181", "ensembl_id": "ENSG00000142875" } }, "GRch38": { "90": { "location": "1:84078062-84238498", "ensembl_id": "ENSG00000142875" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "PRKACB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments", "publications": [ "33058759" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Cardioacrofacial dysplasia 2, MIM# 619143", "Postaxial hand polydactyly", "Postaxial foot polydactyly", "Common atrium", "Atrioventricular canal defect", "Narrow chest", "Abnormality of the teeth", "Intellectual disability" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 84, "hash_id": null, "name": "Ciliopathies", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was created by merging the Ciliopathy panels created by VCGS and RMH and is a consensus panel used by both.\r\n\r\nIt covers conditions caused by mutations in the genes encoding non-motile cilia components as well as a small number of conditions that can present as phenocopies.\r\n\r\nPlease note a number of smaller panels are available that cover specific ciliopathy phenotypes such as Bardet-Biedl syndrome, Jeune syndrome and Joubert syndrome.\r\n\r\nPlease refer to the Ciliary Dyskinesia panel for conditions caused by mutations in genes encoding components of the motile cilia, which present with predominantly respiratory phenotypes.", "status": "public", "version": "1.99", "version_created": "2026-02-26T20:47:06.255758+11:00", "relevant_disorders": [ "Ciliopathy", "MONDO:0005308" ], "stats": { "number_of_genes": 158, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:9529", "gene_name": "protein serine kinase H1", "omim_gene": [ "177015" ], "alias_name": null, "gene_symbol": "PSKH1", "hgnc_symbol": "PSKH1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:67927175-67963581", "ensembl_id": "ENSG00000159792" } }, "GRch38": { "90": { "location": "16:67893272-67929678", "ensembl_id": "ENSG00000159792" } } }, "hgnc_date_symbol_changed": "1993-08-04" }, "entity_type": "gene", "entity_name": "PSKH1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 39132680" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Cholestasis, progressive familial intrahepatic, 13, MIM# 620962" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 84, "hash_id": null, "name": "Ciliopathies", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was created by merging the Ciliopathy panels created by VCGS and RMH and is a consensus panel used by both.\r\n\r\nIt covers conditions caused by mutations in the genes encoding non-motile cilia components as well as a small number of conditions that can present as phenocopies.\r\n\r\nPlease note a number of smaller panels are available that cover specific ciliopathy phenotypes such as Bardet-Biedl syndrome, Jeune syndrome and Joubert syndrome.\r\n\r\nPlease refer to the Ciliary Dyskinesia panel for conditions caused by mutations in genes encoding components of the motile cilia, which present with predominantly respiratory phenotypes.", "status": "public", "version": "1.99", "version_created": "2026-02-26T20:47:06.255758+11:00", "relevant_disorders": [ "Ciliopathy", "MONDO:0005308" ], "stats": { "number_of_genes": 158, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ25972", "CMF608" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26384", "gene_name": "immunoglobulin superfamily member 10", "omim_gene": [ "617351" ], "alias_name": null, "gene_symbol": "IGSF10", "hgnc_symbol": "IGSF10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:151143172-151176497", "ensembl_id": "ENSG00000152580" } }, "GRch38": { "90": { "location": "3:151425384-151458709", "ensembl_id": "ENSG00000152580" } } }, "hgnc_date_symbol_changed": "2004-03-04" }, "entity_type": "gene", "entity_name": "IGSF10", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "27137492", "31042289", "40700020" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Disorder of sex differentiation, MONDO:0002145, IGSF10-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.47", "version_created": "2026-04-06T10:50:25.990411+10:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ20508" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26039", "gene_name": "chromosome 1 open reading frame 109", "omim_gene": [ "614799" ], "alias_name": null, "gene_symbol": "C1orf109", "hgnc_symbol": "C1orf109", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:38147242-38157914", "ensembl_id": "ENSG00000116922" } }, "GRch38": { "90": { "location": "1:37681570-37692249", "ensembl_id": "ENSG00000116922" } } }, "hgnc_date_symbol_changed": "2005-06-03" }, "entity_type": "gene", "entity_name": "C1orf109", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40760247" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, C1orf109-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CIDE-3", "FLJ20871", "Fsp27" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24229", "gene_name": "cell death inducing DFFA like effector c", "omim_gene": [ "612120" ], "alias_name": null, "gene_symbol": "CIDEC", "hgnc_symbol": "CIDEC", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:9908398-9921938", "ensembl_id": "ENSG00000187288" } }, "GRch38": { "90": { "location": "3:9866711-9880254", "ensembl_id": "ENSG00000187288" } } }, "hgnc_date_symbol_changed": "2004-07-26" }, "entity_type": "gene", "entity_name": "CIDEC", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20049731" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Lipodystrophy, familial partial, type 5, MIM# 615238" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4084", "gene_name": "gamma-aminobutyric acid type A receptor delta subunit", "omim_gene": [ "137163" ], "alias_name": [ "GABA(A) receptor, delta" ], "gene_symbol": "GABRD", "hgnc_symbol": "GABRD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:1950780-1962192", "ensembl_id": "ENSG00000187730" } }, "GRch38": { "90": { "location": "1:2019298-2030758", "ensembl_id": "ENSG00000187730" } } }, "hgnc_date_symbol_changed": "1991-08-06" }, "entity_type": "gene", "entity_name": "GABRD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15115768", "34633442" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Susceptibility to epilepsy, MIM#613060" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1119" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7603", "gene_name": "myosin VB", "omim_gene": [ "606540" ], "alias_name": null, "gene_symbol": "MYO5B", "hgnc_symbol": "MYO5B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:47349183-47721463", "ensembl_id": "ENSG00000167306" } }, "GRch38": { "90": { "location": "18:49822813-50195093", "ensembl_id": "ENSG00000167306" } } }, "hgnc_date_symbol_changed": "1996-04-04" }, "entity_type": "gene", "entity_name": "MYO5B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30564347", "29266534", "28027573", "27532546", "33525641" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Microvillus inclusion disease, MIM# 251850", "Cholestasis, progressive familial intrahepatic, 10, MIM# 619868" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1568" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10250", "gene_name": "roundabout guidance receptor 2", "omim_gene": [ "602431" ], "alias_name": null, "gene_symbol": "ROBO2", "hgnc_symbol": "ROBO2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:75955846-77699115", "ensembl_id": "ENSG00000185008" } }, "GRch38": { "90": { "location": "3:75906695-77649964", "ensembl_id": "ENSG00000185008" } } }, "hgnc_date_symbol_changed": "1998-03-26" }, "entity_type": "gene", "entity_name": "ROBO2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18235093", "19350278", "24429398", "17357069", "26026792", "29194579", "34059960" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Vesicoureteral reflux 2 - MIM#610878", "CAKUT" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LCA2", "rd12", "BCO3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10294", "gene_name": "RPE65, retinoid isomerohydrolase", "omim_gene": [ "180069" ], "alias_name": [ "BCO family, member 3", "retinol isomerase", "all-trans-retinyl-palmitate hydrolase" ], "gene_symbol": "RPE65", "hgnc_symbol": "RPE65", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:68894505-68915642", "ensembl_id": "ENSG00000116745" } }, "GRch38": { "90": { "location": "1:68428822-68449959", "ensembl_id": "ENSG00000116745" } } }, "hgnc_date_symbol_changed": "1993-10-04" }, "entity_type": "gene", "entity_name": "RPE65", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "14962443", "12960219", "11786058", "21654732", "27307694", "9501220", "16754667", "15557452" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Leber congenital amaurosis 2 MIM#204100", "Retinitis pigmentosa 20 MIM#613794", "Retinitis pigmentosa 87 with choroidal involvement MIM#618697" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SBBI88", "Mg11", "HDDC1", "MOP-5", "AGS5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15925", "gene_name": "SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1", "omim_gene": [ "606754" ], "alias_name": [ "HD domain containing 1", "monocyte protein 5", "Aicardi-Goutieres syndrome 5" ], "gene_symbol": "SAMHD1", "hgnc_symbol": "SAMHD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:35518632-35580246", "ensembl_id": "ENSG00000101347" } }, "GRch38": { "90": { "location": "20:36890229-36951843", "ensembl_id": "ENSG00000101347" } } }, "hgnc_date_symbol_changed": "2001-07-31" }, "entity_type": "gene", "entity_name": "SAMHD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19525956", "21102625", "33307271", "20301648" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Aicardi-Goutieres syndrome 5, MIM# 612952" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1034", "FLJ21474" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21637", "gene_name": "SATB homeobox 2", "omim_gene": [ "608148" ], "alias_name": null, "gene_symbol": "SATB2", "hgnc_symbol": "SATB2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:200134223-200335989", "ensembl_id": "ENSG00000119042" } }, "GRch38": { "90": { "location": "2:199269500-199471266", "ensembl_id": "ENSG00000119042" } } }, "hgnc_date_symbol_changed": "2003-07-08" }, "entity_type": "gene", "entity_name": "SATB2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29023086", "28151491", "32446642" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Glass syndrome, MIM# 612313", "MONDO:0100147" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GEF", "HDBP1", "Si-1-2", "Si-1-2-19" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15930", "gene_name": "SLC2A4 regulator", "omim_gene": [ "609493" ], "alias_name": [ "GLUT4 enhancer factor", "Huntington's disease gene regulatory region-binding protein 1" ], "gene_symbol": "SLC2A4RG", "hgnc_symbol": "SLC2A4RG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:62371214-62374858", "ensembl_id": "ENSG00000125520" } }, "GRch38": { "90": { "location": "20:63739861-63743505", "ensembl_id": "ENSG00000125520" } } }, "hgnc_date_symbol_changed": "2001-06-21" }, "entity_type": "gene", "entity_name": "SLC2A4RG", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "E2A", "ITF1", "MGC129647", "MGC129648", "bHLHb21", "VDIR", "E47" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11633", "gene_name": "transcription factor 3", "omim_gene": [ "147141" ], "alias_name": [ "transcription factor E2-alpha", "immunoglobulin transcription factor 1", "kappa-E2-binding factor", "E2A immunoglobulin enhancer-binding factor E12/E47", "VDR interacting repressor" ], "gene_symbol": "TCF3", "hgnc_symbol": "TCF3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:1609291-1652604", "ensembl_id": "ENSG00000071564" } }, "GRch38": { "90": { "location": "19:1609290-1652605", "ensembl_id": "ENSG00000071564" } } }, "hgnc_date_symbol_changed": "1990-07-26" }, "entity_type": "gene", "entity_name": "TCF3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24216514", "28532655", "30063982", "8001124", "8001125" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Agammaglobulinaemia 8, autosomal dominant, MIM# 616941", "Agammaglobulinaemia 8B, autosomal recessive, MIM# 619824" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZp761P0710", "KIAA0686", "FEB4", "VLGR1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17416", "gene_name": "adhesion G protein-coupled receptor V1", "omim_gene": [ "602851" ], "alias_name": null, "gene_symbol": "ADGRV1", "hgnc_symbol": "ADGRV1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:89825161-90460038", "ensembl_id": "ENSG00000164199" } }, "GRch38": { "90": { "location": "5:90529344-91164437", "ensembl_id": "ENSG00000164199" } } }, "hgnc_date_symbol_changed": "2015-03-03" }, "entity_type": "gene", "entity_name": "ADGRV1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29266188", "29261713", "32962041", "34160719", "40673693", "40217298", "36399868", "34744978" ], "evidence": [ "Expert list", "Expert Review Green" ], "phenotypes": [ "Epilepsy, MONDO:0005027, ADGRV1-related", "Usher syndrome, type 2C MIM#60547", "Usher syndrome, type 2C, GPR98/PDZD7 digenic MIM#605472" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CP47", "CP49", "LIFL-L", "phakinin" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1041", "gene_name": "beaded filament structural protein 2", "omim_gene": [ "603212" ], "alias_name": null, "gene_symbol": "BFSP2", "hgnc_symbol": "BFSP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:133118839-133194066", "ensembl_id": "ENSG00000170819" } }, "GRch38": { "90": { "location": "3:133399995-133475222", "ensembl_id": "ENSG00000170819" } } }, "hgnc_date_symbol_changed": "1999-04-14" }, "entity_type": "gene", "entity_name": "BFSP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10729115", "10739768", "15570218", "24654948", "21836522" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cataract 12, multiple types, MIM# 611597" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZP586P0123" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24564", "gene_name": "C2 calcium dependent domain containing 3", "omim_gene": [ "615944" ], "alias_name": null, "gene_symbol": "C2CD3", "hgnc_symbol": "C2CD3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:73723763-73882255", "ensembl_id": "ENSG00000168014" } }, "GRch38": { "90": { "location": "11:74012714-74171210", "ensembl_id": "ENSG00000168014" } } }, "hgnc_date_symbol_changed": "2007-10-17" }, "entity_type": "gene", "entity_name": "C2CD3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24997988", "26477546", "27094867", "30097616", "33875766" ], "evidence": [ "Expert Review Green", "Expert list", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Orofaciodigital syndrome XIV, MIM# 615948", "MONDO:0014413" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ND2", "NAD2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7456", "gene_name": "mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 2", "omim_gene": [ "516001" ], "alias_name": [ "complex I ND2 subunit", "NADH-ubiquinone oxidoreductase chain 2" ], "gene_symbol": "MT-ND2", "hgnc_symbol": "MT-ND2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "MT:4470-5511", "ensembl_id": "ENSG00000198763" } }, "GRch38": { "90": { "location": "MT:4470-5511", "ensembl_id": "ENSG00000198763" } } }, "hgnc_date_symbol_changed": "2005-02-16" }, "entity_type": "gene", "entity_name": "MT-ND2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26258512", "16738010", "15781840", "12192017" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Mitochondrial disease (MONDO:0044970), MT-ND2-related" ], "mode_of_inheritance": "MITOCHONDRIAL", "tags": [ "mtDNA" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0561" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19036", "gene_name": "microtubule associated serine/threonine kinase 3", "omim_gene": [ "612258" ], "alias_name": null, "gene_symbol": "MAST3", "hgnc_symbol": "MAST3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:18208603-18262502", "ensembl_id": "ENSG00000099308" } }, "GRch38": { "90": { "location": "19:18097793-18151692", "ensembl_id": "ENSG00000099308" } } }, "hgnc_date_symbol_changed": "2004-02-10" }, "entity_type": "gene", "entity_name": "MAST3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34185323" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Developmental and epileptic encephalopathy 108, MIM#620115" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:12831", "gene_name": "X-ray repair cross complementing 4", "omim_gene": [ "194363" ], "alias_name": [ "X-ray repair, complementing defective, repair in Chinese hamster", "DNA repair protein XRCC4" ], "gene_symbol": "XRCC4", "hgnc_symbol": "XRCC4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:82373317-82649606", "ensembl_id": "ENSG00000152422" } }, "GRch38": { "90": { "location": "5:83077498-83353787", "ensembl_id": "ENSG00000152422" } } }, "hgnc_date_symbol_changed": "1990-10-16" }, "entity_type": "gene", "entity_name": "XRCC4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 25839420", "25728776" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Short stature, microcephaly, and endocrine dysfunction (MIM#616541)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.427", "version_created": "2026-04-02T17:28:09.565635+11:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 383, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EXO70", "KIAA1067", "YJL085W", "Exo70p", "BLOM4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23214", "gene_name": "exocyst complex component 7", "omim_gene": [ "608163" ], "alias_name": null, "gene_symbol": "EXOC7", "hgnc_symbol": "EXOC7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:74077087-74117657", "ensembl_id": "ENSG00000182473" } }, "GRch38": { "90": { "location": "17:76081017-76121576", "ensembl_id": "ENSG00000182473" } } }, "hgnc_date_symbol_changed": "2004-01-13" }, "entity_type": "gene", "entity_name": "EXOC7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 32103185" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "brain atrophy", "seizures", "developmental delay", "microcephaly" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.427", "version_created": "2026-04-02T17:28:09.565635+11:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 383, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SLIM1", "KYO-T", "bA535K18.1", "FHL1B", "XMPMA", "FLH1A", "MGC111107" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3702", "gene_name": "four and a half LIM domains 1", "omim_gene": [ "300163" ], "alias_name": [ "Four-and-a-half LIM domains 1", "LIM protein SLIMMER" ], "gene_symbol": "FHL1", "hgnc_symbol": "FHL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:135229559-135293518", "ensembl_id": "ENSG00000022267" } }, "GRch38": { "90": { "location": "X:136146702-136211359", "ensembl_id": "ENSG00000022267" } } }, "hgnc_date_symbol_changed": "1997-08-28" }, "entity_type": "gene", "entity_name": "FHL1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "19716112", "20186852", "20301609", "18179901", "25274776", "34366191", "18274675", "19181672" ], "evidence": [ "Expert Review Green", "Expert list", "Expert list" ], "phenotypes": [ "Reducing body myopathy, X-linked 1a, severe, infantile or early childhood onset, MIM# 300717" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 141, "hash_id": null, "name": "Muscular dystrophy and myopathy_Paediatric", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and RMH.\r\n\r\nIt contains genes typically associated with congenital muscular dystrophies and myopathies, which are characterised by weakness at birth, muscle biopsy showing dystrophic or myopathic changes, raised CK, and sometimes structural brain abnormalities. It also contains some genes that cause disorders with overlapping clinical features.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.122", "version_created": "2026-04-02T11:45:25.115390+11:00", "relevant_disorders": [ "Muscular dystrophy", "HP:0003560; Elevated circulating creatine kinase concentration", "HP:0003236; Myopathy", "HP:0003198" ], "stats": { "number_of_genes": 146, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MYH2A", "MYHSA2", "MyHC-IIa", "MYHas8", "MyHC-2A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7572", "gene_name": "myosin heavy chain 2", "omim_gene": [ "160740" ], "alias_name": null, "gene_symbol": "MYH2", "hgnc_symbol": "MYH2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:10424465-10453274", "ensembl_id": "ENSG00000125414" } }, "GRch38": { "90": { "location": "17:10521148-10549957", "ensembl_id": "ENSG00000125414" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "MYH2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "20418530", "15548556", "24193343", "11114175", "23489661", "32578970", "29934118", "28729039", "27490141", "27177998" ], "evidence": [ "Expert Review Green", "Expert list", "Expert Review Green" ], "phenotypes": [ "Myopathy, proximal, and ophthalmoplegia MONDO:0011577" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "tags": [], "panel": { "id": 141, "hash_id": null, "name": "Muscular dystrophy and myopathy_Paediatric", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and RMH.\r\n\r\nIt contains genes typically associated with congenital muscular dystrophies and myopathies, which are characterised by weakness at birth, muscle biopsy showing dystrophic or myopathic changes, raised CK, and sometimes structural brain abnormalities. It also contains some genes that cause disorders with overlapping clinical features.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.122", "version_created": "2026-04-02T11:45:25.115390+11:00", "relevant_disorders": [ "Muscular dystrophy", "HP:0003560; Elevated circulating creatine kinase concentration", "HP:0003236; Myopathy", "HP:0003198" ], "stats": { "number_of_genes": 146, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CGI-85" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24283", "gene_name": "lysine methyltransferase 5B", "omim_gene": [ "610881" ], "alias_name": null, "gene_symbol": "KMT5B", "hgnc_symbol": "KMT5B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:67922330-67981295", "ensembl_id": "ENSG00000110066" } }, "GRch38": { "90": { "location": "11:68154863-68213828", "ensembl_id": "ENSG00000110066" } } }, "hgnc_date_symbol_changed": "2015-11-05" }, "entity_type": "gene", "entity_name": "KMT5B", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25363768", "28191889", "29276005" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Intellectual developmental disorder, autosomal dominant 51 MIM# 617788" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 151, "hash_id": null, "name": "Overgrowth", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with generalised overgrowth of prenatal or postnatal onset. Generalised overgrowth is characterised by a relatively proportionate increase in stature (length or height) and/or head circumference at least two standard deviations above the mean compared to the age‐related peer group. This panel does not contain genes causing segmental overgrowth.\r\n\r\nChromosomal testing/methylation studies are recommended prior to sequencing for the diagnosis of Beckwith-Wiedemann syndrome.\r\n\r\nPlease also refer to the Macrocephaly panel if head growth is primarily or disproportionately affected.", "status": "public", "version": "1.21", "version_created": "2026-04-01T17:27:51.801810+11:00", "relevant_disorders": [ "Overgrowth", "HP:0001548; Tall stature", "HP:0000098; Increased body weight", "HP:0004324" ], "stats": { "number_of_genes": 31, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:967", "gene_name": "Bardet-Biedl syndrome 2", "omim_gene": [ "606151" ], "alias_name": null, "gene_symbol": "BBS2", "hgnc_symbol": "BBS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:56500748-56554195", "ensembl_id": "ENSG00000125124" } }, "GRch38": { "90": { "location": "16:56466836-56520283", "ensembl_id": "ENSG00000125124" } } }, "hgnc_date_symbol_changed": "1993-10-26" }, "entity_type": "gene", "entity_name": "BBS2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11567139", "16823392", "28143435" ], "evidence": [ "Expert Review Green", "KidGen_CilioNephronop v38.1.0", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bardet-Biedl syndrome 2, MIM# 615981" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 193, "hash_id": null, "name": "Renal Ciliopathies and Nephronophthisis", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel was created by the KidGen consortium and is a consensus panel used by VCGS and KidGen", "status": "public", "version": "1.53", "version_created": "2026-03-19T17:14:29.802874+11:00", "relevant_disorders": [ "Abnormality of renal medullary morphology", "HP:0025361; Renal cyst", "HP:0000107" ], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:8960", "gene_name": "phosphatidylinositol glycan anchor biosynthesis class C", "omim_gene": [ "601730" ], "alias_name": [ "phosphatidylinositol N-acetylglucosaminyltransferase" ], "gene_symbol": "PIGC", "hgnc_symbol": "PIGC", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:172339329-172413230", "ensembl_id": "ENSG00000135845" } }, "GRch38": { "90": { "location": "1:172370189-172444086", "ensembl_id": "ENSG00000135845" } } }, "hgnc_date_symbol_changed": "1997-04-16" }, "entity_type": "gene", "entity_name": "PIGC", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27694521", "32707268" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Glycosylphosphatidylinositol biosynthesis defect 16, MIM# 617816" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "UBC2", "HHR6A", "RAD6A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12472", "gene_name": "ubiquitin conjugating enzyme E2 A", "omim_gene": [ "312180" ], "alias_name": null, "gene_symbol": "UBE2A", "hgnc_symbol": "UBE2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:118708501-118718381", "ensembl_id": "ENSG00000077721" } }, "GRch38": { "90": { "location": "X:119574467-119591083", "ensembl_id": "ENSG00000077721" } } }, "hgnc_date_symbol_changed": "1992-12-02" }, "entity_type": "gene", "entity_name": "UBE2A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24053514", "16909393" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Intellectual developmental disorder, X-linked syndromic, Nascimento type 300860" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ11712" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25671", "gene_name": "ribonuclease H2 subunit B", "omim_gene": [ "610326" ], "alias_name": null, "gene_symbol": "RNASEH2B", "hgnc_symbol": "RNASEH2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:51483814-51544592", "ensembl_id": "ENSG00000136104" } }, "GRch38": { "90": { "location": "13:50909678-50973745", "ensembl_id": "ENSG00000136104" } } }, "hgnc_date_symbol_changed": "2006-08-17" }, "entity_type": "gene", "entity_name": "RNASEH2B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16845400", "33307271", "29239743" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Aicardi-Goutieres syndrome 2, MIM# 610181" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RAB3-GAP150", "KIAA0839", "DKFZP434D245", "SPG69" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17168", "gene_name": "RAB3 GTPase activating non-catalytic protein subunit 2", "omim_gene": [ "609275" ], "alias_name": null, "gene_symbol": "RAB3GAP2", "hgnc_symbol": "RAB3GAP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:220321635-220445796", "ensembl_id": "ENSG00000118873" } }, "GRch38": { "90": { "location": "1:220148293-220272454", "ensembl_id": "ENSG00000118873" } } }, "hgnc_date_symbol_changed": "2005-08-23" }, "entity_type": "gene", "entity_name": "RAB3GAP2", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship" ], "phenotypes": [ "Martsolf syndrome, MIM#212720", "Warburg micro syndrome 2, MIM#614225" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GPBP", "STARD11", "CERT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2205", "gene_name": "collagen type IV alpha 3 binding protein", "omim_gene": [ "604677" ], "alias_name": [ "ceramide transporter", "StAR-related lipid transfer (START) domain containing 11" ], "gene_symbol": "COL4A3BP", "hgnc_symbol": "COL4A3BP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:74664311-74807963", "ensembl_id": "ENSG00000113163" } }, "GRch38": { "90": { "location": "5:75368486-75512138", "ensembl_id": "ENSG00000113163" } } }, "hgnc_date_symbol_changed": "2007-06-08" }, "entity_type": "gene", "entity_name": "COL4A3BP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "PMID: 36976648" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with hypotonia, speech delay, and dysmorphic facies (MIM#616351)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5386", "gene_name": "isocitrate dehydrogenase 3 (NAD(+)) gamma", "omim_gene": [ "300089" ], "alias_name": null, "gene_symbol": "IDH3G", "hgnc_symbol": "IDH3G", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:153051221-153059978", "ensembl_id": "ENSG00000067829" } }, "GRch38": { "90": { "location": "X:153785766-153794523", "ensembl_id": "ENSG00000067829" } } }, "hgnc_date_symbol_changed": "1995-11-02" }, "entity_type": "gene", "entity_name": "IDH3G", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40119724" ], "evidence": [ "Expert Review Green", "Literature", "Literature" ], "phenotypes": [ "Retinitis pigmentosa 99, MIM# 301148" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2260", "gene_name": "COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor", "omim_gene": [ "602125" ], "alias_name": [ "protoheme IX farnesyltransferase, mitochondrial", "heme O synthase" ], "gene_symbol": "COX10", "hgnc_symbol": "COX10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:13972813-14111994", "ensembl_id": "ENSG00000006695" } }, "GRch38": { "90": { "location": "17:14069496-14208677", "ensembl_id": "ENSG00000006695" } } }, "hgnc_date_symbol_changed": "1996-10-31" }, "entity_type": "gene", "entity_name": "COX10", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10767350", "12928484", "15455402", "27290639" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Mitochondrial complex IV deficiency, nuclear type 3, MIM# 619046" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.611", "version_created": "2026-04-07T13:48:08.700916+10:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ATP6", "ATPase-6", "Su6m" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7414", "gene_name": "mitochondrially encoded ATP synthase 6", "omim_gene": [ "516060" ], "alias_name": null, "gene_symbol": "MT-ATP6", "hgnc_symbol": "MT-ATP6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "MT:8527-9207", "ensembl_id": "ENSG00000198899" } }, "GRch38": { "90": { "location": "MT:8527-9207", "ensembl_id": "ENSG00000198899" } } }, "hgnc_date_symbol_changed": "2005-02-16" }, "entity_type": "gene", "entity_name": "MT-ATP6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40112238" ], "evidence": [ "Expert Review Green", "Expert list", "Expert list" ], "phenotypes": [ "Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related" ], "mode_of_inheritance": "MITOCHONDRIAL", "tags": [ "mtDNA" ], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SEN2", "SEN2L", "MGC2776" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28422", "gene_name": "tRNA splicing endonuclease subunit 2", "omim_gene": [ "608753" ], "alias_name": null, "gene_symbol": "TSEN2", "hgnc_symbol": "TSEN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:12525931-12581122", "ensembl_id": "ENSG00000154743" } }, "GRch38": { "90": { "location": "3:12484432-12539623", "ensembl_id": "ENSG00000154743" } } }, "hgnc_date_symbol_changed": "2005-03-07" }, "entity_type": "gene", "entity_name": "TSEN2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 34964109" ], "evidence": [ "Expert Review Green", "Literature", "Expert Review Green", "Expert list", "Expert list", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "TRACK syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 211, "hash_id": null, "name": "Atypical Haemolytic Uraemic Syndrome_MPGN", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "Renal complement disorders panel including atypical Haemolytic Uraemic Syndrome (aHUS) and Membranoproliferative Glomerulonephritis (MPGN).\r\n\r\nThis panel was developed and is maintained by the KidGen Collaborative, and is a consensus panel used by VCGS and RMH.\r\n\r\nThe contents of this panel have been compared against the Genomics England PanelApp aHUS and MPGN panels, and discrepancies have been reviewed and resolved by Chirag Patel and Zornitza Stark, with reciprocal reviews provided to Genomics England. 09/01/2020", "status": "public", "version": "1.0", "version_created": "2026-03-24T16:31:25.995226+11:00", "relevant_disorders": [ "Haemolytic anaemia", "HP:0001878" ], "stats": { "number_of_genes": 16, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "AMN", "ALDP", "adrenoleukodystrophy" ], "biotype": "protein_coding", "hgnc_id": "HGNC:61", "gene_name": "ATP binding cassette subfamily D member 1", "omim_gene": [ "300371" ], "alias_name": null, "gene_symbol": "ABCD1", "hgnc_symbol": "ABCD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:152990323-153010216", "ensembl_id": "ENSG00000101986" } }, "GRch38": { "90": { "location": "X:153724868-153744762", "ensembl_id": "ENSG00000101986" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "ABCD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Adrenoleukodystrophy, MIM#300100" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 221, "hash_id": null, "name": "Additional findings_Adult", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Additional findings flagship.\r\n\r\nThe framework used considered clinical actionability and public screening principles, for full publication see Martyn M et al 2019, PMID: 30776170. The genes included are associated with conditions that are adult-onset, clinically-actionable, have a known management pathway which is publicly funded in Victoria, and have a population frequency of gene variants greater than 1/100,000.\r\n\r\nThis has been updated with the 2023 ACMG V3.2 Secondary Findings list, PMID: 37347242.\r\n\r\nV1.0 was used for the Australian Genomics Acute Care additional findings study.\r\n\r\nThe panel has been updated with ClinGen Adult Actionability assertions.", "status": "public", "version": "2.0", "version_created": "2026-03-16T10:56:03.168206+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 136, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CD152", "CD", "GSE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2505", "gene_name": "cytotoxic T-lymphocyte associated protein 4", "omim_gene": [ "123890" ], "alias_name": null, "gene_symbol": "CTLA4", "hgnc_symbol": "CTLA4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:204732509-204738683", "ensembl_id": "ENSG00000163599" } }, "GRch38": { "90": { "location": "2:203867786-203873960", "ensembl_id": "ENSG00000163599" } } }, "hgnc_date_symbol_changed": "1989-05-25" }, "entity_type": "gene", "entity_name": "CTLA4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25213377", "25329329", "30377434" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Autoimmune lymphoproliferative syndrome, type V, MIM# 616100" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 229, "hash_id": null, "name": "Disorders of immune dysregulation", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause diseases of immune dysregulation, including:\r\n- Familial Hemophagocytic Lymphohistiocytosis (FHL syndromes)\r\n- FHL Syndromes with Hypopigmentation\r\n- Regulatory T Cell Defects\r\n- Autoimmunity with or without Lymphoproliferation\r\n- Immune Dysregulation with Colitis\r\n- Autoimmune Lymphoproliferative Syndrome (ALPS, Canale Smith syndrome)\r\n- Susceptibility to EBV and Lymphoproliferative Conditions\r\n\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.43", "version_created": "2026-04-06T13:01:39.255117+10:00", "relevant_disorders": [ "Immune dysregulation", "HP:0002958" ], "stats": { "number_of_genes": 118, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "4-1BB-L" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11939", "gene_name": "TNF superfamily member 9", "omim_gene": [ "606182" ], "alias_name": [ "receptor 4-1BB ligand", "homolog of mouse 4-1BB-L" ], "gene_symbol": "TNFSF9", "hgnc_symbol": "TNFSF9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:6531010-6535931", "ensembl_id": "ENSG00000125657" } }, "GRch38": { "90": { "location": "19:6530999-6535928", "ensembl_id": "ENSG00000125657" } } }, "hgnc_date_symbol_changed": "1998-12-04" }, "entity_type": "gene", "entity_name": "TNFSF9", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35657354" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Hereditary susceptibility to infections, MONDO:0015979, TNFSF9-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 237, "hash_id": null, "name": "Susceptibility to Viral Infections", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital). It is currently maintained by VCGS.\r\n\r\nUpdated with the 2019 International Union of Immunological Societies Committee classification, Tangye et al. 2019 and the COVID Human Genetic Effort list, Casanova et al 2020.", "status": "public", "version": "1.10", "version_created": "2026-03-26T15:17:02.053015+11:00", "relevant_disorders": [ "Recurrent viral infections", "HP:0004429; Severe viral infection", "HP:0031691" ], "stats": { "number_of_genes": 54, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4079", "gene_name": "gamma-aminobutyric acid type A receptor alpha5 subunit", "omim_gene": [ "137142" ], "alias_name": [ "GABA(A) receptor, alpha 5" ], "gene_symbol": "GABRA5", "hgnc_symbol": "GABRA5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:27111510-27194354", "ensembl_id": "ENSG00000186297" } }, "GRch38": { "90": { "location": "15:26866363-26949207", "ensembl_id": "ENSG00000186297" } } }, "hgnc_date_symbol_changed": "1992-08-07" }, "entity_type": "gene", "entity_name": "GABRA5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 31056671", "29961870" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Epileptic encephalopathy, early infantile, 79", "OMIM #618559" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11805", "gene_name": "T-cell lymphoma invasion and metastasis 1", "omim_gene": [ "600687" ], "alias_name": null, "gene_symbol": "TIAM1", "hgnc_symbol": "TIAM1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:32490734-32932290", "ensembl_id": "ENSG00000156299" } }, "GRch38": { "90": { "location": "21:31118416-31559977", "ensembl_id": "ENSG00000156299" } } }, "hgnc_date_symbol_changed": "1994-04-22" }, "entity_type": "gene", "entity_name": "TIAM1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with language delay and seizures, MIM# 619908" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2303", "gene_name": "carboxypeptidase E", "omim_gene": [ "114855" ], "alias_name": [ "carboxypeptidase H", "enkephalin convertase", "insulin granule-associated carboxypeptidase", "cobalt-stimulated chromaffin granule carboxypeptidase" ], "gene_symbol": "CPE", "hgnc_symbol": "CPE", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:166282346-166419472", "ensembl_id": "ENSG00000109472" } }, "GRch38": { "90": { "location": "4:165361194-165498320", "ensembl_id": "ENSG00000109472" } } }, "hgnc_date_symbol_changed": "1992-04-09" }, "entity_type": "gene", "entity_name": "CPE", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26120850", "32936766", "34383079" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM#\t619326" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "TAD3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25151", "gene_name": "adenosine deaminase, tRNA specific 3", "omim_gene": [ "615302" ], "alias_name": [ "tRNA-specific adenosine deaminase 3 homolog (S. cerevisiae)" ], "gene_symbol": "ADAT3", "hgnc_symbol": "ADAT3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:1905377-1913444", "ensembl_id": "ENSG00000213638" } }, "GRch38": { "90": { "location": "19:1905378-1913447", "ensembl_id": "ENSG00000213638" } } }, "hgnc_date_symbol_changed": "2007-08-16" }, "entity_type": "gene", "entity_name": "ADAT3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23620220", "26842963", "29796286" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Mental retardation, autosomal recessive 36, MIM#615286" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "U8" ], "biotype": "snoRNA", "hgnc_id": "HGNC:32952", "gene_name": "small nucleolar RNA, C/D box 118", "omim_gene": [ "616663" ], "alias_name": null, "gene_symbol": "SNORD118", "hgnc_symbol": "SNORD118", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:8076772-8076905", "ensembl_id": "ENSG00000200463" } }, "GRch38": { "90": { "location": "17:8173454-8173587", "ensembl_id": "ENSG00000200463" } } }, "hgnc_date_symbol_changed": "2006-07-07" }, "entity_type": "gene", "entity_name": "SNORD118", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27571260" ], "evidence": [ "Expert Review Amber", "Genetic Health Queensland" ], "phenotypes": [ "Leukoencephalopathy, brain calcifications, and cysts, MIM#614561" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "non-coding gene" ], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RTS", "CBP", "KAT3A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2348", "gene_name": "CREB binding protein", "omim_gene": [ "600140" ], "alias_name": null, "gene_symbol": "CREBBP", "hgnc_symbol": "CREBBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:3775055-3930727", "ensembl_id": "ENSG00000005339" } }, "GRch38": { "90": { "location": "16:3725054-3880726", "ensembl_id": "ENSG00000005339" } } }, "hgnc_date_symbol_changed": "1995-01-10" }, "entity_type": "gene", "entity_name": "CREBBP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "UKGTN", "Expert Review Green", "Radboud University Medical Center, Nijmegen", "NHS GMS", "Expert list", "Emory Genetics Laboratory", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Rubinstein-Taybi syndrome\t180849", "Rubinstein-Taybi syndrome 180849" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PGT", "OATP2A1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10955", "gene_name": "solute carrier organic anion transporter family member 2A1", "omim_gene": [ "601460" ], "alias_name": null, "gene_symbol": "SLCO2A1", "hgnc_symbol": "SLCO2A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:133651540-133771028", "ensembl_id": "ENSG00000174640" } }, "GRch38": { "90": { "location": "3:133932696-134052184", "ensembl_id": "ENSG00000174640" } } }, "hgnc_date_symbol_changed": "2003-11-26" }, "entity_type": "gene", "entity_name": "SLCO2A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23509104", "27134495", "33852188", "22331663", "27134495" ], "evidence": [ "Expert Review Green", "NHS GMS" ], "phenotypes": [ "Hypertrophic osteoarthropathy, primary, autosomal recessive 2\t614441", "Hypertrophic osteoarthropathy, primary, autosomal recessive 2 614441" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TMPT27", "TPARL", "GDT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30760", "gene_name": "transmembrane protein 165", "omim_gene": [ "614726" ], "alias_name": [ "TPA regulated locus" ], "gene_symbol": "TMEM165", "hgnc_symbol": "TMEM165", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:56262124-56319564", "ensembl_id": "ENSG00000134851" } }, "GRch38": { "90": { "location": "4:55395957-55453397", "ensembl_id": "ENSG00000134851" } } }, "hgnc_date_symbol_changed": "2006-07-17" }, "entity_type": "gene", "entity_name": "TMEM165", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Illumina TruGenome Clinical Sequencing Services", "Radboud University Medical Center, Nijmegen", "Expert Review Green", "NHS GMS", "Expert list", "Emory Genetics Laboratory", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Congenital disorder of glycosylation, type IIk 614727" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "END", "HHT1", "CD105" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3349", "gene_name": "endoglin", "omim_gene": [ "131195" ], "alias_name": null, "gene_symbol": "ENG", "hgnc_symbol": "ENG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:130577291-130617035", "ensembl_id": "ENSG00000106991" } }, "GRch38": { "90": { "location": "9:127815012-127854756", "ensembl_id": "ENSG00000106991" } } }, "hgnc_date_symbol_changed": "1993-03-03" }, "entity_type": "gene", "entity_name": "ENG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Telangiectasia, hereditary hemorrhagic, type 1, 187300", "Gastrointestinal telangiectasia (HP:0002604)", "Palate telangiectasia (HP:0002707)", "Lip telangiectasia (HP:0000214)", "Pulmonary arteriovenous malformation (HP:0006548)", "Nasal mucosa telangiectasia (HP:0000434)", "Tongue telangiectasia (HP:0000227)", "Epistaxis (HP:0000421)", "Cerebral arteriovenous malformation (HP:0002408)", "Hepatic arteriovenous malformation (HP:0006574", "Spinal arteriovenous malformation (HP:0002390)", ")", "Finger pad telangiectasia (pulp not nail side)", "Arteriovenous malformation (HP:0100026)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 260, "hash_id": null, "name": "Hereditary Haemorrhagic Telangiectasia", "disease_group": "Vascular disorders", "disease_sub_group": "", "description": "This panel was developed for use in cases with a clinical diagnosis of hereditary haemorrhagic telangiectasia. It is maintained by Royal Melbourne Hospital. It is a consensus panel used by VCGS.", "status": "public", "version": "1.6", "version_created": "2026-04-06T11:40:33.000186+10:00", "relevant_disorders": [ "Telangiectasia", "HP:0001009" ], "stats": { "number_of_genes": 7, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SBBI88", "Mg11", "HDDC1", "MOP-5", "AGS5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15925", "gene_name": "SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1", "omim_gene": [ "606754" ], "alias_name": [ "HD domain containing 1", "monocyte protein 5", "Aicardi-Goutieres syndrome 5" ], "gene_symbol": "SAMHD1", "hgnc_symbol": "SAMHD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:35518632-35580246", "ensembl_id": "ENSG00000101347" } }, "GRch38": { "90": { "location": "20:36890229-36951843", "ensembl_id": "ENSG00000101347" } } }, "hgnc_date_symbol_changed": "2001-07-31" }, "entity_type": "gene", "entity_name": "SAMHD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "19525956" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Aicardi-Goutieres syndrome 5, MIM#\t612952" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.394", "version_created": "2026-04-07T13:49:15.516142+10:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "D18S892E", "DTN", "DTN-1", "DTN-2", "DTN-3", "DRP3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3057", "gene_name": "dystrobrevin alpha", "omim_gene": [ "601239" ], "alias_name": [ "dystrophin-related protein 3" ], "gene_symbol": "DTNA", "hgnc_symbol": "DTNA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:32073254-32471808", "ensembl_id": "ENSG00000134769" } }, "GRch38": { "90": { "location": "18:34493290-34891844", "ensembl_id": "ENSG00000134769" } } }, "hgnc_date_symbol_changed": "1998-02-11" }, "entity_type": "gene", "entity_name": "DTNA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments", "publications": [ "PMID: 36799992" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Muscular dystrophy, MONDO:0020121, DTNA-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3084, "hash_id": null, "name": "Rhabdomyolysis and Metabolic Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where rhabdomyolysis, exercise intolerance, and metabolic myopathy are a presenting or prominent feature. It was developed and maintained by the Royal Melbourne Hospital. It is a consensus panel used by VCGS.\r\n\r\nDepending on the clinical features present, consider applying additional panels such as Mitochondrial Disorders or the Myopathy Superpanel.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Rhabdomyolysis and metabolic muscle disorders' panel V1.42 on 8/10/2020, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.46", "version_created": "2026-03-31T19:05:14.301918+11:00", "relevant_disorders": [ "Rhabdomyolysis", "HP:0003201;Exercise intolerance", "HP:0003546;Metabolic myopathy", "MONDO:0020123" ], "stats": { "number_of_genes": 124, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:14341", "gene_name": "EDAR associated death domain", "omim_gene": [ "606603" ], "alias_name": null, "gene_symbol": "EDARADD", "hgnc_symbol": "EDARADD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:236511562-236648214", "ensembl_id": "ENSG00000186197" } }, "GRch38": { "90": { "location": "1:236348257-236484914", "ensembl_id": "ENSG00000186197" } } }, "hgnc_date_symbol_changed": "2002-02-08" }, "entity_type": "gene", "entity_name": "EDARADD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Ectodermal dysplasia, anhidrotic, autosomal recessive, Ectodermal dysplasia, anhidrotic, autosomal dominant, Ectodermal dysplasia, hypohidrotic, autosomal dominant, Ectodermal dysplasia, hypohidrotic, autosomal recessive" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3089, "hash_id": null, "name": "Ectodermal Dysplasia", "disease_group": "Dermatological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause heritable conditions in which there are abnormalities of two or more ectodermal structures such as the hair, teeth, nails, sweat glands, salivary glands, cranial-facial structure, digits and other parts of the body.\r\n\r\nThis is a consensus panel used by RMH and VCGS.\r\n\r\nPlease refer to the Hair Disorders panel for disorders primarily affecting hair.", "status": "public", "version": "0.110", "version_created": "2026-03-31T16:43:36.155380+11:00", "relevant_disorders": [ "Ectodermal dysplasia", "HP:0000968" ], "stats": { "number_of_genes": 61, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3148", "gene_name": "thymidine phosphorylase", "omim_gene": [ "131222" ], "alias_name": [ "gliostatin" ], "gene_symbol": "TYMP", "hgnc_symbol": "TYMP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:50964181-50968485", "ensembl_id": "ENSG00000025708" } }, "GRch38": { "90": { "location": "22:50525752-50530056", "ensembl_id": "ENSG00000025708" } } }, "hgnc_date_symbol_changed": "2008-01-21" }, "entity_type": "gene", "entity_name": "TYMP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Mitochondrial DNA depletion syndrome 1 (MNGIE type), 603041 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DPC4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6770", "gene_name": "SMAD family member 4", "omim_gene": [ "600993" ], "alias_name": null, "gene_symbol": "SMAD4", "hgnc_symbol": "SMAD4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:48494410-48611415", "ensembl_id": "ENSG00000141646" } }, "GRch38": { "90": { "location": "18:51028394-51085045", "ensembl_id": "ENSG00000141646" } } }, "hgnc_date_symbol_changed": "2004-05-26" }, "entity_type": "gene", "entity_name": "SMAD4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome 175050" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3141, "hash_id": null, "name": "Stroke", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with stroke or stroke-like episodes. It was developed and is maintained by RMH and is a consensus panel used by VCGS.\r\n\r\nConsider applying the Bleeding and Platelet disorders, Aortopathy_Connective Tissue Disorders and Cerebral Vascular Malformations panels based on the clinical features.", "status": "public", "version": "1.48", "version_created": "2026-03-31T17:20:59.161732+11:00", "relevant_disorders": [ "Stroke", "HP:0001297" ], "stats": { "number_of_genes": 75, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RGI1", "LCA6", "CORD13" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13436", "gene_name": "RPGR interacting protein 1", "omim_gene": [ "605446" ], "alias_name": null, "gene_symbol": "RPGRIP1", "hgnc_symbol": "RPGRIP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:21756098-21819460", "ensembl_id": "ENSG00000092200" } }, "GRch38": { "90": { "location": "14:21287939-21351301", "ensembl_id": "ENSG00000092200" } } }, "hgnc_date_symbol_changed": "2000-12-20" }, "entity_type": "gene", "entity_name": "RPGRIP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30679166" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Cone-rod dystrophy 13, 608194" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3147, "hash_id": null, "name": "Cone-rod Dystrophy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause non-syndromic cone and cone-rod dystrophies, characterised by cone photoreceptor degeneration, which may be followed by subsequent rod photoreceptor loss. This panel was developed and is maintained by RMH, and is a consensus panel used by VCGS.\r\n\r\nConsider using the broader Retinal Disorders superpanel when ophthalmological findings are not specific for this sub-group of disorders, particularly in individuals early in the diagnostic trajectory or where additional features are present.", "status": "public", "version": "0.68", "version_created": "2026-04-11T11:12:33.696021+10:00", "relevant_disorders": [ "Retinal dystrophy", "HP:0000556" ], "stats": { "number_of_genes": 41, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LHRHR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4421", "gene_name": "gonadotropin releasing hormone receptor", "omim_gene": [ "138850" ], "alias_name": null, "gene_symbol": "GNRHR", "hgnc_symbol": "GNRHR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:68605046-68620078", "ensembl_id": "ENSG00000109163" } }, "GRch38": { "90": { "location": "4:67739328-67754360", "ensembl_id": "ENSG00000109163" } } }, "hgnc_date_symbol_changed": "1994-01-15" }, "entity_type": "gene", "entity_name": "GNRHR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28348023", "9371856" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hypogonadotropic hypogonadism 7 without anosmia 146110" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3166, "hash_id": null, "name": "Primary Ovarian Insufficiency_Premature Ovarian Failure", "disease_group": "Endocrine disorders", "disease_sub_group": "Gonadal and sex development disorders", "description": "This panel contains genes that cause non-syndromic and syndromic amenorrhoea, and ovarian insufficiency/failure. It was developed by RMH and Genetic Health QLD. It is a consensus panel used by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Primary ovarian insufficiency' panel V1.69, with all discrepancies reviewed and resolved (October 2025). \r\n\r\nWith early onset premature ovarian insufficiency, the following should be considered:\r\n• X chromosome abnormality such as Turner syndrome\r\n• Presence of FMR1 premutation\r\n• Iatrogenic cause (bilateral oophorectomy, chemotherapy, radiotherapy or any other iatrogenic cause)\r\n• Presence of thyroid or adrenal auto-antibodies\r\n\r\nTesting for fragile X premutation and chromosome abnormalities are strongly recommended prior to genomic testing.\r\n\r\nThis panel should be used for individuals with raised FSH. If FSH is low, the Hypogonadotropic hypogonadism panel should be used.\r\n\r\nPlease also consider the Differences of Sex Development panel where appropriate depending on clinical features.", "status": "public", "version": "0.410", "version_created": "2026-04-06T10:52:55.877866+10:00", "relevant_disorders": [ "Premature ovarian insufficiency", "HP:0008209" ], "stats": { "number_of_genes": 164, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:6595", "gene_name": "LIM homeobox 3", "omim_gene": [ "600577" ], "alias_name": null, "gene_symbol": "LHX3", "hgnc_symbol": "LHX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:139088096-139096955", "ensembl_id": "ENSG00000107187" } }, "GRch38": { "90": { "location": "9:136196250-136205109", "ensembl_id": "ENSG00000107187" } } }, "hgnc_date_symbol_changed": "2000-03-22" }, "entity_type": "gene", "entity_name": "LHX3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Pituitary hormone deficiency, combined, 3 (221750)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 3236, "hash_id": null, "name": "Pituitary hormone deficiency", "disease_group": "Endocrine disorders", "disease_sub_group": "Pituitary disorders", "description": "This panel contains genes associated with pituitary hormone deficiency. \r\nIncludes isolated hormone deficiency, combined hormone deficiencies, and panhypopituitarism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Pituitary hormone deficiency' panel V4.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.208", "version_created": "2026-04-02T15:15:10.893013+11:00", "relevant_disorders": [ "Hypopituitarism", "HP:0040075" ], "stats": { "number_of_genes": 118, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PAP-A", "PAPA", "PAPA1", "PAPB", "ACLS", "PPDIV" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4319", "gene_name": "GLI family zinc finger 3", "omim_gene": [ "165240" ], "alias_name": [ "zinc finger protein GLI3", "oncogene GLI3", "DNA-binding protein" ], "gene_symbol": "GLI3", "hgnc_symbol": "GLI3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:42000548-42277469", "ensembl_id": "ENSG00000106571" } }, "GRch38": { "90": { "location": "7:41960950-42237870", "ensembl_id": "ENSG00000106571" } } }, "hgnc_date_symbol_changed": "1989-05-29" }, "entity_type": "gene", "entity_name": "GLI3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Greig cephalopolysyndactyly syndrome" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SERCA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:811", "gene_name": "ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 1", "omim_gene": [ "108730" ], "alias_name": [ "sarcoplasmic/endoplasmic reticulum calcium ATPase 1", "calcium pump 1" ], "gene_symbol": "ATP2A1", "hgnc_symbol": "ATP2A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:28889726-28915830", "ensembl_id": "ENSG00000196296" } }, "GRch38": { "90": { "location": "16:28878405-28904509", "ensembl_id": "ENSG00000196296" } } }, "hgnc_date_symbol_changed": "1990-09-10" }, "entity_type": "gene", "entity_name": "ATP2A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Brody myopathy" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MLC", "KIAA0027", "LVM", "VL" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17082", "gene_name": "megalencephalic leukoencephalopathy with subcortical cysts 1", "omim_gene": [ "605908" ], "alias_name": null, "gene_symbol": "MLC1", "hgnc_symbol": "MLC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:50497820-50524331", "ensembl_id": "ENSG00000100427" } }, "GRch38": { "90": { "location": "22:50059391-50085902", "ensembl_id": "ENSG00000100427" } } }, "hgnc_date_symbol_changed": "2002-04-30" }, "entity_type": "gene", "entity_name": "MLC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Megalencephalic leukoencephalopathy" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZP564I122", "cblC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24525", "gene_name": "methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria", "omim_gene": [ "609831" ], "alias_name": null, "gene_symbol": "MMACHC", "hgnc_symbol": "MMACHC", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:45965725-45976739", "ensembl_id": "ENSG00000132763" } }, "GRch38": { "90": { "location": "1:45500053-45513382", "ensembl_id": "ENSG00000132763" } } }, "hgnc_date_symbol_changed": "2006-01-12" }, "entity_type": "gene", "entity_name": "MMACHC", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Methylmalonic aciduria and homocystinuria, cblC type" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ZIP4", "AWMS2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17129", "gene_name": "solute carrier family 39 member 4", "omim_gene": [ "607059" ], "alias_name": null, "gene_symbol": "SLC39A4", "hgnc_symbol": "SLC39A4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:145635126-145642279", "ensembl_id": "ENSG00000147804" } }, "GRch38": { "90": { "location": "8:144409742-144416895", "ensembl_id": "ENSG00000147804" } } }, "hgnc_date_symbol_changed": "2002-02-13" }, "entity_type": "gene", "entity_name": "SLC39A4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Acrodermatitis enteropathica" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MAD", "MADA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:468", "gene_name": "adenosine monophosphate deaminase 1", "omim_gene": [ "102770" ], "alias_name": [ "AMPD isoform M", "skeletal muscle AMPD" ], "gene_symbol": "AMPD1", "hgnc_symbol": "AMPD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:115215719-115238239", "ensembl_id": "ENSG00000116748" } }, "GRch38": { "90": { "location": "1:114673090-114695618", "ensembl_id": "ENSG00000116748" } } }, "hgnc_date_symbol_changed": "1989-05-19" }, "entity_type": "gene", "entity_name": "AMPD1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Adenosine monophosphate deaminase deficiency" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:626", "gene_name": "adenine phosphoribosyltransferase", "omim_gene": [ "102600" ], "alias_name": null, "gene_symbol": "APRT", "hgnc_symbol": "APRT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:88875747-88878352", "ensembl_id": "ENSG00000198931" } }, "GRch38": { "90": { "location": "16:88809339-88811944", "ensembl_id": "ENSG00000198931" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "APRT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BabySeq Category C gene" ], "phenotypes": [ "Adenine phosphoribosyltransferase deficiency, MIM#\t614723" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:1402", "gene_name": "calcium voltage-gated channel auxiliary subunit beta 2", "omim_gene": [ "600003" ], "alias_name": null, "gene_symbol": "CACNB2", "hgnc_symbol": "CACNB2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:18429606-18830798", "ensembl_id": "ENSG00000165995" } }, "GRch38": { "90": { "location": "10:18140677-18541869", "ensembl_id": "ENSG00000165995" } } }, "hgnc_date_symbol_changed": "1992-03-27" }, "entity_type": "gene", "entity_name": "CACNB2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Brugada syndrome" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "IL5RB", "CD131", "betaGMR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2436", "gene_name": "colony stimulating factor 2 receptor beta common subunit", "omim_gene": [ "138981" ], "alias_name": [ "beta common cytokine receptor", "beta-GM-CSF receptor" ], "gene_symbol": "CSF2RB", "hgnc_symbol": "CSF2RB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:37309670-37336491", "ensembl_id": "ENSG00000100368" } }, "GRch38": { "90": { "location": "22:36913628-36940449", "ensembl_id": "ENSG00000100368" } } }, "hgnc_date_symbol_changed": "1991-08-07" }, "entity_type": "gene", "entity_name": "CSF2RB", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Pulmonary alveolar proteinosis" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EKLF" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6345", "gene_name": "Kruppel like factor 1", "omim_gene": [ "600599" ], "alias_name": [ "erythroid Kruppel-like factor" ], "gene_symbol": "KLF1", "hgnc_symbol": "KLF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:12995237-12997995", "ensembl_id": "ENSG00000105610" } }, "GRch38": { "90": { "location": "19:12884423-12887181", "ensembl_id": "ENSG00000105610" } } }, "hgnc_date_symbol_changed": "1999-12-14" }, "entity_type": "gene", "entity_name": "KLF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21055716", "33339573", "32815883", "32221653", "32032242", "31818881" ], "evidence": [ "Expert Review Green", "BabySeq Category C gene" ], "phenotypes": [ "Dyserythropoietic anaemia, congenital, type IV, MIM# 613673", "MONDO:0013355" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD240CE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10008", "gene_name": "Rh blood group CcEe antigens", "omim_gene": [ "111700" ], "alias_name": null, "gene_symbol": "RHCE", "hgnc_symbol": "RHCE", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:25688740-25756683", "ensembl_id": "ENSG00000188672" } }, "GRch38": { "90": { "location": "1:25362249-25430192", "ensembl_id": "ENSG00000188672" } } }, "hgnc_date_symbol_changed": "1993-10-22" }, "entity_type": "gene", "entity_name": "RHCE", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "9657766", "16271106", "25413218" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Rh-null disease, amorph type, MIM# 617970" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3366, "hash_id": null, "name": "Red cell disorders", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with red cell disorders, including anaemias and erythrocytosis.\r\n\r\nPlease refer to the Bone Marrow Failure panel if there is suspicion of pancytopaenia, and to the Diamond Blackfan Anaemia panel if specific features of DBA are present.\r\n\r\nWith thanks to Genomics England PanelApp/NHS Genomic Medicine Service for the original design of this panel.", "status": "public", "version": "1.52", "version_created": "2026-03-28T15:18:36.006857+11:00", "relevant_disorders": [ "Abnormal erythrocyte morphology", "HP:0001877" ], "stats": { "number_of_genes": 116, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "TGN", "AITD3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11764", "gene_name": "thyroglobulin", "omim_gene": [ "188450" ], "alias_name": null, "gene_symbol": "TG", "hgnc_symbol": "TG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:133879203-134147147", "ensembl_id": "ENSG00000042832" } }, "GRch38": { "90": { "location": "8:132866958-133134903", "ensembl_id": "ENSG00000042832" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "TG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27525530 (Nicholas et al.,2016) identify a monogenic and polygenic basis of disease.", "23164529" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Congenital hypothyroidism", "Thyroid dyshormonogenesis 3, 274700", "TDH3", "low thyroglobulin, goitre" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3471, "hash_id": null, "name": "Congenital hypothyroidism", "disease_group": "Endocrine disorders", "disease_sub_group": "Thyroid disorders", "description": "This panel contains genes associated with congenital hypothyroidism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'congenital hypothyroidism' panel V3.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.120", "version_created": "2026-04-02T11:51:29.895216+11:00", "relevant_disorders": [ "Hypothyroidism HP:0000821" ], "stats": { "number_of_genes": 63, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1592" ], "biotype": "protein_coding", "hgnc_id": "HGNC:105", "gene_name": "cyclin and CBS domain divalent metal cation transport mediator 4", "omim_gene": [ "607805" ], "alias_name": null, "gene_symbol": "CNNM4", "hgnc_symbol": "CNNM4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:97426639-97477628", "ensembl_id": "ENSG00000158158" } }, "GRch38": { "90": { "location": "2:96760902-96811891", "ensembl_id": "ENSG00000158158" } } }, "hgnc_date_symbol_changed": "1999-12-07" }, "entity_type": "gene", "entity_name": "CNNM4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19200527", "19200525", "30705057" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Jalili syndrome, MIM#217080", "cone-rod dystrophy and amelogenesis imperfecta" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3564, "hash_id": null, "name": "Amelogenesis imperfecta", "disease_group": "Skeletal disorders", "disease_sub_group": "", "description": "This panel contains genes associated with amelogenesis imperfecta, which is characterised by dental hypomineralisation and/or hypoplasia, resulting in discolouration, sensitivity and fragility. Both the primary and secondary dentition are commonly affected. Amelogenesis imperfecta can either be isolated or part of other rare disorders.\r\n\r\nConsider the Ectodermal Dysplasia panel if relevant clinical features are present (skin/hair/nail abnormalities) and dental findings are not typical.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel.", "status": "public", "version": "1.14", "version_created": "2026-01-09T15:02:14.439855+11:00", "relevant_disorders": [ "Amelogenesis imperfecta", "HP:0000705" ], "stats": { "number_of_genes": 41, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0083" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2939", "gene_name": "DNA replication helicase/nuclease 2", "omim_gene": [ "601810" ], "alias_name": null, "gene_symbol": "DNA2", "hgnc_symbol": "DNA2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:70173821-70231879", "ensembl_id": "ENSG00000138346" } }, "GRch38": { "90": { "location": "10:68414064-68472121", "ensembl_id": "ENSG00000138346" } } }, "hgnc_date_symbol_changed": "2008-01-08" }, "entity_type": "gene", "entity_name": "DNA2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24389050", "31045292" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Seckel syndrome 8, MIM:615807" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3631, "hash_id": null, "name": "Growth failure", "disease_group": "", "disease_sub_group": "", "description": "This panel contains genes associated with growth failure in infancy/early childhood, either isolated or as part of another disorder.\r\n\r\nConsider applying this panel in individuals with:\r\n -Height Standard Deviation Score (SDS) <-3 (very significant short stature - well below the 0.4th centile)\r\nAND at least one of:\r\n- History of small for gestational age (birth weight and/or length <-2SDS)\r\n- Body disproportion, e.g. discrepancy between stature and head size\r\n- Dysmorphic features and congenital anomalies\r\n- Abnormalities in the GH-IGF axis (evidence of GH insensitivity or deficiency) and/or other pituitary hormonal deficiencies\r\n- Family history of significant short stature (1st and 2nd degree relatives) and/or consanguinity\r\n\r\nPrior to genomic testing consider:\r\n-Chromosomal microarray analysis (e.g. Turner syndrome)\r\n-Methylation analysis for Russell-Silver syndrome and Temple syndrome\r\n-Skeletal survey\r\n\r\nAcquired causes of short stature are relatively common.\r\n\r\nDepending on the specific clinical features present, consider applying the Skeletal dysplasia, Intellectual Disability, and/or Pituitary Hormone deficiency panels.\r\n\r\nWith thanks to Genomics England for the original design of this panel.", "status": "public", "version": "1.102", "version_created": "2026-04-01T10:17:12.005431+11:00", "relevant_disorders": [ "Failure to thrive", "HP:0001508; Growth delay", "HP:0001510" ], "stats": { "number_of_genes": 204, "number_of_strs": 0, "number_of_regions": 4 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NMNAT", "PNAT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17877", "gene_name": "nicotinamide nucleotide adenylyltransferase 1", "omim_gene": [ "608700" ], "alias_name": null, "gene_symbol": "NMNAT1", "hgnc_symbol": "NMNAT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:10003486-10045559", "ensembl_id": "ENSG00000173614" } }, "GRch38": { "90": { "location": "1:9943428-9985501", "ensembl_id": "ENSG00000173614" } } }, "hgnc_date_symbol_changed": "2003-05-02" }, "entity_type": "gene", "entity_name": "NMNAT1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30004997", "33668384", "33308271", "33308271", "32150116", "22842230", "22842231", "22842227", "29184169" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Leber congenital amaurosis 9 MIM#608553", "Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual developmental disorder, and Leber congenital amaurosis MIM#619260" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3762, "hash_id": null, "name": "Congenital nystagmus", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with isolated or syndromic nystagmus presenting in infancy or early childhood.", "status": "public", "version": "1.24", "version_created": "2026-01-26T13:26:36.043723+11:00", "relevant_disorders": [ "Nystagmus HP:0000639" ], "stats": { "number_of_genes": 84, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MANA-ER", "MRT15", "ERManI" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6823", "gene_name": "mannosidase alpha class 1B member 1", "omim_gene": [ "604346" ], "alias_name": [ "endoplasmic reticulum alpha-mannosidase 1", "alpha 1,2-mannosidase", "endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1", "ER alpha 1,2-mannosidase", "Man9GlcNAc2-specific processing alpha-mannosidase", "endoplasmic Reticulum Class I alpha-mannosidase" ], "gene_symbol": "MAN1B1", "hgnc_symbol": "MAN1B1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:139981379-140003635", "ensembl_id": "ENSG00000177239" } }, "GRch38": { "90": { "location": "9:137086927-137109187", "ensembl_id": "ENSG00000177239" } } }, "hgnc_date_symbol_changed": "1999-09-28" }, "entity_type": "gene", "entity_name": "MAN1B1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Rafiq syndrome, MIM# 614202" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HNRBP2", "FOX-2", "HRNBP2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9906", "gene_name": "RNA binding fox-1 homolog 2", "omim_gene": [ "612149" ], "alias_name": [ "hexaribonucleotide binding protein 2" ], "gene_symbol": "RBFOX2", "hgnc_symbol": "RBFOX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:36134783-36424473", "ensembl_id": "ENSG00000100320" } }, "GRch38": { "90": { "location": "22:35738736-36028425", "ensembl_id": "ENSG00000100320" } } }, "hgnc_date_symbol_changed": "2010-09-10" }, "entity_type": "gene", "entity_name": "RBFOX2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26785492", "27670201", "27485310", "25205790", "35137168", "26785492", "37165897" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "RBFOX2-related congenital heart disorder (MONDO:0100557)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ubi-d4", "BAF45d" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9964", "gene_name": "double PHD fingers 2", "omim_gene": [ "601671" ], "alias_name": null, "gene_symbol": "DPF2", "hgnc_symbol": "DPF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:65101225-65120720", "ensembl_id": "ENSG00000133884" } }, "GRch38": { "90": { "location": "11:65333754-65353249", "ensembl_id": "ENSG00000133884" } } }, "hgnc_date_symbol_changed": "2003-10-08" }, "entity_type": "gene", "entity_name": "DPF2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29429572", "31706665" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Coffin-Siris syndrome 7, MIM#618027" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AMSH" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16950", "gene_name": "STAM binding protein", "omim_gene": [ "606247" ], "alias_name": null, "gene_symbol": "STAMBP", "hgnc_symbol": "STAMBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:74056086-74100786", "ensembl_id": "ENSG00000124356" } }, "GRch38": { "90": { "location": "2:73828916-73873659", "ensembl_id": "ENSG00000124356" } } }, "hgnc_date_symbol_changed": "2004-02-04" }, "entity_type": "gene", "entity_name": "STAMBP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23542699", "31638258", "29907875", "27531570", "25692795", "25266620" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Microcephaly-capillary malformation syndrome, MIM# 614261", "MONDO:0013659" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LTBP-4", "LTBP-4L", "FLJ46318", "FLJ90018" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6717", "gene_name": "latent transforming growth factor beta binding protein 4", "omim_gene": [ "604710" ], "alias_name": null, "gene_symbol": "LTBP4", "hgnc_symbol": "LTBP4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:41098789-41135725", "ensembl_id": "ENSG00000090006" } }, "GRch38": { "90": { "location": "19:40592883-40629818", "ensembl_id": "ENSG00000090006" } } }, "hgnc_date_symbol_changed": "1998-11-18" }, "entity_type": "gene", "entity_name": "LTBP4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26866239", "22829427", "19836010" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Cutis laxa, autosomal recessive, type IC, #613177" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NSRD2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7606", "gene_name": "myosin VIIA", "omim_gene": [ "276903" ], "alias_name": null, "gene_symbol": "MYO7A", "hgnc_symbol": "MYO7A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:76839310-76926284", "ensembl_id": "ENSG00000137474" } }, "GRch38": { "90": { "location": "11:77128264-77215239", "ensembl_id": "ENSG00000137474" } } }, "hgnc_date_symbol_changed": "1992-06-08" }, "entity_type": "gene", "entity_name": "MYO7A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29400105", "8160750" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Usher syndrome, type 1B, MIM# 276900" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CMTX5", "DFNX1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9462", "gene_name": "phosphoribosyl pyrophosphate synthetase 1", "omim_gene": [ "311850" ], "alias_name": [ "PRS I", "ribose-phosphate diphosphokinase 1" ], "gene_symbol": "PRPS1", "hgnc_symbol": "PRPS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:106871737-106894256", "ensembl_id": "ENSG00000147224" } }, "GRch38": { "90": { "location": "X:107628424-107651026", "ensembl_id": "ENSG00000147224" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "PRPS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "PRPS1 deficiency disorder MONDO:0100061", "Phosphoribosylpyrophosphate synthetase superactivity MIM#300661 MONDO:0010395" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "hRad50", "RAD50-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9816", "gene_name": "RAD50 double strand break repair protein", "omim_gene": [ "604040" ], "alias_name": null, "gene_symbol": "RAD50", "hgnc_symbol": "RAD50", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:131891711-131980313", "ensembl_id": "ENSG00000113522" } }, "GRch38": { "90": { "location": "5:132556019-132646344", "ensembl_id": "ENSG00000113522" } } }, "hgnc_date_symbol_changed": "1999-07-23" }, "entity_type": "gene", "entity_name": "RAD50", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19409520", "32212377", "33378670" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Nijmegen breakage syndrome-like disorder, MIM# 613078" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ABP-280" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3754", "gene_name": "filamin A", "omim_gene": [ "300017" ], "alias_name": [ "actin binding protein 280", "alpha filamin" ], "gene_symbol": "FLNA", "hgnc_symbol": "FLNA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:153576892-153603006", "ensembl_id": "ENSG00000196924" } }, "GRch38": { "90": { "location": "X:154348524-154374638", "ensembl_id": "ENSG00000196924" } } }, "hgnc_date_symbol_changed": "1993-03-18" }, "entity_type": "gene", "entity_name": "FLNA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30089473", "26471271", "22366253" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "FG syndrome 2, MIM#300321", "Frontometaphyseal dysplasia 1, MIM#305620", "Heterotopia, periventricular, 1, MIM#300049", "Intestinal pseudoobstruction, neuronal, MIM#300048", "Melnick-Needles syndrome, MIM#309350", "Otopalatodigital syndrome, type I, MIM#311300", "Otopalatodigital syndrome, type II, MIM#304120", "Terminal osseous dysplasia, MIM#300244" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:634", "gene_name": "aquaporin 2", "omim_gene": [ "107777" ], "alias_name": null, "gene_symbol": "AQP2", "hgnc_symbol": "AQP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:50344524-50352664", "ensembl_id": "ENSG00000167580" } }, "GRch38": { "90": { "location": "12:49950741-49958881", "ensembl_id": "ENSG00000167580" } } }, "hgnc_date_symbol_changed": "1993-07-09" }, "entity_type": "gene", "entity_name": "AQP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "7537761", "11536078" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Diabetes insipidus, nephrogenic, type 2 MIM# 125800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5401", "gene_name": "SP110 nuclear body protein", "omim_gene": [ "604457" ], "alias_name": null, "gene_symbol": "SP110", "hgnc_symbol": "SP110", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:231032009-231090444", "ensembl_id": "ENSG00000135899" } }, "GRch38": { "90": { "location": "2:230167293-230225729", "ensembl_id": "ENSG00000135899" } } }, "hgnc_date_symbol_changed": "2001-12-20" }, "entity_type": "gene", "entity_name": "SP110", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BabySeq Category A gene" ], "phenotypes": [ "Hepatic veno-occlusive disease with immunodeficiency MIM#235550" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "immunological" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC2840" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23161", "gene_name": "ALG8, alpha-1,3-glucosyltransferase", "omim_gene": [ "608103" ], "alias_name": [ "dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase" ], "gene_symbol": "ALG8", "hgnc_symbol": "ALG8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:77811982-77850706", "ensembl_id": "ENSG00000159063" } }, "GRch38": { "90": { "location": "11:78100936-78139660", "ensembl_id": "ENSG00000159063" } } }, "hgnc_date_symbol_changed": "2003-10-15" }, "entity_type": "gene", "entity_name": "ALG8", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category A gene" ], "phenotypes": [ "Congenital disorder of glycosylation, type Ih, MIM# 608104" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NY-BR-96", "LYK5", "Stlk", "STRAD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30172", "gene_name": "STE20-related kinase adaptor alpha", "omim_gene": [ "608626" ], "alias_name": [ "STE20-like pseudokinase" ], "gene_symbol": "STRADA", "hgnc_symbol": "STRADA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:61780192-61819330", "ensembl_id": "ENSG00000266173" } }, "GRch38": { "90": { "location": "17:63682336-63741986", "ensembl_id": "ENSG00000266173" } } }, "hgnc_date_symbol_changed": "2008-09-15" }, "entity_type": "gene", "entity_name": "STRADA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30311510, 28688840, 27170158, 17522105" ], "evidence": [ "Expert Review Green", "Literature", "Literature" ], "phenotypes": [ "Polyhydramnios, megalencephaly, and symptomatic epilepsy", "OMIM #611087" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3993, "hash_id": null, "name": "Renal Tubulopathies and related disorders", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel was developed/updated in Dec'22 and is maintained by the KidGen Collaborative, and is a consensus panel used by VCGS, GHQ, and RMH.\r\n\r\nThis panel contains genes that cause:\r\n-renal tubular disorders\r\n-electrolyte abnormalities (e.g. Na, K, H, Mg, Ca, PO4, Cl, HCO3)\r\n-aldosterone abnormalities\r\n-nephrolithiasis\r\n-metabolic renal diseases \r\n\r\nIt supersedes the following panels: Bartter syndrome, Dent disease, Diabetes Insipidus, Hyperoxaluria, Metabolic renal disease, Nephrolithiasis and Nephrocalcinosis, Renal abnormalities of calcium and phosphate metabolism, Renal Abnormalities of Magnesium Metabolism, Renal Hypertension and Disorders of Aldosterone Metabolism, and Renal Tubulopathies_KidGen.", "status": "public", "version": "1.26", "version_created": "2026-03-30T10:01:51.458813+11:00", "relevant_disorders": [ "Renal tubular dysfunction", "HP:0000124; Nephrolithiasis", "HP:0000787; Abnormal circulating aldosterone", "HP:0040085" ], "stats": { "number_of_genes": 134, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GCST", "NKH" ], "biotype": "protein_coding", "hgnc_id": "HGNC:473", "gene_name": "aminomethyltransferase", "omim_gene": [ "238310" ], "alias_name": [ "glycine cleavage system protein T" ], "gene_symbol": "AMT", "hgnc_symbol": "AMT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:49454211-49460186", "ensembl_id": "ENSG00000145020" } }, "GRch38": { "90": { "location": "3:49416775-49422753", "ensembl_id": "ENSG00000145020" } } }, "hgnc_date_symbol_changed": "1992-04-08" }, "entity_type": "gene", "entity_name": "AMT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16450403", "27362913", "16450403", "30350008", "26179960", "20301531", "25231368", "35646099" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Glycine encephalopathy MIM#620398" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HSP78", "SKD3", "FLJ13152", "ANKCLB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30664", "gene_name": "ClpB homolog, mitochondrial AAA ATPase chaperonin", "omim_gene": [ "616254" ], "alias_name": [ "suppressor of potassium transport defect 3", "ankyrin-repeat containing bacterial clp fusion" ], "gene_symbol": "CLPB", "hgnc_symbol": "CLPB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:72003469-72145692", "ensembl_id": "ENSG00000162129" } }, "GRch38": { "90": { "location": "11:72292425-72434680", "ensembl_id": "ENSG00000162129" } } }, "hgnc_date_symbol_changed": "2005-10-04" }, "entity_type": "gene", "entity_name": "CLPB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "34140661" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "3-methylglutaconic aciduria, type VIIB, autosomal recessive (MIM#616271)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:8653", "gene_name": "propionyl-CoA carboxylase alpha subunit", "omim_gene": [ "232000" ], "alias_name": null, "gene_symbol": "PCCA", "hgnc_symbol": "PCCA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:100741269-101182686", "ensembl_id": "ENSG00000175198" } }, "GRch38": { "90": { "location": "13:100089015-100530437", "ensembl_id": "ENSG00000175198" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "PCCA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17966092", "10101253", "9887338" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Propionicacidaemia, MIM#606054" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SBF", "pHZ-1", "STAF" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12928", "gene_name": "zinc finger protein 143", "omim_gene": [ "603433" ], "alias_name": null, "gene_symbol": "ZNF143", "hgnc_symbol": "ZNF143", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:9481866-9550071", "ensembl_id": "ENSG00000166478" } }, "GRch38": { "90": { "location": "11:9460319-9528524", "ensembl_id": "ENSG00000166478" } } }, "hgnc_date_symbol_changed": "1993-06-07" }, "entity_type": "gene", "entity_name": "ZNF143", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "27349184", "33845046", "9009278", "22268977", "27349184", "27349184" ], "evidence": [ "Expert Review Amber", "Literature", "Expert Review Red", "Expert Review" ], "phenotypes": [ "methylmalonic aciduria and homocystinuria MONDO:0016826" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4257, "hash_id": null, "name": "Vitamin metabolism disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "The gene panel contains genes that cause inborn errors of vitamin metabolism.\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.7", "version_created": "2024-09-18T09:35:00.495806+10:00", "relevant_disorders": [ "Abnormality of vitamin metabolism", "HP:0100508" ], "stats": { "number_of_genes": 62, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11199", "gene_name": "SRY-box 3", "omim_gene": [ "313430" ], "alias_name": null, "gene_symbol": "SOX3", "hgnc_symbol": "SOX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:139585152-139587225", "ensembl_id": "ENSG00000134595" } }, "GRch38": { "90": { "location": "X:140502985-140505116", "ensembl_id": "ENSG00000134595" } } }, "hgnc_date_symbol_changed": "1993-11-30" }, "entity_type": "gene", "entity_name": "SOX3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24346842", "15800844", "21289259", "24737742" ], "evidence": [ "Genomics England PanelApp", "Expert Review Green", "Expert Review Green" ], "phenotypes": [ "Panhypopituitarism, X-linked (312000)", "Mental retardation, X-linked, with isolated growth hormone deficiency (300123)" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [ "SV/CNV" ], "panel": { "id": 4521, "hash_id": null, "name": "Hypogonadotropic hypogonadism", "disease_group": "Endocrine disorders", "disease_sub_group": "Pituitary disorders", "description": "This panel contains genes associated with hypogonadotropic hypogonadism.\r\n\r\nIt includes genes from the Genomics England PanelApp 'hypogonadotropic hypogonadism' panel V1.42. \r\n\r\nFor multiple pituitary hormone deficiencies, apply Pituitary hormone deficiency panel.", "status": "public", "version": "0.111", "version_created": "2026-04-04T15:37:44.052003+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 83, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699427 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [], "panel": { "id": 24, "hash_id": null, "name": "Early-onset Dementia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.58", "version_created": "2026-03-31T16:43:37.497568+11:00", "relevant_disorders": [ "Cognitive impairment", "HP:0100543" ], "stats": { "number_of_genes": 96, "number_of_strs": 6, "number_of_regions": 0 }, "types": [ { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } } ] }