Search Entities

GET /api/v1/entities/?format=api&page=36
HTTP 200 OK
Allow: GET, HEAD, OPTIONS
Content-Type: application/json
Vary: Accept

{
    "count": 36035,
    "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=37",
    "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=35",
    "results": [
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:613",
                "gene_name": "apolipoprotein E",
                "omim_gene": [
                    "107741"
                ],
                "alias_name": null,
                "gene_symbol": "APOE",
                "hgnc_symbol": "APOE",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:45409011-45412650",
                            "ensembl_id": "ENSG00000130203"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:44905754-44909393",
                            "ensembl_id": "ENSG00000130203"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "APOE",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Amber",
                "Melbourne Genomics Health Alliance Complex Neurology Flagship",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Alzheimer disease 2, MIM# 104310"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 24,
                "hash_id": null,
                "name": "Early-onset Dementia",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.",
                "status": "public",
                "version": "1.58",
                "version_created": "2026-03-31T16:43:37.497568+11:00",
                "relevant_disorders": [
                    "Cognitive impairment",
                    "HP:0100543"
                ],
                "stats": {
                    "number_of_genes": 96,
                    "number_of_strs": 6,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA0610",
                    "TAHCCP1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:18514",
                "gene_name": "spartin",
                "omim_gene": [
                    "607111"
                ],
                "alias_name": [
                    "spartin"
                ],
                "gene_symbol": "SPART",
                "hgnc_symbol": "SPART",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "13:36875775-36944317",
                            "ensembl_id": "ENSG00000133104"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "13:36301638-36370180",
                            "ensembl_id": "ENSG00000133104"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2017-05-30"
            },
            "entity_type": "gene",
            "entity_name": "SPART",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Red",
                "Melbourne Genomics Health Alliance Complex Neurology Flagship",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 24,
                "hash_id": null,
                "name": "Early-onset Dementia",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause frontotemporal dementia (FTD), Alzheimer's disease, other forms of dementia, and adult-onset cognitive decline. It is currently maintained by VCGS and RMH. The base panel (17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.",
                "status": "public",
                "version": "1.58",
                "version_created": "2026-03-31T16:43:37.497568+11:00",
                "relevant_disorders": [
                    "Cognitive impairment",
                    "HP:0100543"
                ],
                "stats": {
                    "number_of_genes": 96,
                    "number_of_strs": 6,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DPC4"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6770",
                "gene_name": "SMAD family member 4",
                "omim_gene": [
                    "600993"
                ],
                "alias_name": null,
                "gene_symbol": "SMAD4",
                "hgnc_symbol": "SMAD4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "18:48494410-48611415",
                            "ensembl_id": "ENSG00000141646"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "18:51028394-51085045",
                            "ensembl_id": "ENSG00000141646"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-05-26"
            },
            "entity_type": "gene",
            "entity_name": "SMAD4",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "28406602"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature",
                "Expert list"
            ],
            "phenotypes": [
                "Myhre syndrome - OMIM#139210",
                "MONDO:0007688"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 28,
                "hash_id": null,
                "name": "Skeletal Dysplasia_Fetal",
                "disease_group": "Skeletal disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and used by the Melbourne Genomics Perinatal Autopsy Flagship. It is maintained by VCGS.\r\n\r\nIt contains genes associated with conditions primarily affecting bone and cartilage that present prenatally.\r\n\r\nPlease consider the larger Fetal Anomalies and Skeletal Dysplasia panels, or other specific panels such as Growth Failure, Craniosynostosis, Radial ray abnormalities, Polydactyly or Limb and Digital Malformations depending on the clinical presentation.",
                "status": "public",
                "version": "0.246",
                "version_created": "2026-03-02T10:22:48.751874+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 157,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ22688",
                    "Fy"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:26219",
                "gene_name": "fuzzy planar cell polarity protein",
                "omim_gene": [
                    "610622"
                ],
                "alias_name": null,
                "gene_symbol": "FUZ",
                "hgnc_symbol": "FUZ",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:50310126-50320633",
                            "ensembl_id": "ENSG00000010361"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:49806869-49817376",
                            "ensembl_id": "ENSG00000010361"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-06-21"
            },
            "entity_type": "gene",
            "entity_name": "FUZ",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID: 38702430, 29068549, 34719684"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Ciliopathy_MONDO_0005308, FUZ-related",
                "skeletal ciliopathy"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 28,
                "hash_id": null,
                "name": "Skeletal Dysplasia_Fetal",
                "disease_group": "Skeletal disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and used by the Melbourne Genomics Perinatal Autopsy Flagship. It is maintained by VCGS.\r\n\r\nIt contains genes associated with conditions primarily affecting bone and cartilage that present prenatally.\r\n\r\nPlease consider the larger Fetal Anomalies and Skeletal Dysplasia panels, or other specific panels such as Growth Failure, Craniosynostosis, Radial ray abnormalities, Polydactyly or Limb and Digital Malformations depending on the clinical presentation.",
                "status": "public",
                "version": "0.246",
                "version_created": "2026-03-02T10:22:48.751874+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 157,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "LOC255275"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:34548",
                "gene_name": "myeloid associated differentiation marker like 2",
                "omim_gene": null,
                "alias_name": null,
                "gene_symbol": "MYADML2",
                "hgnc_symbol": "MYADML2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:79897521-79905109",
                            "ensembl_id": "ENSG00000185105"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:81939645-81947233",
                            "ensembl_id": "ENSG00000185105"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2008-10-15"
            },
            "entity_type": "gene",
            "entity_name": "MYADML2",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "32778762"
            ],
            "evidence": [
                "Expert Review Red",
                "Literature",
                "Literature"
            ],
            "phenotypes": [
                "MYADML2-related connective tissue disroder MONDO:0003900"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [
                "SV/CNV"
            ],
            "panel": {
                "id": 44,
                "hash_id": null,
                "name": "Aortopathy_Connective Tissue Disorders",
                "disease_group": "Cardiovascular disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS and is a consensus panel used by RMH.\r\n\r\nIt contains genes that cause isolated thoracic aortic aneurysm; connective tissue disorders, including Ehlers Danlos syndromes and cutis laxa; and other syndromic/multi-system disorders where connective tissue involvement is prominent.\r\n\r\nThis panel incorporates assessments from the ClinGen Familial Thoracic Aortic Aneurysm and Dissection Gene Curation Expert Panel (PMID: 30071989) and the  \r\nThe 2017 international classification of the Ehlers-Danlos syndromes (PMID: 28306229).\r\n\r\nThe panel has been compared against the Genomics England PanelApp 'Thoracic Aortic Aneurysm and Dissection' and 'Ehlers Danlos syndrome' panels, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England.\r\n\r\nFurther comparison and consolidation undertaken against the Genomics England/GMS 'Thoracic aortic aneurysm and dissection' panel V4.0 in July 2025.",
                "status": "public",
                "version": "1.105",
                "version_created": "2026-02-05T18:09:24.690760+11:00",
                "relevant_disorders": [
                    "Aortic aneurysm",
                    "HP:0004942;Joint dislocation",
                    "HP:0001373;Cutis laxa",
                    "HP:0000973; Ectopia lentis",
                    "HP:0001083;Arachnodactyly",
                    "HP:0001166"
                ],
                "stats": {
                    "number_of_genes": 100,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "RPD3"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:13315",
                "gene_name": "histone deacetylase 8",
                "omim_gene": [
                    "300269"
                ],
                "alias_name": null,
                "gene_symbol": "HDAC8",
                "hgnc_symbol": "HDAC8",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:71549366-71792953",
                            "ensembl_id": "ENSG00000147099"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:72329516-72573103",
                            "ensembl_id": "ENSG00000147099"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-09-06"
            },
            "entity_type": "gene",
            "entity_name": "HDAC8",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "30614194",
                "24403048"
            ],
            "evidence": [
                "Expert Review Red",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Cornelia de Lange syndrome 5, MIM# 300882"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "tags": [],
            "panel": {
                "id": 69,
                "hash_id": null,
                "name": "Congenital diaphragmatic hernia",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS and contains genes associated with syndromic and non-syndromic congenital diaphragmatic hernia.\r\n\r\nNote pathogenic variants in a broad range of genes have been ascertained in CDH cohorts (e.g. PMID 33461977), so a broader testing approach is recommended particularly in the perinatal period.",
                "status": "public",
                "version": "1.18",
                "version_created": "2025-11-21T16:59:26.431729+11:00",
                "relevant_disorders": [
                    "Congenital diaphragmatic hernia HP:0000776"
                ],
                "stats": {
                    "number_of_genes": 49,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DKFZp434H247",
                    "MED2"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:23074",
                "gene_name": "mediator complex subunit 29",
                "omim_gene": [
                    "612914"
                ],
                "alias_name": null,
                "gene_symbol": "MED29",
                "hgnc_symbol": "MED29",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:39881943-39891277",
                            "ensembl_id": "ENSG00000063322"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:39391303-39400637",
                            "ensembl_id": "ENSG00000063322"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2007-07-30"
            },
            "entity_type": "gene",
            "entity_name": "MED29",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID: 40745490"
            ],
            "evidence": [
                "Expert Review Amber",
                "Literature"
            ],
            "phenotypes": [
                "Pontocerebellar hypoplasia, MONDO:0020135, MED29-related"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 72,
                "hash_id": null,
                "name": "Cerebellar and Pontocerebellar Hypoplasia",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the panels used by VCGS and RMH and is a consensus panel maintained by both.",
                "status": "public",
                "version": "1.100",
                "version_created": "2026-04-02T11:42:58.167964+11:00",
                "relevant_disorders": [
                    "Aplasia/hypoplasia of the cerebellum HP:0007360;Pontocerebellar atrophy HP:0006879"
                ],
                "stats": {
                    "number_of_genes": 122,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA1577"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29316",
                "gene_name": "zinc finger SWIM-type containing 6",
                "omim_gene": [
                    "615951"
                ],
                "alias_name": null,
                "gene_symbol": "ZSWIM6",
                "hgnc_symbol": "ZSWIM6",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "5:60628100-60841997",
                            "ensembl_id": "ENSG00000130449"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "5:61332273-61546170",
                            "ensembl_id": "ENSG00000130449"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-12-17"
            },
            "entity_type": "gene",
            "entity_name": "ZSWIM6",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID: 29198722"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, OMIM #617865"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 73,
                "hash_id": null,
                "name": "Cerebral Palsy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "Cerebral palsy (CP) is a non-progressive neurodevelopmental disorder characterized by motor impairments, often accompanied by intellectual disability, epilepsy, visual and hearing impairment and speech and language deficits.\r\n\r\nPMID 33528536 reported a cohort of 1345 individuals undergoing genomic testing. Diagnostic yield ranged between 10-30% depending on presence of additional characteristics such as ID/epilepsy/ASD.\r\n\r\nThe aetiology of cerebral palsy is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia, Ataxia, Malformations of Cortical Development, Mitochondrial Disorders and the Bleeding and Platelet Disorders panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Jozef Gecz, Clare van Eyk, Luisa Weiss and team for their contribution to the development of this panel.",
                "status": "public",
                "version": "1.410",
                "version_created": "2026-02-17T16:35:59.013988+11:00",
                "relevant_disorders": [
                    "Cerebral palsy HP:0100021"
                ],
                "stats": {
                    "number_of_genes": 364,
                    "number_of_strs": 0,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "Eu-HMTase1",
                    "FLJ12879",
                    "KIAA1876",
                    "bA188C12.1",
                    "KMT1D",
                    "FLJ40292"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:24650",
                "gene_name": "euchromatic histone lysine methyltransferase 1",
                "omim_gene": [
                    "607001"
                ],
                "alias_name": null,
                "gene_symbol": "EHMT1",
                "hgnc_symbol": "EHMT1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:140513444-140764468",
                            "ensembl_id": "ENSG00000181090"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:137618963-137870016",
                            "ensembl_id": "ENSG00000181090"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-06-01"
            },
            "entity_type": "gene",
            "entity_name": "EHMT1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "16826528",
                "19264732",
                "19293338",
                "22670143",
                "30448833"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Kleefstra syndrome 1, MIM# 610253",
                "MONDO:0027407"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [
                "SV/CNV"
            ],
            "panel": {
                "id": 76,
                "hash_id": null,
                "name": "Congenital Heart Defect",
                "disease_group": "Cardiovascular disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.",
                "status": "public",
                "version": "0.534",
                "version_created": "2026-03-30T13:14:35.719896+11:00",
                "relevant_disorders": [
                    "Abnormal heart morphology HP:0001627"
                ],
                "stats": {
                    "number_of_genes": 253,
                    "number_of_strs": 1,
                    "number_of_regions": 10
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA1119"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7603",
                "gene_name": "myosin VB",
                "omim_gene": [
                    "606540"
                ],
                "alias_name": null,
                "gene_symbol": "MYO5B",
                "hgnc_symbol": "MYO5B",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "18:47349183-47721463",
                            "ensembl_id": "ENSG00000167306"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "18:49822813-50195093",
                            "ensembl_id": "ENSG00000167306"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1996-04-04"
            },
            "entity_type": "gene",
            "entity_name": "MYO5B",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "28027573",
                "27532546",
                "33525641"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Microvillus inclusion disease, MIM#251850",
                "Cholestasis, progressive familial intrahepatic, 10, MIM# 619868"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 78,
                "hash_id": null,
                "name": "Cholestasis",
                "disease_group": "Gastroenterological disorders",
                "disease_sub_group": "",
                "description": "This panel was developed by and is maintained by VCGS.\r\n\r\nIt includes primary liver disorders as well as metabolic and other multi-system disorders that have been reported to cause cholestasis.\r\n\r\nPlease also consider using the Liver Failure_Paediatric panel if clinically indicated.\r\n\r\nThe content of this panel has been compared against the Genomics England PanelApp 'Cholestasis' panel V1.21, with all discrepancies reviewed and resolved, and reciprocal feedback provided to Genomics England.",
                "status": "public",
                "version": "1.10",
                "version_created": "2026-03-26T17:26:27.105917+11:00",
                "relevant_disorders": [
                    "Cholestasis HP:0001396"
                ],
                "stats": {
                    "number_of_genes": 99,
                    "number_of_strs": 0,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "SLSN4",
                    "KIAA0673",
                    "POC10"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:19104",
                "gene_name": "nephrocystin 4",
                "omim_gene": [
                    "607215"
                ],
                "alias_name": [
                    "nephroretinin",
                    "POC10 centriolar protein homolog (Chlamydomonas)"
                ],
                "gene_symbol": "NPHP4",
                "hgnc_symbol": "NPHP4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:5922871-6052533",
                            "ensembl_id": "ENSG00000131697"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:5862811-5992473",
                            "ensembl_id": "ENSG00000131697"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-10-03"
            },
            "entity_type": "gene",
            "entity_name": "NPHP4",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "12244321",
                "12205563",
                "34013113"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Nephronophthisis 4, MIM# 606966",
                "Senior-Loken syndrome 4, MIM# 606996"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 84,
                "hash_id": null,
                "name": "Ciliopathies",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was created by merging the Ciliopathy panels created by VCGS and RMH and is a consensus panel used by both.\r\n\r\nIt covers conditions caused by mutations in the genes encoding non-motile cilia components as well as a small number of conditions that can present as phenocopies.\r\n\r\nPlease note a number of smaller panels are available that cover specific ciliopathy phenotypes such as Bardet-Biedl syndrome, Jeune syndrome and Joubert syndrome.\r\n\r\nPlease refer to the Ciliary Dyskinesia panel for conditions caused by mutations in genes encoding components of the motile cilia, which present with predominantly respiratory phenotypes.",
                "status": "public",
                "version": "1.99",
                "version_created": "2026-02-26T20:47:06.255758+11:00",
                "relevant_disorders": [
                    "Ciliopathy",
                    "MONDO:0005308"
                ],
                "stats": {
                    "number_of_genes": 158,
                    "number_of_strs": 0,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MGC33196",
                    "KIAA1336",
                    "IFT121",
                    "IFTA1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29250",
                "gene_name": "WD repeat domain 35",
                "omim_gene": [
                    "613602"
                ],
                "alias_name": null,
                "gene_symbol": "WDR35",
                "hgnc_symbol": "WDR35",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:20110021-20189892",
                            "ensembl_id": "ENSG00000118965"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:19910260-19990131",
                            "ensembl_id": "ENSG00000118965"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-03-02"
            },
            "entity_type": "gene",
            "entity_name": "WDR35",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "33421337",
                "29134781",
                "28870638",
                "26691894",
                "24027799",
                "21473986"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Cranioectodermal dysplasia 2, MIM#613610",
                "MONDO:0013323",
                "Short-rib thoracic dysplasia 7 with or without polydactyly, MIM#614091",
                "MONDO:0013569"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 84,
                "hash_id": null,
                "name": "Ciliopathies",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was created by merging the Ciliopathy panels created by VCGS and RMH and is a consensus panel used by both.\r\n\r\nIt covers conditions caused by mutations in the genes encoding non-motile cilia components as well as a small number of conditions that can present as phenocopies.\r\n\r\nPlease note a number of smaller panels are available that cover specific ciliopathy phenotypes such as Bardet-Biedl syndrome, Jeune syndrome and Joubert syndrome.\r\n\r\nPlease refer to the Ciliary Dyskinesia panel for conditions caused by mutations in genes encoding components of the motile cilia, which present with predominantly respiratory phenotypes.",
                "status": "public",
                "version": "1.99",
                "version_created": "2026-02-26T20:47:06.255758+11:00",
                "relevant_disorders": [
                    "Ciliopathy",
                    "MONDO:0005308"
                ],
                "stats": {
                    "number_of_genes": 158,
                    "number_of_strs": 0,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ23191"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:26256",
                "gene_name": "neuron derived neurotrophic factor",
                "omim_gene": [
                    "616506"
                ],
                "alias_name": null,
                "gene_symbol": "NDNF",
                "hgnc_symbol": "NDNF",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "4:121956768-121994176",
                            "ensembl_id": "ENSG00000173376"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "4:121035613-121073021",
                            "ensembl_id": "ENSG00000173376"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2011-07-05"
            },
            "entity_type": "gene",
            "entity_name": "NDNF",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "31883645",
                "40788466",
                "36454653"
            ],
            "evidence": [
                "Literature",
                "Expert Review Amber",
                "Literature"
            ],
            "phenotypes": [
                "Hypogonadotropic hypogonadism 25 with anosmia MIM#618841"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 99,
                "hash_id": null,
                "name": "Differences of Sex Development",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.",
                "status": "public",
                "version": "1.47",
                "version_created": "2026-04-06T10:50:25.990411+10:00",
                "relevant_disorders": [
                    "Abnormality of the genital system",
                    "HP:0000078"
                ],
                "stats": {
                    "number_of_genes": 141,
                    "number_of_strs": 1,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "nNOS"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7872",
                "gene_name": "nitric oxide synthase 1",
                "omim_gene": [
                    "163731"
                ],
                "alias_name": null,
                "gene_symbol": "NOS1",
                "hgnc_symbol": "NOS1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:117645947-117889975",
                            "ensembl_id": "ENSG00000089250"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:117208142-117452170",
                            "ensembl_id": "ENSG00000089250"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1992-06-09"
            },
            "entity_type": "gene",
            "entity_name": "NOS1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "36197968"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature",
                "Literature"
            ],
            "phenotypes": [
                "Hypogonadotropic hypogonadism, MONDO:0018555"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 99,
                "hash_id": null,
                "name": "Differences of Sex Development",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.",
                "status": "public",
                "version": "1.47",
                "version_created": "2026-04-06T10:50:25.990411+10:00",
                "relevant_disorders": [
                    "Abnormality of the genital system",
                    "HP:0000078"
                ],
                "stats": {
                    "number_of_genes": 141,
                    "number_of_strs": 1,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6416",
                "gene_name": "keratin 14",
                "omim_gene": [
                    "148066"
                ],
                "alias_name": [
                    "epidermolysis bullosa simplex, Dowling-Meara, Koebner"
                ],
                "gene_symbol": "KRT14",
                "hgnc_symbol": "KRT14",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:39738531-39743173",
                            "ensembl_id": "ENSG00000186847"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:41582279-41586921",
                            "ensembl_id": "ENSG00000186847"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1992-04-09"
            },
            "entity_type": "gene",
            "entity_name": "KRT14",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "Other",
            "publications": [
                "16960809",
                "18049449"
            ],
            "evidence": [
                "Expert Review Green",
                "NHS GMS",
                "Expert Review Green",
                "Expert Review Green",
                "Victorian Clinical Genetics Services",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Epidermolysis bullosa simplex, recessive 1, 601001",
                "Dermatopathia pigmentosa reticularis, 125595",
                "Epidermolysis bullosa simplex, Dowling-Meara type, 131760",
                "Epidermolysis bullosa simplex, Koebner type, 131900",
                "Epidermolysis bullosa simplex, Weber-Cockayne type, 131800",
                "Naegeli-Franceschetti-Jadassohn syndrome, 161000"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 101,
                "hash_id": null,
                "name": "Epidermolysis bullosa",
                "disease_group": "Dermatological disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause epidermolysis bullosa, as well as genes that cause other blistering and peeling skin disorders. Including those described as EB-related disorders in Has et al 2020 (PMID: 32017015).\r\n\r\nThis panel has been compared against the Genomics England 'Epidermolysis bullosa and congenital skin fragility' with all discrepancies resolved and reciprocal feedback provided to Genomics England, 10/8/2020.\r\n\r\nThis panel was created by merging the panels developed by VCGS and RMH.",
                "status": "public",
                "version": "1.27",
                "version_created": "2026-03-08T22:19:30.435795+11:00",
                "relevant_disorders": [
                    "Abnormal blistering of the skin",
                    "HP:0008066"
                ],
                "stats": {
                    "number_of_genes": 46,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MTPB"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:4803",
                "gene_name": "hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit beta",
                "omim_gene": [
                    "143450"
                ],
                "alias_name": [
                    "mitochondrial trifunctional protein, beta subunit"
                ],
                "gene_symbol": "HADHB",
                "hgnc_symbol": "HADHB",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:26466038-26513336",
                            "ensembl_id": "ENSG00000138029"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:26243170-26290468",
                            "ensembl_id": "ENSG00000138029"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1994-12-16"
            },
            "entity_type": "gene",
            "entity_name": "HADHB",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "30682426",
                "28515471"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Trifunctional protein deficiency, MIM# 609015"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [
                "treatable"
            ],
            "panel": {
                "id": 103,
                "hash_id": null,
                "name": "Fatty Acid Oxidation Defects",
                "disease_group": "Metabolic disorders",
                "disease_sub_group": "",
                "description": "Fatty acid oxidation disorders (FAODs) are inborn errors of metabolism caused by disruption of either mitochondrial β-oxidation or the fatty acid transport using the carnitine transport pathway. The clinical presentation of a FAOD depends on the specific disorder, but commonly includes cardiomyopathy in the newborn period, liver dysfunction and hypoketotic hypoglycaemia during infancy and childhood, and episodic rhabdomyolysis during or after adolescence.\r\n\r\nThis panel was developed and is maintained by VCGS and is a consensus panel used by RMH.\r\n\r\nIt incorporates assessments by the ClinGen Fatty Acid Oxidation Disorders Working Group, McGlaughon et al 2019, PMID: 31399326.",
                "status": "public",
                "version": "1.15",
                "version_created": "2025-11-20T16:48:15.748218+11:00",
                "relevant_disorders": [
                    "Abnormal circulating fatty acid concentration",
                    "HP:0004359; Rhabdomyolysis",
                    "HP:0003201; Hypoglycaemia",
                    "HP:0001943"
                ],
                "stats": {
                    "number_of_genes": 33,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:2867",
                "gene_name": "dihydroorotate dehydrogenase (quinone)",
                "omim_gene": [
                    "126064"
                ],
                "alias_name": null,
                "gene_symbol": "DHODH",
                "hgnc_symbol": "DHODH",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "16:72042487-72058954",
                            "ensembl_id": "ENSG00000102967"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "16:72008588-72027664",
                            "ensembl_id": "ENSG00000102967"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1993-06-29"
            },
            "entity_type": "gene",
            "entity_name": "DHODH",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "19915526",
                "20220176",
                "33262786",
                "27370710"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Miller syndrome, MIM# 263750"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 136,
                "hash_id": null,
                "name": "Mandibulofacial Acrofacial dysostosis",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel contains genes associated with the facial dysostoses, which can be subdivided into mandibulofacial dysostoses, which present with craniofacial defects only, and acrofacial dysostoses, which encompass both craniofacial and limb anomalies. Facial dysostoses arise as a consequence of abnormal development of the first and second pharyngeal arches and their derivatives, including the upper and lower jaw and their hyoid support structures.",
                "status": "public",
                "version": "1.22",
                "version_created": "2026-03-25T17:21:58.910310+11:00",
                "relevant_disorders": [
                    "Craniofacial dysostosis",
                    "HP:0004439"
                ],
                "stats": {
                    "number_of_genes": 35,
                    "number_of_strs": 1,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MAP5",
                    "PPP1R102"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6836",
                "gene_name": "microtubule associated protein 1B",
                "omim_gene": [
                    "157129"
                ],
                "alias_name": [
                    "protein phosphatase 1, regulatory subunit 102"
                ],
                "gene_symbol": "MAP1B",
                "hgnc_symbol": "MAP1B",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "5:71403061-71505395",
                            "ensembl_id": "ENSG00000131711"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "5:72107234-72209570",
                            "ensembl_id": "ENSG00000131711"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1992-02-06"
            },
            "entity_type": "gene",
            "entity_name": "MAP1B",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "31317654",
                "30150678",
                "30214071"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services",
                "Victorian Clinical Genetics Services",
                "Australian Genomics Health Alliance Brain Malformations Flagship"
            ],
            "phenotypes": [
                "Intellectual disability",
                "seizures",
                "PVNH",
                "dysmorphic features",
                "Periventricular nodular heterotopia 9, MIM# 618918",
                "Deafness, autosomal dominant 83, MIM# 619808"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "ADRBR",
                    "BAR",
                    "B2AR"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:286",
                "gene_name": "adrenoceptor beta 2",
                "omim_gene": [
                    "109690"
                ],
                "alias_name": null,
                "gene_symbol": "ADRB2",
                "hgnc_symbol": "ADRB2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "5:148206156-148208196",
                            "ensembl_id": "ENSG00000169252"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "5:148825245-148828687",
                            "ensembl_id": "ENSG00000169252"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1990-09-10"
            },
            "entity_type": "gene",
            "entity_name": "ADRB2",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "PMID: 15724149"
            ],
            "evidence": [
                "Expert Review Red",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Beta-2-adrenoreceptor agonist, reduced response to",
                "{Asthma, nocturnal, susceptibility to} MIM#600807",
                "{Obesity, susceptibility to} MIM#601665"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "HEAB",
                    "hClp1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:16999",
                "gene_name": "cleavage and polyadenylation factor I subunit 1",
                "omim_gene": [
                    "608757"
                ],
                "alias_name": [
                    "ATP/GTPbinding protein",
                    "polyribonucleotide 5'-hydroxyl-kinase"
                ],
                "gene_symbol": "CLP1",
                "hgnc_symbol": "CLP1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "11:57416465-57429340",
                            "ensembl_id": "ENSG00000172409"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "11:57648992-57661868",
                            "ensembl_id": "ENSG00000172409"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-11-13"
            },
            "entity_type": "gene",
            "entity_name": "CLP1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "24766809",
                "29307788"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Pontocerebellar hypoplasia type 10, MIM# 615803"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [
                "founder"
            ],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA1592"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:105",
                "gene_name": "cyclin and CBS domain divalent metal cation transport mediator 4",
                "omim_gene": [
                    "607805"
                ],
                "alias_name": null,
                "gene_symbol": "CNNM4",
                "hgnc_symbol": "CNNM4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:97426639-97477628",
                            "ensembl_id": "ENSG00000158158"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:96760902-96811891",
                            "ensembl_id": "ENSG00000158158"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-12-07"
            },
            "entity_type": "gene",
            "entity_name": "CNNM4",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "30705057"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Jalili syndrome\t217080",
                "amelogenesis imperfecta, cone-rod dystrophy"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ11113",
                    "KIAA1461"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:20444",
                "gene_name": "methyl-CpG binding domain protein 5",
                "omim_gene": [
                    "611472"
                ],
                "alias_name": null,
                "gene_symbol": "MBD5",
                "hgnc_symbol": "MBD5",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:148778580-149275805",
                            "ensembl_id": "ENSG00000204406"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:148021011-148516971",
                            "ensembl_id": "ENSG00000204406"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-03-03"
            },
            "entity_type": "gene",
            "entity_name": "MBD5",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "18812405",
                "21981781",
                "23708187",
                "22726846",
                "33912662"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Mental retardation, autosomal dominant 1, MIM# 156200",
                "MONDO:0007974"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [
                "SV/CNV"
            ],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MRG1",
                    "HsT18361"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7001",
                "gene_name": "Meis homeobox 2",
                "omim_gene": [
                    "601740"
                ],
                "alias_name": null,
                "gene_symbol": "MEIS2",
                "hgnc_symbol": "MEIS2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "15:37181406-37393504",
                            "ensembl_id": "ENSG00000134138"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "15:36889204-37101299",
                            "ensembl_id": "ENSG00000134138"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-02-09"
            },
            "entity_type": "gene",
            "entity_name": "MEIS2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "33427397",
                "25712757"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Cleft palate, cardiac defects, and mental retardation (MIM#600987)"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "CSX2",
                    "NKX4-2"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:32940",
                "gene_name": "NK2 homeobox 6",
                "omim_gene": [
                    "611770"
                ],
                "alias_name": [
                    "tinman paralog (Drosophila)"
                ],
                "gene_symbol": "NKX2-6",
                "hgnc_symbol": "NKX2-6",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "8:23559964-23564111",
                            "ensembl_id": "ENSG00000180053"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "8:23702451-23706598",
                            "ensembl_id": "ENSG00000180053"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-06-29"
            },
            "entity_type": "gene",
            "entity_name": "NKX2-6",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "24421281",
                "15649947",
                "32198970",
                "25380965",
                "25319568"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Conotruncal heart malformations - MIM#217095",
                "Persistent truncus arteriosus - MIM#217095"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DKFZP434G099"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:16075",
                "gene_name": "RAB33B, member RAS oncogene family",
                "omim_gene": [
                    "605950"
                ],
                "alias_name": null,
                "gene_symbol": "RAB33B",
                "hgnc_symbol": "RAB33B",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "4:140374386-140397763",
                            "ensembl_id": "ENSG00000172007"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "4:139453232-139476609",
                            "ensembl_id": "ENSG00000172007"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-09-14"
            },
            "entity_type": "gene",
            "entity_name": "RAB33B",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "22652534",
                "28127940",
                "23042644",
                "34284742"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Smith-McCort dysplasia 2 (MIM#615222)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:19957",
                "gene_name": "tectonin beta-propeller repeat containing 2",
                "omim_gene": [
                    "615000"
                ],
                "alias_name": null,
                "gene_symbol": "TECPR2",
                "hgnc_symbol": "TECPR2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "14:102829300-102968818",
                            "ensembl_id": "ENSG00000196663"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "14:102362963-102502481",
                            "ensembl_id": "ENSG00000196663"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2009-02-27"
            },
            "entity_type": "gene",
            "entity_name": "TECPR2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "23176824",
                "26542466"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Spastic paraplegia 49, autosomal recessive, MIM# 615031",
                "Autonomic-sensory neuropathy"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DKFZP434J046",
                    "FLJ33298"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:24502",
                "gene_name": "WD repeat domain 62",
                "omim_gene": [
                    "613583"
                ],
                "alias_name": null,
                "gene_symbol": "WDR62",
                "hgnc_symbol": "WDR62",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:36545783-36596008",
                            "ensembl_id": "ENSG00000075702"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:36054881-36105106",
                            "ensembl_id": "ENSG00000075702"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-05-09"
            },
            "entity_type": "gene",
            "entity_name": "WDR62",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "20890279",
                "20729831",
                "20890278",
                "21496009",
                "21834044",
                "22775483",
                "32677750",
                "31788460"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Microcephaly 2, primary, autosomal recessive, with or without cortical malformations, MIM# 604317",
                "MONDO:0011435"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FACT",
                    "FACTP140",
                    "SPT16/CDC68",
                    "FLJ14010",
                    "FLJ10857",
                    "CDC68"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:11465",
                "gene_name": "SPT16 homolog, facilitates chromatin remodeling subunit",
                "omim_gene": [
                    "605012"
                ],
                "alias_name": [
                    "facilitates chromatin remodeling 140 kDa subunit"
                ],
                "gene_symbol": "SUPT16H",
                "hgnc_symbol": "SUPT16H",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "14:21819631-21852425",
                            "ensembl_id": "ENSG00000092201"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "14:21351472-21384266",
                            "ensembl_id": "ENSG00000092201"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1996-08-21"
            },
            "entity_type": "gene",
            "entity_name": "SUPT16H",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "31924697"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480",
                "Intellectual disability",
                "Abnormality of the corpus callosum"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "COX3",
                    "COIII",
                    "CO3"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7422",
                "gene_name": "mitochondrially encoded cytochrome c oxidase III",
                "omim_gene": [
                    "516050"
                ],
                "alias_name": null,
                "gene_symbol": "MT-CO3",
                "hgnc_symbol": "MT-CO3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "MT:9207-9990",
                            "ensembl_id": "ENSG00000198938"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "MT:9207-9990",
                            "ensembl_id": "ENSG00000198938"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-02-16"
            },
            "entity_type": "gene",
            "entity_name": "MT-CO3",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "20525945",
                "11063732",
                "33863631",
                "34054915",
                "8630495",
                "9634511",
                "12414820",
                "21163656",
                "16288875",
                "8630495",
                "9634511"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature",
                "Literature"
            ],
            "phenotypes": [
                "Mitochondrial disease MONDO:0044970, MT-CO3-related"
            ],
            "mode_of_inheritance": "MITOCHONDRIAL",
            "tags": [
                "mtDNA"
            ],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "Dnahc6",
                    "HL-2",
                    "FLJ37357"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:2951",
                "gene_name": "dynein axonemal heavy chain 6",
                "omim_gene": [
                    "603336"
                ],
                "alias_name": null,
                "gene_symbol": "DNAH6",
                "hgnc_symbol": "DNAH6",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:84743579-85046713",
                            "ensembl_id": "ENSG00000115423"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:84516455-84819589",
                            "ensembl_id": "ENSG00000115423"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1995-11-15"
            },
            "entity_type": "gene",
            "entity_name": "DNAH6",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "26918822",
                "37594300",
                "39192248",
                "37424858",
                "31676830",
                "29356036",
                "40592014"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Spermatogenic failure, MONDO:0004983, DNAH6-related"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "LZIP",
                    "Luman",
                    "sLZIP"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:2347",
                "gene_name": "cAMP responsive element binding protein 3",
                "omim_gene": [
                    "606443"
                ],
                "alias_name": [
                    "small leucine zipper protein"
                ],
                "gene_symbol": "CREB3",
                "hgnc_symbol": "CREB3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:35732332-35737001",
                            "ensembl_id": "ENSG00000107175"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:35732335-35737004",
                            "ensembl_id": "ENSG00000107175"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-10-13"
            },
            "entity_type": "gene",
            "entity_name": "CREB3",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID: 40674075"
            ],
            "evidence": [
                "Expert Review Amber",
                "Literature"
            ],
            "phenotypes": [
                "Retinal degeneration, MONDO:0004580, CREB3-related"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [
                "founder"
            ],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ20232",
                    "MiD51"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25979",
                "gene_name": "mitochondrial elongation factor 1",
                "omim_gene": [
                    "615497"
                ],
                "alias_name": null,
                "gene_symbol": "MIEF1",
                "hgnc_symbol": "MIEF1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "22:39895437-39914137",
                            "ensembl_id": "ENSG00000100335"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "22:39499432-39518132",
                            "ensembl_id": "ENSG00000100335"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2013-09-23"
            },
            "entity_type": "gene",
            "entity_name": "MIEF1",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "33632269"
            ],
            "evidence": [
                "Expert Review Red",
                "Literature"
            ],
            "phenotypes": [
                "Optic atrophy 14 (MIM#620550)"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ20493",
                    "MRP-L50"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:16654",
                "gene_name": "mitochondrial ribosomal protein L50",
                "omim_gene": [
                    "611854"
                ],
                "alias_name": [
                    "mitochondrial 39S ribosomal protein L50"
                ],
                "gene_symbol": "MRPL50",
                "hgnc_symbol": "MRPL50",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:104149915-104160896",
                            "ensembl_id": "ENSG00000136897"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:101387633-101398614",
                            "ensembl_id": "ENSG00000136897"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-10-12"
            },
            "entity_type": "gene",
            "entity_name": "MRPL50",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID: 37148394"
            ],
            "evidence": [
                "Expert Review Amber",
                "Literature"
            ],
            "phenotypes": [
                "Mitochondrial disease, MONDO: 004470, MRPL50-related"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "5-HT2C",
                    "5HTR2C"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:5295",
                "gene_name": "5-hydroxytryptamine receptor 2C",
                "omim_gene": [
                    "312861"
                ],
                "alias_name": null,
                "gene_symbol": "HTR2C",
                "hgnc_symbol": "HTR2C",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:113818551-114144624",
                            "ensembl_id": "ENSG00000147246"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:114584078-114910061",
                            "ensembl_id": "ENSG00000147246"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1994-08-29"
            },
            "entity_type": "gene",
            "entity_name": "HTR2C",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "36536256"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Obesity disorder, MONDO:0011122, HTR2C-related"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "RNMX",
                    "hnRNP-G",
                    "HNRNPG"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:9910",
                "gene_name": "RNA binding motif protein, X-linked",
                "omim_gene": [
                    "300199"
                ],
                "alias_name": [
                    "heterogeneous nuclear ribonucleoprotein G"
                ],
                "gene_symbol": "RBMX",
                "hgnc_symbol": "RBMX",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:135930163-135962923",
                            "ensembl_id": "ENSG00000147274"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:136848004-136880764",
                            "ensembl_id": "ENSG00000147274"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2000-01-31"
            },
            "entity_type": "gene",
            "entity_name": "RBMX",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "25256757",
                "34260915",
                "37277488",
                "39263607"
            ],
            "evidence": [
                "Expert Review Amber",
                "Expert Review"
            ],
            "phenotypes": [
                "Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238",
                "Gustavson syndrome, MIM# 309555",
                "Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "tags": [],
            "panel": {
                "id": 137,
                "hash_id": null,
                "name": "Mendeliome",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.",
                "status": "public",
                "version": "1.4733",
                "version_created": "2026-04-09T11:50:28.536610+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6013,
                    "number_of_strs": 43,
                    "number_of_regions": 7
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "C48",
                    "FLJ10867",
                    "CEP215"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:18672",
                "gene_name": "CDK5 regulatory subunit associated protein 2",
                "omim_gene": [
                    "608201"
                ],
                "alias_name": [
                    "centrosomin"
                ],
                "gene_symbol": "CDK5RAP2",
                "hgnc_symbol": "CDK5RAP2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:123151147-123342448",
                            "ensembl_id": "ENSG00000136861"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:120388869-120580170",
                            "ensembl_id": "ENSG00000136861"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-07-22"
            },
            "entity_type": "gene",
            "entity_name": "CDK5RAP2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "15793586",
                "22887808",
                "23995685",
                "23726037",
                "27761245",
                "20460369",
                "32677750",
                "32015000"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Microcephaly 3, primary, autosomal recessive, MIM# 604804",
                "MONDO:0011488"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 138,
                "hash_id": null,
                "name": "Microcephaly",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.",
                "status": "public",
                "version": "1.427",
                "version_created": "2026-04-02T17:28:09.565635+11:00",
                "relevant_disorders": [
                    "Microcephaly",
                    "HP:0000252"
                ],
                "stats": {
                    "number_of_genes": 383,
                    "number_of_strs": 0,
                    "number_of_regions": 8
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "CI-49"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7708",
                "gene_name": "NADH:ubiquinone oxidoreductase core subunit S2",
                "omim_gene": [
                    "602985"
                ],
                "alias_name": [
                    "complex I 49kDa subunit",
                    "NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"
                ],
                "gene_symbol": "NDUFS2",
                "hgnc_symbol": "NDUFS2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:161166894-161184185",
                            "ensembl_id": "ENSG00000158864"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:161197104-161214395",
                            "ensembl_id": "ENSG00000158864"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1992-06-30"
            },
            "entity_type": "gene",
            "entity_name": "NDUFS2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "28031252",
                "31411514",
                "22036843",
                "20819849",
                "11220739",
                "23266820",
                "31411514"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Mitochondrial complex I deficiency, nuclear type 6 - MIM#618228",
                "Leber hereditary optic neuropathy, autosomal recessive 2, MIM# 620569"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 149,
                "hash_id": null,
                "name": "Optic Atrophy",
                "disease_group": "Ophthalmological disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS and RMH and contains genes associated with isolated and complex optic atrophy.",
                "status": "public",
                "version": "1.72",
                "version_created": "2026-03-31T18:57:17.873049+11:00",
                "relevant_disorders": [
                    "Optic atrophy",
                    "HP:0000648"
                ],
                "stats": {
                    "number_of_genes": 80,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "XH2",
                    "XNP"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:886",
                "gene_name": "ATRX, chromatin remodeler",
                "omim_gene": [
                    "300032",
                    "300504"
                ],
                "alias_name": [
                    "RAD54 homolog (S. cerevisiae)"
                ],
                "gene_symbol": "ATRX",
                "hgnc_symbol": "ATRX",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:76760356-77041702",
                            "ensembl_id": "ENSG00000085224"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:77504878-77786269",
                            "ensembl_id": "ENSG00000085224"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1992-11-27"
            },
            "entity_type": "gene",
            "entity_name": "ATRX",
            "confidence_level": "3",
            "penetrance": "unknown",
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID: 28371217, 29706636, 28371197"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "ATR-X-related syndrome MONDO:0016980",
                "Osteosarcoma, mild to severe intellectual disability, facial, skeletal, urogenital, and hematopoietic anomalies."
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "tags": [],
            "panel": {
                "id": 152,
                "hash_id": null,
                "name": "Cancer Predisposition_Paediatric",
                "disease_group": "Cancer",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.133",
                "version_created": "2026-01-12T09:35:45.797477+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 106,
                    "number_of_strs": 0,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA0243",
                    "LAM",
                    "hamartin"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:12362",
                "gene_name": "TSC complex subunit 1",
                "omim_gene": [
                    "605284"
                ],
                "alias_name": [
                    "hamartin"
                ],
                "gene_symbol": "TSC1",
                "hgnc_symbol": "TSC1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:135766735-135820020",
                            "ensembl_id": "ENSG00000165699"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:132891348-132944633",
                            "ensembl_id": "ENSG00000165699"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1986-01-01"
            },
            "entity_type": "gene",
            "entity_name": "TSC1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Victorian Clinical Genetics Services",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 152,
                "hash_id": null,
                "name": "Cancer Predisposition_Paediatric",
                "disease_group": "Cancer",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.133",
                "version_created": "2026-01-12T09:35:45.797477+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 106,
                    "number_of_strs": 0,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ38979"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:30452",
                "gene_name": "family with sequence similarity 92 member A",
                "omim_gene": [
                    "617273"
                ],
                "alias_name": null,
                "gene_symbol": "FAM92A",
                "hgnc_symbol": "FAM92A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "8:94710789-94743755",
                            "ensembl_id": "ENSG00000188343"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "8:93698561-93731527",
                            "ensembl_id": "ENSG00000188343"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2016-09-30"
            },
            "entity_type": "gene",
            "entity_name": "FAM92A",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "30395363"
            ],
            "evidence": [
                "Expert Review Amber",
                "Expert list"
            ],
            "phenotypes": [
                "Polydactyly, postaxial, type A9, MIM#\t618219"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 159,
                "hash_id": null,
                "name": "Polydactyly",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS. It contains genes that cause syndromic and non-syndromic polydactyly.",
                "status": "public",
                "version": "0.301",
                "version_created": "2026-03-12T11:30:58.449890+11:00",
                "relevant_disorders": [
                    "Polydactyly",
                    "HP:0010442"
                ],
                "stats": {
                    "number_of_genes": 141,
                    "number_of_strs": 2,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "DTDST"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10994",
                "gene_name": "solute carrier family 26 member 2",
                "omim_gene": [
                    "606718"
                ],
                "alias_name": null,
                "gene_symbol": "SLC26A2",
                "hgnc_symbol": "SLC26A2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "5:149340300-149373018",
                            "ensembl_id": "ENSG00000155850"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "5:149960737-149993455",
                            "ensembl_id": "ENSG00000155850"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1990-09-10"
            },
            "entity_type": "gene",
            "entity_name": "SLC26A2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Victorian Clinical Genetics Services",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 160,
                "hash_id": null,
                "name": "Pierre Robin Sequence",
                "disease_group": "Dysmorphic and congenital abnormality syndromes",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.61",
                "version_created": "2026-01-26T17:52:14.382309+11:00",
                "relevant_disorders": [
                    "Pierre Robin sequence",
                    "HP:0000201"
                ],
                "stats": {
                    "number_of_genes": 54,
                    "number_of_strs": 1,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "PTF1-p48",
                    "bHLHa29"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:23734",
                "gene_name": "pancreas specific transcription factor, 1a",
                "omim_gene": [
                    "607194"
                ],
                "alias_name": null,
                "gene_symbol": "PTF1A",
                "hgnc_symbol": "PTF1A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "10:23481256-23483181",
                            "ensembl_id": "ENSG00000168267"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "10:23192327-23194252",
                            "ensembl_id": "ENSG00000168267"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-12-04"
            },
            "entity_type": "gene",
            "entity_name": "PTF1A",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "21749365",
                "15543146",
                "19650412"
            ],
            "evidence": [
                "Expert Review Amber",
                "Victorian Clinical Genetics Services",
                "Australian Genomics Health Alliance Epilepsy Flagship"
            ],
            "phenotypes": [
                "Pancreatic and cerebellar agenesis, MIM#609069"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 202,
                "hash_id": null,
                "name": "Genetic Epilepsy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.",
                "status": "public",
                "version": "1.408",
                "version_created": "2026-04-02T11:46:13.244668+11:00",
                "relevant_disorders": [
                    "Seizure",
                    "HP:0001250; Epileptic encephalopathy",
                    "HP:0200134; EEG abnormality",
                    "HP:0002353"
                ],
                "stats": {
                    "number_of_genes": 1154,
                    "number_of_strs": 9,
                    "number_of_regions": 13
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6600",
                "gene_name": "DNA ligase 3",
                "omim_gene": [
                    "600940"
                ],
                "alias_name": null,
                "gene_symbol": "LIG3",
                "hgnc_symbol": "LIG3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:33307513-33332083",
                            "ensembl_id": "ENSG00000005156"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:34980494-35009743",
                            "ensembl_id": "ENSG00000005156"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1991-05-09"
            },
            "entity_type": "gene",
            "entity_name": "LIG3",
            "confidence_level": "3",
            "penetrance": "Complete",
            "mode_of_pathogenicity": null,
            "publications": [
                "33855352"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 202,
                "hash_id": null,
                "name": "Genetic Epilepsy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.",
                "status": "public",
                "version": "1.408",
                "version_created": "2026-04-02T11:46:13.244668+11:00",
                "relevant_disorders": [
                    "Seizure",
                    "HP:0001250; Epileptic encephalopathy",
                    "HP:0200134; EEG abnormality",
                    "HP:0002353"
                ],
                "stats": {
                    "number_of_genes": 1154,
                    "number_of_strs": 9,
                    "number_of_regions": 13
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10297",
                "gene_name": "ribose 5-phosphate isomerase A",
                "omim_gene": [
                    "180430"
                ],
                "alias_name": [
                    "ribose 5-phosphate epimerase"
                ],
                "gene_symbol": "RPIA",
                "hgnc_symbol": "RPIA",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:88991162-89050452",
                            "ensembl_id": "ENSG00000153574"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:88691644-88750935",
                            "ensembl_id": "ENSG00000153574"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-09-30"
            },
            "entity_type": "gene",
            "entity_name": "RPIA",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "14988808",
                "10589548",
                "20499043",
                "28801340",
                "30088433"
            ],
            "evidence": [
                "Expert Review Amber",
                "Expert Review",
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Ribose 5-phosphate isomerase deficiency, MIM 608611"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 202,
                "hash_id": null,
                "name": "Genetic Epilepsy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.",
                "status": "public",
                "version": "1.408",
                "version_created": "2026-04-02T11:46:13.244668+11:00",
                "relevant_disorders": [
                    "Seizure",
                    "HP:0001250; Epileptic encephalopathy",
                    "HP:0200134; EEG abnormality",
                    "HP:0002353"
                ],
                "stats": {
                    "number_of_genes": 1154,
                    "number_of_strs": 9,
                    "number_of_regions": 13
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "GATD4"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:1424",
                "gene_name": "carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase",
                "omim_gene": [
                    "114010"
                ],
                "alias_name": null,
                "gene_symbol": "CAD",
                "hgnc_symbol": "CAD",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:27440258-27466811",
                            "ensembl_id": "ENSG00000084774"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:27217390-27243943",
                            "ensembl_id": "ENSG00000084774"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "CAD",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "28007989",
                "25678555"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Epileptic encephalopathy, early infantile, 50, MIM#\t616457"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 202,
                "hash_id": null,
                "name": "Genetic Epilepsy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.",
                "status": "public",
                "version": "1.408",
                "version_created": "2026-04-02T11:46:13.244668+11:00",
                "relevant_disorders": [
                    "Seizure",
                    "HP:0001250; Epileptic encephalopathy",
                    "HP:0200134; EEG abnormality",
                    "HP:0002353"
                ],
                "stats": {
                    "number_of_genes": 1154,
                    "number_of_strs": 9,
                    "number_of_regions": 13
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "PPP1R115"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:8104",
                "gene_name": "occludin",
                "omim_gene": [
                    "602876"
                ],
                "alias_name": [
                    "tight junction protein occludin TM4 minus",
                    "phosphatase 1, regulatory subunit 115"
                ],
                "gene_symbol": "OCLN",
                "hgnc_symbol": "OCLN",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "5:68788119-68853931",
                            "ensembl_id": "ENSG00000197822"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "5:69492292-69558104",
                            "ensembl_id": "ENSG00000197822"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-01-20"
            },
            "entity_type": "gene",
            "entity_name": "OCLN",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "20727516",
                "32240828",
                "29192239",
                "28386946"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services",
                "Australian Genomics Health Alliance Epilepsy Flagship",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Pseudo-TORCH syndrome 1, MIM#251290"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 202,
                "hash_id": null,
                "name": "Genetic Epilepsy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.",
                "status": "public",
                "version": "1.408",
                "version_created": "2026-04-02T11:46:13.244668+11:00",
                "relevant_disorders": [
                    "Seizure",
                    "HP:0001250; Epileptic encephalopathy",
                    "HP:0200134; EEG abnormality",
                    "HP:0002353"
                ],
                "stats": {
                    "number_of_genes": 1154,
                    "number_of_strs": 9,
                    "number_of_regions": 13
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:4693",
                "gene_name": "guanylate kinase 1",
                "omim_gene": [
                    "139270"
                ],
                "alias_name": null,
                "gene_symbol": "GUK1",
                "hgnc_symbol": "GUK1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:228327663-228336685",
                            "ensembl_id": "ENSG00000143774"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:228139962-228148984",
                            "ensembl_id": "ENSG00000143774"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "GUK1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "39230499"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Mitochondrial DNA depletion syndrome 21, MIM# 621071"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 203,
                "hash_id": null,
                "name": "Mitochondrial disease",
                "disease_group": "Metabolic disorders",
                "disease_sub_group": "",
                "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.",
                "status": "public",
                "version": "1.16",
                "version_created": "2026-03-13T18:22:35.610861+11:00",
                "relevant_disorders": [
                    "Increased serum lactate",
                    "HP:0002151; Abnormality of mitochondrial metabolism",
                    "HP:0003287"
                ],
                "stats": {
                    "number_of_genes": 438,
                    "number_of_strs": 1,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "CAV",
                    "CAVA"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:1377",
                "gene_name": "carbonic anhydrase 5A",
                "omim_gene": [
                    "114761"
                ],
                "alias_name": null,
                "gene_symbol": "CA5A",
                "hgnc_symbol": "CA5A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "16:87921625-87970135",
                            "ensembl_id": "ENSG00000174990"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "16:87881546-87936529",
                            "ensembl_id": "ENSG00000174990"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1993-10-15"
            },
            "entity_type": "gene",
            "entity_name": "CA5A",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "Hyperammonemia due to carbonic anhydrase VA deficiency, MIM#\t615751"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [
                "SV/CNV",
                "treatable"
            ],
            "panel": {
                "id": 203,
                "hash_id": null,
                "name": "Mitochondrial disease",
                "disease_group": "Metabolic disorders",
                "disease_sub_group": "",
                "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.",
                "status": "public",
                "version": "1.16",
                "version_created": "2026-03-13T18:22:35.610861+11:00",
                "relevant_disorders": [
                    "Increased serum lactate",
                    "HP:0002151; Abnormality of mitochondrial metabolism",
                    "HP:0003287"
                ],
                "stats": {
                    "number_of_genes": 438,
                    "number_of_strs": 1,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "dJ186O1.1",
                    "DDDD",
                    "EMRE"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25055",
                "gene_name": "single-pass membrane protein with aspartate rich tail 1",
                "omim_gene": [
                    "615588"
                ],
                "alias_name": [
                    "essential MCU regulator"
                ],
                "gene_symbol": "SMDT1",
                "hgnc_symbol": "SMDT1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "22:42475695-42480288",
                            "ensembl_id": "ENSG00000183172"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "22:42079691-42084284",
                            "ensembl_id": "ENSG00000183172"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2013-03-08"
            },
            "entity_type": "gene",
            "entity_name": "SMDT1",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "37454773"
            ],
            "evidence": [
                "Expert Review Amber",
                "Literature"
            ],
            "phenotypes": [
                "Mitochondrial disease, MONDO:0044970, SMDT1-related"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 203,
                "hash_id": null,
                "name": "Mitochondrial disease",
                "disease_group": "Metabolic disorders",
                "disease_sub_group": "",
                "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.",
                "status": "public",
                "version": "1.16",
                "version_created": "2026-03-13T18:22:35.610861+11:00",
                "relevant_disorders": [
                    "Increased serum lactate",
                    "HP:0002151; Abnormality of mitochondrial metabolism",
                    "HP:0003287"
                ],
                "stats": {
                    "number_of_genes": 438,
                    "number_of_strs": 1,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "SEB",
                    "KIAA0437"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:15573",
                "gene_name": "SET binding protein 1",
                "omim_gene": [
                    "611060"
                ],
                "alias_name": null,
                "gene_symbol": "SETBP1",
                "hgnc_symbol": "SETBP1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "18:42260138-42648475",
                            "ensembl_id": "ENSG00000152217"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "18:44680173-45068510",
                            "ensembl_id": "ENSG00000152217"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-05"
            },
            "entity_type": "gene",
            "entity_name": "SETBP1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Victorian Clinical Genetics Services",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 205,
                "hash_id": null,
                "name": "Callosome",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.593",
                "version_created": "2026-04-02T11:47:10.809612+11:00",
                "relevant_disorders": [
                    "Abnormal corpus callosum morphology",
                    "HP:0001273"
                ],
                "stats": {
                    "number_of_genes": 459,
                    "number_of_strs": 2,
                    "number_of_regions": 3
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ20052"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:19349",
                "gene_name": "kinesin family member 21A",
                "omim_gene": [
                    "608283"
                ],
                "alias_name": null,
                "gene_symbol": "KIF21A",
                "hgnc_symbol": "KIF21A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:39687030-39837192",
                            "ensembl_id": "ENSG00000139116"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:39293228-39443390",
                            "ensembl_id": "ENSG00000139116"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-10-08"
            },
            "entity_type": "gene",
            "entity_name": "KIF21A",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "37921537",
                "39643435",
                "41282472",
                "32141982",
                "24715754",
                "36494820",
                "22699964"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Fibrosis of extraocular muscles, congenital, 1/3B, MIM#135700"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 205,
                "hash_id": null,
                "name": "Callosome",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.593",
                "version_created": "2026-04-02T11:47:10.809612+11:00",
                "relevant_disorders": [
                    "Abnormal corpus callosum morphology",
                    "HP:0001273"
                ],
                "stats": {
                    "number_of_genes": 459,
                    "number_of_strs": 2,
                    "number_of_regions": 3
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:8858",
                "gene_name": "peroxisomal biogenesis factor 3",
                "omim_gene": [
                    "603164"
                ],
                "alias_name": null,
                "gene_symbol": "PEX3",
                "hgnc_symbol": "PEX3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:143771944-143811147",
                            "ensembl_id": "ENSG00000034693"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:143450807-143490010",
                            "ensembl_id": "ENSG00000034693"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-10-21"
            },
            "entity_type": "gene",
            "entity_name": "PEX3",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Victorian Clinical Genetics Services",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 205,
                "hash_id": null,
                "name": "Callosome",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.593",
                "version_created": "2026-04-02T11:47:10.809612+11:00",
                "relevant_disorders": [
                    "Abnormal corpus callosum morphology",
                    "HP:0001273"
                ],
                "stats": {
                    "number_of_genes": 459,
                    "number_of_strs": 2,
                    "number_of_regions": 3
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ38663",
                    "SPG55"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:26784",
                "gene_name": "chromosome 12 open reading frame 65",
                "omim_gene": [
                    "613541"
                ],
                "alias_name": null,
                "gene_symbol": "C12orf65",
                "hgnc_symbol": "C12orf65",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:123717463-123742506",
                            "ensembl_id": "ENSG00000130921"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:123232916-123257959",
                            "ensembl_id": "ENSG00000130921"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2007-02-26"
            },
            "entity_type": "gene",
            "entity_name": "C12orf65",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Victorian Clinical Genetics Services",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [],
            "panel": {
                "id": 206,
                "hash_id": null,
                "name": "Regression",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was developed and is maintained by VCGS.",
                "status": "public",
                "version": "0.611",
                "version_created": "2026-04-07T13:48:08.700916+10:00",
                "relevant_disorders": [
                    "Developmental regression",
                    "HP:0002376"
                ],
                "stats": {
                    "number_of_genes": 442,
                    "number_of_strs": 3,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MASP"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:6901",
                "gene_name": "mannan binding lectin serine peptidase 1",
                "omim_gene": [
                    "600521"
                ],
                "alias_name": [
                    "C4/C2 activating component of Ra-reactive factor"
                ],
                "gene_symbol": "MASP1",
                "hgnc_symbol": "MASP1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "3:186935942-187009810",
                            "ensembl_id": "ENSG00000127241"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "3:187217285-187292022",
                            "ensembl_id": "ENSG00000127241"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1995-07-06"
            },
            "entity_type": "gene",
            "entity_name": "MASP1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Melbourne Genomics Health Alliance Deafness Flagship",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "3MC syndrome 1, MIM#\t257920"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 209,
                "hash_id": null,
                "name": "Deafness_IsolatedAndComplex",
                "disease_group": "Hearing and ear disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).",
                "status": "public",
                "version": "1.359",
                "version_created": "2026-04-03T14:38:51.840380+11:00",
                "relevant_disorders": [
                    "Hearing impairment",
                    "HP:0000365"
                ],
                "stats": {
                    "number_of_genes": 348,
                    "number_of_strs": 1,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "Helios"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:13177",
                "gene_name": "IKAROS family zinc finger 2",
                "omim_gene": [
                    "606234"
                ],
                "alias_name": null,
                "gene_symbol": "IKZF2",
                "hgnc_symbol": "IKZF2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:213864429-214017151",
                            "ensembl_id": "ENSG00000030419"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:212999691-213152427",
                            "ensembl_id": "ENSG00000030419"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-08-25"
            },
            "entity_type": "gene",
            "entity_name": "IKZF2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "34826260",
                "34826259",
                "34920454"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "HELIOS deficiency MONDO:0800139"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 223,
                "hash_id": null,
                "name": "Combined Immunodeficiency",
                "disease_group": "Immunological disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause combined immunodeficiencies with associated or syndromic features, including genes classified by the International Union of Immunological Societies Inborn Errors of Immunity Committee (July 2024 update). These include genes that fall into the following subcategories:\r\n- Immunodeficiency with Congenital Thrombocytopenia\r\n- DNA Repair Defects\r\n- Thymic Defects with Additional Congenital Anomalies\r\n- Immuno-osseous Dysplasias\r\n- Hyper IgE Syndromes (HIES)\r\n- Defects of Vitamin B12 and Folate Metabolism\r\n- Anhidrotic Ectodermodysplasia with Immunodeficiency (EDA-ID)\r\n- Calcium Channel Defects\r\n- Other Combined immunodeficiencies with syndromic features\r\n- Combined Immunodeficiencies Generally Less Profound than Severe Combined Immunodeficiency (Immunodeficiencies affecting cellular and humoral immunity)\r\n\r\nThis panel was originally developed by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital) for the Melbourne Genomics Immunology Flagship.",
                "status": "public",
                "version": "1.145",
                "version_created": "2026-03-02T21:55:19.238904+11:00",
                "relevant_disorders": [
                    "Combined immunodeficiency",
                    "MONDO:0015131; Combined immunodeficiency",
                    "HP:0005387"
                ],
                "stats": {
                    "number_of_genes": 170,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Melbourne Genomics",
                        "slug": "melbourne-genomics",
                        "description": "Panel used by a Melbourne Genomics project."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA0653",
                    "GL50",
                    "B7-H2",
                    "B7RP-1",
                    "B7H2",
                    "B7RP1",
                    "ICOS-L",
                    "CD275"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:17087",
                "gene_name": "inducible T-cell costimulator ligand",
                "omim_gene": [
                    "605717"
                ],
                "alias_name": [
                    "B7-related protein 1",
                    "B7 homologue 2",
                    "B7 homolog 2"
                ],
                "gene_symbol": "ICOSLG",
                "hgnc_symbol": "ICOSLG",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "21:45642874-45660849",
                            "ensembl_id": "ENSG00000160223"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "21:44222991-44240966",
                            "ensembl_id": "ENSG00000160223"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-01-12"
            },
            "entity_type": "gene",
            "entity_name": "ICOSLG",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert list",
                "Expert Review Green"
            ],
            "phenotypes": [],
            "mode_of_inheritance": "Unknown",
            "tags": [
                "umccr"
            ],
            "panel": {
                "id": 243,
                "hash_id": null,
                "name": "Immune_markers_WTS_UMCCR",
                "disease_group": "Cancer",
                "disease_sub_group": "",
                "description": "Author: Jacek Marzec, jacek.marzec@unimelb.edu.au\r\n\r\nPurpose: panel of immune markers used to assess pre-existing anti-cancer immunity and likelihood of response to immunotherapy. This set of genes is used in UMCCR WTS report \"Immune markers\" section\r\n\r\nSource: https://www.omniseq.com\r\n\r\nGithub: https://github.com/umccr/RNAsum",
                "status": "public",
                "version": "0.77",
                "version_created": "2025-11-03T15:30:48.145923+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 71,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MGC33662"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:28510",
                "gene_name": "GLIS family zinc finger 3",
                "omim_gene": [
                    "610192"
                ],
                "alias_name": null,
                "gene_symbol": "GLIS3",
                "hgnc_symbol": "GLIS3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:3824127-4348392",
                            "ensembl_id": "ENSG00000107249"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:3824127-4348392",
                            "ensembl_id": "ENSG00000107249"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-07-16"
            },
            "entity_type": "gene",
            "entity_name": "GLIS3",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "21139041"
            ],
            "evidence": [
                "Expert Review Green",
                "Genetic Health Queensland"
            ],
            "phenotypes": [
                "Diabetes mellitus, neonatal, with congenital hypothyroidism, MIM#610199"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 250,
                "hash_id": null,
                "name": "Intellectual disability syndromic and non-syndromic",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.",
                "status": "public",
                "version": "1.745",
                "version_created": "2026-04-03T15:53:29.044094+11:00",
                "relevant_disorders": [
                    "Intellectual disability",
                    "HP:0001249; Neurodevelopmental delay",
                    "HP:0012758"
                ],
                "stats": {
                    "number_of_genes": 2523,
                    "number_of_strs": 10,
                    "number_of_regions": 57
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA1361",
                    "MARKK",
                    "PSK2",
                    "MAP3K16",
                    "FLJ14314",
                    "TAO1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29259",
                "gene_name": "TAO kinase 1",
                "omim_gene": [
                    "610266"
                ],
                "alias_name": null,
                "gene_symbol": "TAOK1",
                "hgnc_symbol": "TAOK1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:27717482-27878922",
                            "ensembl_id": "ENSG00000160551"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:29390464-29551904",
                            "ensembl_id": "ENSG00000160551"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-10-20"
            },
            "entity_type": "gene",
            "entity_name": "TAOK1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "31230721"
            ],
            "evidence": [
                "Expert Review Green",
                "Genetic Health Queensland"
            ],
            "phenotypes": [
                "Developmental delay with or without intellectual impairment or behavioural abnormalities, MIM#619575",
                "Intellectual disability",
                "hypotonia",
                "macrocephaly"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 250,
                "hash_id": null,
                "name": "Intellectual disability syndromic and non-syndromic",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.",
                "status": "public",
                "version": "1.745",
                "version_created": "2026-04-03T15:53:29.044094+11:00",
                "relevant_disorders": [
                    "Intellectual disability",
                    "HP:0001249; Neurodevelopmental delay",
                    "HP:0012758"
                ],
                "stats": {
                    "number_of_genes": 2523,
                    "number_of_strs": 10,
                    "number_of_regions": 57
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:13753",
                "gene_name": "fibronectin type III and SPRY domain containing 1 like",
                "omim_gene": [
                    "609829"
                ],
                "alias_name": null,
                "gene_symbol": "FSD1L",
                "hgnc_symbol": "FSD1L",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:108210077-108314714",
                            "ensembl_id": "ENSG00000106701"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:105447796-105552433",
                            "ensembl_id": "ENSG00000106701"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-03-10"
            },
            "entity_type": "gene",
            "entity_name": "FSD1L",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Other"
            ],
            "phenotypes": [
                "Neurodevelopmental disorder, MONDO:0700092, FSD1L-related"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 250,
                "hash_id": null,
                "name": "Intellectual disability syndromic and non-syndromic",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.",
                "status": "public",
                "version": "1.745",
                "version_created": "2026-04-03T15:53:29.044094+11:00",
                "relevant_disorders": [
                    "Intellectual disability",
                    "HP:0001249; Neurodevelopmental delay",
                    "HP:0012758"
                ],
                "stats": {
                    "number_of_genes": 2523,
                    "number_of_strs": 10,
                    "number_of_regions": 57
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "FHF2",
                    "FGF2"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3670",
                "gene_name": "fibroblast growth factor 13",
                "omim_gene": [
                    "300070"
                ],
                "alias_name": [
                    "fibroblast growth factor homologous factor 2"
                ],
                "gene_symbol": "FGF13",
                "hgnc_symbol": "FGF13",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:137713735-138304939",
                            "ensembl_id": "ENSG00000129682"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:138614731-139222777",
                            "ensembl_id": "ENSG00000129682"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1996-12-16"
            },
            "entity_type": "gene",
            "entity_name": "FGF13",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "Other",
            "publications": [
                "33245860",
                "34184986"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Developmental and epileptic encephalopathy 90, MIM# 301058",
                "Intellectual developmental disorder, X-linked 110, MIM# 301095"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females",
            "tags": [
                "5'UTR"
            ],
            "panel": {
                "id": 250,
                "hash_id": null,
                "name": "Intellectual disability syndromic and non-syndromic",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.",
                "status": "public",
                "version": "1.745",
                "version_created": "2026-04-03T15:53:29.044094+11:00",
                "relevant_disorders": [
                    "Intellectual disability",
                    "HP:0001249; Neurodevelopmental delay",
                    "HP:0012758"
                ],
                "stats": {
                    "number_of_genes": 2523,
                    "number_of_strs": 10,
                    "number_of_regions": 57
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "prp28",
                    "U5-100K",
                    "PRPF28",
                    "SNRNP100"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:17347",
                "gene_name": "DEAD-box helicase 23",
                "omim_gene": [
                    "612172"
                ],
                "alias_name": null,
                "gene_symbol": "DDX23",
                "hgnc_symbol": "DDX23",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:49223547-49246625",
                            "ensembl_id": "ENSG00000174243"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:48829764-48852842",
                            "ensembl_id": "ENSG00000174243"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-06-13"
            },
            "entity_type": "gene",
            "entity_name": "DDX23",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "33057194",
                "34050707"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Neurodevelopmental disorder, MONDO:0700092, DDX23-related"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 250,
                "hash_id": null,
                "name": "Intellectual disability syndromic and non-syndromic",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.",
                "status": "public",
                "version": "1.745",
                "version_created": "2026-04-03T15:53:29.044094+11:00",
                "relevant_disorders": [
                    "Intellectual disability",
                    "HP:0001249; Neurodevelopmental delay",
                    "HP:0012758"
                ],
                "stats": {
                    "number_of_genes": 2523,
                    "number_of_strs": 10,
                    "number_of_regions": 57
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7436",
                "gene_name": "methylenetetrahydrofolate reductase",
                "omim_gene": [
                    "607093"
                ],
                "alias_name": null,
                "gene_symbol": "MTHFR",
                "hgnc_symbol": "MTHFR",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:11845780-11866977",
                            "ensembl_id": "ENSG00000177000"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:11785723-11806920",
                            "ensembl_id": "ENSG00000177000"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1994-07-15"
            },
            "entity_type": "gene",
            "entity_name": "MTHFR",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "27604308",
                "7920641"
            ],
            "evidence": [
                "Expert Review Green",
                "Genetic Health Queensland"
            ],
            "phenotypes": [
                "Homocystinuria due to MTHFR deficiency MIM#236250",
                "Disorders of folate metabolism and transport"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 250,
                "hash_id": null,
                "name": "Intellectual disability syndromic and non-syndromic",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.",
                "status": "public",
                "version": "1.745",
                "version_created": "2026-04-03T15:53:29.044094+11:00",
                "relevant_disorders": [
                    "Intellectual disability",
                    "HP:0001249; Neurodevelopmental delay",
                    "HP:0012758"
                ],
                "stats": {
                    "number_of_genes": 2523,
                    "number_of_strs": 10,
                    "number_of_regions": 57
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3607",
                "gene_name": "fructose-bisphosphatase 2",
                "omim_gene": [
                    "603027"
                ],
                "alias_name": null,
                "gene_symbol": "FBP2",
                "hgnc_symbol": "FBP2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:97321002-97356075",
                            "ensembl_id": "ENSG00000130957"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:94558720-94593793",
                            "ensembl_id": "ENSG00000130957"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-12-09"
            },
            "entity_type": "gene",
            "entity_name": "FBP2",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "33977262"
            ],
            "evidence": [
                "Expert Review Amber",
                "Expert list"
            ],
            "phenotypes": [
                "Leukodystrophy, childhood-onset, remitting, MIM# \t619864"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 298,
                "hash_id": null,
                "name": "Leukodystrophy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.",
                "status": "public",
                "version": "0.394",
                "version_created": "2026-04-07T13:49:15.516142+10:00",
                "relevant_disorders": [
                    "Leukodystrophy",
                    "HP:0002415; Abnormal cerebral white matter morphology",
                    "HP:0002500; Abnormal CNS myelination",
                    "HP:0011400"
                ],
                "stats": {
                    "number_of_genes": 262,
                    "number_of_strs": 3,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "LCB1",
                    "SPTI",
                    "HSAN1",
                    "hLCB1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:11277",
                "gene_name": "serine palmitoyltransferase long chain base subunit 1",
                "omim_gene": [
                    "605712"
                ],
                "alias_name": null,
                "gene_symbol": "SPTLC1",
                "hgnc_symbol": "SPTLC1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:94794281-94877666",
                            "ensembl_id": "ENSG00000090054"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:92031999-92115384",
                            "ensembl_id": "ENSG00000090054"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2000-07-31"
            },
            "entity_type": "gene",
            "entity_name": "SPTLC1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "11242114",
                "11242106",
                "15037712",
                "26681808"
            ],
            "evidence": [
                "Royal Melbourne Hospital",
                "Expert Review Green",
                "Expert Review Green"
            ],
            "phenotypes": [
                "Juvenile amyotrophic lateral sclerosis-27, MIM#620285",
                "HSAN/SFN",
                "Hereditary Sensory and Autonomic Neuropathy, Type II",
                "Neuropathy, hereditary sensory and autonomic, type IA, 162400"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3070,
                "hash_id": null,
                "name": "Hereditary Neuropathy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),",
                "status": "public",
                "version": "1.190",
                "version_created": "2026-03-31T19:04:58.660686+11:00",
                "relevant_disorders": [
                    "Peripheral neuropathy",
                    "HP:0009830"
                ],
                "stats": {
                    "number_of_genes": 277,
                    "number_of_strs": 6,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "H11",
                    "E2IG1",
                    "HSP22",
                    "HspB8",
                    "CMT2L"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:30171",
                "gene_name": "heat shock protein family B (small) member 8",
                "omim_gene": [
                    "608014"
                ],
                "alias_name": null,
                "gene_symbol": "HSPB8",
                "hgnc_symbol": "HSPB8",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:119616447-119658936",
                            "ensembl_id": "ENSG00000152137"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:119178642-119221131",
                            "ensembl_id": "ENSG00000152137"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-01-29"
            },
            "entity_type": "gene",
            "entity_name": "HSPB8",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "15122253",
                "15565283",
                "29029362",
                "28780615",
                "28144995",
                "26718575"
            ],
            "evidence": [
                "Royal Melbourne Hospital",
                "Expert Review Green",
                "Expert Review Green"
            ],
            "phenotypes": [
                "HMSN, dHMN/dSMA",
                "Neuropathy, distal hereditary motor, type IIA, 158590",
                "Charcot Marie Tooth disease, axonal, type 2L, 608673"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3070,
                "hash_id": null,
                "name": "Hereditary Neuropathy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),",
                "status": "public",
                "version": "1.190",
                "version_created": "2026-03-31T19:04:58.660686+11:00",
                "relevant_disorders": [
                    "Peripheral neuropathy",
                    "HP:0009830"
                ],
                "stats": {
                    "number_of_genes": 277,
                    "number_of_strs": 6,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "HNPP",
                    "GAS3",
                    "Sp110"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:9118",
                "gene_name": "peripheral myelin protein 22",
                "omim_gene": [
                    "601097"
                ],
                "alias_name": null,
                "gene_symbol": "PMP22",
                "hgnc_symbol": "PMP22",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:15133095-15168643",
                            "ensembl_id": "ENSG00000109099"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:15229777-15265326",
                            "ensembl_id": "ENSG00000109099"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1992-11-05"
            },
            "entity_type": "gene",
            "entity_name": "PMP22",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "32412171",
                "31777123",
                "32719652",
                "32356557"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services",
                "Royal Melbourne Hospital",
                "Royal Melbourne Hospital",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Charcot-Marie-Tooth disease, type 1A, MIM# 118220",
                "Charcot-Marie-Tooth disease, type 1E, MIM# 118300",
                "Dejerine-Sottas disease, MIM# 145900",
                "Neuropathy, recurrent, with pressure palsies 162500",
                "Roussy-Levy syndrome 180800"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "tags": [
                "SV/CNV"
            ],
            "panel": {
                "id": 3070,
                "hash_id": null,
                "name": "Hereditary Neuropathy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),",
                "status": "public",
                "version": "1.190",
                "version_created": "2026-03-31T19:04:58.660686+11:00",
                "relevant_disorders": [
                    "Peripheral neuropathy",
                    "HP:0009830"
                ],
                "stats": {
                    "number_of_genes": 277,
                    "number_of_strs": 6,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "HBVES",
                    "POP1",
                    "POPDC1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:1152",
                "gene_name": "blood vessel epicardial substance",
                "omim_gene": [
                    "604577"
                ],
                "alias_name": [
                    "popeye domain containing 1"
                ],
                "gene_symbol": "BVES",
                "hgnc_symbol": "BVES",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:105544697-105585049",
                            "ensembl_id": "ENSG00000112276"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:105096822-105137174",
                            "ensembl_id": "ENSG00000112276"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2000-01-10"
            },
            "entity_type": "gene",
            "entity_name": "BVES",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "26642364 32528171 31119192"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert Review Green",
                "Expert list",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Muscular dystrophy, limb-girdle, autosomal recessive 25 616812"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3071,
                "hash_id": null,
                "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.",
                "status": "public",
                "version": "1.65",
                "version_created": "2026-01-21T10:59:30.179226+11:00",
                "relevant_disorders": [
                    "Limb-girdle muscular dystrophy",
                    "MONDO:0016971; Proximal muscle weakness",
                    "HP:0003701; Distal myopathy MONDO:0018949"
                ],
                "stats": {
                    "number_of_genes": 102,
                    "number_of_strs": 10,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "Uae1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:23657",
                "gene_name": "glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase",
                "omim_gene": [
                    "603824"
                ],
                "alias_name": [
                    "bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase"
                ],
                "gene_symbol": "GNE",
                "hgnc_symbol": "GNE",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:36214438-36277053",
                            "ensembl_id": "ENSG00000159921"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:36214441-36277056",
                            "ensembl_id": "ENSG00000159921"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-11-28"
            },
            "entity_type": "gene",
            "entity_name": "GNE",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "22883483",
                "20301439"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert Review",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Nonaka myopathy (MIM#605820)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3071,
                "hash_id": null,
                "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy",
                "disease_group": "Neurology and neurodevelopmental disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.",
                "status": "public",
                "version": "1.65",
                "version_created": "2026-01-21T10:59:30.179226+11:00",
                "relevant_disorders": [
                    "Limb-girdle muscular dystrophy",
                    "MONDO:0016971; Proximal muscle weakness",
                    "HP:0003701; Distal myopathy MONDO:0018949"
                ],
                "stats": {
                    "number_of_genes": 102,
                    "number_of_strs": 10,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA1032",
                    "Munc13-1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:23150",
                "gene_name": "unc-13 homolog A",
                "omim_gene": [
                    "609894"
                ],
                "alias_name": null,
                "gene_symbol": "UNC13A",
                "hgnc_symbol": "UNC13A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:17712137-17799401",
                            "ensembl_id": "ENSG00000130477"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:17601328-17688365",
                            "ensembl_id": "ENSG00000130477"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-10-16"
            },
            "entity_type": "gene",
            "entity_name": "UNC13A",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "40011789"
            ],
            "evidence": [
                "Expert Review Red",
                "Literature"
            ],
            "phenotypes": [
                "Monogenic diabetes, MONDO:0015967, UNC13A-related"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3093,
                "hash_id": null,
                "name": "Monogenic Diabetes",
                "disease_group": "Endocrine disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with monogenic diabetes, including: \r\n-familial diabetes\r\n-neonatal diabetes\r\n-maturity onset diabetes of the young\r\n-insulin resistance (including lipodystrophy)\r\n\r\nIt has been compared against the following Genomics England PanelApp panels with all discrepancies reviewed and resolved (February 2026) : monogenic diabetes (V3.8), familial diabetes (V1.68), neonatal diabetes (V5.14), multi-organ autoimmune diabetes (V1.12), diabetes with additional phenotypes suggestive of a monogenic aetiology (V1.68), and insulin resistance (including lipodystrophy)(V1.18). \r\n\r\nFor a high suspicion of a mitochondrial DNA disorder: \r\nrequest a specific assay for mitochondrially encoded genes (such as mitochondrial genome sequencing or whole genome sequencing).",
                "status": "public",
                "version": "0.224",
                "version_created": "2026-04-06T18:03:06.439122+10:00",
                "relevant_disorders": [
                    "Diabetes mellitus",
                    "HP:0000819"
                ],
                "stats": {
                    "number_of_genes": 109,
                    "number_of_strs": 0,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "CL640",
                    "FLJ26072"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25223",
                "gene_name": "coenzyme Q2, polyprenyltransferase",
                "omim_gene": [
                    "609825"
                ],
                "alias_name": [
                    "4-hydroxybenzoate polyprenyltransferase"
                ],
                "gene_symbol": "COQ2",
                "hgnc_symbol": "COQ2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "4:84182689-84206067",
                            "ensembl_id": "ENSG00000173085"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "4:83261536-83284914",
                            "ensembl_id": "ENSG00000173085"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-07-05"
            },
            "entity_type": "gene",
            "entity_name": "COQ2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "16400613",
                "30337132",
                "26296322"
            ],
            "evidence": [
                "Expert Review Green",
                "NHS GMS"
            ],
            "phenotypes": [
                "coenzyme Q10 deficiency, primary, 1 MONDO:0011829"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3093,
                "hash_id": null,
                "name": "Monogenic Diabetes",
                "disease_group": "Endocrine disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with monogenic diabetes, including: \r\n-familial diabetes\r\n-neonatal diabetes\r\n-maturity onset diabetes of the young\r\n-insulin resistance (including lipodystrophy)\r\n\r\nIt has been compared against the following Genomics England PanelApp panels with all discrepancies reviewed and resolved (February 2026) : monogenic diabetes (V3.8), familial diabetes (V1.68), neonatal diabetes (V5.14), multi-organ autoimmune diabetes (V1.12), diabetes with additional phenotypes suggestive of a monogenic aetiology (V1.68), and insulin resistance (including lipodystrophy)(V1.18). \r\n\r\nFor a high suspicion of a mitochondrial DNA disorder: \r\nrequest a specific assay for mitochondrially encoded genes (such as mitochondrial genome sequencing or whole genome sequencing).",
                "status": "public",
                "version": "0.224",
                "version_created": "2026-04-06T18:03:06.439122+10:00",
                "relevant_disorders": [
                    "Diabetes mellitus",
                    "HP:0000819"
                ],
                "stats": {
                    "number_of_genes": 109,
                    "number_of_strs": 0,
                    "number_of_regions": 2
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "RNU4ATAC1"
                ],
                "biotype": "snRNA",
                "hgnc_id": "HGNC:34016",
                "gene_name": "RNA, U4atac small nuclear (U12-dependent splicing)",
                "omim_gene": [
                    "601428"
                ],
                "alias_name": null,
                "gene_symbol": "RNU4ATAC",
                "hgnc_symbol": "RNU4ATAC",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:122288457-122288583",
                            "ensembl_id": "ENSG00000264229"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:121530881-121531007",
                            "ensembl_id": "ENSG00000264229"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2008-03-12"
            },
            "entity_type": "gene",
            "entity_name": "RNU4ATAC",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "2801768",
                "29265708",
                "30368667"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert Review"
            ],
            "phenotypes": [
                "Roifman syndrome, MIM#\t616651",
                "Lowry-Wood syndrome, MIM#\t226960"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [
                "non-coding gene"
            ],
            "panel": {
                "id": 3099,
                "hash_id": null,
                "name": "Syndromic Retinopathy",
                "disease_group": "Ophthalmological disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes that cause retinopathy with at least one other consistent extra-ocular feature, forming a syndrome. The panel does NOT include the Bardet-Biedl syndrome, Stickler syndrome, and Usher syndrome genes, which have their own panels and are part of the Retinal Disorders Superpanel.\r\n\r\nConsider using the panel Retinal Disorders Superpanel when ophthalmological findings are not specific for a sub-group of disorders, particularly in individuals early in the diagnostic trajectory or if a dual diagnosis is a possibility.",
                "status": "public",
                "version": "0.256",
                "version_created": "2026-03-31T19:05:29.271183+11:00",
                "relevant_disorders": [
                    "Retinopathy",
                    "HP:0000488"
                ],
                "stats": {
                    "number_of_genes": 138,
                    "number_of_strs": 1,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:2217",
                "gene_name": "collagen type IX alpha 1 chain",
                "omim_gene": [
                    "120210"
                ],
                "alias_name": null,
                "gene_symbol": "COL9A1",
                "hgnc_symbol": "COL9A1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:70924764-71012786",
                            "ensembl_id": "ENSG00000112280"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:70215061-70303083",
                            "ensembl_id": "ENSG00000112280"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1989-05-08"
            },
            "entity_type": "gene",
            "entity_name": "COL9A1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "16909383",
                "21421862",
                "31090205"
            ],
            "evidence": [
                "Expert Review Green",
                "Victorian Clinical Genetics Services"
            ],
            "phenotypes": [
                "Stickler syndrome, type IV, MIM# 614134"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3114,
                "hash_id": null,
                "name": "Stickler Syndrome",
                "disease_group": "Ophthalmological disorders",
                "disease_sub_group": "",
                "description": "This is a consensus panel between VCGS and RMH.\r\n\r\nThis panel contains genes associated with Stickler syndrome, a connective tissue disorder that can include ocular findings of myopia, cataract, and retinal detachment; hearing loss that is both conductive and sensorineural; midfacial underdevelopment and cleft palate (either alone or as part of the Robin sequence); and mild spondyloepiphyseal dysplasia and/or precocious arthritis.\r\n\r\nThe features of Stickler syndrome can be highly variable. Consider applying the Vitreoretinopathy, Deafness, Skeletal Dysplasia and Pierre Robin sequence panels if features are not entirely typical.",
                "status": "public",
                "version": "1.12",
                "version_created": "2025-10-24T18:06:37.494562+11:00",
                "relevant_disorders": [
                    "Myopia",
                    "HP:0000545; Retinal detachment",
                    "HP:0000541; Cleft palate",
                    "HP:0000175"
                ],
                "stats": {
                    "number_of_genes": 10,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:13666",
                "gene_name": "aladin WD repeat nucleoporin",
                "omim_gene": [
                    "605378"
                ],
                "alias_name": [
                    "aladin",
                    "Allgrove, triple-A",
                    "adracalin"
                ],
                "gene_symbol": "AAAS",
                "hgnc_symbol": "AAAS",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "12:53701240-53718648",
                            "ensembl_id": "ENSG00000094914"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "12:53307456-53324864",
                            "ensembl_id": "ENSG00000094914"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2000-11-08"
            },
            "entity_type": "gene",
            "entity_name": "AAAS",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Achalasia-addisonianism-alacrimia syndrome, 231550 (3)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3139,
                "hash_id": null,
                "name": "Mackenzie's Mission_Reproductive Carrier Screening",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.",
                "status": "public",
                "version": "0.111",
                "version_created": "2025-11-21T16:50:54.555702+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1335,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "New South Wales Health Pathology",
                        "slug": "new-south-wales-health-pathology",
                        "description": "New South Wales Health Pathology"
                    },
                    {
                        "name": "PathWest",
                        "slug": "pathwest",
                        "description": "PathWest"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ25330",
                    "ODA7",
                    "CILD13",
                    "swt"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:30539",
                "gene_name": "dynein axonemal assembly factor 1",
                "omim_gene": [
                    "613190"
                ],
                "alias_name": [
                    "outer row dynein assembly 7 homolog (Chlamydomonas)"
                ],
                "gene_symbol": "DNAAF1",
                "hgnc_symbol": "DNAAF1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "16:84178865-84212373",
                            "ensembl_id": "ENSG00000154099"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "16:84145287-84178767",
                            "ensembl_id": "ENSG00000154099"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2011-06-09"
            },
            "entity_type": "gene",
            "entity_name": "DNAAF1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Ciliary dyskinesia, primary, 13, 613193 (3)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3139,
                "hash_id": null,
                "name": "Mackenzie's Mission_Reproductive Carrier Screening",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.",
                "status": "public",
                "version": "0.111",
                "version_created": "2025-11-21T16:50:54.555702+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1335,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "New South Wales Health Pathology",
                        "slug": "new-south-wales-health-pathology",
                        "description": "New South Wales Health Pathology"
                    },
                    {
                        "name": "PathWest",
                        "slug": "pathwest",
                        "description": "PathWest"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ12660",
                    "IND1",
                    "huInd1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:20278",
                "gene_name": "nucleotide binding protein like",
                "omim_gene": [
                    "613621"
                ],
                "alias_name": [
                    "iron-sulfur protein required for NADH dehydrogenase"
                ],
                "gene_symbol": "NUBPL",
                "hgnc_symbol": "NUBPL",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "14:31959162-32330430",
                            "ensembl_id": "ENSG00000151413"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "14:31489956-31861224",
                            "ensembl_id": "ENSG00000151413"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-01-07"
            },
            "entity_type": "gene",
            "entity_name": "NUBPL",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Mitochondrial complex I deficiency, 252010 (3)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3139,
                "hash_id": null,
                "name": "Mackenzie's Mission_Reproductive Carrier Screening",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.",
                "status": "public",
                "version": "0.111",
                "version_created": "2025-11-21T16:50:54.555702+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1335,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "New South Wales Health Pathology",
                        "slug": "new-south-wales-health-pathology",
                        "description": "New South Wales Health Pathology"
                    },
                    {
                        "name": "PathWest",
                        "slug": "pathwest",
                        "description": "PathWest"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ33817",
                    "PPP1R166",
                    "CAMRQ2",
                    "SORF-2"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:26600",
                "gene_name": "WD repeat domain 81",
                "omim_gene": [
                    "614218"
                ],
                "alias_name": [
                    "protein phosphatase 1, regulatory subunit 166"
                ],
                "gene_symbol": "WDR81",
                "hgnc_symbol": "WDR81",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:1619817-1641893",
                            "ensembl_id": "ENSG00000167716"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:1716523-1738599",
                            "ensembl_id": "ENSG00000167716"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-12-16"
            },
            "entity_type": "gene",
            "entity_name": "WDR81",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185 (3)"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3139,
                "hash_id": null,
                "name": "Mackenzie's Mission_Reproductive Carrier Screening",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.",
                "status": "public",
                "version": "0.111",
                "version_created": "2025-11-21T16:50:54.555702+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1335,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "New South Wales Health Pathology",
                        "slug": "new-south-wales-health-pathology",
                        "description": "New South Wales Health Pathology"
                    },
                    {
                        "name": "PathWest",
                        "slug": "pathwest",
                        "description": "PathWest"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MGC12981",
                    "FLJ30131",
                    "ccp1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:28178",
                "gene_name": "coiled-coil domain containing 115",
                "omim_gene": [
                    "613734"
                ],
                "alias_name": null,
                "gene_symbol": "CCDC115",
                "hgnc_symbol": "CCDC115",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:131095814-131099922",
                            "ensembl_id": "ENSG00000136710"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:130338241-130342349",
                            "ensembl_id": "ENSG00000136710"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2006-07-03"
            },
            "entity_type": "gene",
            "entity_name": "CCDC115",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Congenital disorder of glycosylation, type IIo, 616828 (3), Autosomal recessive"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3139,
                "hash_id": null,
                "name": "Mackenzie's Mission_Reproductive Carrier Screening",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.",
                "status": "public",
                "version": "0.111",
                "version_created": "2025-11-21T16:50:54.555702+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1335,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "New South Wales Health Pathology",
                        "slug": "new-south-wales-health-pathology",
                        "description": "New South Wales Health Pathology"
                    },
                    {
                        "name": "PathWest",
                        "slug": "pathwest",
                        "description": "PathWest"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ36445",
                    "Nesprin-4",
                    "Nesp4"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:26703",
                "gene_name": "spectrin repeat containing nuclear envelope family member 4",
                "omim_gene": [
                    "615535"
                ],
                "alias_name": null,
                "gene_symbol": "SYNE4",
                "hgnc_symbol": "SYNE4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:36494209-36499695",
                            "ensembl_id": "ENSG00000181392"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:36003307-36008793",
                            "ensembl_id": "ENSG00000181392"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2012-05-31"
            },
            "entity_type": "gene",
            "entity_name": "SYNE4",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Red",
                "BabySeq Category C gene"
            ],
            "phenotypes": [
                "Hearing loss"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3302,
                "hash_id": null,
                "name": "Additional findings_Paediatric",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).",
                "status": "public",
                "version": "0.280",
                "version_created": "2026-01-16T11:59:53.863455+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1425,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:333",
                "gene_name": "angiotensinogen",
                "omim_gene": [
                    "106150"
                ],
                "alias_name": [
                    "alpha-1 antiproteinase, antitrypsin"
                ],
                "gene_symbol": "AGT",
                "hgnc_symbol": "AGT",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:230838269-230850043",
                            "ensembl_id": "ENSG00000135744"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:230702523-230714297",
                            "ensembl_id": "ENSG00000135744"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-29"
            },
            "entity_type": "gene",
            "entity_name": "AGT",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Red",
                "BabySeq Category C gene"
            ],
            "phenotypes": [
                "Renal tubular dysgenesis"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3302,
                "hash_id": null,
                "name": "Additional findings_Paediatric",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).",
                "status": "public",
                "version": "0.280",
                "version_created": "2026-01-16T11:59:53.863455+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1425,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MYH2A",
                    "MYHSA2",
                    "MyHC-IIa",
                    "MYHas8",
                    "MyHC-2A"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:7572",
                "gene_name": "myosin heavy chain 2",
                "omim_gene": [
                    "160740"
                ],
                "alias_name": null,
                "gene_symbol": "MYH2",
                "hgnc_symbol": "MYH2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:10424465-10453274",
                            "ensembl_id": "ENSG00000125414"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:10521148-10549957",
                            "ensembl_id": "ENSG00000125414"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-06-22"
            },
            "entity_type": "gene",
            "entity_name": "MYH2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "PMID 24193343",
                "32578970",
                "11114175",
                "23489661"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Proximal myopathy and ophthalmoplegia, MIM# 605637"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3379,
                "hash_id": null,
                "name": "Congenital ophthalmoplegia",
                "disease_group": "Ophthalmological disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with congenital ophthalmoplegia including those associated with congenital fibrosis of the extra-ocular muscles (CFEOM), Duane anomaly, Moebius syndrome, and gaze palsies.\r\n\r\nIn addition, it includes genes associated with conditions where ophthalmoplegia can occur in infancy/early childhood as a common/prominent feature of a more complex syndromic, metabolic or neuromuscular condition.",
                "status": "public",
                "version": "1.14",
                "version_created": "2025-12-14T20:52:23.588623+11:00",
                "relevant_disorders": [
                    "Abnormality of eye movement",
                    "HP:0000496"
                ],
                "stats": {
                    "number_of_genes": 55,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "EBI"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:11585",
                "gene_name": "transducin beta like 1 X-linked",
                "omim_gene": [
                    "300196"
                ],
                "alias_name": null,
                "gene_symbol": "TBL1X",
                "hgnc_symbol": "TBL1X",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "X:9431335-9687780",
                            "ensembl_id": "ENSG00000101849"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "X:9463295-9719743",
                            "ensembl_id": "ENSG00000101849"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2002-05-24"
            },
            "entity_type": "gene",
            "entity_name": "TBL1X",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "30591955",
                "27603907"
            ],
            "evidence": [
                "Expert Review Red",
                "Literature"
            ],
            "phenotypes": [
                "Hypothyroidism, congenital, nongoitrous, 8 - MIM#301033"
            ],
            "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.558",
                "version_created": "2026-04-07T13:44:14.990434+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2207,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "MRLC2",
                    "HUMMLC2B",
                    "MYL11"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29824",
                "gene_name": "myosin light chain, phosphorylatable, fast skeletal muscle",
                "omim_gene": [
                    "617378"
                ],
                "alias_name": [
                    "myosin, light chain 11, regulatory",
                    "myosin regulatory light chain 2"
                ],
                "gene_symbol": "MYLPF",
                "hgnc_symbol": "MYLPF",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "16:30382255-30389312",
                            "ensembl_id": "ENSG00000180209"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "16:30370934-30377991",
                            "ensembl_id": "ENSG00000180209"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2009-03-06"
            },
            "entity_type": "gene",
            "entity_name": "MYLPF",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "32707087"
            ],
            "evidence": [
                "Expert Review Amber",
                "Literature",
                "Expert list"
            ],
            "phenotypes": [
                "Distal arthrogryposis type 1C (DA1C), MIM#619110"
            ],
            "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.558",
                "version_created": "2026-04-07T13:44:14.990434+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2207,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:11191",
                "gene_name": "SRY-box 11",
                "omim_gene": [
                    "600898"
                ],
                "alias_name": [
                    "SRY-related HMG-box gene 11"
                ],
                "gene_symbol": "SOX11",
                "hgnc_symbol": "SOX11",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:5832799-5841516",
                            "ensembl_id": "ENSG00000176887"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:5692667-5701385",
                            "ensembl_id": "ENSG00000176887"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1995-06-08"
            },
            "entity_type": "gene",
            "entity_name": "SOX11",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "24886874",
                "33785884",
                "33430815",
                "33086258",
                "31530938"
            ],
            "evidence": [
                "Expert Review Green",
                "Genomics England PanelApp"
            ],
            "phenotypes": [
                "Coffin-Siris syndrome 9, OMIM # 615866"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.558",
                "version_created": "2026-04-07T13:44:14.990434+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2207,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA0436"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:30228",
                "gene_name": "prolyl endopeptidase-like",
                "omim_gene": [
                    "609557"
                ],
                "alias_name": null,
                "gene_symbol": "PREPL",
                "hgnc_symbol": "PREPL",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:44543420-44589001",
                            "ensembl_id": "ENSG00000138078"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:44316281-44361862",
                            "ensembl_id": "ENSG00000138078"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2005-02-25"
            },
            "entity_type": "gene",
            "entity_name": "PREPL",
            "confidence_level": "2",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "29483676",
                "28726805",
                "24610330",
                "27472506"
            ],
            "evidence": [
                "Expert Review Amber",
                "Genomics England PanelApp",
                "Genetic Health Queensland"
            ],
            "phenotypes": [
                "Myasthenic syndrome, congenital, 22, MIM#616224",
                "Hypotonia-cystinuria syndrome"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.558",
                "version_created": "2026-04-07T13:44:14.990434+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2207,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "AST",
                    "SD",
                    "ISSD",
                    "NSD",
                    "SIALIN",
                    "SLD"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:10933",
                "gene_name": "solute carrier family 17 member 5",
                "omim_gene": [
                    "604322"
                ],
                "alias_name": null,
                "gene_symbol": "SLC17A5",
                "hgnc_symbol": "SLC17A5",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:74303102-74363878",
                            "ensembl_id": "ENSG00000119899"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:73593379-73654155",
                            "ensembl_id": "ENSG00000119899"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2000-01-06"
            },
            "entity_type": "gene",
            "entity_name": "SLC17A5",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "33862140",
                "10581036",
                "10947946"
            ],
            "evidence": [
                "Expert Review Green",
                "Genomics England PanelApp"
            ],
            "phenotypes": [
                "Sialic acid storage disorder, infantile, MIM#269920",
                "MONDO:0010027"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.558",
                "version_created": "2026-04-07T13:44:14.990434+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2207,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:3091",
                "gene_name": "dual specificity tyrosine phosphorylation regulated kinase 1A",
                "omim_gene": [
                    "600855"
                ],
                "alias_name": null,
                "gene_symbol": "DYRK1A",
                "hgnc_symbol": "DYRK1A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "21:38738092-38889753",
                            "ensembl_id": "ENSG00000157540"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "21:37365790-37517450",
                            "ensembl_id": "ENSG00000157540"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1999-01-29"
            },
            "entity_type": "gene",
            "entity_name": "DYRK1A",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "25707398"
            ],
            "evidence": [
                "Expert Review Green",
                "Genomics England PanelApp",
                "Literature"
            ],
            "phenotypes": [
                "Mental retardation, autosomal dominant 7, MIM# 614104"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [
                "SV/CNV"
            ],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.558",
                "version_created": "2026-04-07T13:44:14.990434+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2207,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ22329"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:26182",
                "gene_name": "collagen beta(1-O)galactosyltransferase 1",
                "omim_gene": [
                    "617531"
                ],
                "alias_name": [
                    "Procollagen galactosyltransferase",
                    "Hydroxylysine galactosyltransferase"
                ],
                "gene_symbol": "COLGALT1",
                "hgnc_symbol": "COLGALT1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:17666403-17693971",
                            "ensembl_id": "ENSG00000130309"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:17555594-17583162",
                            "ensembl_id": "ENSG00000130309"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2013-02-27"
            },
            "entity_type": "gene",
            "entity_name": "COLGALT1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "30412317",
                "33709034",
                "31759980"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Brain small vessel disease 3, MIM# 618360"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3763,
                "hash_id": null,
                "name": "Fetal anomalies",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.",
                "status": "public",
                "version": "1.558",
                "version_created": "2026-04-07T13:44:14.990434+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 2207,
                    "number_of_strs": 3,
                    "number_of_regions": 6
                },
                "types": [
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ34884"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:25118",
                "gene_name": "OTU deubiquitinase with linear linkage specificity",
                "omim_gene": [
                    "615712"
                ],
                "alias_name": [
                    "gumby"
                ],
                "gene_symbol": "OTULIN",
                "hgnc_symbol": "OTULIN",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "5:14664773-14699820",
                            "ensembl_id": "ENSG00000154124"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "5:14664664-14699711",
                            "ensembl_id": "ENSG00000154124"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2014-03-11"
            },
            "entity_type": "gene",
            "entity_name": "OTULIN",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "27523608",
                "27559085",
                "30796585",
                "35170849"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "Autoinflammation, panniculitis, and dermatosis syndrome, autosomal recessive MIM#617099"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.16",
                "version_created": "2026-04-02T17:30:09.498472+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "FLJ20343",
                    "MGC19520"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:26006",
                "gene_name": "tetratricopeptide repeat domain 19",
                "omim_gene": [
                    "613814"
                ],
                "alias_name": null,
                "gene_symbol": "TTC19",
                "hgnc_symbol": "TTC19",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "17:15902694-15948329",
                            "ensembl_id": "ENSG00000011295"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "17:15999380-16045015",
                            "ensembl_id": "ENSG00000011295"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2004-08-27"
            },
            "entity_type": "gene",
            "entity_name": "TTC19",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "21278747",
                "23532514",
                "24368687",
                "24397319",
                "25887401"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Mitochondrial complex III deficiency, nuclear type 2 MIM#615157"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.16",
                "version_created": "2026-04-02T17:30:09.498472+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:9988",
                "gene_name": "regulatory factor X associated protein",
                "omim_gene": [
                    "601861"
                ],
                "alias_name": null,
                "gene_symbol": "RFXAP",
                "hgnc_symbol": "RFXAP",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "13:37393361-37403241",
                            "ensembl_id": "ENSG00000133111"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "13:36819224-36829104",
                            "ensembl_id": "ENSG00000133111"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1997-11-05"
            },
            "entity_type": "gene",
            "entity_name": "RFXAP",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "9118943",
                "32875002",
                "11258423"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "MHC class II deficiency 4 MIM#620817"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.16",
                "version_created": "2026-04-02T17:30:09.498472+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:14938",
                "gene_name": "phosphatidylinositol glycan anchor biosynthesis class T",
                "omim_gene": [
                    "610272"
                ],
                "alias_name": [
                    "GPI transamidase subunit"
                ],
                "gene_symbol": "PIGT",
                "hgnc_symbol": "PIGT",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "20:44044717-44054884",
                            "ensembl_id": "ENSG00000124155"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "20:45416067-45456934",
                            "ensembl_id": "ENSG00000124155"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2001-03-27"
            },
            "entity_type": "gene",
            "entity_name": "PIGT",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "30976099",
                "25943031",
                "24906948",
                "24906948",
                "24906948",
                "28728837",
                "28728837",
                "28728837"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.16",
                "version_created": "2026-04-02T17:30:09.498472+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "Uae1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:23657",
                "gene_name": "glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase",
                "omim_gene": [
                    "603824"
                ],
                "alias_name": [
                    "bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase"
                ],
                "gene_symbol": "GNE",
                "hgnc_symbol": "GNE",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "9:36214438-36277053",
                            "ensembl_id": "ENSG00000159921"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "9:36214441-36277056",
                            "ensembl_id": "ENSG00000159921"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2003-11-28"
            },
            "entity_type": "gene",
            "entity_name": "GNE",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "25257349",
                "17549255",
                "25061177",
                "30171045",
                "29941673"
            ],
            "evidence": [
                "Expert Review Red",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Nonaka myopathy MIM#605820",
                "Thrombocytopenia 12 with or without myopathy MIM#620757"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.16",
                "version_created": "2026-04-02T17:30:09.498472+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DPP1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:2528",
                "gene_name": "cathepsin C",
                "omim_gene": [
                    "602365"
                ],
                "alias_name": [
                    "dipeptidyl peptidase 1"
                ],
                "gene_symbol": "CTSC",
                "hgnc_symbol": "CTSC",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "11:88026760-88070955",
                            "ensembl_id": "ENSG00000109861"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "11:88293592-88337787",
                            "ensembl_id": "ENSG00000109861"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1995-11-08"
            },
            "entity_type": "gene",
            "entity_name": "CTSC",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Haim-Munk syndrome MIM#245010",
                "Papillon-Lefevre syndrome MIM#245000"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.16",
                "version_created": "2026-04-02T17:30:09.498472+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "DIDMOAD",
                    "WFS"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:12762",
                "gene_name": "wolframin ER transmembrane glycoprotein",
                "omim_gene": [
                    "606201"
                ],
                "alias_name": null,
                "gene_symbol": "WFS1",
                "hgnc_symbol": "WFS1",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "4:6271576-6304992",
                            "ensembl_id": "ENSG00000109501"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "4:6269849-6303265",
                            "ensembl_id": "ENSG00000109501"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1995-01-30"
            },
            "entity_type": "gene",
            "entity_name": "WFS1",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "20301750",
                "33946243"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Wolfram syndrome 1 MIM#222300"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 3861,
                "hash_id": null,
                "name": "Prepair 1000+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.16",
                "version_created": "2026-04-02T17:30:09.498472+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1389,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA0733"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:17075",
                "gene_name": "TGF-beta activated kinase 1/MAP3K7 binding protein 2",
                "omim_gene": [
                    "605101"
                ],
                "alias_name": null,
                "gene_symbol": "TAB2",
                "hgnc_symbol": "TAB2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "6:149539777-149732749",
                            "ensembl_id": "ENSG00000055208"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "6:149218641-149411613",
                            "ensembl_id": "ENSG00000055208"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2010-02-05"
            },
            "entity_type": "gene",
            "entity_name": "TAB2",
            "confidence_level": "1",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [],
            "evidence": [
                "BabySeq Category C gene",
                "Expert Review Red"
            ],
            "phenotypes": [
                "Congenital heart disease, nonsyndromic"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3931,
                "hash_id": null,
                "name": "Genomic newborn screening: BabyScreen+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)",
                "status": "public",
                "version": "1.148",
                "version_created": "2026-03-31T15:17:11.094244+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 1723,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:2553",
                "gene_name": "cullin 3",
                "omim_gene": [
                    "603136"
                ],
                "alias_name": null,
                "gene_symbol": "CUL3",
                "hgnc_symbol": "CUL3",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "2:225334867-225450110",
                            "ensembl_id": "ENSG00000036257"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "2:224470150-224585397",
                            "ensembl_id": "ENSG00000036257"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1998-10-29"
            },
            "entity_type": "gene",
            "entity_name": "CUL3",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "22266938"
            ],
            "evidence": [
                "Expert Review Green",
                "KidGen_AldoHypertension v38.1.0",
                "Expert Review Green",
                "KidGen_AldoHypertension v38.1.0"
            ],
            "phenotypes": [
                "Pseudohypoaldosteronism, type IIE, MIM# 614496"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 3993,
                "hash_id": null,
                "name": "Renal Tubulopathies and related disorders",
                "disease_group": "Renal and urinary tract disorders",
                "disease_sub_group": "",
                "description": "This panel was developed/updated in Dec'22 and is maintained by the KidGen Collaborative, and is a consensus panel used by VCGS, GHQ, and RMH.\r\n\r\nThis panel contains genes that cause:\r\n-renal tubular disorders\r\n-electrolyte abnormalities (e.g. Na, K, H, Mg, Ca, PO4, Cl, HCO3)\r\n-aldosterone abnormalities\r\n-nephrolithiasis\r\n-metabolic renal diseases \r\n\r\nIt supersedes the following panels: Bartter syndrome, Dent disease, Diabetes Insipidus, Hyperoxaluria, Metabolic renal disease, Nephrolithiasis and Nephrocalcinosis, Renal abnormalities of calcium and phosphate metabolism, Renal Abnormalities of Magnesium Metabolism, Renal Hypertension and Disorders of Aldosterone Metabolism, and Renal Tubulopathies_KidGen.",
                "status": "public",
                "version": "1.26",
                "version_created": "2026-03-30T10:01:51.458813+11:00",
                "relevant_disorders": [
                    "Renal tubular dysfunction",
                    "HP:0000124; Nephrolithiasis",
                    "HP:0000787; Abnormal circulating aldosterone",
                    "HP:0040085"
                ],
                "stats": {
                    "number_of_genes": 134,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    },
                    {
                        "name": "KidGen",
                        "slug": "kidgen",
                        "description": "Panel used by the KidGen Collaborative."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "tuberin",
                    "LAM",
                    "PPP1R160"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:12363",
                "gene_name": "TSC complex subunit 2",
                "omim_gene": [
                    "191092"
                ],
                "alias_name": [
                    "protein phosphatase 1, regulatory subunit 160"
                ],
                "gene_symbol": "TSC2",
                "hgnc_symbol": "TSC2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "16:2097466-2138716",
                            "ensembl_id": "ENSG00000103197"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "16:2047465-2088720",
                            "ensembl_id": "ENSG00000103197"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "1989-05-25"
            },
            "entity_type": "gene",
            "entity_name": "TSC2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "20301399"
            ],
            "evidence": [
                "Expert Review Green",
                "Expert list"
            ],
            "phenotypes": [
                "tuberous sclerosis MONDO:0001734"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 4093,
                "hash_id": null,
                "name": "Facial papules",
                "disease_group": "Dermatological disorders",
                "disease_sub_group": "",
                "description": "This panel contains genes associated with diseases where facial papules and lesions can be a predominant feature of the phenotype, including coarse facies. It was developed by Prof Ingrid Winship from Royal Melbourne Hospital for use in the Genodermatosis clinic.",
                "status": "public",
                "version": "1.1",
                "version_created": "2026-01-12T09:37:15.457047+11:00",
                "relevant_disorders": [
                    "Papule HP:0200034"
                ],
                "stats": {
                    "number_of_genes": 22,
                    "number_of_strs": 0,
                    "number_of_regions": 1
                },
                "types": [
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "FRAG1",
                    "CWH43-N"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:17893",
                "gene_name": "post-GPI attachment to proteins 2",
                "omim_gene": [
                    "615187"
                ],
                "alias_name": [
                    "FGF receptor activating protein 1",
                    "cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"
                ],
                "gene_symbol": "PGAP2",
                "hgnc_symbol": "PGAP2",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "11:3818954-3847601",
                            "ensembl_id": "ENSG00000148985"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "11:3797724-3826371",
                            "ensembl_id": "ENSG00000148985"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2009-06-18"
            },
            "entity_type": "gene",
            "entity_name": "PGAP2",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": "",
            "publications": [
                "23561846",
                "23561847",
                "31805394",
                "29119105",
                "27871432"
            ],
            "evidence": [
                "Expert Review Green",
                "Mackenzie's Mission"
            ],
            "phenotypes": [
                "Hyperphosphatasia with impaired intellectual development syndrome 3, MIM#614207"
            ],
            "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal",
            "tags": [],
            "panel": {
                "id": 4225,
                "hash_id": null,
                "name": "Prepair 500+",
                "disease_group": "Screening",
                "disease_sub_group": "",
                "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.",
                "status": "public",
                "version": "2.0",
                "version_created": "2025-05-30T02:52:12.758302+10:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 629,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Victorian Clinical Genetics Services",
                        "slug": "victorian-clinical-genetics-services",
                        "description": "Panel used by VCGS."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": null
        },
        {
            "gene_data": {
                "alias": [
                    "KIAA0601",
                    "BHC110",
                    "LSD1"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29079",
                "gene_name": "lysine demethylase 1A",
                "omim_gene": [
                    "609132"
                ],
                "alias_name": null,
                "gene_symbol": "KDM1A",
                "hgnc_symbol": "KDM1A",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "1:23345941-23410182",
                            "ensembl_id": "ENSG00000004487"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "1:23019448-23083689",
                            "ensembl_id": "ENSG00000004487"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2009-09-29"
            },
            "entity_type": "gene",
            "entity_name": "KDM1A",
            "confidence_level": "3",
            "penetrance": null,
            "mode_of_pathogenicity": null,
            "publications": [
                "34655521, 34906447"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "ACTH-independent macronodular adrenal hyperplasia 3, MONDO:0700299"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "tags": [],
            "panel": {
                "id": 4488,
                "hash_id": null,
                "name": "Primary nodular adrenocortical disease",
                "disease_group": "Endocrine disorders; Cancer Predisposition",
                "disease_sub_group": "Adrenal disorders",
                "description": "This panel contains genes associated with primary pigmented nodular adrenocortical disease and ACTH-independent macronodular adrenal hyperplasia.\r\n\r\nThis panel has been compared against the Genomics England PanelApp and aligned with any assessments by ClinGen.",
                "status": "public",
                "version": "0.15",
                "version_created": "2026-02-02T07:59:54.010712+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 6,
                    "number_of_strs": 0,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Genetic Health Queensland",
                        "slug": "genetic-health-queensland",
                        "description": "Panel used by GHQ."
                    }
                ],
                "child_panel_ids": []
            },
            "transcript": []
        },
        {
            "gene_data": {
                "alias": [
                    "S3-12"
                ],
                "biotype": "protein_coding",
                "hgnc_id": "HGNC:29393",
                "gene_name": "perilipin 4",
                "omim_gene": [
                    "613247"
                ],
                "alias_name": null,
                "gene_symbol": "PLIN4",
                "hgnc_symbol": "PLIN4",
                "hgnc_release": "2017-11-03",
                "ensembl_genes": {
                    "GRch37": {
                        "82": {
                            "location": "19:4502204-4517716",
                            "ensembl_id": "ENSG00000167676"
                        }
                    },
                    "GRch38": {
                        "90": {
                            "location": "19:4502180-4518465",
                            "ensembl_id": "ENSG00000167676"
                        }
                    }
                },
                "hgnc_date_symbol_changed": "2009-08-12"
            },
            "entity_type": "str",
            "entity_name": "PLIN4_MRUPAV_33-mer",
            "confidence_level": "3",
            "penetrance": null,
            "publications": [
                "32451610",
                "37145156",
                "36151849",
                "35499779"
            ],
            "evidence": [
                "Expert Review Green",
                "Literature"
            ],
            "phenotypes": [
                "myopathy, distal, with rimmed vacuoles MONDO:0014945"
            ],
            "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted",
            "repeated_sequence": "ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC",
            "chromosome": "19",
            "grch37_coordinates": [
                4510975,
                4511073
            ],
            "grch38_coordinates": [
                4510963,
                4511061
            ],
            "normal_repeats": 31,
            "pathogenic_repeats": 39,
            "tags": [
                "adult-onset"
            ],
            "panel": {
                "id": 3597,
                "hash_id": null,
                "name": "Repeat Disorders",
                "disease_group": "",
                "disease_sub_group": "",
                "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.",
                "status": "public",
                "version": "0.272",
                "version_created": "2026-01-02T15:16:39.779953+11:00",
                "relevant_disorders": [],
                "stats": {
                    "number_of_genes": 0,
                    "number_of_strs": 76,
                    "number_of_regions": 0
                },
                "types": [
                    {
                        "name": "Australian Genomics",
                        "slug": "australian-genomics",
                        "description": "Panel used by Australian Genomics project."
                    },
                    {
                        "name": "Royal Melbourne Hospital",
                        "slug": "royal-melbourne-hospital",
                        "description": "Royal Melbourne Hospital"
                    },
                    {
                        "name": "Rare Disease",
                        "slug": "rare-disease",
                        "description": "Rare disease panels"
                    }
                ],
                "child_panel_ids": []
            }
        }
    ]
}