Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=67
{ "count": 36035, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=68", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=66", "results": [ { "gene_data": { "alias": [ "RNASE5", "RAA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:483", "gene_name": "angiogenin", "omim_gene": [ "105850" ], "alias_name": [ "ribonuclease A family member 5" ], "gene_symbol": "ANG", "hgnc_symbol": "ANG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:21152336-21167130", "ensembl_id": "ENSG00000214274" } }, "GRch38": { "90": { "location": "14:20684177-20698971", "ensembl_id": "ENSG00000214274" } } }, "hgnc_date_symbol_changed": "1989-05-23" }, "entity_type": "gene", "entity_name": "ANG", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17886298", "16501576", "18087731", "20301623" ], "evidence": [ "Expert Review Amber", "Melbourne Genomics Health Alliance Complex Neurology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Amyotrophic Lateral Sclerosis 9 (MONDO: 0012753", "MIM#611895)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 25, "hash_id": null, "name": "Motor Neurone Disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause motor neurone disease, including amyotrophic lateral sclerosis and genes causing spinal muscular atrophies (SMAs) with adult onset. It is maintained by VCGS and RMH.\r\n\r\nGenes causing spinal muscular atrophies (SMAs) with congenital/childhood onset are not included in this panel but can be found in the Hereditary Neuropathy panels.\r\n\r\nThe original panel (as 17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.48", "version_created": "2026-03-31T16:37:58.241144+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 79, "number_of_strs": 4, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "P85B", "p85" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8980", "gene_name": "phosphoinositide-3-kinase regulatory subunit 2", "omim_gene": [ "603157" ], "alias_name": [ "phosphoinositide-3-kinase regulatory subunit beta" ], "gene_symbol": "PIK3R2", "hgnc_symbol": "PIK3R2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:18263928-18281350", "ensembl_id": "ENSG00000105647" } }, "GRch38": { "90": { "location": "19:18153118-18170540", "ensembl_id": "ENSG00000105647" } } }, "hgnc_date_symbol_changed": "1992-12-08" }, "entity_type": "gene", "entity_name": "PIK3R2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 51, "hash_id": null, "name": "Autism", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.248", "version_created": "2026-03-19T12:51:18.584438+11:00", "relevant_disorders": [ "Autism", "HP:0000717" ], "stats": { "number_of_genes": 157, "number_of_strs": 0, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ22794", "KIAA1895" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24725", "gene_name": "family with sequence similarity 111 member A", "omim_gene": [ "615292" ], "alias_name": null, "gene_symbol": "FAM111A", "hgnc_symbol": "FAM111A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:58910221-58922512", "ensembl_id": "ENSG00000166801" } }, "GRch38": { "90": { "location": "11:59142748-59155039", "ensembl_id": "ENSG00000166801" } } }, "hgnc_date_symbol_changed": "2006-02-06" }, "entity_type": "gene", "entity_name": "FAM111A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32734340", "23996431", "35205306" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Kenny-Caffey syndrome, type 2, MIM# 127000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 58, "hash_id": null, "name": "Brain Calcification", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Primary brain calcification disorders are characterised by abnormal deposits of calcium in blood vessels within the brain, particularly the basal ganglia. They typically present with movement disorders and psychiatric or behavioural problems. This panel also contains other multi-system conditions where brain calcification can occur as part of the phenotype.\r\n\r\nThis panel was developed and is maintained by VCGS.\r\n\r\nThe panel has been compared against the Genomics England PanelApp Intracerebral Calcifications panel V1.27 with all discrepancies resolved and reciprocal feedback provided to Genomics England.\r\n\r\nUpdated December 2025 following literature review.", "status": "public", "version": "2.6", "version_created": "2026-01-08T18:01:53.861975+11:00", "relevant_disorders": [ "Cerebral calcification", "HP:0002514" ], "stats": { "number_of_genes": 96, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EGFL6L", "POEM" ], "biotype": "protein_coding", "hgnc_id": "HGNC:27405", "gene_name": "nephronectin", "omim_gene": [ "610306" ], "alias_name": null, "gene_symbol": "NPNT", "hgnc_symbol": "NPNT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:106815932-106925184", "ensembl_id": "ENSG00000168743" } }, "GRch38": { "90": { "location": "4:105894775-106004027", "ensembl_id": "ENSG00000168743" } } }, "hgnc_date_symbol_changed": "2005-10-07" }, "entity_type": "gene", "entity_name": "NPNT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 35246978", "34049960", "17537792" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Renal agenesis, MONDO:0018470, NPNT-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 63, "hash_id": null, "name": "Congenital anomalies of the kidney and urinary tract (CAKUT)", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel contains genes associated with nonsyndromic and syndromic congenital anomalies of the kidney and urinary tract (CAKUT).", "status": "public", "version": "0.204", "version_created": "2026-03-19T13:24:30.325727+11:00", "relevant_disorders": [ "Abnormality of the urinary system HP:0000079" ], "stats": { "number_of_genes": 124, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:12692", "gene_name": "vimentin", "omim_gene": [ "193060" ], "alias_name": null, "gene_symbol": "VIM", "hgnc_symbol": "VIM", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:17270258-17279592", "ensembl_id": "ENSG00000026025" } }, "GRch38": { "90": { "location": "10:17228259-17237593", "ensembl_id": "ENSG00000026025" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "VIM", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26694549" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cataract 30, pulverulent, MIM# 116300" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10718", "MLAT4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19317", "gene_name": "prolyl 3-hydroxylase 2", "omim_gene": [ "610341" ], "alias_name": [ "procollagen-proline 3-dioxygenase 2" ], "gene_symbol": "P3H2", "hgnc_symbol": "P3H2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:189674517-189840226", "ensembl_id": "ENSG00000090530" } }, "GRch38": { "90": { "location": "3:189956728-190122437", "ensembl_id": "ENSG00000090530" } } }, "hgnc_date_symbol_changed": "2014-12-12" }, "entity_type": "gene", "entity_name": "P3H2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21885030", "24172257", "25469533" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Myopia, high, with cataract and vitreoretinal degeneration - MIM#614292" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ11856", "PAR1", "GPCR41", "D15Ertd747e", "RFVT2", "hRFT3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30224", "gene_name": "solute carrier family 52 member 2", "omim_gene": [ "607882" ], "alias_name": null, "gene_symbol": "SLC52A2", "hgnc_symbol": "SLC52A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:145577795-145584932", "ensembl_id": "ENSG00000185803" } }, "GRch38": { "90": { "location": "8:144354135-144361272", "ensembl_id": "ENSG00000185803" } } }, "hgnc_date_symbol_changed": "2012-02-29" }, "entity_type": "gene", "entity_name": "SLC52A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "22864630", "23243084" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Brown-Vialetto-Van Laere syndrome 2", "614707" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 71, "hash_id": null, "name": "Central Hypoventilation", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed by and is maintained by VCGS.\r\n\r\nMore than 90% of individuals with congenital central hypoventilation syndrome have variants in the PHOX2B gene, most commonly an expansion of the polyalanine tract, which may not be tractable by all NGS assays.", "status": "public", "version": "1.7", "version_created": "2026-01-04T18:41:11.422790+11:00", "relevant_disorders": [ "Central hypoventilation HP:0007110" ], "stats": { "number_of_genes": 12, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "dJ40E16.7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12412", "gene_name": "tubulin beta 2A class IIa", "omim_gene": [ "615101" ], "alias_name": [ "class IIa beta-tubulin" ], "gene_symbol": "TUBB2A", "hgnc_symbol": "TUBB2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:3153903-3157760", "ensembl_id": "ENSG00000137267" } }, "GRch38": { "90": { "location": "6:3153669-3157526", "ensembl_id": "ENSG00000137267" } } }, "hgnc_date_symbol_changed": "2005-11-03" }, "entity_type": "gene", "entity_name": "TUBB2A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33528536", "24702957" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Cortical dysplasia, complex, with other brain malformations MIM# 615763" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 73, "hash_id": null, "name": "Cerebral Palsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Cerebral palsy (CP) is a non-progressive neurodevelopmental disorder characterized by motor impairments, often accompanied by intellectual disability, epilepsy, visual and hearing impairment and speech and language deficits.\r\n\r\nPMID 33528536 reported a cohort of 1345 individuals undergoing genomic testing. Diagnostic yield ranged between 10-30% depending on presence of additional characteristics such as ID/epilepsy/ASD.\r\n\r\nThe aetiology of cerebral palsy is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia, Ataxia, Malformations of Cortical Development, Mitochondrial Disorders and the Bleeding and Platelet Disorders panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Jozef Gecz, Clare van Eyk, Luisa Weiss and team for their contribution to the development of this panel.", "status": "public", "version": "1.410", "version_created": "2026-02-17T16:35:59.013988+11:00", "relevant_disorders": [ "Cerebral palsy HP:0100021" ], "stats": { "number_of_genes": 364, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ABP-280" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3754", "gene_name": "filamin A", "omim_gene": [ "300017" ], "alias_name": [ "actin binding protein 280", "alpha filamin" ], "gene_symbol": "FLNA", "hgnc_symbol": "FLNA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:153576892-153603006", "ensembl_id": "ENSG00000196924" } }, "GRch38": { "90": { "location": "X:154348524-154374638", "ensembl_id": "ENSG00000196924" } } }, "hgnc_date_symbol_changed": "1993-03-18" }, "entity_type": "gene", "entity_name": "FLNA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.534", "version_created": "2026-03-30T13:14:35.719896+11:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 253, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BAF47", "Ini1", "Snr1", "hSNFS", "Sfh1p", "RDT", "PPP1R144" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11103", "gene_name": "SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1", "omim_gene": [ "601607" ], "alias_name": [ "sucrose nonfermenting, yeast, homolog-like 1", "integrase interactor 1", "malignant rhabdoid tumor suppressor", "protein phosphatase 1, regulatory subunit 144" ], "gene_symbol": "SMARCB1", "hgnc_symbol": "SMARCB1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:24129150-24176703", "ensembl_id": "ENSG00000099956" } }, "GRch38": { "90": { "location": "22:23786963-23834516", "ensembl_id": "ENSG00000099956" } } }, "hgnc_date_symbol_changed": "1995-08-21" }, "entity_type": "gene", "entity_name": "SMARCB1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.534", "version_created": "2026-03-30T13:14:35.719896+11:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 253, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FREAC8" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3808", "gene_name": "forkhead box E3", "omim_gene": [ "601094" ], "alias_name": null, "gene_symbol": "FOXE3", "hgnc_symbol": "FOXE3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:47881744-47883723", "ensembl_id": "ENSG00000186790" } }, "GRch38": { "90": { "location": "1:47416072-47418052", "ensembl_id": "ENSG00000186790" } } }, "hgnc_date_symbol_changed": "1995-06-05" }, "entity_type": "gene", "entity_name": "FOXE3", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Anterior segment dysgenesis 2, multiple subtypes, MIM# 610256" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 91, "hash_id": null, "name": "Corneal Dystrophy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThe corneal dystrophies are a heterogenous group of bilateral genetically determined non-inflammatory corneal diseases that are restricted to the cornea, causing opacification. The corneal dystrophies can be divided into three groups based on the sole or predominant anatomical location of the abnormalities: (a). the anterior corneal dystrophies affect primarily the corneal epithelium and its basement membrane or Bowman layer and the superficial corneal stroma, (b).the stromal corneal dystrophies affect the corneal stroma, (c). the posterior corneal dystrophies affect the Descemet membrane and the corneal endothelium. \r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Corneal Dystrophy' panel with all discrepancies resolved, and reciprocal feedback provided to Genomics England, 27/07/2020.", "status": "public", "version": "1.21", "version_created": "2026-02-22T15:53:37.257206+11:00", "relevant_disorders": [ "Abnormal corneal morphology", "HP:0000481" ], "stats": { "number_of_genes": 33, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7865", "gene_name": "nodal growth differentiation factor", "omim_gene": [ "601265" ], "alias_name": null, "gene_symbol": "NODAL", "hgnc_symbol": "NODAL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:72192071-72207707", "ensembl_id": "ENSG00000156574" } }, "GRch38": { "90": { "location": "10:70432315-70447951", "ensembl_id": "ENSG00000156574" } } }, "hgnc_date_symbol_changed": "1998-06-05" }, "entity_type": "gene", "entity_name": "NODAL", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "9354794", "19064609", "29368431", "19933292", "11311163", "30293987" ], "evidence": [ "Expert Review Amber", "Expert Review" ], "phenotypes": [ "Heterotaxy, visceral, 5 (MIM#270100)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "disputed" ], "panel": { "id": 108, "hash_id": null, "name": "Heterotaxy", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Laterality disorders and isomerism' panel V1.19, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.45", "version_created": "2026-03-17T16:09:39.911604+11:00", "relevant_disorders": [ "Heterotaxy", "HP:0030853; Dextrocardia", "HP:0001651; Asplenia", "HP:0001746; Abnormal spatial orientation of cardiac segments", "HP:0011534; Polysplenia", "HP:0001748;Midline liver", "HP:0034188" ], "stats": { "number_of_genes": 67, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZp762C186", "TANGERIN" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30682", "gene_name": "EH domain binding protein 1 like 1", "omim_gene": null, "alias_name": null, "gene_symbol": "EHBP1L1", "hgnc_symbol": "EHBP1L1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:65343509-65360121", "ensembl_id": "ENSG00000173442" } }, "GRch38": { "90": { "location": "11:65576038-65592650", "ensembl_id": "ENSG00000173442" } } }, "hgnc_date_symbol_changed": "2004-08-26" }, "entity_type": "gene", "entity_name": "EHBP1L1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34645488", "26833786" ], "evidence": [ "Expert Review Green", "Literature", "Expert list" ], "phenotypes": [ "non-immune hydrops fetalis MONDO:0009369, EHBP1L1-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 116, "hash_id": null, "name": "Hydrops fetalis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared with the Genomics England 100K Genomes Fetal Hydrops panel. All discrepancies have been resolved by George McGillivray and Zornitza Stark (30/12/2019), with reciprocal reviews provided to Genomics England PanelApp.", "status": "public", "version": "0.328", "version_created": "2025-07-08T23:27:02.854141+10:00", "relevant_disorders": [ "Hydrops fetalis", "HP:0001789" ], "stats": { "number_of_genes": 169, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC10744" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28128", "gene_name": "transmembrane protein 107", "omim_gene": [ "616183" ], "alias_name": null, "gene_symbol": "TMEM107", "hgnc_symbol": "TMEM107", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:8076555-8079717", "ensembl_id": "ENSG00000179029" } }, "GRch38": { "90": { "location": "17:8173237-8176399", "ensembl_id": "ENSG00000179029" } } }, "hgnc_date_symbol_changed": "2005-12-19" }, "entity_type": "gene", "entity_name": "TMEM107", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26595381", "26123494" ], "evidence": [ "Expert Review Amber", "Expert Review" ], "phenotypes": [ "Meckel syndrome 13 (MIM#617562)", "Orofaciodigital syndrome XVI (MIM#617563)", "Joubert syndrome 29, MIM# 617562" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 129, "hash_id": null, "name": "Joubert syndrome and other neurological ciliopathies", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It contains genes associated with Joubert syndrome, Meckel Gruber syndrome and other ciliopathies where structural CNS abnormalities are prominent.\r\n\r\nPlease consider also applying the Cerebellar and Pontocerebellar Hypoplasia panel in the presence of more non-specific cerebellar abnormalities and applying the Ciliopathy panel in the presence of additional clinical features suggestive of a multi-system ciliopathy.", "status": "public", "version": "1.33", "version_created": "2025-12-16T12:55:34.757878+11:00", "relevant_disorders": [ "Molar tooth sign on MRI", "HP:0002419; Joubert syndrome", "MONDO:0018772" ], "stats": { "number_of_genes": 69, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7765", "gene_name": "neurofibromin 1", "omim_gene": [ "613113" ], "alias_name": [ "neurofibromatosis", "von Recklinghausen disease", "Watson disease" ], "gene_symbol": "NF1", "hgnc_symbol": "NF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:29421945-29709134", "ensembl_id": "ENSG00000196712" } }, "GRch38": { "90": { "location": "17:31094927-31382116", "ensembl_id": "ENSG00000196712" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "NF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 135, "hash_id": null, "name": "Macrocephaly_Megalencephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.161", "version_created": "2026-01-12T09:38:37.890372+11:00", "relevant_disorders": [ "Macrocephaly", "HP:0000256; Megalencephaly", "HP:0001355" ], "stats": { "number_of_genes": 151, "number_of_strs": 0, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MSAP", "c86fus" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7413", "gene_name": "methylthioadenosine phosphorylase", "omim_gene": [ "156540" ], "alias_name": [ "S-methyl-5'-thioadenosine phosphorylase" ], "gene_symbol": "MTAP", "hgnc_symbol": "MTAP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:21802542-21931646", "ensembl_id": "ENSG00000099810" } }, "GRch38": { "90": { "location": "9:21802543-21937651", "ensembl_id": "ENSG00000099810" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "MTAP", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22464254" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Diaphyseal medullary stenosis with malignant fibrous histiocytoma, MIM# 112250" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BLAU", "CD", "PSORAS1", "CLR16.3", "NLRC2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5331", "gene_name": "nucleotide binding oligomerization domain containing 2", "omim_gene": [ "605956" ], "alias_name": [ "nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2", "NOD-like receptor C2", "NLR family, CARD domain containing 2" ], "gene_symbol": "NOD2", "hgnc_symbol": "NOD2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:50727514-50766988", "ensembl_id": "ENSG00000167207" } }, "GRch38": { "90": { "location": "16:50693603-50734041", "ensembl_id": "ENSG00000167207" } } }, "hgnc_date_symbol_changed": "2006-12-08" }, "entity_type": "gene", "entity_name": "NOD2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15459013", "11385576", "17804789", "32463623", "33692434", "39372397" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Blau syndrome, MIM# 186580", "{Inflammatory bowel disease 1, Crohn disease} 266600", "{Yao syndrome} 617321" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "O-FUT", "O-Fuc-T", "KIAA0180", "FUT12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14988", "gene_name": "protein O-fucosyltransferase 1", "omim_gene": [ "607491" ], "alias_name": [ "peptide-O-fucosyltransferase", "GDP-fucose protein O-fucosyltransferase 1" ], "gene_symbol": "POFUT1", "hgnc_symbol": "POFUT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:30795683-30826470", "ensembl_id": "ENSG00000101346" } }, "GRch38": { "90": { "location": "20:32207880-32238667", "ensembl_id": "ENSG00000101346" } } }, "hgnc_date_symbol_changed": "2001-10-29" }, "entity_type": "gene", "entity_name": "POFUT1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23684010", "29452367", "25157627" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Dowling-Degos disease 2 (MIM# 615327)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:9475", "gene_name": "protease, serine 1", "omim_gene": [ "276000" ], "alias_name": null, "gene_symbol": "PRSS1", "hgnc_symbol": "PRSS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:142457319-142460923", "ensembl_id": "ENSG00000204983" } }, "GRch38": { "90": { "location": "7:142749468-142753076", "ensembl_id": "ENSG00000204983" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "PRSS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8841182", "10204851", "10529393", "11097832", "11702203", "15776435", "16791840", "18461367", "17072318" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Pancreatitis, hereditary, MIM# 167800" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "SV/CNV" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CDA-II", "CDAII", "HEMPAS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10702", "gene_name": "Sec23 homolog B, coat complex II component", "omim_gene": [ "610512" ], "alias_name": null, "gene_symbol": "SEC23B", "hgnc_symbol": "SEC23B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:18488137-18542059", "ensembl_id": "ENSG00000101310" } }, "GRch38": { "90": { "location": "20:18507493-18561415", "ensembl_id": "ENSG00000101310" } } }, "hgnc_date_symbol_changed": "2000-01-07" }, "entity_type": "gene", "entity_name": "SEC23B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19561605", "19621418", "26522472" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Dyserythropoietic anemia, congenital, type II , MIM#224100", "Cowden syndrome 7, MIM#\t616858" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SEB", "KIAA0437" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15573", "gene_name": "SET binding protein 1", "omim_gene": [ "611060" ], "alias_name": null, "gene_symbol": "SETBP1", "hgnc_symbol": "SETBP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:42260138-42648475", "ensembl_id": "ENSG00000152217" } }, "GRch38": { "90": { "location": "18:44680173-45068510", "ensembl_id": "ENSG00000152217" } } }, "hgnc_date_symbol_changed": "2001-06-05" }, "entity_type": "gene", "entity_name": "SETBP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20436468", "25217958", "34807554" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Schinzel-Giedion midface retraction syndrome, MIM# 269150", "Intellectual disability, autosomal dominant 29, MIM# 616078" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10619", "KIAA0453" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23595", "gene_name": "vacuolar protein sorting 13 homolog D", "omim_gene": [ "608877" ], "alias_name": null, "gene_symbol": "VPS13D", "hgnc_symbol": "VPS13D", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:12290124-12572099", "ensembl_id": "ENSG00000048707" } }, "GRch38": { "90": { "location": "1:12230067-12512047", "ensembl_id": "ENSG00000048707" } } }, "hgnc_date_symbol_changed": "2004-02-10" }, "entity_type": "gene", "entity_name": "VPS13D", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29604224", "29518281" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10385", "TCAB1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25522", "gene_name": "WD repeat containing antisense to TP53", "omim_gene": [ "612661" ], "alias_name": [ "telomerase cajal body protein 1", "WD-encoding RNA antisense to p53" ], "gene_symbol": "WRAP53", "hgnc_symbol": "WRAP53", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:7589389-7606820", "ensembl_id": "ENSG00000141499" } }, "GRch38": { "90": { "location": "17:7686071-7703502", "ensembl_id": "ENSG00000141499" } } }, "hgnc_date_symbol_changed": "2009-02-16" }, "entity_type": "gene", "entity_name": "WRAP53", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21205863", "32303682", "29514627" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Dyskeratosis congenita, autosomal recessive 3, MIM# 613988" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ13995", "CGI-04", "mt-TyrRS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24249", "gene_name": "tyrosyl-tRNA synthetase 2", "omim_gene": [ "610957" ], "alias_name": [ "tyrosine tRNA ligase 2, mitochondrial" ], "gene_symbol": "YARS2", "hgnc_symbol": "YARS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:32880424-32908836", "ensembl_id": "ENSG00000139131" } }, "GRch38": { "90": { "location": "12:32727490-32755902", "ensembl_id": "ENSG00000139131" } } }, "hgnc_date_symbol_changed": "2005-06-28" }, "entity_type": "gene", "entity_name": "YARS2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24430573", "24344687" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561", "sideroblastic anaemia", "muscle atrophy", "myopathy", "lactic acidosis", "Hypertrophic cardiomyopathy", "Hepatomegaly", "Decreased cytochrome C oxidase activity" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GCAP2", "RP48" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4679", "gene_name": "guanylate cyclase activator 1B", "omim_gene": [ "602275" ], "alias_name": null, "gene_symbol": "GUCA1B", "hgnc_symbol": "GUCA1B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:42152139-42162654", "ensembl_id": "ENSG00000112599" } }, "GRch38": { "90": { "location": "6:42184401-42194916", "ensembl_id": "ENSG00000112599" } } }, "hgnc_date_symbol_changed": "1996-12-18" }, "entity_type": "gene", "entity_name": "GUCA1B", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15452722", "26161267" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Retinitis pigmentosa 48, MIM# 613827" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "founder" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NEPPK" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6423", "gene_name": "keratin 16", "omim_gene": [ "148067" ], "alias_name": [ "focal non-epidermolytic palmoplantar keratoderma" ], "gene_symbol": "KRT16", "hgnc_symbol": "KRT16", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:39766030-39772151", "ensembl_id": "ENSG00000186832" } }, "GRch38": { "90": { "location": "17:41609778-41615899", "ensembl_id": "ENSG00000186832" } } }, "hgnc_date_symbol_changed": "1992-12-14" }, "entity_type": "gene", "entity_name": "KRT16", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8595410", "10839714" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Palmoplantar keratoderma, nonepidermolytic, focal (MIM#613000)", "Pachyonychia congenita 1 (MIM#167200)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SBP1", "FLJ22365" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3233", "gene_name": "multiple EGF like domains 8", "omim_gene": [ "604267" ], "alias_name": [ "HBV pre s2 binding protein 1" ], "gene_symbol": "MEGF8", "hgnc_symbol": "MEGF8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:42829761-42882921", "ensembl_id": "ENSG00000105429" } }, "GRch38": { "90": { "location": "19:42325609-42378769", "ensembl_id": "ENSG00000105429" } } }, "hgnc_date_symbol_changed": "2006-03-31" }, "entity_type": "gene", "entity_name": "MEGF8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23063620" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Carpenter syndrome, MIM#614976" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GlyRS", "DSMAV", "SMAD1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4162", "gene_name": "glycyl-tRNA synthetase", "omim_gene": [ "600287" ], "alias_name": [ "glycine tRNA ligase" ], "gene_symbol": "GARS", "hgnc_symbol": "GARS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:30634297-30673649", "ensembl_id": "ENSG00000106105" } }, "GRch38": { "90": { "location": "7:30594681-30634033", "ensembl_id": "ENSG00000106105" } } }, "hgnc_date_symbol_changed": "1995-03-21" }, "entity_type": "gene", "entity_name": "GARS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17101916", "22462675", "31985473", "32181591", "12690580", "25168514", "26503042", "29648643", "16982418", "24669931", "28594869" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Mitochondrial disease (MONDO:0044970), GARS1-related", "Spinal muscular atrophy, infantile, James type, MIM# 619042", "Charcot-Marie-Tooth disease, type 2D, MIM# 601472", "Neuronopathy, distal hereditary motor, type VA, MIM# 600794", "Multi-system mitochondrial disorder" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [ "new gene name" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "processed_transcript", "hgnc_id": "HGNC:48626", "gene_name": "long intergenic non-protein coding RNA 1578", "omim_gene": null, "alias_name": null, "gene_symbol": "LINC01578", "hgnc_symbol": "LINC01578", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:93425937-93441975", "ensembl_id": "ENSG00000272888" } }, "GRch38": { "90": { "location": "15:92882707-92899701", "ensembl_id": "ENSG00000272888" } } }, "hgnc_date_symbol_changed": "2014-11-21" }, "entity_type": "gene", "entity_name": "LINC01578", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "39442041" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "SV/CNV", "new gene name", "non-coding gene" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "BAF60A", "Rsc6p", "CRACD1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11106", "gene_name": "SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1", "omim_gene": [ "601735" ], "alias_name": null, "gene_symbol": "SMARCD1", "hgnc_symbol": "SMARCD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:50478755-50494495", "ensembl_id": "ENSG00000066117" } }, "GRch38": { "90": { "location": "12:50084972-50100712", "ensembl_id": "ENSG00000066117" } } }, "hgnc_date_symbol_changed": "1998-05-15" }, "entity_type": "gene", "entity_name": "SMARCD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30879640" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder MONDO:0700092, SMARCD1-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0648", "PIG54", "SCC-112" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29088", "gene_name": "PDS5 cohesin associated factor A", "omim_gene": [ "613200" ], "alias_name": null, "gene_symbol": "PDS5A", "hgnc_symbol": "PDS5A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:39824483-39979576", "ensembl_id": "ENSG00000121892" } }, "GRch38": { "90": { "location": "4:39822863-39977956", "ensembl_id": "ENSG00000121892" } } }, "hgnc_date_symbol_changed": "2007-06-20" }, "entity_type": "gene", "entity_name": "PDS5A", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "10.64898/2026.02.23.26346364", "30158690" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Complex neurodevelopmental disorder, MONDO:0100038" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "preprint" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "PHKD", "CAMII" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1445", "gene_name": "calmodulin 2", "omim_gene": [ "114182" ], "alias_name": [ "prepro-calmodulin 2", "phosphorylase kinase subunit delta" ], "gene_symbol": "CALM2", "hgnc_symbol": "CALM2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:47387221-47403740", "ensembl_id": "ENSG00000143933" } }, "GRch38": { "90": { "location": "2:47160082-47176601", "ensembl_id": "ENSG00000143933" } } }, "hgnc_date_symbol_changed": "1991-06-04" }, "entity_type": "gene", "entity_name": "CALM2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31983240" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Long QT syndrome 15 MIM#616249", "CPVT" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4736", "version_created": "2026-04-11T11:19:25.397495+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11581", "gene_name": "tubulin folding cofactor D", "omim_gene": [ "604649" ], "alias_name": null, "gene_symbol": "TBCD", "hgnc_symbol": "TBCD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:80709940-80900724", "ensembl_id": "ENSG00000141556" } }, "GRch38": { "90": { "location": "17:82752064-82945922", "ensembl_id": "ENSG00000141556" } } }, "hgnc_date_symbol_changed": "1998-07-31" }, "entity_type": "gene", "entity_name": "TBCD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27666370", "27666374" ], "evidence": [ "Expert Review Green", "Expert Review", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.427", "version_created": "2026-04-02T17:28:09.565635+11:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 383, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ22259", "DKFZp686I14213" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2203", "gene_name": "collagen type IV alpha 2 chain", "omim_gene": [ "120090" ], "alias_name": [ "canstatin", "collagen type IV alpha 2" ], "gene_symbol": "COL4A2", "hgnc_symbol": "COL4A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:110958159-111165374", "ensembl_id": "ENSG00000134871" } }, "GRch38": { "90": { "location": "13:110305812-110513027", "ensembl_id": "ENSG00000134871" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "COL4A2", "confidence_level": "1", "penetrance": "Incomplete", "mode_of_pathogenicity": "Other", "publications": [ "PMID: 25719457", "30315939" ], "evidence": [ "Expert Review Green", "Expert Review Red", "Expert list" ], "phenotypes": [ "Brain small vessel disease 2\t614483" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 141, "hash_id": null, "name": "Muscular dystrophy and myopathy_Paediatric", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and RMH.\r\n\r\nIt contains genes typically associated with congenital muscular dystrophies and myopathies, which are characterised by weakness at birth, muscle biopsy showing dystrophic or myopathic changes, raised CK, and sometimes structural brain abnormalities. It also contains some genes that cause disorders with overlapping clinical features.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.122", "version_created": "2026-04-02T11:45:25.115390+11:00", "relevant_disorders": [ "Muscular dystrophy", "HP:0003560; Elevated circulating creatine kinase concentration", "HP:0003236; Myopathy", "HP:0003198" ], "stats": { "number_of_genes": 146, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:8616", "gene_name": "paired box 2", "omim_gene": [ "167409" ], "alias_name": null, "gene_symbol": "PAX2", "hgnc_symbol": "PAX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:102495360-102589698", "ensembl_id": "ENSG00000075891" } }, "GRch38": { "90": { "location": "10:100735603-100829941", "ensembl_id": "ENSG00000075891" } } }, "hgnc_date_symbol_changed": "1993-06-07" }, "entity_type": "gene", "entity_name": "PAX2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24676634" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Glomerulosclerosis, focal segmental, 7, MIM#616002" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 144, "hash_id": null, "name": "Proteinuria", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "To be used in individuals with suspected nephrotic syndrome and related conditions, part of the Renal Glomerular Disease Superpanel.\r\n\r\n09/01/2020: This panel has been compared with the Genomics England PanelApp Proteinuric Renal Disease panel and all discrepancies have been reviewed and resolved by Chirag Patel and Zornitza Stark, with reciprocal reviews provided to Genomics England.", "status": "public", "version": "0.239", "version_created": "2026-03-12T18:51:41.043263+11:00", "relevant_disorders": [ "Proteinuria HP:0000093" ], "stats": { "number_of_genes": 88, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SPG48", "zeta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:22197", "gene_name": "adaptor related protein complex 5 zeta 1 subunit", "omim_gene": [ "613653" ], "alias_name": null, "gene_symbol": "AP5Z1", "hgnc_symbol": "AP5Z1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:4815253-4833943", "ensembl_id": "ENSG00000242802" } }, "GRch38": { "90": { "location": "7:4775622-4794312", "ensembl_id": "ENSG00000242802" } } }, "hgnc_date_symbol_changed": "2012-03-20" }, "entity_type": "gene", "entity_name": "AP5Z1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26085577", "29884839" ], "evidence": [ "Expert Review Green" ], "phenotypes": [ "Disorders of autophagy", "hereditary spastic paraplegia MONDO:0019064" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 181, "hash_id": null, "name": "Lysosomal Storage Disorder", "disease_group": "Metabolic conditions", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThe lysosomal storage diseases are a group of progressive metabolic disorders that are caused by enzyme deficiencies within the lysosome. The abnormal storage process leads to a broad spectrum of somatic and/or neurological clinical manifestations depending on the specific substrate and site of accumulation. Examples include the mucopolysaccharidoses, mucolipidoses, oligosaccharidoses, Pompe disease, Gaucher disease, Fabry disease, the Niemann-Pick disorders, and neuronal ceroid lipofuscinoses.\r\n\r\nIf the clinical presentation is not specific for a lysosomal storage disorder, please consider the broader Metabolic Disorders Superpanel.", "status": "public", "version": "1.31", "version_created": "2026-03-31T16:05:25.488597+11:00", "relevant_disorders": [ "Lysosomal storage disorder", "MONDO:0002561; Visceromegaly", "HP:0003271" ], "stats": { "number_of_genes": 80, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2204", "gene_name": "collagen type IV alpha 3 chain", "omim_gene": [ "120070" ], "alias_name": [ "tumstatin" ], "gene_symbol": "COL4A3", "hgnc_symbol": "COL4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:228029281-228179508", "ensembl_id": "ENSG00000169031" } }, "GRch38": { "90": { "location": "2:227164565-227314792", "ensembl_id": "ENSG00000169031" } } }, "hgnc_date_symbol_changed": "1991-09-12" }, "entity_type": "gene", "entity_name": "COL4A3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "39190485", "38514012" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Alport syndrome MONDO:0018965" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 194, "hash_id": null, "name": "Renal Macrocystic Disease", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel is developed was developed and is maintained by the KidGen Collaborative, and is a consensus panel used by VCGS, GHQ, and RMH.\r\n\r\nThis panel contains genes that cause macrocystic kidney disease. Many of the disorders also have a polycystic liver disease, either as the predominant phenotype or in association with primary kidney cysts.", "status": "public", "version": "1.0", "version_created": "2026-03-24T16:17:17.075108+11:00", "relevant_disorders": [ "Renal cyst", "HP:0000107" ], "stats": { "number_of_genes": 31, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:12616", "gene_name": "ubiquitin specific peptidase 18", "omim_gene": [ "607057" ], "alias_name": null, "gene_symbol": "USP18", "hgnc_symbol": "USP18", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:18632666-18660164", "ensembl_id": "ENSG00000184979" } }, "GRch38": { "90": { "location": "22:18149899-18177397", "ensembl_id": "ENSG00000184979" } } }, "hgnc_date_symbol_changed": "1999-11-16" }, "entity_type": "gene", "entity_name": "USP18", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "12833411", "27325888", "31940699" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Pseudo-TORCH syndrome 2, MIM#617397" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CPTASE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2330", "gene_name": "carnitine palmitoyltransferase 2", "omim_gene": [ "600650" ], "alias_name": null, "gene_symbol": "CPT2", "hgnc_symbol": "CPT2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:53662101-53679869", "ensembl_id": "ENSG00000157184" } }, "GRch38": { "90": { "location": "1:53196429-53214197", "ensembl_id": "ENSG00000157184" } } }, "hgnc_date_symbol_changed": "1991-05-09" }, "entity_type": "gene", "entity_name": "CPT2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 20301431", "35028265", "36478999" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "CPT II deficiency, infantile 600649", "CPT II deficiency, lethal neonatal 608836", "CPT II deficiency, myopathic, stress-induced 255110" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0123", "Alpha-MPP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18667", "gene_name": "peptidase, mitochondrial processing alpha subunit", "omim_gene": [ "613036" ], "alias_name": null, "gene_symbol": "PMPCA", "hgnc_symbol": "PMPCA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:139305110-139318213", "ensembl_id": "ENSG00000165688" } }, "GRch38": { "90": { "location": "9:136410570-136423761", "ensembl_id": "ENSG00000165688" } } }, "hgnc_date_symbol_changed": "2003-06-20" }, "entity_type": "gene", "entity_name": "PMPCA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25808372", "26657514", "33272776", "30617178" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Mitochondrial Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FZD11" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11119", "gene_name": "smoothened, frizzled class receptor", "omim_gene": [ "601500" ], "alias_name": [ "frizzled family member 11" ], "gene_symbol": "SMO", "hgnc_symbol": "SMO", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:128828713-128853386", "ensembl_id": "ENSG00000128602" } }, "GRch38": { "90": { "location": "7:129188872-129213545", "ensembl_id": "ENSG00000128602" } } }, "hgnc_date_symbol_changed": "2003-01-17" }, "entity_type": "gene", "entity_name": "SMO", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27236920" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Curry-Jones syndrome, somatic mosaic 601707" ], "mode_of_inheritance": "Other", "tags": [ "somatic" ], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RNASEHI", "RNHIA", "RNHL", "AGS4" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18518", "gene_name": "ribonuclease H2 subunit A", "omim_gene": [ "606034" ], "alias_name": null, "gene_symbol": "RNASEH2A", "hgnc_symbol": "RNASEH2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:12917394-12924452", "ensembl_id": "ENSG00000104889" } }, "GRch38": { "90": { "location": "19:12802063-12813638", "ensembl_id": "ENSG00000104889" } } }, "hgnc_date_symbol_changed": "2002-06-05" }, "entity_type": "gene", "entity_name": "RNASEH2A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CIP98", "USH2D", "PDZD7B" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16361", "gene_name": "whirlin", "omim_gene": [ "607928" ], "alias_name": null, "gene_symbol": "WHRN", "hgnc_symbol": "WHRN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:117164360-117267730", "ensembl_id": "ENSG00000095397" } }, "GRch38": { "90": { "location": "9:114402080-114505450", "ensembl_id": "ENSG00000095397" } } }, "hgnc_date_symbol_changed": "2016-05-17" }, "entity_type": "gene", "entity_name": "WHRN", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17171570", "21738389", "22147658", "26338283", "12833159", "20502675", "28254438", "27117407", "12833159", "29270100", "15841483" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Deafness Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Usher syndrome, type 2D, MIM# 611383", "Deafness, autosomal recessive 31, MIM# 607084" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:6654", "gene_name": "LIM homeobox transcription factor 1 beta", "omim_gene": [ "602575" ], "alias_name": null, "gene_symbol": "LMX1B", "hgnc_symbol": "LMX1B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:129376722-129463311", "ensembl_id": "ENSG00000136944" } }, "GRch38": { "90": { "location": "9:126614443-126701032", "ensembl_id": "ENSG00000136944" } } }, "hgnc_date_symbol_changed": "1998-02-11" }, "entity_type": "gene", "entity_name": "LMX1B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 27450397, 32457516, 15928687" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Nail-patella syndrome (MIM#161200), MONDO:0008061" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.361", "version_created": "2026-04-11T11:20:22.713350+10:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TRX1", "HRX", "ALL-1", "HTRX1", "CXXC7", "MLL1A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7132", "gene_name": "lysine methyltransferase 2A", "omim_gene": [ "159555" ], "alias_name": null, "gene_symbol": "KMT2A", "hgnc_symbol": "KMT2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:118307205-118397539", "ensembl_id": "ENSG00000118058" } }, "GRch38": { "90": { "location": "11:118436490-118526832", "ensembl_id": "ENSG00000118058" } } }, "hgnc_date_symbol_changed": "2013-05-09" }, "entity_type": "gene", "entity_name": "KMT2A", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32048120", "28623346", "27320412" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Wiedemann-Steiner syndrome MIM#605130" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 223, "hash_id": null, "name": "Combined Immunodeficiency", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause combined immunodeficiencies with associated or syndromic features, including genes classified by the International Union of Immunological Societies Inborn Errors of Immunity Committee (July 2024 update). These include genes that fall into the following subcategories:\r\n- Immunodeficiency with Congenital Thrombocytopenia\r\n- DNA Repair Defects\r\n- Thymic Defects with Additional Congenital Anomalies\r\n- Immuno-osseous Dysplasias\r\n- Hyper IgE Syndromes (HIES)\r\n- Defects of Vitamin B12 and Folate Metabolism\r\n- Anhidrotic Ectodermodysplasia with Immunodeficiency (EDA-ID)\r\n- Calcium Channel Defects\r\n- Other Combined immunodeficiencies with syndromic features\r\n- Combined Immunodeficiencies Generally Less Profound than Severe Combined Immunodeficiency (Immunodeficiencies affecting cellular and humoral immunity)\r\n\r\nThis panel was originally developed by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital) for the Melbourne Genomics Immunology Flagship.", "status": "public", "version": "1.145", "version_created": "2026-03-02T21:55:19.238904+11:00", "relevant_disorders": [ "Combined immunodeficiency", "MONDO:0015131; Combined immunodeficiency", "HP:0005387" ], "stats": { "number_of_genes": 170, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KBF1", "p105", "NFKB-p50", "p50", "NF-kappaB", "NFkappaB", "NF-kB1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7794", "gene_name": "nuclear factor kappa B subunit 1", "omim_gene": [ "164011" ], "alias_name": null, "gene_symbol": "NFKB1", "hgnc_symbol": "NFKB1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:103422486-103538459", "ensembl_id": "ENSG00000109320" } }, "GRch38": { "90": { "location": "4:102501329-102617302", "ensembl_id": "ENSG00000109320" } } }, "hgnc_date_symbol_changed": "1991-11-14" }, "entity_type": "gene", "entity_name": "NFKB1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26279205", "32278790", "27022143", "7834752" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Immunodeficiency, common variable, 12 MIM# 616576", "Normal-low IgG, IgA, IgM", "low-normal B cells", "low switched memory B cells", "hypogammaglobulinaemia", "recurrent respiratory and gastrointestinal infections", "Chronic obstructive pulmonary disease COPD", "EBV proliferation", "autoimmunity", "alopecia" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 223, "hash_id": null, "name": "Combined Immunodeficiency", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause combined immunodeficiencies with associated or syndromic features, including genes classified by the International Union of Immunological Societies Inborn Errors of Immunity Committee (July 2024 update). These include genes that fall into the following subcategories:\r\n- Immunodeficiency with Congenital Thrombocytopenia\r\n- DNA Repair Defects\r\n- Thymic Defects with Additional Congenital Anomalies\r\n- Immuno-osseous Dysplasias\r\n- Hyper IgE Syndromes (HIES)\r\n- Defects of Vitamin B12 and Folate Metabolism\r\n- Anhidrotic Ectodermodysplasia with Immunodeficiency (EDA-ID)\r\n- Calcium Channel Defects\r\n- Other Combined immunodeficiencies with syndromic features\r\n- Combined Immunodeficiencies Generally Less Profound than Severe Combined Immunodeficiency (Immunodeficiencies affecting cellular and humoral immunity)\r\n\r\nThis panel was originally developed by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital) for the Melbourne Genomics Immunology Flagship.", "status": "public", "version": "1.145", "version_created": "2026-03-02T21:55:19.238904+11:00", "relevant_disorders": [ "Combined immunodeficiency", "MONDO:0015131; Combined immunodeficiency", "HP:0005387" ], "stats": { "number_of_genes": 170, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "hILP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:592", "gene_name": "X-linked inhibitor of apoptosis", "omim_gene": [ "300079" ], "alias_name": null, "gene_symbol": "XIAP", "hgnc_symbol": "XIAP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:122993574-123047829", "ensembl_id": "ENSG00000101966" } }, "GRch38": { "90": { "location": "X:123859724-123913979", "ensembl_id": "ENSG00000101966" } } }, "hgnc_date_symbol_changed": "2008-03-04" }, "entity_type": "gene", "entity_name": "XIAP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22228567", "25943627" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Lymphoproliferative syndrome, X-linked, 2, MIM# 300635" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [ "treatable" ], "panel": { "id": 229, "hash_id": null, "name": "Disorders of immune dysregulation", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause diseases of immune dysregulation, including:\r\n- Familial Hemophagocytic Lymphohistiocytosis (FHL syndromes)\r\n- FHL Syndromes with Hypopigmentation\r\n- Regulatory T Cell Defects\r\n- Autoimmunity with or without Lymphoproliferation\r\n- Immune Dysregulation with Colitis\r\n- Autoimmune Lymphoproliferative Syndrome (ALPS, Canale Smith syndrome)\r\n- Susceptibility to EBV and Lymphoproliferative Conditions\r\n\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.43", "version_created": "2026-04-06T13:01:39.255117+10:00", "relevant_disorders": [ "Immune dysregulation", "HP:0002958" ], "stats": { "number_of_genes": 118, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:6131", "gene_name": "interferon regulatory factor 9", "omim_gene": [ "147574" ], "alias_name": null, "gene_symbol": "IRF9", "hgnc_symbol": "IRF9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:24630262-24635774", "ensembl_id": "ENSG00000213928" } }, "GRch38": { "90": { "location": "14:24161053-24166565", "ensembl_id": "ENSG00000213928" } } }, "hgnc_date_symbol_changed": "2007-07-06" }, "entity_type": "gene", "entity_name": "IRF9", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30826365", "30143481" ], "evidence": [ "Expert Review Amber", "Expert list", "Expert Review Amber", "Expert list" ], "phenotypes": [ "immunodeficiency 65, susceptibility to viral infections MONDO:0032848" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 231, "hash_id": null, "name": "Defects of intrinsic and innate immunity", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause defects in intrinsic and innate immunity, including the following:\r\n- Mendelian susceptibility to mycobacterial disease (MSMD)\r\n- Epidermodysplasia verruciformis (HPV)\r\n- Predisposition to severe viral infection\r\n- Herpes simplex encephalitis (HSE)\r\n- Predisposition to mucocutaneous candidiasis\r\n- Other inborn errors of immunity related to non-haematopoietic tissues\r\n- Other inborn errors of immunity related to leukocytes\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.36", "version_created": "2026-04-08T12:35:08.612526+10:00", "relevant_disorders": [ "Unusual infections", "HP:0032101" ], "stats": { "number_of_genes": 86, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:10050", "gene_name": "ribonuclease L", "omim_gene": [ "180435" ], "alias_name": null, "gene_symbol": "RNASEL", "hgnc_symbol": "RNASEL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:182542769-182558391", "ensembl_id": "ENSG00000135828" } }, "GRch38": { "90": { "location": "1:182573634-182589256", "ensembl_id": "ENSG00000135828" } } }, "hgnc_date_symbol_changed": "1993-06-09" }, "entity_type": "gene", "entity_name": "RNASEL", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "36538032", "9351818" ], "evidence": [ "Expert Review Amber", "Expert list", "Expert Review Amber", "Literature" ], "phenotypes": [ "Multisystem inflammatory syndrome, MONDO:0035375, RNASEL-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 231, "hash_id": null, "name": "Defects of intrinsic and innate immunity", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause defects in intrinsic and innate immunity, including the following:\r\n- Mendelian susceptibility to mycobacterial disease (MSMD)\r\n- Epidermodysplasia verruciformis (HPV)\r\n- Predisposition to severe viral infection\r\n- Herpes simplex encephalitis (HSE)\r\n- Predisposition to mucocutaneous candidiasis\r\n- Other inborn errors of immunity related to non-haematopoietic tissues\r\n- Other inborn errors of immunity related to leukocytes\r\nUpdated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\n\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.36", "version_created": "2026-04-08T12:35:08.612526+10:00", "relevant_disorders": [ "Unusual infections", "HP:0032101" ], "stats": { "number_of_genes": 86, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CLC-6", "KIAA0046", "ClC-6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2024", "gene_name": "chloride voltage-gated channel 6", "omim_gene": [ "602726" ], "alias_name": null, "gene_symbol": "CLCN6", "hgnc_symbol": "CLCN6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:11866207-11903201", "ensembl_id": "ENSG00000011021" } }, "GRch38": { "90": { "location": "1:11806096-11843144", "ensembl_id": "ENSG00000011021" } } }, "hgnc_date_symbol_changed": "1997-04-21" }, "entity_type": "gene", "entity_name": "CLCN6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33217309" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodegeneration, childhood-onset, hypotonia, respiratory insufficiency and brain imaging abnormalities, MIM# 619173", "Developmental delay", "neurodegeneration" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CLC-7", "OPTA2", "CLC7", "ClC-7", "PPP1R63" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2025", "gene_name": "chloride voltage-gated channel 7", "omim_gene": [ "602727" ], "alias_name": [ "protein phosphatase 1, regulatory subunit 63" ], "gene_symbol": "CLCN7", "hgnc_symbol": "CLCN7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:1494935-1525581", "ensembl_id": "ENSG00000103249" } }, "GRch38": { "90": { "location": "16:1444934-1475580", "ensembl_id": "ENSG00000103249" } } }, "hgnc_date_symbol_changed": "1997-04-21" }, "entity_type": "gene", "entity_name": "CLCN7", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments", "publications": [ "31155284" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Hypopigmentation, organomegaly, and delayed myelination and development, MIM# 618541" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA1854", "CXorf2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13449", "gene_name": "SLIT and NTRK like family member 2", "omim_gene": [ "300561" ], "alias_name": null, "gene_symbol": "SLITRK2", "hgnc_symbol": "SLITRK2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:144899350-144907360", "ensembl_id": "ENSG00000185985" } }, "GRch38": { "90": { "location": "X:145817832-145825842", "ensembl_id": "ENSG00000185985" } } }, "hgnc_date_symbol_changed": "2004-03-11" }, "entity_type": "gene", "entity_name": "SLITRK2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35840571" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Intellectual developmental disorder, X-linked 111, MIM# 301107" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1106", "NZF1", "ZC2HC4B", "ZC2H2C2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7623", "gene_name": "myelin transcription factor 1 like", "omim_gene": [ "613084" ], "alias_name": [ "neural zinc finger transcription factor 1" ], "gene_symbol": "MYT1L", "hgnc_symbol": "MYT1L", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:1792885-2335032", "ensembl_id": "ENSG00000186487" } }, "GRch38": { "90": { "location": "2:1789113-2331260", "ensembl_id": "ENSG00000186487" } } }, "hgnc_date_symbol_changed": "1996-07-11" }, "entity_type": "gene", "entity_name": "MYT1L", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28859103", "32065501" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Mental retardation, autosomal dominant 39, MIM# 616521" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "SV/CNV" ], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Mi-2a", "ZFH", "Mi2-ALPHA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1918", "gene_name": "chromodomain helicase DNA binding protein 3", "omim_gene": [ "602120" ], "alias_name": null, "gene_symbol": "CHD3", "hgnc_symbol": "CHD3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:7788124-7816078", "ensembl_id": "ENSG00000170004" } }, "GRch38": { "90": { "location": "17:7884806-7912760", "ensembl_id": "ENSG00000170004" } } }, "hgnc_date_symbol_changed": "1998-03-20" }, "entity_type": "gene", "entity_name": "CHD3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30397230" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Snijders Blok-Campeau syndrome, MIM#618205" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CTIP-2", "CTIP2", "hRIT1-alpha" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13222", "gene_name": "B-cell CLL/lymphoma 11B", "omim_gene": [ "606558" ], "alias_name": null, "gene_symbol": "BCL11B", "hgnc_symbol": "BCL11B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:99635624-99737861", "ensembl_id": "ENSG00000127152" } }, "GRch38": { "90": { "location": "14:99169287-99271524", "ensembl_id": "ENSG00000127152" } } }, "hgnc_date_symbol_changed": "2001-02-28" }, "entity_type": "gene", "entity_name": "BCL11B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29985992" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Intellectual developmental disorder with dysmorphic facies, speech delay, and T-cell abnormalities, MIM#\t618092" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA1360", "CVAK104" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19286", "gene_name": "SCY1 like pseudokinase 2", "omim_gene": [ "616365" ], "alias_name": [ "coated vesicle-associated kinase of 104 kDa" ], "gene_symbol": "SCYL2", "hgnc_symbol": "SCYL2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:100660918-100735502", "ensembl_id": "ENSG00000136021" } }, "GRch38": { "90": { "location": "12:100267140-100341724", "ensembl_id": "ENSG00000136021" } } }, "hgnc_date_symbol_changed": "2005-01-20" }, "entity_type": "gene", "entity_name": "SCYL2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31960134", "26203146", "40243816", "39169672" ], "evidence": [ "Expert Review Green", "Literature", "Literature" ], "phenotypes": [ "Arthrogryposis multiplex congenita 4, neurogenic, with agenesis of the corpus callosum, MIM# 618766" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SERA", "PGDH", "PDG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8923", "gene_name": "phosphoglycerate dehydrogenase", "omim_gene": [ "606879" ], "alias_name": null, "gene_symbol": "PHGDH", "hgnc_symbol": "PHGDH", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:120202421-120286838", "ensembl_id": "ENSG00000092621" } }, "GRch38": { "90": { "location": "1:119648411-119744226", "ensembl_id": "ENSG00000092621" } } }, "hgnc_date_symbol_changed": "1999-11-22" }, "entity_type": "gene", "entity_name": "PHGDH", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Illumina TruGenome Clinical Sequencing Services", "Expert Review Green", "Radboud University Medical Center, Nijmegen", "NHS GMS", "Expert list", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Phosphoglycerate dehydrogenase deficiency 601815", "Neu-Laxova syndrome 1 256520" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NPHP7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29450", "gene_name": "GLIS family zinc finger 2", "omim_gene": [ "608539" ], "alias_name": [ "nephrocystin-7" ], "gene_symbol": "GLIS2", "hgnc_symbol": "GLIS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:4364762-4389598", "ensembl_id": "ENSG00000126603" } }, "GRch38": { "90": { "location": "16:4314761-4339597", "ensembl_id": "ENSG00000126603" } } }, "hgnc_date_symbol_changed": "2004-07-16" }, "entity_type": "gene", "entity_name": "GLIS2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Amber", "Emory Genetics Laboratory", "Victorian Clinical Genetics Services" ], "phenotypes": [], "mode_of_inheritance": "", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CEK3", "TK14", "TK25", "ECT1", "K-SAM", "CD332" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3689", "gene_name": "fibroblast growth factor receptor 2", "omim_gene": [ "176943" ], "alias_name": [ "Crouzon syndrome", "Pfeiffer syndrome" ], "gene_symbol": "FGFR2", "hgnc_symbol": "FGFR2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:123237848-123357972", "ensembl_id": "ENSG00000066468" } }, "GRch38": { "90": { "location": "10:121478334-121598458", "ensembl_id": "ENSG00000066468" } } }, "hgnc_date_symbol_changed": "1991-05-09" }, "entity_type": "gene", "entity_name": "FGFR2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Illumina TruGenome Clinical Sequencing Services", "UKGTN", "Radboud University Medical Center, Nijmegen", "Expert Review Green", "NHS GMS", "Expert list", "Emory Genetics Laboratory" ], "phenotypes": [ "Craniosynostosis, nonspecific Crouzon syndrome 123500", "Pfeiffer syndrome 101600", "Beare-Stevenson cutis gyrata syndrome 123790", "Apert syndrome 101200", "Gastric cancer, somatic 613659", "Craniofacial-skeletal-dermatologic dysplasia 101600", "Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis 207410", "Bent bone dysplasia syndrome 614592", "Jackson-Weiss syndrome 123150", "LADD syndrome 149730" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NPH3", "KIAA2000", "FLJ30691", "FLJ36696", "MKS7", "SLSN3", "CFAP31" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7907", "gene_name": "nephrocystin 3", "omim_gene": [ "608002" ], "alias_name": [ "Meckel syndrome, type 7", "cilia and flagella associated protein 31" ], "gene_symbol": "NPHP3", "hgnc_symbol": "NPHP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:132276986-132441303", "ensembl_id": "ENSG00000113971" } }, "GRch38": { "90": { "location": "3:132680609-132722442", "ensembl_id": "ENSG00000113971" } } }, "hgnc_date_symbol_changed": "2000-01-20" }, "entity_type": "gene", "entity_name": "NPHP3", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Illumina TruGenome Clinical Sequencing Services", "Expert Review Red", "UKGTN", "Radboud University Medical Center, Nijmegen", "Expert list", "Emory Genetics Laboratory", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Meckel syndrome 7 267010" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC33727", "FLJ11273" ], "biotype": "protein_coding", "hgnc_id": "HGNC:22407", "gene_name": "transmembrane protein 106B", "omim_gene": [ "613413" ], "alias_name": null, "gene_symbol": "TMEM106B", "hgnc_symbol": "TMEM106B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:12250867-12282993", "ensembl_id": "ENSG00000106460" } }, "GRch38": { "90": { "location": "7:12211241-12243367", "ensembl_id": "ENSG00000106460" } } }, "hgnc_date_symbol_changed": "2005-12-19" }, "entity_type": "gene", "entity_name": "TMEM106B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29186371", "29444210" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Hypomyelinating leukodystrophy 16, 617964" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZP434I2117" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25295", "gene_name": "family with sequence similarity 57 member B", "omim_gene": [ "615175" ], "alias_name": null, "gene_symbol": "FAM57B", "hgnc_symbol": "FAM57B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:30035748-30064299", "ensembl_id": "ENSG00000149926" } }, "GRch38": { "90": { "location": "16:30024427-30052978", "ensembl_id": "ENSG00000149926" } } }, "hgnc_date_symbol_changed": "2005-03-15" }, "entity_type": "gene", "entity_name": "FAM57B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 33077892" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Cone-rod dystrophy 22, MIM# 619531", "Maculopathy" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "new gene name" ], "panel": { "id": 277, "hash_id": null, "name": "Retinitis pigmentosa", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause nonsyndromic retinitis pigmentosa and Leber congenital amaurosis. \r\nNote: Exome sequencing may not be a suitable technique for detecting pathogenic variants in RPGR due to regions of low coverage.\r\n\r\nPlease consider the Syndromic Retinopathy and the Retinal Disorders Superpanel when additional features are present.", "status": "public", "version": "0.245", "version_created": "2026-03-28T13:33:23.781842+11:00", "relevant_disorders": [ "Abnormal retinal morphology", "HP:0000479" ], "stats": { "number_of_genes": 159, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "U4c", "U4b", "U4A" ], "biotype": "snRNA", "hgnc_id": "HGNC:10193", "gene_name": "RNA, U4 small nuclear 2", "omim_gene": null, "alias_name": null, "gene_symbol": "RNU4-2", "hgnc_symbol": "RNU4-2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:120729566-120729706", "ensembl_id": "ENSG00000202538" } }, "GRch38": { "90": { "location": "12:120291763-120291903", "ensembl_id": "ENSG00000202538" } } }, "hgnc_date_symbol_changed": "2008-05-01" }, "entity_type": "gene", "entity_name": "RNU4-2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "39830270" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Retinitis pigmentosa, MONDO:0019200, RNU4-2 related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "non-coding gene" ], "panel": { "id": 277, "hash_id": null, "name": "Retinitis pigmentosa", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause nonsyndromic retinitis pigmentosa and Leber congenital amaurosis. \r\nNote: Exome sequencing may not be a suitable technique for detecting pathogenic variants in RPGR due to regions of low coverage.\r\n\r\nPlease consider the Syndromic Retinopathy and the Retinal Disorders Superpanel when additional features are present.", "status": "public", "version": "0.245", "version_created": "2026-03-28T13:33:23.781842+11:00", "relevant_disorders": [ "Abnormal retinal morphology", "HP:0000479" ], "stats": { "number_of_genes": 159, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ45472" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4235", "gene_name": "glial fibrillary acidic protein", "omim_gene": [ "137780" ], "alias_name": [ "intermediate filament protein" ], "gene_symbol": "GFAP", "hgnc_symbol": "GFAP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:42982376-42994305", "ensembl_id": "ENSG00000131095" } }, "GRch38": { "90": { "location": "17:44903161-44916937", "ensembl_id": "ENSG00000131095" } } }, "hgnc_date_symbol_changed": "1989-12-07" }, "entity_type": "gene", "entity_name": "GFAP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34146839" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Alexander disease MONDO:0008752" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "p21-Arc", "ARC21" ], "biotype": "protein_coding", "hgnc_id": "HGNC:706", "gene_name": "actin related protein 2/3 complex subunit 3", "omim_gene": [ "604225" ], "alias_name": null, "gene_symbol": "ARPC3", "hgnc_symbol": "ARPC3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:110872630-110888227", "ensembl_id": "ENSG00000111229" } }, "GRch38": { "90": { "location": "12:110434825-110450422", "ensembl_id": "ENSG00000111229" } } }, "hgnc_date_symbol_changed": "1999-08-06" }, "entity_type": "gene", "entity_name": "ARPC3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "36928819", "26166300", "40011789" ], "evidence": [ "Literature", "Expert Review Amber", "Expert Review Amber", "Literature" ], "phenotypes": [ "Charcot-Marie-Tooth disease MONDO:0015626" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2277", "gene_name": "cytochrome c oxidase subunit 6A1", "omim_gene": [ "602072" ], "alias_name": null, "gene_symbol": "COX6A1", "hgnc_symbol": "COX6A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:120875893-120878545", "ensembl_id": "ENSG00000111775" } }, "GRch38": { "90": { "location": "12:120438090-120440742", "ensembl_id": "ENSG00000111775" } } }, "hgnc_date_symbol_changed": "1990-06-11" }, "entity_type": "gene", "entity_name": "COX6A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25152455", "26302975", "25152455" ], "evidence": [ "Royal Melbourne Hospital", "Expert Review Green", "Expert Review Green" ], "phenotypes": [ "Charcot Marie Tooth disease, recessive intermediate D, 616039", "MONDO:0014467", "HMSN" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CAP102" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2509", "gene_name": "catenin alpha 1", "omim_gene": [ "116805" ], "alias_name": [ "alpha-E-catenin" ], "gene_symbol": "CTNNA1", "hgnc_symbol": "CTNNA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:137946656-138270723", "ensembl_id": "ENSG00000044115" } }, "GRch38": { "90": { "location": "5:138610967-138935034", "ensembl_id": "ENSG00000044115" } } }, "hgnc_date_symbol_changed": "1993-07-13" }, "entity_type": "gene", "entity_name": "CTNNA1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33497368" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Familial exudative vitreoretinopathy" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3113, "hash_id": null, "name": "Vitreoretinopathy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This is a consensus panel between VCGS and RMH.\r\n\r\nConsider using the broader Retinal Disorders superpanel when ophthalmological findings are not specific for this sub-group of disorders, particularly in individuals early in the diagnostic trajectory or where additional features are present.", "status": "public", "version": "1.9", "version_created": "2025-09-25T12:27:18.666129+10:00", "relevant_disorders": [ "Abnormal posterior eye segment morphology", "HP:0004329" ], "stats": { "number_of_genes": 20, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MFE-2", "DBP", "SDR8C1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5213", "gene_name": "hydroxysteroid 17-beta dehydrogenase 4", "omim_gene": [ "601860" ], "alias_name": [ "17beta-estradiol dehydrogenase type IV", "peroxisomal multifunctional protein 2", "17-beta-HSD IV", "17-beta-hydroxysteroid dehydrogenase 4", "D-bifunctional protein, peroxisomal", "D-3-hydroxyacyl-CoA dehydratase", "3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase", "beta-keto-reductase", "beta-hydroxyacyl dehydrogenase", "short chain dehydrogenase/reductase family 8C, member 1" ], "gene_symbol": "HSD17B4", "hgnc_symbol": "HSD17B4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:118788138-118972894", "ensembl_id": "ENSG00000133835" } }, "GRch38": { "90": { "location": "5:119452443-119637199", "ensembl_id": "ENSG00000133835" } } }, "hgnc_date_symbol_changed": "1994-09-14" }, "entity_type": "gene", "entity_name": "HSD17B4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "D-bifunctional protein deficiency, 261515 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3542", "gene_name": "coagulation factor V", "omim_gene": [ "612309" ], "alias_name": null, "gene_symbol": "F5", "hgnc_symbol": "F5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:169483404-169555826", "ensembl_id": "ENSG00000198734" } }, "GRch38": { "90": { "location": "1:169514166-169586588", "ensembl_id": "ENSG00000198734" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "F5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Factor V deficiency, 227400 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MSU" ], "biotype": "protein_coding", "hgnc_id": "HGNC:986", "gene_name": "branched chain keto acid dehydrogenase E1, alpha polypeptide", "omim_gene": [ "608348" ], "alias_name": [ "maple syrup urine disease" ], "gene_symbol": "BCKDHA", "hgnc_symbol": "BCKDHA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:41884215-41930910", "ensembl_id": "ENSG00000248098" } }, "GRch38": { "90": { "location": "19:41397460-41425005", "ensembl_id": "ENSG00000248098" } } }, "hgnc_date_symbol_changed": "1989-06-30" }, "entity_type": "gene", "entity_name": "BCKDHA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Maple syrup urine disease, type Ia, 248600 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "XGALT-1", "beta4Gal-T7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:930", "gene_name": "beta-1,4-galactosyltransferase 7", "omim_gene": [ "604327" ], "alias_name": [ "galactosyltransferase I" ], "gene_symbol": "B4GALT7", "hgnc_symbol": "B4GALT7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:177027101-177037348", "ensembl_id": "ENSG00000027847" } }, "GRch38": { "90": { "location": "5:177600100-177610347", "ensembl_id": "ENSG00000027847" } } }, "hgnc_date_symbol_changed": "1999-12-07" }, "entity_type": "gene", "entity_name": "B4GALT7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Ehlers-Danlos syndrome, progeroid type, 1, 130070 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "QCR2", "UQCR2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12586", "gene_name": "ubiquinol-cytochrome c reductase core protein 2", "omim_gene": [ "191329" ], "alias_name": null, "gene_symbol": "UQCRC2", "hgnc_symbol": "UQCRC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:21963981-21994981", "ensembl_id": "ENSG00000140740" } }, "GRch38": { "90": { "location": "16:21952660-21983660", "ensembl_id": "ENSG00000140740" } } }, "hgnc_date_symbol_changed": "1993-07-09" }, "entity_type": "gene", "entity_name": "UQCRC2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "Mackenzie's Mission" ], "phenotypes": [ "Mitochondrial complex III deficiency, nuclear type 5, 615160 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MTH2", "FLJ10956" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23063", "gene_name": "nudix hydrolase 15", "omim_gene": [ "615792" ], "alias_name": null, "gene_symbol": "NUDT15", "hgnc_symbol": "NUDT15", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:48611703-48621358", "ensembl_id": "ENSG00000136159" } }, "GRch38": { "90": { "location": "13:48037567-48047222", "ensembl_id": "ENSG00000136159" } } }, "hgnc_date_symbol_changed": "2003-12-22" }, "entity_type": "gene", "entity_name": "NUDT15", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "21270794", "23422873", "30447069" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "{Thiopurines, poor metabolism of, 2}\t616903", "Azathioprine", "Mercaptopurine" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3271, "hash_id": null, "name": "Pharmacogenomics_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is under development, to be used by the Australian Genomics Acute Care Flagship.", "status": "public", "version": "0.50", "version_created": "2020-08-27T20:53:11.205850+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 17, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "UNC18B", "Hunc18b" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11445", "gene_name": "syntaxin binding protein 2", "omim_gene": [ "601717" ], "alias_name": null, "gene_symbol": "STXBP2", "hgnc_symbol": "STXBP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:7701767-7712759", "ensembl_id": "ENSG00000076944" } }, "GRch38": { "90": { "location": "19:7636881-7647873", "ensembl_id": "ENSG00000076944" } } }, "hgnc_date_symbol_changed": "1996-12-27" }, "entity_type": "gene", "entity_name": "STXBP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Hemophagocytic lymphohistiocytosis" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "L35A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10345", "gene_name": "ribosomal protein L35a", "omim_gene": [ "180468" ], "alias_name": null, "gene_symbol": "RPL35A", "hgnc_symbol": "RPL35A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:197676858-197683481", "ensembl_id": "ENSG00000182899" } }, "GRch38": { "90": { "location": "3:197949987-197956610", "ensembl_id": "ENSG00000182899" } } }, "hgnc_date_symbol_changed": "1991-11-29" }, "entity_type": "gene", "entity_name": "RPL35A", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Diamond-Blackfan anemia" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HNPCC", "FCC2", "HNPCC2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7127", "gene_name": "mutL homolog 1", "omim_gene": [ "120436" ], "alias_name": null, "gene_symbol": "MLH1", "hgnc_symbol": "MLH1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:37034823-37107380", "ensembl_id": "ENSG00000076242" } }, "GRch38": { "90": { "location": "3:36993332-37050918", "ensembl_id": "ENSG00000076242" } } }, "hgnc_date_symbol_changed": "1993-11-24" }, "entity_type": "gene", "entity_name": "MLH1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "NSW Health Pathology", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 3437, "hash_id": null, "name": "Incidentalome_PREGEN_DRAFT", "disease_group": "", "disease_sub_group": "", "description": "Imported to facilitate update work. Do not use while labeled as DRAFT", "status": "public", "version": "0.43", "version_created": "2021-01-20T16:42:09.286633+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 173, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PCDGF", "PGRN", "CLN11" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4601", "gene_name": "granulin precursor", "omim_gene": [ "138945" ], "alias_name": [ "progranulin" ], "gene_symbol": "GRN", "hgnc_symbol": "GRN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:42422614-42430470", "ensembl_id": "ENSG00000030582" } }, "GRch38": { "90": { "location": "17:44345086-44353102", "ensembl_id": "ENSG00000030582" } } }, "hgnc_date_symbol_changed": "1992-11-30" }, "entity_type": "gene", "entity_name": "GRN", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "NSW Health Pathology", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 3437, "hash_id": null, "name": "Incidentalome_PREGEN_DRAFT", "disease_group": "", "disease_sub_group": "", "description": "Imported to facilitate update work. Do not use while labeled as DRAFT", "status": "public", "version": "0.43", "version_created": "2021-01-20T16:42:09.286633+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 173, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PH" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8582", "gene_name": "phenylalanine hydroxylase", "omim_gene": [ "612349" ], "alias_name": [ "phenylalanine 4-monooxygenase" ], "gene_symbol": "PAH", "hgnc_symbol": "PAH", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:103230663-103352188", "ensembl_id": "ENSG00000171759" } }, "GRch38": { "90": { "location": "12:102836885-102958410", "ensembl_id": "ENSG00000171759" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "PAH", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "27604308", "3008810" ], "evidence": [ "Expert Review Green", "NHS GMS" ], "phenotypes": [ "Phenylketonuria MIM#261600", "Disorders of phenylalanine or tyrosine metabolism" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 3468, "hash_id": null, "name": "Miscellaneous Metabolic Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause miscellaneous metabolic disorders, that are not present on any of the more specific metabolic disorders panels (see the Metabolic Disorders Superpanel for the full list of panels). It contains, but is not limited to, the following groups of conditions:\r\n-Disorders of purine and pyrimidine metabolism\r\n-Organic acidurias, and other disorders of amino acid and peptide metabolism\r\n-Disorders of bile acid metabolism and transport, and other disorders of the metabolism of sterols\r\n-Disorders of nucleotide metabolism\r\n-Disorders of glucose transport, and other disorders of carbohydrate metabolism (excluding glycogen storage disorders)\r\n-Disorders of zinc and manganese metabolism\r\n-Disorders of vitamins and cofactors\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.60", "version_created": "2026-01-15T15:39:27.439934+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 149, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "P58", "P58IPK", "HP58", "ERdj6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9439", "gene_name": "DnaJ heat shock protein family (Hsp40) member C3", "omim_gene": [ "601184" ], "alias_name": [ "interferon-induced, double-stranded RNA-activated protein kinase inhibitor", "protein kinase inhibitor of 58 kDa", "endoplasmic reticulum DNA J domain-containing protein 6" ], "gene_symbol": "DNAJC3", "hgnc_symbol": "DNAJC3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:96329393-96447243", "ensembl_id": "ENSG00000102580" } }, "GRch38": { "90": { "location": "13:95677139-95794989", "ensembl_id": "ENSG00000102580" } } }, "hgnc_date_symbol_changed": "1995-09-20" }, "entity_type": "gene", "entity_name": "DNAJC3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34654017", "34630333", "33486469", "32738013", "28940199" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "juvenile-onset diabetes mellitus-central and peripheral neurodegeneration syndrome, MONDO:0014523" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3471, "hash_id": null, "name": "Congenital hypothyroidism", "disease_group": "Endocrine disorders", "disease_sub_group": "Thyroid disorders", "description": "This panel contains genes associated with congenital hypothyroidism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'congenital hypothyroidism' panel V3.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.120", "version_created": "2026-04-02T11:51:29.895216+11:00", "relevant_disorders": [ "Hypothyroidism HP:0000821" ], "stats": { "number_of_genes": 63, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "NIS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11040", "gene_name": "solute carrier family 5 member 5", "omim_gene": [ "601843" ], "alias_name": null, "gene_symbol": "SLC5A5", "hgnc_symbol": "SLC5A5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:17982782-18005983", "ensembl_id": "ENSG00000105641" } }, "GRch38": { "90": { "location": "19:17871973-17895174", "ensembl_id": "ENSG00000105641" } } }, "hgnc_date_symbol_changed": "1997-04-16" }, "entity_type": "gene", "entity_name": "SLC5A5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9171822", "16418213" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Apparent athyreosis on nuclear medicine scan", "childhood onset hypothyroidism", "goitre", "Thyroid dyshormonogenesis 1, 274400", "HYPOTHYROIDISM, CONGENITAL, DUE TO DYSHORMONOGENESIS, 1" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3471, "hash_id": null, "name": "Congenital hypothyroidism", "disease_group": "Endocrine disorders", "disease_sub_group": "Thyroid disorders", "description": "This panel contains genes associated with congenital hypothyroidism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'congenital hypothyroidism' panel V3.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.120", "version_created": "2026-04-02T11:51:29.895216+11:00", "relevant_disorders": [ "Hypothyroidism HP:0000821" ], "stats": { "number_of_genes": 63, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:12372", "gene_name": "thyroid stimulating hormone beta", "omim_gene": [ "188540" ], "alias_name": null, "gene_symbol": "TSHB", "hgnc_symbol": "TSHB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:115572415-115576941", "ensembl_id": "ENSG00000134200" } }, "GRch38": { "90": { "location": "1:115029824-115034309", "ensembl_id": "ENSG00000134200" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "TSHB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "2792087", "27362444" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Congenital hypothyroidism", "Hypothryoidism, congenital, nongoitrous 4, 275100", "severe isolated central hypothyroidism" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3471, "hash_id": null, "name": "Congenital hypothyroidism", "disease_group": "Endocrine disorders", "disease_sub_group": "Thyroid disorders", "description": "This panel contains genes associated with congenital hypothyroidism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'congenital hypothyroidism' panel V3.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.120", "version_created": "2026-04-02T11:51:29.895216+11:00", "relevant_disorders": [ "Hypothyroidism HP:0000821" ], "stats": { "number_of_genes": 63, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SHOT", "OG12X", "OG12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10854", "gene_name": "short stature homeobox 2", "omim_gene": [ "602504" ], "alias_name": null, "gene_symbol": "SHOX2", "hgnc_symbol": "SHOX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:157814948-157824292", "ensembl_id": "ENSG00000168779" } }, "GRch38": { "90": { "location": "3:158095954-158106503", "ensembl_id": "ENSG00000168779" } } }, "hgnc_date_symbol_changed": "1998-06-05" }, "entity_type": "gene", "entity_name": "SHOX2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30443179", "16537395", "16537395" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp" ], "phenotypes": [ "Sinus Node Dysfunction", "Atrial Fibrillation" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3631, "hash_id": null, "name": "Growth failure", "disease_group": "", "disease_sub_group": "", "description": "This panel contains genes associated with growth failure in infancy/early childhood, either isolated or as part of another disorder.\r\n\r\nConsider applying this panel in individuals with:\r\n -Height Standard Deviation Score (SDS) <-3 (very significant short stature - well below the 0.4th centile)\r\nAND at least one of:\r\n- History of small for gestational age (birth weight and/or length <-2SDS)\r\n- Body disproportion, e.g. discrepancy between stature and head size\r\n- Dysmorphic features and congenital anomalies\r\n- Abnormalities in the GH-IGF axis (evidence of GH insensitivity or deficiency) and/or other pituitary hormonal deficiencies\r\n- Family history of significant short stature (1st and 2nd degree relatives) and/or consanguinity\r\n\r\nPrior to genomic testing consider:\r\n-Chromosomal microarray analysis (e.g. Turner syndrome)\r\n-Methylation analysis for Russell-Silver syndrome and Temple syndrome\r\n-Skeletal survey\r\n\r\nAcquired causes of short stature are relatively common.\r\n\r\nDepending on the specific clinical features present, consider applying the Skeletal dysplasia, Intellectual Disability, and/or Pituitary Hormone deficiency panels.\r\n\r\nWith thanks to Genomics England for the original design of this panel.", "status": "public", "version": "1.102", "version_created": "2026-04-01T10:17:12.005431+11:00", "relevant_disorders": [ "Failure to thrive", "HP:0001508; Growth delay", "HP:0001510" ], "stats": { "number_of_genes": 204, "number_of_strs": 0, "number_of_regions": 4 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FAE" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3586", "gene_name": "Fanconi anemia complementation group E", "omim_gene": [ "613976" ], "alias_name": null, "gene_symbol": "FANCE", "hgnc_symbol": "FANCE", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:35420138-35434880", "ensembl_id": "ENSG00000112039" } }, "GRch38": { "90": { "location": "6:35452361-35467103", "ensembl_id": "ENSG00000112039" } } }, "hgnc_date_symbol_changed": "1996-04-09" }, "entity_type": "gene", "entity_name": "FANCE", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11001585", "31586946", "7662964", "9382107", "9147877", "10205272" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Fanconi anaemia, complementation group E, MIM# 600901", "MONDO:0010953" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3631, "hash_id": null, "name": "Growth failure", "disease_group": "", "disease_sub_group": "", "description": "This panel contains genes associated with growth failure in infancy/early childhood, either isolated or as part of another disorder.\r\n\r\nConsider applying this panel in individuals with:\r\n -Height Standard Deviation Score (SDS) <-3 (very significant short stature - well below the 0.4th centile)\r\nAND at least one of:\r\n- History of small for gestational age (birth weight and/or length <-2SDS)\r\n- Body disproportion, e.g. discrepancy between stature and head size\r\n- Dysmorphic features and congenital anomalies\r\n- Abnormalities in the GH-IGF axis (evidence of GH insensitivity or deficiency) and/or other pituitary hormonal deficiencies\r\n- Family history of significant short stature (1st and 2nd degree relatives) and/or consanguinity\r\n\r\nPrior to genomic testing consider:\r\n-Chromosomal microarray analysis (e.g. Turner syndrome)\r\n-Methylation analysis for Russell-Silver syndrome and Temple syndrome\r\n-Skeletal survey\r\n\r\nAcquired causes of short stature are relatively common.\r\n\r\nDepending on the specific clinical features present, consider applying the Skeletal dysplasia, Intellectual Disability, and/or Pituitary Hormone deficiency panels.\r\n\r\nWith thanks to Genomics England for the original design of this panel.", "status": "public", "version": "1.102", "version_created": "2026-04-01T10:17:12.005431+11:00", "relevant_disorders": [ "Failure to thrive", "HP:0001508; Growth delay", "HP:0001510" ], "stats": { "number_of_genes": 204, "number_of_strs": 0, "number_of_regions": 4 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0902", "CNK2", "KSR2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19701", "gene_name": "connector enhancer of kinase suppressor of Ras 2", "omim_gene": [ "300724" ], "alias_name": null, "gene_symbol": "CNKSR2", "hgnc_symbol": "CNKSR2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:21392536-21672813", "ensembl_id": "ENSG00000149970" } }, "GRch38": { "90": { "location": "X:21374418-21654695", "ensembl_id": "ENSG00000149970" } } }, "hgnc_date_symbol_changed": "2004-05-27" }, "entity_type": "gene", "entity_name": "CNKSR2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "34266427" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp" ], "phenotypes": [ "Intellectual developmental disorder, X-linked, syndromic, Houge type, MIM# 301008" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ32753", "RSP44", "RSPH10A", "CILD24" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12371", "gene_name": "radial spoke head 1 homolog", "omim_gene": [ "609314" ], "alias_name": [ "meichroacidin" ], "gene_symbol": "RSPH1", "hgnc_symbol": "RSPH1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:43892596-43916464", "ensembl_id": "ENSG00000160188" } }, "GRch38": { "90": { "location": "21:42472486-42496354", "ensembl_id": "ENSG00000160188" } } }, "hgnc_date_symbol_changed": "2007-06-25" }, "entity_type": "gene", "entity_name": "RSPH1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30166424", "23993197" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp" ], "phenotypes": [ "Ciliary dyskinesia, primary, 24 (MIM#615481)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:12616", "gene_name": "ubiquitin specific peptidase 18", "omim_gene": [ "607057" ], "alias_name": null, "gene_symbol": "USP18", "hgnc_symbol": "USP18", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:18632666-18660164", "ensembl_id": "ENSG00000184979" } }, "GRch38": { "90": { "location": "22:18149899-18177397", "ensembl_id": "ENSG00000184979" } } }, "hgnc_date_symbol_changed": "1999-11-16" }, "entity_type": "gene", "entity_name": "USP18", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27325888", "12833411", "31940699" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Pseudo-TORCH syndrome 2, MIM#617397" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NY-REN-43", "MGC15161" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13429", "gene_name": "ring finger protein, LIM domain interacting", "omim_gene": [ "300379" ], "alias_name": [ "ring zinc finger protein NY-REN-43antigen", "LIM domain interacting ring finger protein", "E3 ubiquitin-protein ligase RLIM" ], "gene_symbol": "RLIM", "hgnc_symbol": "RLIM", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:73805052-73834452", "ensembl_id": "ENSG00000131263" } }, "GRch38": { "90": { "location": "X:74585217-74614617", "ensembl_id": "ENSG00000131263" } } }, "hgnc_date_symbol_changed": "2009-02-17" }, "entity_type": "gene", "entity_name": "RLIM", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29728705", "25735484", "25644381" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Expert list" ], "phenotypes": [ "Tonne-Kalscheuer syndrome, MIM# 300978" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LonHS", "hLON", "PIM1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9479", "gene_name": "lon peptidase 1, mitochondrial", "omim_gene": [ "605490" ], "alias_name": null, "gene_symbol": "LONP1", "hgnc_symbol": "LONP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:5691845-5720583", "ensembl_id": "ENSG00000196365" } }, "GRch38": { "90": { "location": "19:5691834-5720572", "ensembl_id": "ENSG00000196365" } } }, "hgnc_date_symbol_changed": "2006-10-20" }, "entity_type": "gene", "entity_name": "LONP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31636596", "34547244", "25574826", "29408517" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Literature", "Literature", "Genetic Health Queensland" ], "phenotypes": [ "CODAS syndrome, OMIM:600373", "CODAS syndrome, MONDO:0010879" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EL2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11272", "gene_name": "spectrin alpha, erythrocytic 1", "omim_gene": [ "182860" ], "alias_name": [ "elliptocytosis 2" ], "gene_symbol": "SPTA1", "hgnc_symbol": "SPTA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:158580496-158656488", "ensembl_id": "ENSG00000163554" } }, "GRch38": { "90": { "location": "1:158610706-158686698", "ensembl_id": "ENSG00000163554" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "SPTA1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34132406", "35483216", "31333484", "29594000" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Spherocytosis type 3 #270970", "Elliptocytosis-2 #130600", "pyropoikilocytosis #266140" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ33903", "PPP1R147" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20249", "gene_name": "sprouty related EVH1 domain containing 1", "omim_gene": [ "609291" ], "alias_name": [ "protein phosphatase 1, regulatory subunit 147" ], "gene_symbol": "SPRED1", "hgnc_symbol": "SPRED1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:38544527-38649450", "ensembl_id": "ENSG00000166068" } }, "GRch38": { "90": { "location": "15:38252326-38357249", "ensembl_id": "ENSG00000166068" } } }, "hgnc_date_symbol_changed": "2003-01-24" }, "entity_type": "gene", "entity_name": "SPRED1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "17704776", "19366998", "21548021" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Legius syndrome, MIM# 611431" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:1912", "gene_name": "choline O-acetyltransferase", "omim_gene": [ "118490" ], "alias_name": null, "gene_symbol": "CHAT", "hgnc_symbol": "CHAT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:50817141-50901925", "ensembl_id": "ENSG00000070748" } }, "GRch38": { "90": { "location": "10:49609095-49665104", "ensembl_id": "ENSG00000070748" } } }, "hgnc_date_symbol_changed": "1990-03-14" }, "entity_type": "gene", "entity_name": "CHAT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11172068", "12756141", "31192527", "29518833", "29189923" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Myasthenic syndrome, congenital, 6, presynaptic 254210" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CI-75k" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7707", "gene_name": "NADH:ubiquinone oxidoreductase core subunit S1", "omim_gene": [ "157655" ], "alias_name": [ "complex I 75kDa subunit", "NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial" ], "gene_symbol": "NDUFS1", "hgnc_symbol": "NDUFS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:206979541-207024327", "ensembl_id": "ENSG00000023228" } }, "GRch38": { "90": { "location": "2:206114817-206159603", "ensembl_id": "ENSG00000023228" } } }, "hgnc_date_symbol_changed": "1992-04-03" }, "entity_type": "gene", "entity_name": "NDUFS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24952175", "20797884", "15824269", "25615419", "11349233", "22399432" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Mitochondrial complex I deficiency, nuclear type 5, MIM#618226" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MSS1", "THDF1", "GTPBG3", "MTGP1", "FLJ14700" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14880", "gene_name": "GTP binding protein 3, mitochondrial", "omim_gene": [ "608536" ], "alias_name": null, "gene_symbol": "GTPBP3", "hgnc_symbol": "GTPBP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:17445729-17453544", "ensembl_id": "ENSG00000130299" } }, "GRch38": { "90": { "location": "19:17334920-17342735", "ensembl_id": "ENSG00000130299" } } }, "hgnc_date_symbol_changed": "2003-11-27" }, "entity_type": "gene", "entity_name": "GTPBP3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "34276756", "25434004" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Combined oxidative phosphorylation deficiency 23 MIM#616198" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BLU", "CILD22" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19412", "gene_name": "zinc finger MYND-type containing 10", "omim_gene": [ "607070" ], "alias_name": null, "gene_symbol": "ZMYND10", "hgnc_symbol": "ZMYND10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:50378541-50384283", "ensembl_id": "ENSG00000004838" } }, "GRch38": { "90": { "location": "3:50341110-50346852", "ensembl_id": "ENSG00000004838" } } }, "hgnc_date_symbol_changed": "2003-05-01" }, "entity_type": "gene", "entity_name": "ZMYND10", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23891471", "23891469" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Ciliary dyskinesia, primary, 22 (MIM#615444)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HBA-T3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4823", "gene_name": "hemoglobin subunit alpha 1", "omim_gene": [ "141800" ], "alias_name": null, "gene_symbol": "HBA1", "hgnc_symbol": "HBA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:226679-227521", "ensembl_id": "ENSG00000206172" } }, "GRch38": { "90": { "location": "16:176680-177522", "ensembl_id": "ENSG00000206172" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "HBA1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "21381239", "11722414", "36907606" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Erythrocytosis 7, MIM# 617981", "Heinz body anemias, alpha-, MIM# 140700", "Methemoglobinemia, alpha type , MIM#617973", "Thalassemias, alpha-, MIM# 604131", "Hemoglobin H disease, nondeletional, MIM# 613978" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "SV/CNV" ], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Nav1.4", "HYPP", "SkM1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10591", "gene_name": "sodium voltage-gated channel alpha subunit 4", "omim_gene": [ "603967" ], "alias_name": null, "gene_symbol": "SCN4A", "hgnc_symbol": "SCN4A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:62015914-62050278", "ensembl_id": "ENSG00000007314" } }, "GRch38": { "90": { "location": "17:63938554-63972918", "ensembl_id": "ENSG00000007314" } } }, "hgnc_date_symbol_changed": "1990-09-30" }, "entity_type": "gene", "entity_name": "SCN4A", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category C gene", "BabySeq Category A gene", "Expert Review Red", "BeginNGS" ], "phenotypes": [ "Hyperkalemic periodic paralysis, type 2, MIM# 170500", "Hypokalemic periodic paralysis, type 2", "Paramyotonia congenita , MIM#168300", "Myotonia congenita, atypical, acetazolamide-responsive , MIM#608390", "Myasthenic syndrome, congenital, 16, MIM# 614198", "Hyperkalemic periodic paralysis, type 2", "Hypokalemic periodic paralysis, type 2, MIM# 613345" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "cblG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7468", "gene_name": "5-methyltetrahydrofolate-homocysteine methyltransferase", "omim_gene": [ "156570" ], "alias_name": null, "gene_symbol": "MTR", "hgnc_symbol": "MTR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:236958610-237067281", "ensembl_id": "ENSG00000116984" } }, "GRch38": { "90": { "location": "1:236795281-236903981", "ensembl_id": "ENSG00000116984" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "MTR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8968736", "8968737", "9683607", "12068375" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:9399", "gene_name": "protein kinase C delta", "omim_gene": [ "176977" ], "alias_name": null, "gene_symbol": "PRKCD", "hgnc_symbol": "PRKCD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:53190025-53226733", "ensembl_id": "ENSG00000163932" } }, "GRch38": { "90": { "location": "3:53156009-53192717", "ensembl_id": "ENSG00000163932" } } }, "hgnc_date_symbol_changed": "1991-08-06" }, "entity_type": "gene", "entity_name": "PRKCD", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "37794137" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Autoimmune lymphoproliferative syndrome, type III\tMIM#615559" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4389, "hash_id": null, "name": "Autoimmune Lymphoproliferative Syndrome", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel has been compiled based on the following study:\r\n\r\nGenetic Testing in Patients with Autoimmune Lymphoproliferative Syndrome: Experience of 802 Patients at Cincinnati Children’s Hospital Medical Center (PMID: 39060684)", "status": "public", "version": "1.12", "version_created": "2026-02-26T20:52:40.847942+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 20, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0111", "EIF4AIII", "Fal1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18683", "gene_name": "eukaryotic translation initiation factor 4A3", "omim_gene": [ "608546" ], "alias_name": null, "gene_symbol": "EIF4A3", "hgnc_symbol": "EIF4A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:78109013-78120982", "ensembl_id": "ENSG00000141543" } }, "GRch38": { "90": { "location": "17:80135214-80147183", "ensembl_id": "ENSG00000141543" } } }, "hgnc_date_symbol_changed": "2006-11-27" }, "entity_type": "str", "entity_name": "EIF4A3_RCPS_complex", "confidence_level": "3", "penetrance": null, "publications": [ "24360810", "29112243" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Robin sequence with cleft mandible and limb anomalies MIM#268305", "Richieri-Costa-Pereira syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "TCGGCAGCGGCGCAGCGAGG", "chromosome": "17", "grch37_coordinates": [ 78120803, 78120938 ], "grch38_coordinates": [ 80147004, 80147139 ], "normal_repeats": 12, "pathogenic_repeats": 14, "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "BPES1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1092", "gene_name": "forkhead box L2", "omim_gene": [ "605597" ], "alias_name": null, "gene_symbol": "FOXL2", "hgnc_symbol": "FOXL2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:138663066-138665982", "ensembl_id": "ENSG00000183770" } }, "GRch38": { "90": { "location": "3:138944224-138947140", "ensembl_id": "ENSG00000183770" } } }, "hgnc_date_symbol_changed": "1992-02-28" }, "entity_type": "str", "entity_name": "FOXL2_BPES_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "11468277", "33811808" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Blepharophimosis, epicanthus inversus, and ptosis type 1 and 2 MIM#110100", "Premature ovarian failure 3 MIM#608996" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "3", "grch37_coordinates": [ 138664863, 138664904 ], "grch38_coordinates": [ 138946021, 138946062 ], "normal_repeats": 14, "pathogenic_repeats": 19, "tags": [], "panel": { "id": 3166, "hash_id": null, "name": "Primary Ovarian Insufficiency_Premature Ovarian Failure", "disease_group": "Endocrine disorders", "disease_sub_group": "Gonadal and sex development disorders", "description": "This panel contains genes that cause non-syndromic and syndromic amenorrhoea, and ovarian insufficiency/failure. It was developed by RMH and Genetic Health QLD. It is a consensus panel used by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Primary ovarian insufficiency' panel V1.69, with all discrepancies reviewed and resolved (October 2025). \r\n\r\nWith early onset premature ovarian insufficiency, the following should be considered:\r\n• X chromosome abnormality such as Turner syndrome\r\n• Presence of FMR1 premutation\r\n• Iatrogenic cause (bilateral oophorectomy, chemotherapy, radiotherapy or any other iatrogenic cause)\r\n• Presence of thyroid or adrenal auto-antibodies\r\n\r\nTesting for fragile X premutation and chromosome abnormalities are strongly recommended prior to genomic testing.\r\n\r\nThis panel should be used for individuals with raised FSH. If FSH is low, the Hypogonadotropic hypogonadism panel should be used.\r\n\r\nPlease also consider the Differences of Sex Development panel where appropriate depending on clinical features.", "status": "public", "version": "0.410", "version_created": "2026-04-06T10:52:55.877866+10:00", "relevant_disorders": [ "Premature ovarian insufficiency", "HP:0008209" ], "stats": { "number_of_genes": 164, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } } ] }