Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=7
{ "count": 36022, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=8", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=6", "results": [ { "gene_data": { "alias": [ "CX50" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4281", "gene_name": "gap junction protein alpha 8", "omim_gene": [ "600897" ], "alias_name": [ "connexin 50" ], "gene_symbol": "GJA8", "hgnc_symbol": "GJA8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:147374946-147381393", "ensembl_id": "ENSG00000121634" } }, "GRch38": { "90": { "location": "1:147907956-147909257", "ensembl_id": "ENSG00000121634" } } }, "hgnc_date_symbol_changed": "1995-11-29" }, "entity_type": "gene", "entity_name": "GJA8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30498267", "29464339", "32499604" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Cataract 1, multiple types, MIM# 116200", "Microphthalmia", "Anterior segment dysgenesis" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 43, "hash_id": null, "name": "Eye Anterior Segment Abnormalities", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nAnterior segment dysgeneses are a heterogeneous group of developmental disorders affecting the anterior segment of the eye, including the cornea, iris, lens, trabecular meshwork, and Schlemm canal. Clinical features include iris hypoplasia, an enlarged or reduced corneal diameter, corneal vascularization and opacity, posterior embryotoxon, corectopia, polycoria, an abnormal iridocorneal angle, ectopia lentis, and anterior synechiae between the iris and posterior corneal surface.\r\n\r\nAnterior segment dysgenesis can occur in isolation or as part of a more complex eye malformation or syndromic disorder. Also consider applying the Anophthalmia_Microphthalmia_Coloboma and Cataracts panels as indicated.", "status": "public", "version": "1.20", "version_created": "2026-02-21T14:46:08.710773+11:00", "relevant_disorders": [ "Abnormal anterior eye segment morphology", "HP:0004328" ], "stats": { "number_of_genes": 29, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "RAI" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10074", "gene_name": "ribonuclease/angiogenin inhibitor 1", "omim_gene": [ "173320" ], "alias_name": null, "gene_symbol": "RNH1", "hgnc_symbol": "RNH1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:494512-507300", "ensembl_id": "ENSG00000023191" } }, "GRch38": { "90": { "location": "11:494512-507300", "ensembl_id": "ENSG00000023191" } } }, "hgnc_date_symbol_changed": "2005-06-01" }, "entity_type": "gene", "entity_name": "RNH1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 36935417" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, RNH1-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GBA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4177", "gene_name": "glucosylceramidase beta", "omim_gene": [ "606463" ], "alias_name": null, "gene_symbol": "GBA", "hgnc_symbol": "GBA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:155204243-155214490", "ensembl_id": "ENSG00000177628" } }, "GRch38": { "90": { "location": "1:155234452-155244699", "ensembl_id": "ENSG00000177628" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "GBA", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 38693247" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Gaucher disease, MIM#231000" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 73, "hash_id": null, "name": "Cerebral Palsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Cerebral palsy (CP) is a non-progressive neurodevelopmental disorder characterized by motor impairments, often accompanied by intellectual disability, epilepsy, visual and hearing impairment and speech and language deficits.\r\n\r\nPMID 33528536 reported a cohort of 1345 individuals undergoing genomic testing. Diagnostic yield ranged between 10-30% depending on presence of additional characteristics such as ID/epilepsy/ASD.\r\n\r\nThe aetiology of cerebral palsy is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia, Ataxia, Malformations of Cortical Development, Mitochondrial Disorders and the Bleeding and Platelet Disorders panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Jozef Gecz, Clare van Eyk, Luisa Weiss and team for their contribution to the development of this panel.", "status": "public", "version": "1.410", "version_created": "2026-02-17T16:35:59.013988+11:00", "relevant_disorders": [ "Cerebral palsy HP:0100021" ], "stats": { "number_of_genes": 364, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC10676", "bHLHc5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29658", "gene_name": "mesoderm posterior bHLH transcription factor 1", "omim_gene": [ "608689" ], "alias_name": null, "gene_symbol": "MESP1", "hgnc_symbol": "MESP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:90291892-90294541", "ensembl_id": "ENSG00000166823" } }, "GRch38": { "90": { "location": "15:89748661-89751310", "ensembl_id": "ENSG00000166823" } } }, "hgnc_date_symbol_changed": "2005-10-21" }, "entity_type": "gene", "entity_name": "MESP1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28677747", "28050627", "27185833", "26694203" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Congenital heart disease, MONDO:0005453, MESP1-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.534", "version_created": "2026-03-30T13:14:35.719896+11:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 253, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RPC2", "FLJ10388" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30348", "gene_name": "RNA polymerase III subunit B", "omim_gene": [ "614366" ], "alias_name": null, "gene_symbol": "POLR3B", "hgnc_symbol": "POLR3B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:106751436-106903976", "ensembl_id": "ENSG00000013503" } }, "GRch38": { "90": { "location": "12:106357658-106510198", "ensembl_id": "ENSG00000013503" } } }, "hgnc_date_symbol_changed": "2004-04-21" }, "entity_type": "gene", "entity_name": "POLR3B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "27512013", "23355746", "22036171", "22036172", "25339210", "33005949", "22855961" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism", "OMIM #614381" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.46", "version_created": "2026-04-02T12:35:34.329595+11:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DAPLE", "HkRP2", "SCA40" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19967", "gene_name": "coiled-coil domain containing 88C", "omim_gene": [ "611204" ], "alias_name": [ "Dvl-associating protein with a high frequency of leucine residues", "spinocerebellar ataxia 40" ], "gene_symbol": "CCDC88C", "hgnc_symbol": "CCDC88C", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:91737667-91884188", "ensembl_id": "ENSG00000015133" } }, "GRch38": { "90": { "location": "14:91271323-91417844", "ensembl_id": "ENSG00000015133" } } }, "hgnc_date_symbol_changed": "2007-05-31" }, "entity_type": "gene", "entity_name": "CCDC88C", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25062847", "30398676" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hydrocephalus, nonsyndromic, autosomal recessive 236600" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 115, "hash_id": null, "name": "Hydrocephalus_Ventriculomegaly", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the Genomics England 'Hydrocephalus' panel, with all discrepancies resolved and reciprocal feedback provided to Genomics England, 8/8/2020.", "status": "public", "version": "0.134", "version_created": "2026-01-28T12:49:29.963583+11:00", "relevant_disorders": [ "Hydrocephalus", "HP:0000238; Ventriculomegaly", "HP:0002119" ], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SOCS-1", "SSI-1", "JAB", "TIP3", "Cish1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19383", "gene_name": "suppressor of cytokine signaling 1", "omim_gene": [ "603597" ], "alias_name": null, "gene_symbol": "SOCS1", "hgnc_symbol": "SOCS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:11348262-11350036", "ensembl_id": "ENSG00000185338" } }, "GRch38": { "90": { "location": "16:11254405-11256179", "ensembl_id": "ENSG00000185338" } } }, "hgnc_date_symbol_changed": "2002-11-13" }, "entity_type": "gene", "entity_name": "SOCS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 37156989" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Autoinflammatory syndrome, familial, with or without immunodeficiency, MIM# 619375", "Enteropathy" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 123, "hash_id": null, "name": "Inflammatory bowel disease", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.126", "version_created": "2025-10-16T15:50:33.114198+11:00", "relevant_disorders": [ "Gastrointestinal inflammation", "HP:0004386" ], "stats": { "number_of_genes": 85, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Kv7.1", "KCNA8", "KVLQT1", "JLNS1", "LQT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6294", "gene_name": "potassium voltage-gated channel subfamily Q member 1", "omim_gene": [ "607542" ], "alias_name": [ "Jervell and Lange-Nielsen syndrome 1" ], "gene_symbol": "KCNQ1", "hgnc_symbol": "KCNQ1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:2465914-2870339", "ensembl_id": "ENSG00000053918" } }, "GRch38": { "90": { "location": "11:2444684-2849109", "ensembl_id": "ENSG00000053918" } } }, "hgnc_date_symbol_changed": "1997-02-05" }, "entity_type": "gene", "entity_name": "KCNQ1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20301308" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Atrial fibrillation, familial, 3 607554", "Jervell and Lange-Nielsen syndrome 220400", "Long QT syndrome 1, 192500", "Short QT syndrome 2 609621" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "tags": [], "panel": { "id": 131, "hash_id": null, "name": "Long QT Syndrome", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It has been compared against the ClinGen Long QT working group and the Genomics England PanelApp Long QT panel gene-disease associations, with all differences reconciled, with thanks to Ivan Macciocca.", "status": "public", "version": "0.63", "version_created": "2026-02-06T09:22:25.758996+11:00", "relevant_disorders": [ "Prolonged QT interval", "HP:0001657" ], "stats": { "number_of_genes": 18, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:132", "gene_name": "actin beta", "omim_gene": [ "102630" ], "alias_name": null, "gene_symbol": "ACTB", "hgnc_symbol": "ACTB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:5566782-5603415", "ensembl_id": "ENSG00000075624" } }, "GRch38": { "90": { "location": "7:5527151-5563784", "ensembl_id": "ENSG00000075624" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "ACTB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 134, "hash_id": null, "name": "Kabuki syndrome", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.17", "version_created": "2025-11-13T11:58:53.337652+11:00", "relevant_disorders": [ "Kabuki syndrome", "MONDO:0016512" ], "stats": { "number_of_genes": 8, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Tieg3", "MODY7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11811", "gene_name": "Kruppel like factor 11", "omim_gene": [ "603301" ], "alias_name": null, "gene_symbol": "KLF11", "hgnc_symbol": "KLF11", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:10182976-10194963", "ensembl_id": "ENSG00000172059" } }, "GRch38": { "90": { "location": "2:10042849-10054836", "ensembl_id": "ENSG00000172059" } } }, "hgnc_date_symbol_changed": "2004-12-01" }, "entity_type": "gene", "entity_name": "KLF11", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15774581", "26248217", "23589285", "31124255", "35108381" ], "evidence": [ "Expert Review Red", "Royal Melbourne Hospital", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Maturity-onset diabetes of the young, type VII MIM#610508" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "refuted" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PMX2A", "CFEOM2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:691", "gene_name": "paired like homeobox 2a", "omim_gene": [ "602753" ], "alias_name": null, "gene_symbol": "PHOX2A", "hgnc_symbol": "PHOX2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:71950121-71956708", "ensembl_id": "ENSG00000165462" } }, "GRch38": { "90": { "location": "11:72239077-72245664", "ensembl_id": "ENSG00000165462" } } }, "hgnc_date_symbol_changed": "2003-02-14" }, "entity_type": "gene", "entity_name": "PHOX2A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11600883", "18323871", "16815872" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Fibrosis of extraocular muscles, congenital, 2 602078" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SCO1L" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10604", "gene_name": "SCO2, cytochrome c oxidase assembly protein", "omim_gene": [ "604272" ], "alias_name": null, "gene_symbol": "SCO2", "hgnc_symbol": "SCO2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:50961997-50964868", "ensembl_id": "ENSG00000130489" } }, "GRch38": { "90": { "location": "22:50523568-50525606", "ensembl_id": "ENSG00000130489" } } }, "hgnc_date_symbol_changed": "1999-10-12" }, "entity_type": "gene", "entity_name": "SCO2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31844624", "29351582", "26427993" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1", "Myopia 6", "Charcot-Marie-Tooth type 4", "Cerebellar ataxia and progressive peripheral axonal neuropthy" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NKCC2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10910", "gene_name": "solute carrier family 12 member 1", "omim_gene": [ "600839" ], "alias_name": null, "gene_symbol": "SLC12A1", "hgnc_symbol": "SLC12A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:48483861-48596275", "ensembl_id": "ENSG00000074803" } }, "GRch38": { "90": { "location": "15:48191664-48304078", "ensembl_id": "ENSG00000074803" } } }, "hgnc_date_symbol_changed": "1994-02-16" }, "entity_type": "gene", "entity_name": "SLC12A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8640224", "9355073", "28095294" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bartter syndrome, type 1, MIM# 601678" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11303", "gene_name": "signal recognition particle 72", "omim_gene": [ "602122" ], "alias_name": null, "gene_symbol": "SRP72", "hgnc_symbol": "SRP72", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:57333081-57369839", "ensembl_id": "ENSG00000174780" } }, "GRch38": { "90": { "location": "4:56466915-56503680", "ensembl_id": "ENSG00000174780" } } }, "hgnc_date_symbol_changed": "1991-12-05" }, "entity_type": "gene", "entity_name": "SRP72", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22541560", "31254415", "40922878", "37176611", "41472573", "40510848", "41142505" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bone marrow failure syndrome 1, MIM# 614675" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "disputed" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ13154", "HVSL1", "Mpn1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25792", "gene_name": "U6 snRNA biogenesis phosphodiesterase 1", "omim_gene": [ "613276" ], "alias_name": [ "HVSL motif containing 1", "poikiloderma with neutropenia", "U six biogenesis 1", "mutated in poikiloderma with neutropenia protein 1" ], "gene_symbol": "USB1", "hgnc_symbol": "USB1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:58033450-58055522", "ensembl_id": "ENSG00000103005" } }, "GRch38": { "90": { "location": "16:57999546-58021618", "ensembl_id": "ENSG00000103005" } } }, "hgnc_date_symbol_changed": "2012-08-21" }, "entity_type": "gene", "entity_name": "USB1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25044170", "27612988", "20004881", "20503306", "34004352", "33624217", "33111394", "32936385", "32620997", "31522452" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Poikiloderma with neutropaenia, MIM# 604173", "MONDO:0011405" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BOP", "CBT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1012", "gene_name": "opsin 1, short wave sensitive", "omim_gene": [ "613522" ], "alias_name": [ "color blindness, tritan", "blue-sensitive opsin" ], "gene_symbol": "OPN1SW", "hgnc_symbol": "OPN1SW", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:128412545-128415844", "ensembl_id": "ENSG00000128617" } }, "GRch38": { "90": { "location": "7:128772491-128775790", "ensembl_id": "ENSG00000128617" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "OPN1SW", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "1531728", "2937147", "22065927", "32400513", "31944634" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Colourblindness, tritan - MIM#190900" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CARMA1", "BIMP3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16393", "gene_name": "caspase recruitment domain family member 11", "omim_gene": [ "607210" ], "alias_name": [ "card-maguk protein 1", "bcl10-interacting maguk protein 3" ], "gene_symbol": "CARD11", "hgnc_symbol": "CARD11", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:2945775-3083579", "ensembl_id": "ENSG00000198286" } }, "GRch38": { "90": { "location": "7:2906141-3043945", "ensembl_id": "ENSG00000198286" } } }, "hgnc_date_symbol_changed": "2001-08-13" }, "entity_type": "gene", "entity_name": "CARD11", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23561803", "12818158", "23374270", "28628108" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Immunodeficiency 11A, autosomal recessive, MIM# 615206", "Immunodeficiency 11B with atopic dermatitis, autosomal dominant, MIM# 617638" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FER1L1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3097", "gene_name": "dysferlin", "omim_gene": [ "603009" ], "alias_name": [ "fer-1-like family member 1" ], "gene_symbol": "DYSF", "hgnc_symbol": "DYSF", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:71680852-71913898", "ensembl_id": "ENSG00000135636" } }, "GRch38": { "90": { "location": "2:71453722-71686768", "ensembl_id": "ENSG00000135636" } } }, "hgnc_date_symbol_changed": "1994-03-24" }, "entity_type": "gene", "entity_name": "DYSF", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27602406" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Miyoshi muscular dystrophy 1 254130", "Muscular dystrophy, limb-girdle, autosomal recessive 2 253601", "Myopathy, distal, with anterior tibial onset 606768" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FBX11", "UBR6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13590", "gene_name": "F-box protein 11", "omim_gene": [ "607871" ], "alias_name": [ "ubiquitin protein ligase E3 component n-recognin 6" ], "gene_symbol": "FBXO11", "hgnc_symbol": "FBXO11", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:48016455-48132932", "ensembl_id": "ENSG00000138081" } }, "GRch38": { "90": { "location": "2:47789316-47905793", "ensembl_id": "ENSG00000138081" } } }, "hgnc_date_symbol_changed": "2008-06-23" }, "entity_type": "gene", "entity_name": "FBXO11", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30679813", "30057029", "29796876" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Intellectual Developmental Disorder with Dysmorphic Facies and Behavioural Abnormalities, MIM#618089" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Hfz6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4044", "gene_name": "frizzled class receptor 6", "omim_gene": [ "603409" ], "alias_name": null, "gene_symbol": "FZD6", "hgnc_symbol": "FZD6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:104310661-104345094", "ensembl_id": "ENSG00000164930" } }, "GRch38": { "90": { "location": "8:103298433-103332866", "ensembl_id": "ENSG00000164930" } } }, "hgnc_date_symbol_changed": "1998-09-17" }, "entity_type": "gene", "entity_name": "FZD6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21665003", "23374899", "33082562", "26036949", "28425981" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Nail disorder, nonsyndromic congenital, 1, MIM# 161050", "Hydrops fetalis, MONDO:0015193, FZD6-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PAP-A", "PAPA", "PAPA1", "PAPB", "ACLS", "PPDIV" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4319", "gene_name": "GLI family zinc finger 3", "omim_gene": [ "165240" ], "alias_name": [ "zinc finger protein GLI3", "oncogene GLI3", "DNA-binding protein" ], "gene_symbol": "GLI3", "hgnc_symbol": "GLI3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:42000548-42277469", "ensembl_id": "ENSG00000106571" } }, "GRch38": { "90": { "location": "7:41960950-42237870", "ensembl_id": "ENSG00000106571" } } }, "hgnc_date_symbol_changed": "1989-05-29" }, "entity_type": "gene", "entity_name": "GLI3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32591344", "18000979", "24736735" ], "evidence": [ "Expert Review Green", "Expert Review Green", "Expert list", "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Polydactyly, postaxial, types A1 and B, MIM#174200", "Greig cephalopolysyndactyly syndrome MIM#175700", "Polydactyly, preaxial, type IV MIM#174700", "Pallister-Hall syndrome MIM#146510" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD42c", "GPIbbeta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4440", "gene_name": "glycoprotein Ib platelet beta subunit", "omim_gene": [ "138720" ], "alias_name": [ "platelet glycoprotein Ib beta chain" ], "gene_symbol": "GP1BB", "hgnc_symbol": "GP1BB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:19710468-19712294", "ensembl_id": "ENSG00000203618" } }, "GRch38": { "90": { "location": "22:19722945-19724771", "ensembl_id": "ENSG00000203618" } } }, "hgnc_date_symbol_changed": "1991-11-21" }, "entity_type": "gene", "entity_name": "GP1BB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "8703016", "9116284", "10887115", "33813986", "33657022", "33216977", "31997307", "1730088", "11222377" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bernard-Soulier syndrome, type B, MIM# 231200", "Macrothrombocytopaenia" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC50831" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28741", "gene_name": "immunoglobulin like domain containing receptor 1", "omim_gene": [ "609739" ], "alias_name": null, "gene_symbol": "ILDR1", "hgnc_symbol": "ILDR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:121706170-121741051", "ensembl_id": "ENSG00000145103" } }, "GRch38": { "90": { "location": "3:121987323-122022204", "ensembl_id": "ENSG00000145103" } } }, "hgnc_date_symbol_changed": "2004-07-27" }, "entity_type": "gene", "entity_name": "ILDR1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21255762", "23226338", "22903915", "27344577", "21255762", "23239027", "25822906", "25819842", "24990150" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Deafness, autosomal recessive 42, MIM# 609646" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RLF", "MGC119818", "MGC119819" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6086", "gene_name": "insulin like 3", "omim_gene": [ "146738" ], "alias_name": [ "prepro-INSL3" ], "gene_symbol": "INSL3", "hgnc_symbol": "INSL3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:17927321-17932383", "ensembl_id": "ENSG00000248099" } }, "GRch38": { "90": { "location": "19:17816512-17821574", "ensembl_id": "ENSG00000248099" } } }, "hgnc_date_symbol_changed": "1993-11-02" }, "entity_type": "gene", "entity_name": "INSL3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12601553", "12970298", "11095425", "41369823", "37208861", "33095795" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cryptorchidism, MIM# 219050", "Infertility disorder MONDO:0005047, INSL3-related" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NKX2.2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7835", "gene_name": "NK2 homeobox 2", "omim_gene": [ "604612" ], "alias_name": null, "gene_symbol": "NKX2-2", "hgnc_symbol": "NKX2-2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:21491648-21494664", "ensembl_id": "ENSG00000125820" } }, "GRch38": { "90": { "location": "20:21511010-21514026", "ensembl_id": "ENSG00000125820" } } }, "hgnc_date_symbol_changed": "2002-10-04" }, "entity_type": "gene", "entity_name": "NKX2-2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "24411943", "9584121" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Syndromic neonatal diabetes, with severe developmental delay, hypotonia, cortical blindness, hearing impairment" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ND5", "NAD5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7461", "gene_name": "mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 5", "omim_gene": [ "516005" ], "alias_name": [ "complex I ND5 subunit", "NADH-ubiquinone oxidoreductase chain 5" ], "gene_symbol": "MT-ND5", "hgnc_symbol": "MT-ND5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "MT:12337-14148", "ensembl_id": "ENSG00000198786" } }, "GRch38": { "90": { "location": "MT:12337-14148", "ensembl_id": "ENSG00000198786" } } }, "hgnc_date_symbol_changed": "2005-02-16" }, "entity_type": "gene", "entity_name": "MT-ND5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "17400793", "11938446", "12624137", "18495510", "23918514", "17535832", "29506874", "23034978", "16816025", "9299505", "18977334" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Mitochondrial disease (MONDO:0044970), MT-ND5-related" ], "mode_of_inheritance": "MITOCHONDRIAL", "tags": [ "mtDNA" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "A2lp", "A2D" ], "biotype": "protein_coding", "hgnc_id": "HGNC:31326", "gene_name": "ataxin 2 like", "omim_gene": [ "607931" ], "alias_name": null, "gene_symbol": "ATXN2L", "hgnc_symbol": "ATXN2L", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:28834356-28848558", "ensembl_id": "ENSG00000168488" } }, "GRch38": { "90": { "location": "16:28823035-28837237", "ensembl_id": "ENSG00000168488" } } }, "hgnc_date_symbol_changed": "2004-08-18" }, "entity_type": "gene", "entity_name": "ATXN2L", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33283965", "33057194" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, ATXN2L-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CH1", "SLP1", "OPT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1240", "gene_name": "SUN domain containing ossification factor", "omim_gene": null, "alias_name": [ "SUN-like protein 1", "osteopotentia" ], "gene_symbol": "SUCO", "hgnc_symbol": "SUCO", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:172501489-172580971", "ensembl_id": "ENSG00000094975" } }, "GRch38": { "90": { "location": "1:172532349-172611833", "ensembl_id": "ENSG00000094975" } } }, "hgnc_date_symbol_changed": "2012-07-10" }, "entity_type": "gene", "entity_name": "SUCO", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29620724", "20440000", "41282771" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Syndromic disease (MONDO:0002254), SUCO-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CANP", "CANPS", "30K", "CDPS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1481", "gene_name": "calpain small subunit 1", "omim_gene": [ "114170" ], "alias_name": null, "gene_symbol": "CAPNS1", "hgnc_symbol": "CAPNS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:36630477-36641255", "ensembl_id": "ENSG00000126247" } }, "GRch38": { "90": { "location": "19:36139575-36150353", "ensembl_id": "ENSG00000126247" } } }, "hgnc_date_symbol_changed": "2001-08-10" }, "entity_type": "gene", "entity_name": "CAPNS1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "38230350" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Hereditary pulmonary arterial hypertension MONDO:0017148, CAPNS1-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA1799", "RP4-534K7.1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29379", "gene_name": "EF-hand calcium binding domain 7", "omim_gene": [ "617632" ], "alias_name": null, "gene_symbol": "EFCAB7", "hgnc_symbol": "EFCAB7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:63989043-64038364", "ensembl_id": "ENSG00000203965" } }, "GRch38": { "90": { "location": "1:63523372-63572693", "ensembl_id": "ENSG00000203965" } } }, "hgnc_date_symbol_changed": "2007-12-06" }, "entity_type": "gene", "entity_name": "EFCAB7", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 37684519" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Polydactyly (MONDO:0021003), EFCAB7-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11219", "gene_name": "secreted protein acidic and cysteine rich", "omim_gene": [ "182120" ], "alias_name": [ "cysteine-rich protein", "secreted protein acidic and rich in cysteine" ], "gene_symbol": "SPARC", "hgnc_symbol": "SPARC", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:151040657-151066726", "ensembl_id": "ENSG00000113140" } }, "GRch38": { "90": { "location": "5:151661096-151687165", "ensembl_id": "ENSG00000113140" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "SPARC", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26027498", "34462290" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Osteogenesis imperfecta, type XVII, MIM# 616507" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 147, "hash_id": null, "name": "Osteogenesis Imperfecta and Osteoporosis", "disease_group": "Skeletal disorders; Endocrine disorders", "disease_sub_group": "", "description": "This panel contains genes associated with osteogenesis imperfecta and osteoporosis. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Osteogenesis imperfecta' panel V5.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.18", "version_created": "2026-02-22T14:59:29.563350+11:00", "relevant_disorders": [ "Increased susceptibility to fractures", "HP:0002659" ], "stats": { "number_of_genes": 48, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CX31" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4285", "gene_name": "gap junction protein beta 3", "omim_gene": [ "603324" ], "alias_name": [ "connexin 31" ], "gene_symbol": "GJB3", "hgnc_symbol": "GJB3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:35246790-35251970", "ensembl_id": "ENSG00000188910" } }, "GRch38": { "90": { "location": "1:34781189-34786369", "ensembl_id": "ENSG00000188910" } } }, "hgnc_date_symbol_changed": "1991-07-12" }, "entity_type": "gene", "entity_name": "GJB3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9843209", "10798362", "10594760", "17446259" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Erythrokeratodermia variabilis et progressiva 1, OMIM #133200" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 153, "hash_id": null, "name": "Palmoplantar Keratoderma and Erythrokeratoderma", "disease_group": "Dermatological disorders", "disease_sub_group": "", "description": "This panel was developed by VCGS.\r\n\r\nIt has been compared against the Genomics England PanelApp Palmoplantar Keratoderma panel, and all discrepancies have been reviewed and resolved by VCGS and GHQ.", "status": "public", "version": "0.144", "version_created": "2026-03-08T22:20:02.332483+11:00", "relevant_disorders": [ "Palmoplantar keratoderma", "HP:0000982; Erythrokeratoderma", "MONDO:0019270" ], "stats": { "number_of_genes": 73, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2296", "gene_name": "carboxypeptidase A1", "omim_gene": [ "114850" ], "alias_name": [ "pancreatic carboxypeptidase A" ], "gene_symbol": "CPA1", "hgnc_symbol": "CPA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:130020180-130027955", "ensembl_id": "ENSG00000091704" } }, "GRch38": { "90": { "location": "7:130380339-130388114", "ensembl_id": "ENSG00000091704" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "CPA1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23955596", "28497564", "28258133", "31005883" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hereditary pancreatitis, MONDO:0008185, CPA1-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 154, "hash_id": null, "name": "Pancreatitis", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with hereditary pancreatitis. The aetiology of recurrent acute and chronic pancreatitis is often multifactorial, and common variants in several genes have been implicated in susceptibility.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Pancreatitis' panel, with all differences resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.6", "version_created": "2024-08-08T07:17:52.187056+10:00", "relevant_disorders": [ "Pancreatitis", "HP:0001733" ], "stats": { "number_of_genes": 9, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0985", "rabphilin", "exophilin-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17056", "gene_name": "rabphilin 3A", "omim_gene": [ "612159" ], "alias_name": null, "gene_symbol": "RPH3A", "hgnc_symbol": "RPH3A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:113008184-113336686", "ensembl_id": "ENSG00000089169" } }, "GRch38": { "90": { "location": "12:112570380-112898881", "ensembl_id": "ENSG00000089169" } } }, "hgnc_date_symbol_changed": "2003-12-10" }, "entity_type": "gene", "entity_name": "RPH3A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "37403762", "29441694" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder (MONDO#0700092), RPH3A-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Hb2E" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14944", "gene_name": "protein phosphatase 1 regulatory subunit 3F", "omim_gene": null, "alias_name": null, "gene_symbol": "PPP1R3F", "hgnc_symbol": "PPP1R3F", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:49126306-49157929", "ensembl_id": "ENSG00000049769" } }, "GRch38": { "90": { "location": "X:49269843-49301461", "ensembl_id": "ENSG00000049769" } } }, "hgnc_date_symbol_changed": "2001-06-29" }, "entity_type": "gene", "entity_name": "PPP1R3F", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "37531237" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CGI-92" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19693", "gene_name": "coenzyme Q4", "omim_gene": [ "612898" ], "alias_name": null, "gene_symbol": "COQ4", "hgnc_symbol": "COQ4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:131084815-131096351", "ensembl_id": "ENSG00000167113" } }, "GRch38": { "90": { "location": "9:128322536-128334072", "ensembl_id": "ENSG00000167113" } } }, "hgnc_date_symbol_changed": "2003-01-10" }, "entity_type": "gene", "entity_name": "COQ4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25658047", "26185144", "33704555" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Coenzyme Q10 deficiency, primary, 7, MIM# 616276" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HsT19268" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7437", "gene_name": "methenyltetrahydrofolate synthetase", "omim_gene": [ "604197" ], "alias_name": [ "5,10-methenyltetrahydrofolate synthetase", "5-formyltetrahydrofolate cyclo-ligase" ], "gene_symbol": "MTHFS", "hgnc_symbol": "MTHFS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:80125927-80189721", "ensembl_id": "ENSG00000136371" } }, "GRch38": { "90": { "location": "15:79833585-79897379", "ensembl_id": "ENSG00000136371" } } }, "hgnc_date_symbol_changed": "1999-07-09" }, "entity_type": "gene", "entity_name": "MTHFS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30031689", "31844630", "22303332" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with microcephaly, epilepsy, and hypomyelination, 618367" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "EIF2Bgamma", "EIF-2B" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3259", "gene_name": "eukaryotic translation initiation factor 2B subunit gamma", "omim_gene": [ "606273" ], "alias_name": null, "gene_symbol": "EIF2B3", "hgnc_symbol": "EIF2B3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:45316450-45452282", "ensembl_id": "ENSG00000070785" } }, "GRch38": { "90": { "location": "1:44850522-44986722", "ensembl_id": "ENSG00000070785" } } }, "hgnc_date_symbol_changed": "1998-10-16" }, "entity_type": "gene", "entity_name": "EIF2B3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11835386", "19158808", "21484434", "18263758", "25843247", "25761052", "28904586", "28597716" ], "evidence": [ "Expert Review Green", "Expert list", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship" ], "phenotypes": [ "leukoencephalopathy with vanishing white matter MONDO:0011380" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CI-75k" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7707", "gene_name": "NADH:ubiquinone oxidoreductase core subunit S1", "omim_gene": [ "157655" ], "alias_name": [ "complex I 75kDa subunit", "NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial" ], "gene_symbol": "NDUFS1", "hgnc_symbol": "NDUFS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:206979541-207024327", "ensembl_id": "ENSG00000023228" } }, "GRch38": { "90": { "location": "2:206114817-206159603", "ensembl_id": "ENSG00000023228" } } }, "hgnc_date_symbol_changed": "1992-04-03" }, "entity_type": "gene", "entity_name": "NDUFS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "33751534", "24952175", "20382551", "21203893", "20797884", "15824269", "25615419", "11349233", "22399432" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Mitochondrial Flagship" ], "phenotypes": [ "Mitochondrial complex I deficiency, nuclear type 5 - MIM#618226" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 437, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DXS1283E", "GS2", "iPLA2eta" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24887", "gene_name": "patatin like phospholipase domain containing 4", "omim_gene": [ "300102" ], "alias_name": null, "gene_symbol": "PNPLA4", "hgnc_symbol": "PNPLA4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:7866288-7895780", "ensembl_id": "ENSG00000006757" } }, "GRch38": { "90": { "location": "X:7898247-7927739", "ensembl_id": "ENSG00000006757" } } }, "hgnc_date_symbol_changed": "2004-09-06" }, "entity_type": "gene", "entity_name": "PNPLA4", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26741492" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Mitochondrial Flagship" ], "phenotypes": [ "Mitochondrial disease (MONDO:0044970), PNPLA4-related" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 437, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20452" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26027", "gene_name": "COMM domain containing 4", "omim_gene": [ "616701" ], "alias_name": null, "gene_symbol": "COMMD4", "hgnc_symbol": "COMMD4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:75628232-75634268", "ensembl_id": "ENSG00000140365" } }, "GRch38": { "90": { "location": "15:75335891-75343224", "ensembl_id": "ENSG00000140365" } } }, "hgnc_date_symbol_changed": "2004-02-13" }, "entity_type": "gene", "entity_name": "COMMD4", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40601774" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Ritscher-Schinzel syndrome, MONDO:0019078, COMMD4-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BUBR1", "MAD3L", "Bub1A", "SSK1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1149", "gene_name": "BUB1 mitotic checkpoint serine/threonine kinase B", "omim_gene": [ "602860" ], "alias_name": null, "gene_symbol": "BUB1B", "hgnc_symbol": "BUB1B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:40453224-40513337", "ensembl_id": "ENSG00000156970" } }, "GRch38": { "90": { "location": "15:40161023-40221136", "ensembl_id": "ENSG00000156970" } } }, "hgnc_date_symbol_changed": "1998-03-25" }, "entity_type": "gene", "entity_name": "BUB1B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DYT8", "PDC", "DKFZp564N1362", "FPD1", "MR-1", "BRP17", "FKSG19", "TAHCCP2", "KIAA1184", "KIPP1184", "MGC31943", "PKND1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9153", "gene_name": "paroxysmal nonkinesigenic dyskinesia", "omim_gene": [ "609023" ], "alias_name": [ "myofibrillogenesis regulator 1" ], "gene_symbol": "PNKD", "hgnc_symbol": "PNKD", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:219135115-219211516", "ensembl_id": "ENSG00000127838" } }, "GRch38": { "90": { "location": "2:218270392-218346793", "ensembl_id": "ENSG00000127838" } } }, "hgnc_date_symbol_changed": "1996-09-13" }, "entity_type": "gene", "entity_name": "PNKD", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15262732", "15496428", "15824259", "19124534", "21487022" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800", "MONDO:0007326" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 206, "hash_id": null, "name": "Regression", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.610", "version_created": "2026-03-31T18:57:58.699788+11:00", "relevant_disorders": [ "Developmental regression", "HP:0002376" ], "stats": { "number_of_genes": 442, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SCF", "SF", "Kitl", "KL-1", "FPH2", "SLF", "DFNA69" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6343", "gene_name": "KIT ligand", "omim_gene": [ "184745" ], "alias_name": [ "mast cell growth factor", "stem cell factor", "steel factor", "familial progressive hyperpigmentation 2" ], "gene_symbol": "KITLG", "hgnc_symbol": "KITLG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:88886570-88974628", "ensembl_id": "ENSG00000049130" } }, "GRch38": { "90": { "location": "12:88492793-88580851", "ensembl_id": "ENSG00000049130" } } }, "hgnc_date_symbol_changed": "1991-06-04" }, "entity_type": "gene", "entity_name": "KITLG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26522471" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Waardenburg syndrome, MONDO:0018094, KITLG-related", "Deafness, autosomal dominant 69, unilateral or asymmetric, MIM#\t616697" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 209, "hash_id": null, "name": "Deafness_IsolatedAndComplex", "disease_group": "Hearing and ear disorders", "disease_sub_group": "", "description": "This panel contains genes associated with:\r\n1) Isolated deafness\r\n2) Syndromic deafness \r\n3) Auditory neuropathy spectrum \r\n\r\nAuditory neuropathy spectrum presents with absent or markedly abnormal auditory nerve function measures, such as auditory brainstem response (ABR), and normal measures of sensory hair cell function, such as otoacoustic emissions and cochlear microphonics. \r\n\r\nThis panel was originally designed for the Melbourne Genomics Congenital Deafness Flagship. With special thanks to Rachel Burt and Lilian Downie. The panel incorporates the ClinGen Hearing Loss gene-validity assessments with thanks to Lilian Downie, and the Royal Melbourne Hospital Hearing Loss panel with thanks to Bryony Thompson. \r\n\r\nIt has been compared with the Genomics England PanelApp 'Monogenic hearing loss' V5.47, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.359", "version_created": "2026-04-03T14:38:51.840380+11:00", "relevant_disorders": [ "Hearing impairment", "HP:0000365" ], "stats": { "number_of_genes": 348, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "LCA2", "rd12", "BCO3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10294", "gene_name": "RPE65, retinoid isomerohydrolase", "omim_gene": [ "180069" ], "alias_name": [ "BCO family, member 3", "retinol isomerase", "all-trans-retinyl-palmitate hydrolase" ], "gene_symbol": "RPE65", "hgnc_symbol": "RPE65", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:68894505-68915642", "ensembl_id": "ENSG00000116745" } }, "GRch38": { "90": { "location": "1:68428822-68449959", "ensembl_id": "ENSG00000116745" } } }, "hgnc_date_symbol_changed": "1993-10-04" }, "entity_type": "gene", "entity_name": "RPE65", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34012068" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "RPE-related retinopathy" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 221, "hash_id": null, "name": "Additional findings_Adult", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Additional findings flagship.\r\n\r\nThe framework used considered clinical actionability and public screening principles, for full publication see Martyn M et al 2019, PMID: 30776170. The genes included are associated with conditions that are adult-onset, clinically-actionable, have a known management pathway which is publicly funded in Victoria, and have a population frequency of gene variants greater than 1/100,000.\r\n\r\nThis has been updated with the 2023 ACMG V3.2 Secondary Findings list, PMID: 37347242.\r\n\r\nV1.0 was used for the Australian Genomics Acute Care additional findings study.\r\n\r\nThe panel has been updated with ClinGen Adult Actionability assertions.", "status": "public", "version": "2.0", "version_created": "2026-03-16T10:56:03.168206+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 136, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11943", "gene_name": "troponin C1, slow skeletal and cardiac type", "omim_gene": [ "191040" ], "alias_name": null, "gene_symbol": "TNNC1", "hgnc_symbol": "TNNC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:52485118-52488086", "ensembl_id": "ENSG00000114854" } }, "GRch38": { "90": { "location": "3:52451102-52454070", "ensembl_id": "ENSG00000114854" } } }, "hgnc_date_symbol_changed": "1989-12-11" }, "entity_type": "gene", "entity_name": "TNNC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35802134" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Cardiomyopathy, dilated, 1Z, MIM# 611879" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 221, "hash_id": null, "name": "Additional findings_Adult", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Additional findings flagship.\r\n\r\nThe framework used considered clinical actionability and public screening principles, for full publication see Martyn M et al 2019, PMID: 30776170. The genes included are associated with conditions that are adult-onset, clinically-actionable, have a known management pathway which is publicly funded in Victoria, and have a population frequency of gene variants greater than 1/100,000.\r\n\r\nThis has been updated with the 2023 ACMG V3.2 Secondary Findings list, PMID: 37347242.\r\n\r\nV1.0 was used for the Australian Genomics Acute Care additional findings study.\r\n\r\nThe panel has been updated with ClinGen Adult Actionability assertions.", "status": "public", "version": "2.0", "version_created": "2026-03-16T10:56:03.168206+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 136, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FAD", "FAD1", "BRCC2", "XRCC11" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1101", "gene_name": "BRCA2, DNA repair associated", "omim_gene": [ "600185" ], "alias_name": [ "BRCA1/BRCA2-containing complex, subunit 2" ], "gene_symbol": "BRCA2", "hgnc_symbol": "BRCA2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:32889611-32973805", "ensembl_id": "ENSG00000139618" } }, "GRch38": { "90": { "location": "13:32315474-32400266", "ensembl_id": "ENSG00000139618" } } }, "hgnc_date_symbol_changed": "1994-10-17" }, "entity_type": "gene", "entity_name": "BRCA2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance" ], "phenotypes": [ "Breast-ovarian cancer, familial, 2, MIM#612555", "Fanconi anaemia, complementation group D1, MIM# 605724" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 221, "hash_id": null, "name": "Additional findings_Adult", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Additional findings flagship.\r\n\r\nThe framework used considered clinical actionability and public screening principles, for full publication see Martyn M et al 2019, PMID: 30776170. The genes included are associated with conditions that are adult-onset, clinically-actionable, have a known management pathway which is publicly funded in Victoria, and have a population frequency of gene variants greater than 1/100,000.\r\n\r\nThis has been updated with the 2023 ACMG V3.2 Secondary Findings list, PMID: 37347242.\r\n\r\nV1.0 was used for the Australian Genomics Acute Care additional findings study.\r\n\r\nThe panel has been updated with ClinGen Adult Actionability assertions.", "status": "public", "version": "2.0", "version_created": "2026-03-16T10:56:03.168206+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 136, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CR", "TC", "CROM" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2665", "gene_name": "CD55 molecule (Cromer blood group)", "omim_gene": [ "125240" ], "alias_name": null, "gene_symbol": "CD55", "hgnc_symbol": "CD55", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:207494853-207534311", "ensembl_id": "ENSG00000196352" } }, "GRch38": { "90": { "location": "1:207321508-207386804", "ensembl_id": "ENSG00000196352" } } }, "hgnc_date_symbol_changed": "2006-02-23" }, "entity_type": "gene", "entity_name": "CD55", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "28657829", "28657861" ], "evidence": [ "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Complement hyperactivation, angiopathic thrombosis, and protein-losing enteropathy, MIM#\t226300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 224, "hash_id": null, "name": "Complement Deficiencies", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains all the genes that are associated with complement deficiencies.\r\n\r\nIt has been updated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.\r\nThis panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital).", "status": "public", "version": "1.2", "version_created": "2025-10-30T13:50:05.331358+11:00", "relevant_disorders": [ "Abnormality of complement system", "HP:0005339" ], "stats": { "number_of_genes": 34, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "IFI-78K", "MxA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7532", "gene_name": "MX dynamin like GTPase 1", "omim_gene": [ "147150" ], "alias_name": [ "interferon-inducible protein p78" ], "gene_symbol": "MX1", "hgnc_symbol": "MX1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:42792231-42831141", "ensembl_id": "ENSG00000157601" } }, "GRch38": { "90": { "location": "21:41420304-41459214", "ensembl_id": "ENSG00000157601" } } }, "hgnc_date_symbol_changed": "1988-05-11" }, "entity_type": "gene", "entity_name": "MX1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert list", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [ "umccr" ], "panel": { "id": 243, "hash_id": null, "name": "Immune_markers_WTS_UMCCR", "disease_group": "Cancer", "disease_sub_group": "", "description": "Author: Jacek Marzec, jacek.marzec@unimelb.edu.au\r\n\r\nPurpose: panel of immune markers used to assess pre-existing anti-cancer immunity and likelihood of response to immunotherapy. This set of genes is used in UMCCR WTS report \"Immune markers\" section\r\n\r\nSource: https://www.omniseq.com\r\n\r\nGithub: https://github.com/umccr/RNAsum", "status": "public", "version": "0.77", "version_created": "2025-11-03T15:30:48.145923+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 71, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PDC-E2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2896", "gene_name": "dihydrolipoamide S-acetyltransferase", "omim_gene": [ "608770" ], "alias_name": [ "E2 component of pyruvate dehydrogenase complex" ], "gene_symbol": "DLAT", "hgnc_symbol": "DLAT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:111895538-111935114", "ensembl_id": "ENSG00000150768" } }, "GRch38": { "90": { "location": "11:112024814-112064390", "ensembl_id": "ENSG00000150768" } } }, "hgnc_date_symbol_changed": "1989-06-30" }, "entity_type": "gene", "entity_name": "DLAT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "39007626", "29093066", "16049940" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Pyruvate dehydrogenase E2 deficiency, MIM#245348" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "dJ40E16.7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12412", "gene_name": "tubulin beta 2A class IIa", "omim_gene": [ "615101" ], "alias_name": [ "class IIa beta-tubulin" ], "gene_symbol": "TUBB2A", "hgnc_symbol": "TUBB2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:3153903-3157760", "ensembl_id": "ENSG00000137267" } }, "GRch38": { "90": { "location": "6:3153669-3157526", "ensembl_id": "ENSG00000137267" } } }, "hgnc_date_symbol_changed": "2005-11-03" }, "entity_type": "gene", "entity_name": "TUBB2A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32571897" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Cortical dysplasia, complex, with other brain malformations 5, MIM# 615763" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Cav2.3", "BII", "CACH6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1392", "gene_name": "calcium voltage-gated channel subunit alpha1 E", "omim_gene": [ "601013" ], "alias_name": null, "gene_symbol": "CACNA1E", "hgnc_symbol": "CACNA1E", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:181382238-181777219", "ensembl_id": "ENSG00000198216" } }, "GRch38": { "90": { "location": "1:181413102-181808084", "ensembl_id": "ENSG00000198216" } } }, "hgnc_date_symbol_changed": "1994-12-20" }, "entity_type": "gene", "entity_name": "CACNA1E", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30343943" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Epileptic encephalopathy, early infantile, 69, MIM#618285" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0985", "rabphilin", "exophilin-1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17056", "gene_name": "rabphilin 3A", "omim_gene": [ "612159" ], "alias_name": null, "gene_symbol": "RPH3A", "hgnc_symbol": "RPH3A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:113008184-113336686", "ensembl_id": "ENSG00000089169" } }, "GRch38": { "90": { "location": "12:112570380-112898881", "ensembl_id": "ENSG00000089169" } } }, "hgnc_date_symbol_changed": "2003-12-10" }, "entity_type": "gene", "entity_name": "RPH3A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "37403762", "29441694" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder (MONDO#0700092), RPH3A-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FPP", "PFM", "KIAA1788" ], "biotype": "protein_coding", "hgnc_id": "HGNC:450", "gene_name": "ALX homeobox 4", "omim_gene": [ "605420" ], "alias_name": null, "gene_symbol": "ALX4", "hgnc_symbol": "ALX4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:44281994-44331716", "ensembl_id": "ENSG00000052850" } }, "GRch38": { "90": { "location": "11:44260444-44310166", "ensembl_id": "ENSG00000052850" } } }, "hgnc_date_symbol_changed": "2000-06-15" }, "entity_type": "gene", "entity_name": "ALX4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "NHS GMS" ], "phenotypes": [ "Frontonasal dysplasia 2 613451" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "S1P", "KIAA0091", "SKI-1", "PCSK8" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15456", "gene_name": "membrane bound transcription factor peptidase, site 1", "omim_gene": [ "603355" ], "alias_name": [ "subtilisin kexin isozyme 1", "site-1 protease" ], "gene_symbol": "MBTPS1", "hgnc_symbol": "MBTPS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:84087368-84150511", "ensembl_id": "ENSG00000140943" } }, "GRch38": { "90": { "location": "16:84053761-84116906", "ensembl_id": "ENSG00000140943" } } }, "hgnc_date_symbol_changed": "2001-03-30" }, "entity_type": "gene", "entity_name": "MBTPS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32857899", "32420688", "30046013" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Skeletal dysplasia" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DYT18", "DYT9" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11005", "gene_name": "solute carrier family 2 member 1", "omim_gene": [ "138140" ], "alias_name": null, "gene_symbol": "SLC2A1", "hgnc_symbol": "SLC2A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:43391052-43424530", "ensembl_id": "ENSG00000117394" } }, "GRch38": { "90": { "location": "1:42925375-42959173", "ensembl_id": "ENSG00000117394" } } }, "hgnc_date_symbol_changed": "1994-11-18" }, "entity_type": "gene", "entity_name": "SLC2A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18451999", "34279792", "18577546", "34305802", "27098784" ], "evidence": [ "Expert Review Green", "Royal Children's Hospital Neurology Department", "Victorian Clinical Genetics Services" ], "phenotypes": [ "GLUT1 deficiency syndrome MONDO:0000188" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 259, "hash_id": null, "name": "Paroxysmal Dyskinesia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "With special thanks to Drs Katherine Howell and Eunice Chan, paediatric neurologists at RCH for compiling this panel. This panel contains genes associated with recurrent sudden attacks of dyskinesia without impairment of consciousness. It also contains genes associated with hyperekplexia and myokymia.\r\n\r\nPlease consider overlap with other paroxysmal CNS disorders covered by the Episodic Ataxia and Alternating Hemiplegia_Hemiplegic Migraine panels. If features of a more complex movement disorder are present, consider the Dystonia_Superpanel and the Ataxia_Superpanel.", "status": "public", "version": "0.145", "version_created": "2026-01-09T20:58:50.808183+11:00", "relevant_disorders": [ "Paroxysmal dyskinesia", "HP:0007166" ], "stats": { "number_of_genes": 54, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ13096" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25784", "gene_name": "DDB1 and CUL4 associated factor 17", "omim_gene": [ "612515" ], "alias_name": [ "Woodhouse-Sakati syndrome" ], "gene_symbol": "DCAF17", "hgnc_symbol": "DCAF17", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:172290727-172341562", "ensembl_id": "ENSG00000115827" } }, "GRch38": { "90": { "location": "2:171434217-171485052", "ensembl_id": "ENSG00000115827" } } }, "hgnc_date_symbol_changed": "2009-07-17" }, "entity_type": "gene", "entity_name": "DCAF17", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "19026396", "20507343" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Woodhouse-Sakati syndrome, MIM#\t241080" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.393", "version_created": "2026-03-26T22:06:36.010882+11:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "PMP35", "PAF-1", "RNF72", "ZWS3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9717", "gene_name": "peroxisomal biogenesis factor 2", "omim_gene": [ "170993" ], "alias_name": [ "Zellweger syndrome", "peroxin 2" ], "gene_symbol": "PEX2", "hgnc_symbol": "PEX2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:77892494-77913280", "ensembl_id": "ENSG00000164751" } }, "GRch38": { "90": { "location": "8:76980258-77001044", "ensembl_id": "ENSG00000164751" } } }, "hgnc_date_symbol_changed": "2010-01-25" }, "entity_type": "gene", "entity_name": "PEX2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Royal Melbourne Hospital", "Expert Review Green" ], "phenotypes": [ "Peroxisome biogenesis disorder 5B, 614867", "Peroxisome biogenesis disorder 5A (Zellweger) 614866" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.393", "version_created": "2026-03-26T22:06:36.010882+11:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CED12", "ELMO-2", "CED-12", "KIAA1834", "FLJ11656" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17233", "gene_name": "engulfment and cell motility 2", "omim_gene": [ "606421" ], "alias_name": null, "gene_symbol": "ELMO2", "hgnc_symbol": "ELMO2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:44994688-45061704", "ensembl_id": "ENSG00000062598" } }, "GRch38": { "90": { "location": "20:46366049-46432985", "ensembl_id": "ENSG00000062598" } } }, "hgnc_date_symbol_changed": "2001-12-13" }, "entity_type": "gene", "entity_name": "ELMO2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27476657" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Royal Melbourne Hospital" ], "phenotypes": [ "Vascular malformation, primary intraosseous, MIM#606893" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 300, "hash_id": null, "name": "Vascular Malformations_Germline", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel contains genes that cause Mendelian vascular malformation disorders, particularly those presenting with skin lesions. Genes causing sporadic and congenital vascular malformations through somatic activating mutations are rated Red and labelled 'somatic'. This gene panel is maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nIf a sample of affected tissue is being tested, please use the Vascular Malformations_Somatic panel.", "status": "public", "version": "1.13", "version_created": "2026-01-24T18:03:26.952041+11:00", "relevant_disorders": [ "Abnormal vascular morphology HP:0025015" ], "stats": { "number_of_genes": 42, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RP30", "RFSN" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3960", "gene_name": "fascin actin-bundling protein 2, retinal", "omim_gene": [ "607643" ], "alias_name": null, "gene_symbol": "FSCN2", "hgnc_symbol": "FSCN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:79495422-79504156", "ensembl_id": "ENSG00000186765" } }, "GRch38": { "90": { "location": "17:81528396-81537130", "ensembl_id": "ENSG00000186765" } } }, "hgnc_date_symbol_changed": "2000-02-29" }, "entity_type": "gene", "entity_name": "FSCN2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11527955", "16043865", "16280978", "17251446", "18450588" ], "evidence": [ "Expert Review Red", "Royal Melbourne Hospital" ], "phenotypes": [ "Retinitis pigmentosa 30 MIM#607921", "Macular degeneration" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 303, "hash_id": null, "name": "Macular Dystrophy/Stargardt Disease", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause macular dystrophy and Stargardt disease. It is maintained by the Royal Melbourne Hospital for use in the ocular genetics clinic. It is a consensus panel used by VCGS.\r\n\r\nConsider using the broader Retinal Disorders superpanel when ophthalmological findings are not specific for this sub-group of disorders, particularly in individuals early in the diagnostic trajectory or where additional features are present.", "status": "public", "version": "0.60", "version_created": "2026-03-31T16:05:02.510211+11:00", "relevant_disorders": [ "Macular dystrophy", "HP:0007754" ], "stats": { "number_of_genes": 39, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4115", "gene_name": "galactosylceramidase", "omim_gene": [ "606890" ], "alias_name": [ "Krabbe disease" ], "gene_symbol": "GALC", "hgnc_symbol": "GALC", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:88304164-88460009", "ensembl_id": "ENSG00000054983" } }, "GRch38": { "90": { "location": "14:87837820-87993665", "ensembl_id": "ENSG00000054983" } } }, "hgnc_date_symbol_changed": "1989-06-02" }, "entity_type": "gene", "entity_name": "GALC", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "9272171", "11971051", "22959700", "26396125", "26915362", "28547031", "31185936", "32064984" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Krabbe disease MIM#245200" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MU-ARP2", "MU-4", "SPG50" ], "biotype": "protein_coding", "hgnc_id": "HGNC:574", "gene_name": "adaptor related protein complex 4 mu 1 subunit", "omim_gene": [ "602296" ], "alias_name": [ "mu-adaptin-related protein-2", "mu subunit of AP-4", "AP-4 adapter complex mu subunit", "adaptor-related protein complex AP-4 mu4 subunit" ], "gene_symbol": "AP4M1", "hgnc_symbol": "AP4M1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:99699172-99707968", "ensembl_id": "ENSG00000221838" } }, "GRch38": { "90": { "location": "7:100101549-100110345", "ensembl_id": "ENSG00000221838" } } }, "hgnc_date_symbol_changed": "2000-09-01" }, "entity_type": "gene", "entity_name": "AP4M1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19559397", "21937992", "21937992", "32979048", "31915823", "29096665", "28464862", "25496299" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Spastic paraplegia 50, autosomal recessive, 612936" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "hRrp40p", "Rrp40p", "RRP40", "CGI-102", "p10", "hRrp-40" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17944", "gene_name": "exosome component 3", "omim_gene": [ "606489" ], "alias_name": [ "exosome component Rrp40", "CGI-102 protein" ], "gene_symbol": "EXOSC3", "hgnc_symbol": "EXOSC3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:37766975-37801434", "ensembl_id": "ENSG00000107371" } }, "GRch38": { "90": { "location": "9:37766978-37801437", "ensembl_id": "ENSG00000107371" } } }, "hgnc_date_symbol_changed": "2004-03-26" }, "entity_type": "gene", "entity_name": "EXOSC3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Amber", "Royal Melbourne Hospital" ], "phenotypes": [ "Pontocerebellar hypoplasia, type 1b", "dHMN/dSMA" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7808", "gene_name": "nerve growth factor", "omim_gene": [ "162030" ], "alias_name": null, "gene_symbol": "NGF", "hgnc_symbol": "NGF", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:115828539-115880857", "ensembl_id": "ENSG00000134259" } }, "GRch38": { "90": { "location": "1:115285918-115338236", "ensembl_id": "ENSG00000134259" } } }, "hgnc_date_symbol_changed": "2008-02-07" }, "entity_type": "gene", "entity_name": "NGF", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "14976160", "20978020", "33884296", "32693191", "31685654", "30296891" ], "evidence": [ "Royal Melbourne Hospital", "Expert Review Green", "Expert Review Green" ], "phenotypes": [ "HSAN/SFN", "Neuropathy, hereditary sensory and autonomic, type V, MIM# 608654", "MONDO:0012092" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NEB177D" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7720", "gene_name": "nebulin", "omim_gene": [ "161650" ], "alias_name": [ "nemaline myopathy type 2" ], "gene_symbol": "NEB", "hgnc_symbol": "NEB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:152341850-152591001", "ensembl_id": "ENSG00000183091" } }, "GRch38": { "90": { "location": "2:151485336-151734487", "ensembl_id": "ENSG00000183091" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "NEB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "21724397", "17525139", "33458580", "25205138" ], "evidence": [ "Expert Review Green", "Literature", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "distal myopathy MONDO:0018949" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:18122", "gene_name": "SRY-box 17", "omim_gene": [ "610928" ], "alias_name": null, "gene_symbol": "SOX17", "hgnc_symbol": "SOX17", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:55370495-55373448", "ensembl_id": "ENSG00000164736" } }, "GRch38": { "90": { "location": "8:54457935-54460888", "ensembl_id": "ENSG00000164736" } } }, "hgnc_date_symbol_changed": "2002-02-15" }, "entity_type": "gene", "entity_name": "SOX17", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29650961", "31406341" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Pulmonary hypertension, primary, 7, MIM# 621248" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3095, "hash_id": null, "name": "Pulmonary Arterial Hypertension", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel is maintained by the Royal Melbourne Hospital. It is a consensus panel used by VCGS.\r\n\r\nThe content of this panel has been compared against the Genomics England 'Pulmonary Arterial Hypertension' panel, with all discrepancies resolved and reciprocal feedback provided to Genomics England, 27/07/2020.\r\n\r\nThe content of this panel has been aligned with curations by the ClinGen PAH GCEP, PMID 37422716, 07/08/2023.", "status": "public", "version": "1.56", "version_created": "2026-03-28T14:21:49.158422+11:00", "relevant_disorders": [ "Pulmonary arterial hypertension", "HP:0002092" ], "stats": { "number_of_genes": 37, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ21662" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30073", "gene_name": "DNA polymerase alpha 2, accessory subunit", "omim_gene": null, "alias_name": [ "DNA polymerase alpha subunit B", "DNA polymerase alpha 70 kDa subunit" ], "gene_symbol": "POLA2", "hgnc_symbol": "POLA2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:65029233-65073060", "ensembl_id": "ENSG00000014138" } }, "GRch38": { "90": { "location": "11:65261762-65305589", "ensembl_id": "ENSG00000014138" } } }, "hgnc_date_symbol_changed": "2005-01-10" }, "entity_type": "gene", "entity_name": "POLA2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "39616267" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Telomere biology syndrome MONDO:0100137" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3099, "hash_id": null, "name": "Syndromic Retinopathy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause retinopathy with at least one other consistent extra-ocular feature, forming a syndrome. The panel does NOT include the Bardet-Biedl syndrome, Stickler syndrome, and Usher syndrome genes, which have their own panels and are part of the Retinal Disorders Superpanel.\r\n\r\nConsider using the panel Retinal Disorders Superpanel when ophthalmological findings are not specific for a sub-group of disorders, particularly in individuals early in the diagnostic trajectory or if a dual diagnosis is a possibility.", "status": "public", "version": "0.256", "version_created": "2026-03-31T19:05:29.271183+11:00", "relevant_disorders": [ "Retinopathy", "HP:0000488" ], "stats": { "number_of_genes": 138, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "UNC18B", "Hunc18b" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11445", "gene_name": "syntaxin binding protein 2", "omim_gene": [ "601717" ], "alias_name": null, "gene_symbol": "STXBP2", "hgnc_symbol": "STXBP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:7701767-7712759", "ensembl_id": "ENSG00000076944" } }, "GRch38": { "90": { "location": "19:7636881-7647873", "ensembl_id": "ENSG00000076944" } } }, "hgnc_date_symbol_changed": "1996-12-27" }, "entity_type": "gene", "entity_name": "STXBP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Hemophagocytic lymphohistiocytosis, familial, 5, 613101 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AGAS", "ARGA", "NAT7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17996", "gene_name": "N-acetylglutamate synthase", "omim_gene": [ "608300" ], "alias_name": null, "gene_symbol": "NAGS", "hgnc_symbol": "NAGS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:42081914-42086431", "ensembl_id": "ENSG00000161653" } }, "GRch38": { "90": { "location": "17:44004546-44009063", "ensembl_id": "ENSG00000161653" } } }, "hgnc_date_symbol_changed": "2004-12-03" }, "entity_type": "gene", "entity_name": "NAGS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "N-acetylglutamate synthase deficiency, 237310 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "COD5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9936", "gene_name": "opsin 1, long wave sensitive", "omim_gene": [ "300822" ], "alias_name": [ "cone dystrophy 5 (X-linked)" ], "gene_symbol": "OPN1LW", "hgnc_symbol": "OPN1LW", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:153409698-153424507", "ensembl_id": "ENSG00000102076" } }, "GRch38": { "90": { "location": "X:154144224-154159032", "ensembl_id": "ENSG00000102076" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "OPN1LW", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30679166", "25168334", "32860923" ], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital" ], "phenotypes": [ "Blue cone monochromacy MIM#303700", "Colourblindness, protan MIM#303900" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [ "SV/CNV" ], "panel": { "id": 3147, "hash_id": null, "name": "Cone-rod Dystrophy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause non-syndromic cone and cone-rod dystrophies, characterised by cone photoreceptor degeneration, which may be followed by subsequent rod photoreceptor loss. This panel was developed and is maintained by RMH, and is a consensus panel used by VCGS.\r\n\r\nConsider using the broader Retinal Disorders superpanel when ophthalmological findings are not specific for this sub-group of disorders, particularly in individuals early in the diagnostic trajectory or where additional features are present.", "status": "public", "version": "0.67", "version_created": "2026-04-01T10:29:43.490911+11:00", "relevant_disorders": [ "Retinal dystrophy", "HP:0000556" ], "stats": { "number_of_genes": 41, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "trnR" ], "biotype": "Mt_tRNA", "hgnc_id": "HGNC:7496", "gene_name": "mitochondrially encoded tRNA arginine", "omim_gene": [ "590005" ], "alias_name": null, "gene_symbol": "MT-TR", "hgnc_symbol": "MT-TR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "MT:10405-10469", "ensembl_id": "ENSG00000210174" } }, "GRch38": { "90": { "location": "MT:10405-10469", "ensembl_id": "ENSG00000210174" } } }, "hgnc_date_symbol_changed": "2005-02-16" }, "entity_type": "gene", "entity_name": "MT-TR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "15286228", "17588757", "19809478", "22781096" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "mitochondrial disease (MONDO:0044970), MT-TR-related" ], "mode_of_inheritance": "MITOCHONDRIAL", "tags": [ "mtDNA" ], "panel": { "id": 3270, "hash_id": null, "name": "Cardiomyopathy_Paediatric", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "With thanks to Genomics England PanelApp for the original design of this panel.\r\n\r\nThis panel contains genes associated with childhood-onset cardiomyopathy, including as part of syndromic and metabolic conditions. It is maintained by VCGS.", "status": "public", "version": "0.229", "version_created": "2026-03-31T18:53:53.165018+11:00", "relevant_disorders": [ "Cardiomyopathy", "HP:0001638;Abnormality of the myocardium", "HP:0001637" ], "stats": { "number_of_genes": 252, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "NSRD2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7606", "gene_name": "myosin VIIA", "omim_gene": [ "276903" ], "alias_name": null, "gene_symbol": "MYO7A", "hgnc_symbol": "MYO7A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:76839310-76926284", "ensembl_id": "ENSG00000137474" } }, "GRch38": { "90": { "location": "11:77128264-77215239", "ensembl_id": "ENSG00000137474" } } }, "hgnc_date_symbol_changed": "1992-06-08" }, "entity_type": "gene", "entity_name": "MYO7A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Usher syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:6241", "gene_name": "potassium voltage-gated channel subfamily E regulatory subunit 5", "omim_gene": [ "300328" ], "alias_name": null, "gene_symbol": "KCNE5", "hgnc_symbol": "KCNE5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:108866929-108868393", "ensembl_id": "ENSG00000176076" } }, "GRch38": { "90": { "location": "X:109623700-109625172", "ensembl_id": "ENSG00000176076" } } }, "hgnc_date_symbol_changed": "2015-01-16" }, "entity_type": "gene", "entity_name": "KCNE5", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Atrial fibrillation" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SAP155", "SF3b155", "PRPF10", "Prp10", "Hsh155" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10768", "gene_name": "splicing factor 3b subunit 1", "omim_gene": [ "605590" ], "alias_name": null, "gene_symbol": "SF3B1", "hgnc_symbol": "SF3B1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:198254508-198299815", "ensembl_id": "ENSG00000115524" } }, "GRch38": { "90": { "location": "2:197389784-197435091", "ensembl_id": "ENSG00000115524" } } }, "hgnc_date_symbol_changed": "2000-02-29" }, "entity_type": "gene", "entity_name": "SF3B1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28188970", "21995386" ], "evidence": [ "Expert Review Red", "London South GLH", "NHS GMS" ], "phenotypes": [ "Myelodysplastic syndrome, somatic MIM# 614286" ], "mode_of_inheritance": "Other", "tags": [ "somatic" ], "panel": { "id": 3366, "hash_id": null, "name": "Red cell disorders", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with red cell disorders, including anaemias and erythrocytosis.\r\n\r\nPlease refer to the Bone Marrow Failure panel if there is suspicion of pancytopaenia, and to the Diamond Blackfan Anaemia panel if specific features of DBA are present.\r\n\r\nWith thanks to Genomics England PanelApp/NHS Genomic Medicine Service for the original design of this panel.", "status": "public", "version": "1.52", "version_created": "2026-03-28T15:18:36.006857+11:00", "relevant_disorders": [ "Abnormal erythrocyte morphology", "HP:0001877" ], "stats": { "number_of_genes": 116, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Mi-2b", "Mi2-BETA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1919", "gene_name": "chromodomain helicase DNA binding protein 4", "omim_gene": [ "603277" ], "alias_name": null, "gene_symbol": "CHD4", "hgnc_symbol": "CHD4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:6679249-6716642", "ensembl_id": "ENSG00000111642" } }, "GRch38": { "90": { "location": "12:6570083-6607476", "ensembl_id": "ENSG00000111642" } } }, "hgnc_date_symbol_changed": "1998-03-20" }, "entity_type": "gene", "entity_name": "CHD4", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31388190", "37010288" ], "evidence": [ "Expert Review Amber", "Expert Review" ], "phenotypes": [ "Sifrim-Hitz-Weiss syndrome, MIM 617159" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:746", "gene_name": "argininosuccinate lyase", "omim_gene": [ "608310" ], "alias_name": null, "gene_symbol": "ASL", "hgnc_symbol": "ASL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:65540785-65558545", "ensembl_id": "ENSG00000126522" } }, "GRch38": { "90": { "location": "7:66075798-66093558", "ensembl_id": "ENSG00000126522" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "ASL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "2263616", "12408190" ], "evidence": [ "Victorian Clinical Genetics Services", "Expert list", "NHS GMS", "Genomics England PanelApp", "Expert Review Green", "Expert Review Green", "Expert Review Green", "Expert Review Green", "Genomics England PanelApp", "NHS GMS", "Expert list", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Argininosuccinic aciduria\t207900" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 3400, "hash_id": null, "name": "Liver Failure_Paediatric", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel includes primary liver disorders as well as metabolic and other multi-system disorders that have been reported to cause liver failure in children.\r\n\r\nPlease also consider using the Cholestasis panel if clinically indicated.", "status": "public", "version": "1.33", "version_created": "2026-01-08T17:48:33.703909+11:00", "relevant_disorders": [ "Liver failure", "HP:0001399" ], "stats": { "number_of_genes": 68, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BAT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:932", "gene_name": "bile acid-CoA:amino acid N-acyltransferase", "omim_gene": [ "602938" ], "alias_name": [ "glycine N-choloyltransferase" ], "gene_symbol": "BAAT", "hgnc_symbol": "BAAT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:104122699-104145801", "ensembl_id": "ENSG00000136881" } }, "GRch38": { "90": { "location": "9:101360417-101383519", "ensembl_id": "ENSG00000136881" } } }, "hgnc_date_symbol_changed": "1996-03-13" }, "entity_type": "gene", "entity_name": "BAAT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "12704386", "23415802" ], "evidence": [ "Expert Review Green", "NHS GMS" ], "phenotypes": [ "Bile acid conjugation defect 1, MIM# 619232", "Hypercholanemia, familial MIM#607748", "disorder of bile acid metabolism" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3468, "hash_id": null, "name": "Miscellaneous Metabolic Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause miscellaneous metabolic disorders, that are not present on any of the more specific metabolic disorders panels (see the Metabolic Disorders Superpanel for the full list of panels). It contains, but is not limited to, the following groups of conditions:\r\n-Disorders of purine and pyrimidine metabolism\r\n-Organic acidurias, and other disorders of amino acid and peptide metabolism\r\n-Disorders of bile acid metabolism and transport, and other disorders of the metabolism of sterols\r\n-Disorders of nucleotide metabolism\r\n-Disorders of glucose transport, and other disorders of carbohydrate metabolism (excluding glycogen storage disorders)\r\n-Disorders of zinc and manganese metabolism\r\n-Disorders of vitamins and cofactors\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.60", "version_created": "2026-01-15T15:39:27.439934+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 149, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MI", "bHLHe32" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7105", "gene_name": "melanogenesis associated transcription factor", "omim_gene": [ "156845" ], "alias_name": [ "homolog of mouse microphthalmia" ], "gene_symbol": "MITF", "hgnc_symbol": "MITF", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:69788586-70017488", "ensembl_id": "ENSG00000187098" } }, "GRch38": { "90": { "location": "3:69739435-69968337", "ensembl_id": "ENSG00000187098" } } }, "hgnc_date_symbol_changed": "1993-10-27" }, "entity_type": "gene", "entity_name": "MITF", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27889061", "32541011" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Victorian Clinical Genetics Services" ], "phenotypes": [ "COMMAD syndrome, MIM# 617306" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "H4/g", "dJ221C16.1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4787", "gene_name": "histone cluster 1 H4 family member c", "omim_gene": [ "602827" ], "alias_name": null, "gene_symbol": "HIST1H4C", "hgnc_symbol": "HIST1H4C", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:26104104-26104518", "ensembl_id": "ENSG00000197061" } }, "GRch38": { "90": { "location": "6:26103876-26104310", "ensembl_id": "ENSG00000197061" } } }, "hgnc_date_symbol_changed": "2003-02-21" }, "entity_type": "gene", "entity_name": "HIST1H4C", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28920961" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Tessadori-van Haaften neurodevelopmental syndrome 1 MIM#619758" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "new gene name" ], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CX47", "CX46.6", "SPG44" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17494", "gene_name": "gap junction protein gamma 2", "omim_gene": [ "608803" ], "alias_name": [ "connexin 47" ], "gene_symbol": "GJC2", "hgnc_symbol": "GJC2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:228337553-228347527", "ensembl_id": "ENSG00000198835" } }, "GRch38": { "90": { "location": "1:228149852-228159826", "ensembl_id": "ENSG00000198835" } } }, "hgnc_date_symbol_changed": "2007-11-06" }, "entity_type": "gene", "entity_name": "GJC2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19056803", "31431325", "25059390" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Leukodystrophy, hypomyelinating, 2 MIM#608804" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC12435", "1700010H15RiK", "CILD16" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23247", "gene_name": "dynein axonemal light chain 1", "omim_gene": [ "610062" ], "alias_name": null, "gene_symbol": "DNAL1", "hgnc_symbol": "DNAL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:74111578-74170435", "ensembl_id": "ENSG00000119661" } }, "GRch38": { "90": { "location": "14:73644875-73703732", "ensembl_id": "ENSG00000119661" } } }, "hgnc_date_symbol_changed": "2006-09-04" }, "entity_type": "gene", "entity_name": "DNAL1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21496787" ], "evidence": [ "Expert Review Amber", "Genomics England PanelApp", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Ciliary dyskinesia, primary, 16, MIM# 614017" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1506", "HALR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13726", "gene_name": "lysine methyltransferase 2C", "omim_gene": [ "606833" ], "alias_name": null, "gene_symbol": "KMT2C", "hgnc_symbol": "KMT2C", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:151832010-152133090", "ensembl_id": "ENSG00000055609" } }, "GRch38": { "90": { "location": "7:152134922-152436005", "ensembl_id": "ENSG00000055609" } } }, "hgnc_date_symbol_changed": "2013-05-09" }, "entity_type": "gene", "entity_name": "KMT2C", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29276005", "22726846" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Kleefstra syndrome 2, MIM#617768" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:20344", "gene_name": "ubiquitin protein ligase E3 component n-recognin 7 (putative)", "omim_gene": [ "613816" ], "alias_name": null, "gene_symbol": "UBR7", "hgnc_symbol": "UBR7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:93673401-93695561", "ensembl_id": "ENSG00000012963" } }, "GRch38": { "90": { "location": "14:93207056-93229215", "ensembl_id": "ENSG00000012963" } } }, "hgnc_date_symbol_changed": "2008-06-23" }, "entity_type": "gene", "entity_name": "UBR7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33340455" ], "evidence": [ "Expert Review Green", "Expert list", "Literature" ], "phenotypes": [ "Li-Campeau syndrome - MIM#619189" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KARS2", "KARS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6215", "gene_name": "lysyl-tRNA synthetase", "omim_gene": [ "601421" ], "alias_name": [ "lysine tRNA ligase" ], "gene_symbol": "KARS", "hgnc_symbol": "KARS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:75661622-75682541", "ensembl_id": "ENSG00000065427" } }, "GRch38": { "90": { "location": "16:75627474-75648643", "ensembl_id": "ENSG00000065427" } } }, "hgnc_date_symbol_changed": "1995-07-11" }, "entity_type": "gene", "entity_name": "KARS", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26741492", "31618474", "28887846", "25330800", "29615062", "30252186", "28496994" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp", "Expert list" ], "phenotypes": [ "Leukoencephalopathy with or without deafness (LEPID), MIM#619147" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TBDN100", "NATH", "FLJ13340" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30782", "gene_name": "N(alpha)-acetyltransferase 15, NatA auxiliary subunit", "omim_gene": [ "608000" ], "alias_name": null, "gene_symbol": "NAA15", "hgnc_symbol": "NAA15", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:140222609-140341187", "ensembl_id": "ENSG00000164134" } }, "GRch38": { "90": { "location": "4:139301455-139420033", "ensembl_id": "ENSG00000164134" } } }, "hgnc_date_symbol_changed": "2010-01-14" }, "entity_type": "gene", "entity_name": "NAA15", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31127942", "33557580" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities, MIM 617787" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EMAP", "HuEMAP", "ELP79" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3330", "gene_name": "echinoderm microtubule associated protein like 1", "omim_gene": [ "602033" ], "alias_name": null, "gene_symbol": "EML1", "hgnc_symbol": "EML1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:100204030-100408397", "ensembl_id": "ENSG00000066629" } }, "GRch38": { "90": { "location": "14:99737693-99942060", "ensembl_id": "ENSG00000066629" } } }, "hgnc_date_symbol_changed": "2002-02-15" }, "entity_type": "gene", "entity_name": "EML1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31710781" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Band heterotopia, OMIM:600348" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20071", "DMC", "SMC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21317", "gene_name": "dymeclin", "omim_gene": [ "607461" ], "alias_name": null, "gene_symbol": "DYM", "hgnc_symbol": "DYM", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:46570039-46987717", "ensembl_id": "ENSG00000141627" } }, "GRch38": { "90": { "location": "18:49041474-49461347", "ensembl_id": "ENSG00000141627" } } }, "hgnc_date_symbol_changed": "2005-01-05" }, "entity_type": "gene", "entity_name": "DYM", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12491225", "12554689", "16470731", "19005420" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Smith-McCort dysplasia , MM#607326", "Dyggve-Melchior-Clausen disease, MIM#223800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FAA", "FA-H", "FAH" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3582", "gene_name": "Fanconi anemia complementation group A", "omim_gene": [ "607139" ], "alias_name": null, "gene_symbol": "FANCA", "hgnc_symbol": "FANCA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:89803957-89883065", "ensembl_id": "ENSG00000187741" } }, "GRch38": { "90": { "location": "16:89737549-89816657", "ensembl_id": "ENSG00000187741" } } }, "hgnc_date_symbol_changed": "1995-12-22" }, "entity_type": "gene", "entity_name": "FANCA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "IBMDx Study", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "MONDO:0009215", "Fanconi anaemia, complementation group A, MIM# 227650" ], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 3829, "hash_id": null, "name": "IBMDx study", "disease_group": "", "disease_sub_group": "", "description": "The inherited bone marrow diseases (IBMD) are a diverse group of diseases featuring single or multi-lineage cytopaenias and numerous potential associated manifestations including multi-organ syndromic features, a predisposition to haematological malignancy and/or a bleeding phenotype.\r\n\r\nThis panel is appropriate to be used for the following phenotypes of IBMD :\r\n-\tFanconi anaemia (excluding BRCA1, BRCA2, BRIP1 due to their more common association with familial breast cancer risk than FA) \r\n-\tDiamond-Blackfan anaemia\r\n-\tDyskeratosis congenita / telomere biology disorders\r\n-\tShwachman-Diamond syndrome\r\n-\tSevere congenital neutropenia\r\n-\tThrombocytopenia-absent radius syndrome\r\n-\tCongenital amegakaryocytic thrombocytopenia\r\n-\tAdenosine deaminase deficiency\r\n-\tGATA2 deficiency syndrome\r\n-\tSAMD9 / SAMD9L related disorders \r\n-\tCongenital dyserythropoietic anaemia\r\n-\tCongenital sideroblastic anaemia\r\n-\tBernard-Soulier syndrome\r\n\r\nThis panel is being used in the IBMDx study (NCT05196789) – “Diagnosis, discovery and novel phenotype characterisation using multimodal genomics in patients with inherited bone marrow failure and related disorders”\r\n\r\nSome heritable diseases associated with cytopaenias and/or bleeding (for example thalassaemia/haemoglobinopathies and haemophilia) are not assessed with this panel.", "status": "public", "version": "0.42", "version_created": "2026-03-19T18:45:41.236506+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Research", "slug": "research", "description": "Research panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RAB3GAP", "KIAA0066", "RAB3GAP130", "WARBM1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17063", "gene_name": "RAB3 GTPase activating protein catalytic subunit 1", "omim_gene": [ "602536" ], "alias_name": null, "gene_symbol": "RAB3GAP1", "hgnc_symbol": "RAB3GAP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:135809835-135933964", "ensembl_id": "ENSG00000115839" } }, "GRch38": { "90": { "location": "2:135052265-135176394", "ensembl_id": "ENSG00000115839" } } }, "hgnc_date_symbol_changed": "2005-08-23" }, "entity_type": "gene", "entity_name": "RAB3GAP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Warburg micro syndrome 1, 600118 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4135", "gene_name": "galactose-1-phosphate uridylyltransferase", "omim_gene": [ "606999" ], "alias_name": null, "gene_symbol": "GALT", "hgnc_symbol": "GALT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:34638130-34651032", "ensembl_id": "ENSG00000213930" } }, "GRch38": { "90": { "location": "9:34638133-34651035", "ensembl_id": "ENSG00000213930" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "GALT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Galactosemia MIM# 230400" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MU-ARP2", "MU-4", "SPG50" ], "biotype": "protein_coding", "hgnc_id": "HGNC:574", "gene_name": "adaptor related protein complex 4 mu 1 subunit", "omim_gene": [ "602296" ], "alias_name": [ "mu-adaptin-related protein-2", "mu subunit of AP-4", "AP-4 adapter complex mu subunit", "adaptor-related protein complex AP-4 mu4 subunit" ], "gene_symbol": "AP4M1", "hgnc_symbol": "AP4M1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:99699172-99707968", "ensembl_id": "ENSG00000221838" } }, "GRch38": { "90": { "location": "7:100101549-100110345", "ensembl_id": "ENSG00000221838" } } }, "hgnc_date_symbol_changed": "2000-09-01" }, "entity_type": "gene", "entity_name": "AP4M1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Spastic paraplegia 50, autosomal recessive, 612936 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SSADH", "SSDH" ], "biotype": "protein_coding", "hgnc_id": "HGNC:408", "gene_name": "aldehyde dehydrogenase 5 family member A1", "omim_gene": [ "610045" ], "alias_name": [ "succinate-semialdehyde dehydrogenase" ], "gene_symbol": "ALDH5A1", "hgnc_symbol": "ALDH5A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:24495080-24537435", "ensembl_id": "ENSG00000112294" } }, "GRch38": { "90": { "location": "6:24494852-24537207", "ensembl_id": "ENSG00000112294" } } }, "hgnc_date_symbol_changed": "1999-06-11" }, "entity_type": "gene", "entity_name": "ALDH5A1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category A gene" ], "phenotypes": [ "Succinic semialdehyde dehydrogenase deficiency, MIM# 271980" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11510", "gene_name": "synaptotagmin 2", "omim_gene": [ "600104" ], "alias_name": null, "gene_symbol": "SYT2", "hgnc_symbol": "SYT2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:202559724-202679545", "ensembl_id": "ENSG00000143858" } }, "GRch38": { "90": { "location": "1:202590596-202710417", "ensembl_id": "ENSG00000143858" } } }, "hgnc_date_symbol_changed": "1995-09-27" }, "entity_type": "gene", "entity_name": "SYT2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 32250532, 32776697" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Myasthenic syndrome, congenital, 7B, presynaptic, autosomal recessive MIM#619461" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "neurological" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CPT1-L", "L-CPT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2328", "gene_name": "carnitine palmitoyltransferase 1A", "omim_gene": [ "600528" ], "alias_name": null, "gene_symbol": "CPT1A", "hgnc_symbol": "CPT1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:68522088-68611878", "ensembl_id": "ENSG00000110090" } }, "GRch38": { "90": { "location": "11:68754620-68844410", "ensembl_id": "ENSG00000110090" } } }, "hgnc_date_symbol_changed": "1995-05-30" }, "entity_type": "gene", "entity_name": "CPT1A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12189492", "25778941", "23430932" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "CPT deficiency, hepatic, type IA, MIM#255120" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EAD" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2226", "gene_name": "collagen like tail subunit of asymmetric acetylcholinesterase", "omim_gene": [ "603033" ], "alias_name": [ "single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase", "collagenic tail of endplate acetylcholinesterase", "AChE Q subunit", "acetylcholinesterase-associated collagen" ], "gene_symbol": "COLQ", "hgnc_symbol": "COLQ", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:15491640-15563258", "ensembl_id": "ENSG00000206561" } }, "GRch38": { "90": { "location": "3:15450133-15521751", "ensembl_id": "ENSG00000206561" } } }, "hgnc_date_symbol_changed": "1998-09-14" }, "entity_type": "gene", "entity_name": "COLQ", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9689136", "9758617", "11865139", "32978031", "31831253", "29478601", "23995276", "36835142" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Myasthenic syndrome, congenital, 5 MIM#603034", "MONDO:0011281" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DYT5b" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11782", "gene_name": "tyrosine hydroxylase", "omim_gene": [ "191290" ], "alias_name": [ "tyrosine 3-monooxygenase" ], "gene_symbol": "TH", "hgnc_symbol": "TH", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:2185159-2193107", "ensembl_id": "ENSG00000180176" } }, "GRch38": { "90": { "location": "11:2163929-2171877", "ensembl_id": "ENSG00000180176" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "TH", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Segawa syndrome, recessive, MIM# 605407" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0912", "SCKL5", "MCPH9" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29298", "gene_name": "centrosomal protein 152", "omim_gene": [ "613529" ], "alias_name": [ "asterless" ], "gene_symbol": "CEP152", "hgnc_symbol": "CEP152", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:49005125-49103343", "ensembl_id": "ENSG00000103995" } }, "GRch38": { "90": { "location": "15:48712928-48811146", "ensembl_id": "ENSG00000103995" } } }, "hgnc_date_symbol_changed": "2005-12-01" }, "entity_type": "gene", "entity_name": "CEP152", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20598275", "22775483", "21131973", "23199753", "36685824" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Microcephaly 9, primary, autosomal recessive, MIM# 614852", "MONDO:0013923", "Seckel syndrome 5, MIM# 613823", "MONDO:0013443" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FKHL20" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12765", "gene_name": "forkhead box N1", "omim_gene": [ "600838" ], "alias_name": null, "gene_symbol": "FOXN1", "hgnc_symbol": "FOXN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:26833261-26865914", "ensembl_id": "ENSG00000109101" } }, "GRch38": { "90": { "location": "17:28506243-28538896", "ensembl_id": "ENSG00000109101" } } }, "hgnc_date_symbol_changed": "2003-06-13" }, "entity_type": "gene", "entity_name": "FOXN1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "10206641", "20978268", "20978268", "28636882", "31566583", "31447097" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "T-cell immunodeficiency, congenital alopecia, and nail dystrophy MIM#601705" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "parafibromin", "FIHP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16783", "gene_name": "cell division cycle 73", "omim_gene": [ "607393" ], "alias_name": [ "Paf1/RNA polymerase II complex component" ], "gene_symbol": "CDC73", "hgnc_symbol": "CDC73", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:193091147-193223031", "ensembl_id": "ENSG00000134371" } }, "GRch38": { "90": { "location": "1:193122017-193253901", "ensembl_id": "ENSG00000134371" } } }, "hgnc_date_symbol_changed": "2005-07-20" }, "entity_type": "gene", "entity_name": "CDC73", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12434154" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Hyperparathyroidism-jaw tumour syndrome, MIM# 145001", "Hyperparathyroidism, familial primary, MIM# 145000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4526, "hash_id": null, "name": "Hyperparathyroidism", "disease_group": "Endocrine disorders", "disease_sub_group": "Calcium disorders", "description": "This panel contains genes associated with primary hyperparathyroidism \r\n(and includes some cancer predisposition disorders). \r\n\r\nIt includes genes from the Genomics England PanelApp 'familial hyperparathyroidism or hypocalciuric hypercalcaemia' panel V3.6.", "status": "public", "version": "0.12", "version_created": "2026-01-30T09:51:01.481999+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699427 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [ "adult-onset" ], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.342", "version_created": "2026-03-31T18:54:31.699745+11:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } } ] }