Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=87
{ "count": 36038, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=88", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=86", "results": [ { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11802", "gene_name": "TIA1 cytotoxic granule associated RNA binding protein", "omim_gene": [ "603518" ], "alias_name": [ "T-cell-restricted intracellular antigen-1", "nucleolysin TIA-1 isoform p40" ], "gene_symbol": "TIA1", "hgnc_symbol": "TIA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:70436576-70475792", "ensembl_id": "ENSG00000116001" } }, "GRch38": { "90": { "location": "2:70209444-70248660", "ensembl_id": "ENSG00000116001" } } }, "hgnc_date_symbol_changed": "1995-11-01" }, "entity_type": "gene", "entity_name": "TIA1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29235362", "29886022", "29773329", "29699721", "29216908", "24659297", "29457785", "28817800" ], "evidence": [ "Expert Review Amber", "Expert list" ], "phenotypes": [ "Amyotrophic lateral sclerosis 26 with or without frontotemporal dementia\t619133" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 25, "hash_id": null, "name": "Motor Neurone Disease", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause motor neurone disease, including amyotrophic lateral sclerosis and genes causing spinal muscular atrophies (SMAs) with adult onset. It is maintained by VCGS and RMH.\r\n\r\nGenes causing spinal muscular atrophies (SMAs) with congenital/childhood onset are not included in this panel but can be found in the Hereditary Neuropathy panels.\r\n\r\nThe original panel (as 17/11/2019) was developed and used by the Melbourne Genomics Complex Neurology Flagship.", "status": "public", "version": "1.48", "version_created": "2026-03-31T16:37:58.241144+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 79, "number_of_strs": 4, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:30079", "gene_name": "transmembrane protease, serine 9", "omim_gene": [ "610477" ], "alias_name": [ "polyserase 1" ], "gene_symbol": "TMPRSS9", "hgnc_symbol": "TMPRSS9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:2389769-2426237", "ensembl_id": "ENSG00000178297" } }, "GRch38": { "90": { "location": "19:2389771-2426239", "ensembl_id": "ENSG00000178297" } } }, "hgnc_date_symbol_changed": "2004-04-07" }, "entity_type": "gene", "entity_name": "TMPRSS9", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31943016" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, TMPRSS9-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 51, "hash_id": null, "name": "Autism", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.248", "version_created": "2026-03-19T12:51:18.584438+11:00", "relevant_disorders": [ "Autism", "HP:0000717" ], "stats": { "number_of_genes": 157, "number_of_strs": 0, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ10209", "KIAA1175" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30032", "gene_name": "phosphofurin acidic cluster sorting protein 1", "omim_gene": [ "607492" ], "alias_name": null, "gene_symbol": "PACS1", "hgnc_symbol": "PACS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:65837834-66012218", "ensembl_id": "ENSG00000175115" } }, "GRch38": { "90": { "location": "11:66070363-66244747", "ensembl_id": "ENSG00000175115" } } }, "hgnc_date_symbol_changed": "2005-01-05" }, "entity_type": "gene", "entity_name": "PACS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26842493", "23159249" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Schuurs-Hoeijmakers syndrome (MIM# 615009)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 51, "hash_id": null, "name": "Autism", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.248", "version_created": "2026-03-19T12:51:18.584438+11:00", "relevant_disorders": [ "Autism", "HP:0000717" ], "stats": { "number_of_genes": 157, "number_of_strs": 0, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:10896", "gene_name": "SKI proto-oncogene", "omim_gene": [ "164780" ], "alias_name": null, "gene_symbol": "SKI", "hgnc_symbol": "SKI", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:2160134-2241558", "ensembl_id": "ENSG00000157933" } }, "GRch38": { "90": { "location": "1:2228695-2310119", "ensembl_id": "ENSG00000157933" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "SKI", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Shprintzen-Goldberg syndrome, MIM# 182212" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 54, "hash_id": null, "name": "Bleeding and Platelet Disorders", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with coagulation, platelet and blood vessel disorders that predispose to bleeding and to thrombosis.", "status": "public", "version": "1.77", "version_created": "2026-04-08T12:32:35.286494+10:00", "relevant_disorders": [ "Abnormal bleeding", "HP:0001892;Abnormal thrombosis", "HP:0001977" ], "stats": { "number_of_genes": 140, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20479" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14377", "gene_name": "NHP2 ribonucleoprotein", "omim_gene": [ "606470" ], "alias_name": null, "gene_symbol": "NHP2", "hgnc_symbol": "NHP2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:177576461-177580968", "ensembl_id": "ENSG00000145912" } }, "GRch38": { "90": { "location": "5:178149460-178153967", "ensembl_id": "ENSG00000145912" } } }, "hgnc_date_symbol_changed": "2008-10-13" }, "entity_type": "gene", "entity_name": "NHP2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18523010", "31985013", "40352450", "40073202" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Dyskeratosis congenita, autosomal recessive 2, MIM# 613987" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 56, "hash_id": null, "name": "Bone Marrow Failure", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "Bone marrow failure (BMF) refers to the decreased production of one or more major haematopoietic lineages which leads to diminished or absent haematopoietic precursors in the bone marrow and attendant cytopaenias.\r\n\r\nThis panel was developed and is maintained by VCGS. It contains all the genes on the Peter MacCallum Bone Marrow Failure panel, as of 2/3/2020, and includes all the genes associated with telomere disorders (Dysterkeratosis Congenita).\r\n\r\nIt has been updated with the July 2024 International Union of Immunological Societies Inborn Errors of Immunity Committee classifications.", "status": "public", "version": "1.141", "version_created": "2026-03-17T18:48:23.244194+11:00", "relevant_disorders": [ "Abnormality of multiple cell lineages of the bone marrow", "HP:0012145" ], "stats": { "number_of_genes": 151, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DYT18", "DYT9" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11005", "gene_name": "solute carrier family 2 member 1", "omim_gene": [ "138140" ], "alias_name": null, "gene_symbol": "SLC2A1", "hgnc_symbol": "SLC2A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:43391052-43424530", "ensembl_id": "ENSG00000117394" } }, "GRch38": { "90": { "location": "1:42925375-42959173", "ensembl_id": "ENSG00000117394" } } }, "hgnc_date_symbol_changed": "1994-11-18" }, "entity_type": "gene", "entity_name": "SLC2A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22492876" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "GLUT1 deficiency syndrome MONDO:0000188", "Stomatin-deficient cryohydrocytosis with neurologic defects, MIM# 608885" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 66, "hash_id": null, "name": "Cataract", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions with cataract as a feature, and was created by merging the panels developed by VCGS and RMH.\r\n\r\nCataracts due to monogenic conditions are often present at birth or appear in childhood or young adulthood. The lens alone may be involved, or lens opacities may be associated with other ocular anomalies, such as microphthalmia, aniridia, or other anterior chamber developmental anomalies. Cataracts may also be part of multisystem genetic disorders such as syndromes or metabolic conditions.\r\n\r\nThis panel has been compared against the Genomics England/NHS GMS panel Bilateral congenital or childhood onset cataracts (Version 7.5) on 29/12/2025 with all discrepancies reviewed.\r\n\r\nUpdated following literature review in February 2026.", "status": "public", "version": "1.3", "version_created": "2026-03-31T18:43:23.306556+11:00", "relevant_disorders": [ "Cataract", "HP:0000518" ], "stats": { "number_of_genes": 258, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "W117m" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17474", "gene_name": "endothelial cell adhesion molecule", "omim_gene": [ "614281" ], "alias_name": null, "gene_symbol": "ESAM", "hgnc_symbol": "ESAM", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:124622026-124632186", "ensembl_id": "ENSG00000149564" } }, "GRch38": { "90": { "location": "11:124752583-124762290", "ensembl_id": "ENSG00000149564" } } }, "hgnc_date_symbol_changed": "2003-11-26" }, "entity_type": "gene", "entity_name": "ESAM", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "36996813" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with intracranial hemorrhage, seizures, and spasticity MIM#620371" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 73, "hash_id": null, "name": "Cerebral Palsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Cerebral palsy (CP) is a non-progressive neurodevelopmental disorder characterized by motor impairments, often accompanied by intellectual disability, epilepsy, visual and hearing impairment and speech and language deficits.\r\n\r\nPMID 33528536 reported a cohort of 1345 individuals undergoing genomic testing. Diagnostic yield ranged between 10-30% depending on presence of additional characteristics such as ID/epilepsy/ASD.\r\n\r\nThe aetiology of cerebral palsy is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia, Ataxia, Malformations of Cortical Development, Mitochondrial Disorders and the Bleeding and Platelet Disorders panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Jozef Gecz, Clare van Eyk, Luisa Weiss and team for their contribution to the development of this panel.", "status": "public", "version": "1.410", "version_created": "2026-02-17T16:35:59.013988+11:00", "relevant_disorders": [ "Cerebral palsy HP:0100021" ], "stats": { "number_of_genes": 364, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NF1A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7788", "gene_name": "nuclear factor I X", "omim_gene": [ "164005" ], "alias_name": [ "CCAAT-binding transcription factor" ], "gene_symbol": "NFIX", "hgnc_symbol": "NFIX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:13106422-13209610", "ensembl_id": "ENSG00000008441" } }, "GRch38": { "90": { "location": "19:12995608-13098796", "ensembl_id": "ENSG00000008441" } } }, "hgnc_date_symbol_changed": "1993-11-03" }, "entity_type": "gene", "entity_name": "NFIX", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34788679" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Malan syndrome MIM#614753", "Marshall-Smith syndrome MIM#602535" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 73, "hash_id": null, "name": "Cerebral Palsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "Cerebral palsy (CP) is a non-progressive neurodevelopmental disorder characterized by motor impairments, often accompanied by intellectual disability, epilepsy, visual and hearing impairment and speech and language deficits.\r\n\r\nPMID 33528536 reported a cohort of 1345 individuals undergoing genomic testing. Diagnostic yield ranged between 10-30% depending on presence of additional characteristics such as ID/epilepsy/ASD.\r\n\r\nThe aetiology of cerebral palsy is complex. If an underlying monogenic condition is suspected, please also consider the Intellectual Disability, Genetic Epilepsy, Hereditary Spastic Paraplegia - paediatric, Dystonia, Ataxia, Malformations of Cortical Development, Mitochondrial Disorders and the Bleeding and Platelet Disorders panels among others, depending on the associated clinical features.\r\n\r\nWe would like to thank Jozef Gecz, Clare van Eyk, Luisa Weiss and team for their contribution to the development of this panel.", "status": "public", "version": "1.410", "version_created": "2026-02-17T16:35:59.013988+11:00", "relevant_disorders": [ "Cerebral palsy HP:0100021" ], "stats": { "number_of_genes": 364, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ZFYVE23", "FLJ39957", "FLJ00274" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19117", "gene_name": "FYVE, RhoGEF and PH domain containing 5", "omim_gene": [ "614788" ], "alias_name": null, "gene_symbol": "FGD5", "hgnc_symbol": "FGD5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:14860469-14975895", "ensembl_id": "ENSG00000154783" } }, "GRch38": { "90": { "location": "3:14810853-14934565", "ensembl_id": "ENSG00000154783" } } }, "hgnc_date_symbol_changed": "2003-11-25" }, "entity_type": "gene", "entity_name": "FGD5", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "41574350", "41199744", "32037394", "30232381" ], "evidence": [ "Expert Review Amber", "Literature", "Literature" ], "phenotypes": [ "Congenital heart disease - MONDO:0005453, FGD5-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 76, "hash_id": null, "name": "Congenital Heart Defect", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with syndromic and non-syndromic congenital heart disease.", "status": "public", "version": "0.534", "version_created": "2026-03-30T13:14:35.719896+11:00", "relevant_disorders": [ "Abnormal heart morphology HP:0001627" ], "stats": { "number_of_genes": 253, "number_of_strs": 1, "number_of_regions": 10 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:9529", "gene_name": "protein serine kinase H1", "omim_gene": [ "177015" ], "alias_name": null, "gene_symbol": "PSKH1", "hgnc_symbol": "PSKH1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:67927175-67963581", "ensembl_id": "ENSG00000159792" } }, "GRch38": { "90": { "location": "16:67893272-67929678", "ensembl_id": "ENSG00000159792" } } }, "hgnc_date_symbol_changed": "1993-08-04" }, "entity_type": "gene", "entity_name": "PSKH1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 39132680" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Cholestasis, progressive familial intrahepatic, 13, MIM# 620962" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 78, "hash_id": null, "name": "Cholestasis", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel was developed by and is maintained by VCGS.\r\n\r\nIt includes primary liver disorders as well as metabolic and other multi-system disorders that have been reported to cause cholestasis.\r\n\r\nPlease also consider using the Liver Failure_Paediatric panel if clinically indicated.\r\n\r\nThe content of this panel has been compared against the Genomics England PanelApp 'Cholestasis' panel V1.21, with all discrepancies reviewed and resolved, and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.10", "version_created": "2026-03-26T17:26:27.105917+11:00", "relevant_disorders": [ "Cholestasis HP:0001396" ], "stats": { "number_of_genes": 99, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "TSARG6", "RSPH16A" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30718", "gene_name": "DnaJ heat shock protein family (Hsp40) member B13", "omim_gene": [ "610263" ], "alias_name": [ "radial spoke 16 homolog A (Chlamydomonas)" ], "gene_symbol": "DNAJB13", "hgnc_symbol": "DNAJB13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:73661364-73681411", "ensembl_id": "ENSG00000187726" } }, "GRch38": { "90": { "location": "11:73950319-73970366", "ensembl_id": "ENSG00000187726" } } }, "hgnc_date_symbol_changed": "2005-07-01" }, "entity_type": "gene", "entity_name": "DNAJB13", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID:27486783" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Ciliary dyskinesia, primary, 34\t617091" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 82, "hash_id": null, "name": "Ciliary Dyskinesia", "disease_group": "Respiratory disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It contains conditions caused by defects in the motile cilia, primarily those presenting with respiratory phenotypes. It also contains a small number of other genes that cause conditions with significant phenotypic overlap.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Respiratory Ciliopathies including non-CF bronchiectasis' panel V1.3, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.75", "version_created": "2026-03-30T10:17:46.701193+11:00", "relevant_disorders": [ "Ciliary dyskinesia HP:0012265;Recurrent respiratory infections HP:0002205" ], "stats": { "number_of_genes": 77, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:1951", "gene_name": "cholinergic receptor muscarinic 2", "omim_gene": [ "118493" ], "alias_name": [ "acetylcholine receptor, muscarinic 2" ], "gene_symbol": "CHRM2", "hgnc_symbol": "CHRM2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:136553416-136705002", "ensembl_id": "ENSG00000181072" } }, "GRch38": { "90": { "location": "7:136868669-137020255", "ensembl_id": "ENSG00000181072" } } }, "hgnc_date_symbol_changed": "1988-08-04" }, "entity_type": "gene", "entity_name": "CHRM2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "23743182", "18451336" ], "evidence": [ "Expert Review Red", "Expert Review" ], "phenotypes": [ "Familial Dilated Cardiomyopathy MONDO#0016333, CHRM2-related" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 95, "hash_id": null, "name": "Dilated Cardiomyopathy", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes typically associated with isolated dilated cardiomyopathy, with onset in adolescence or adulthood. For early onset dilated cardiomyopathy, or in the presence of additional features suggestive of an underlying metabolic or syndromic disorder please consider the Cardiomyopathy_Paediatric panel. Where the type of cardiomyopathy is unclear, consider using the Cardiomyopathy Superpanel.\r\n\r\nThis panel has been compared against the Genomics England 'Dilated Cardiomyopathy - teen and adult' panel with all discrepancies resolved and reciprocal feedback provided to Genomics England 5/8/2020.\r\n\r\nThe panel is aligned with the assessments of DCM genes by ClinGen, Jordan E et al, 2021, PMID 33947203.", "status": "public", "version": "1.66", "version_created": "2026-04-02T19:34:23.537467+11:00", "relevant_disorders": [ "Dilated cardiomyopathy", "HP:0001644" ], "stats": { "number_of_genes": 69, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:6553", "gene_name": "leptin", "omim_gene": [ "164160" ], "alias_name": null, "gene_symbol": "LEP", "hgnc_symbol": "LEP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:127881337-127897681", "ensembl_id": "ENSG00000174697" } }, "GRch38": { "90": { "location": "7:128241284-128257628", "ensembl_id": "ENSG00000174697" } } }, "hgnc_date_symbol_changed": "1993-01-26" }, "entity_type": "gene", "entity_name": "LEP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26567097", "31483094" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Obesity, morbid, due to leptin deficiency (MIM#614962)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.50", "version_created": "2026-04-12T14:14:27.453739+10:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 142, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "bA371L19.1", "hRFT2", "RFVT3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16187", "gene_name": "solute carrier family 52 member 3", "omim_gene": [ "613350" ], "alias_name": [ "hypothetical protein LOC113278" ], "gene_symbol": "SLC52A3", "hgnc_symbol": "SLC52A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:740724-749131", "ensembl_id": "ENSG00000101276" } }, "GRch38": { "90": { "location": "20:760080-776015", "ensembl_id": "ENSG00000101276" } } }, "hgnc_date_symbol_changed": "2012-02-29" }, "entity_type": "gene", "entity_name": "SLC52A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Brown-Vialetto-Van Laere syndrome 1, MIM#\t211530" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 103, "hash_id": null, "name": "Fatty Acid Oxidation Defects", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "Fatty acid oxidation disorders (FAODs) are inborn errors of metabolism caused by disruption of either mitochondrial β-oxidation or the fatty acid transport using the carnitine transport pathway. The clinical presentation of a FAOD depends on the specific disorder, but commonly includes cardiomyopathy in the newborn period, liver dysfunction and hypoketotic hypoglycaemia during infancy and childhood, and episodic rhabdomyolysis during or after adolescence.\r\n\r\nThis panel was developed and is maintained by VCGS and is a consensus panel used by RMH.\r\n\r\nIt incorporates assessments by the ClinGen Fatty Acid Oxidation Disorders Working Group, McGlaughon et al 2019, PMID: 31399326.", "status": "public", "version": "1.15", "version_created": "2025-11-20T16:48:15.748218+11:00", "relevant_disorders": [ "Abnormal circulating fatty acid concentration", "HP:0004359; Rhabdomyolysis", "HP:0003201; Hypoglycaemia", "HP:0001943" ], "stats": { "number_of_genes": 33, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4214", "gene_name": "growth differentiation factor 1", "omim_gene": [ "602880" ], "alias_name": null, "gene_symbol": "GDF1", "hgnc_symbol": "GDF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:18979361-19006905", "ensembl_id": "ENSG00000130283" } }, "GRch38": { "90": { "location": "19:18868545-18896096", "ensembl_id": "ENSG00000130283" } } }, "hgnc_date_symbol_changed": "1997-09-12" }, "entity_type": "gene", "entity_name": "GDF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32144877" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Congenital heart defects, multiple types, 6 613854", "Right atrial isomerism (Ivemark) 208530" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "tags": [], "panel": { "id": 108, "hash_id": null, "name": "Heterotaxy", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Laterality disorders and isomerism' panel V1.19, with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.45", "version_created": "2026-03-17T16:09:39.911604+11:00", "relevant_disorders": [ "Heterotaxy", "HP:0030853; Dextrocardia", "HP:0001651; Asplenia", "HP:0001746; Abnormal spatial orientation of cardiac segments", "HP:0011534; Polysplenia", "HP:0001748;Midline liver", "HP:0034188" ], "stats": { "number_of_genes": 67, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "JM2", "XPID", "AIID", "PIDX", "DIETER", "SCURFIN" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6106", "gene_name": "forkhead box P3", "omim_gene": [ "300292" ], "alias_name": null, "gene_symbol": "FOXP3", "hgnc_symbol": "FOXP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:49106897-49121288", "ensembl_id": "ENSG00000049768" } }, "GRch38": { "90": { "location": "X:49250436-49264826", "ensembl_id": "ENSG00000049768" } } }, "hgnc_date_symbol_changed": "2002-09-20" }, "entity_type": "gene", "entity_name": "FOXP3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "33637067", "30813833", "33330291" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Immunodysregulation, polyendocrinopathy, and enteropathy, X-linked, 304790" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 116, "hash_id": null, "name": "Hydrops fetalis", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThis panel has been compared with the Genomics England 100K Genomes Fetal Hydrops panel. All discrepancies have been resolved by George McGillivray and Zornitza Stark (30/12/2019), with reciprocal reviews provided to Genomics England PanelApp.", "status": "public", "version": "0.328", "version_created": "2025-07-08T23:27:02.854141+10:00", "relevant_disorders": [ "Hydrops fetalis", "HP:0001789" ], "stats": { "number_of_genes": 169, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EVEC", "UP50", "DANCE", "ARMD3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3602", "gene_name": "fibulin 5", "omim_gene": [ "604580" ], "alias_name": null, "gene_symbol": "FBLN5", "hgnc_symbol": "FBLN5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:92335756-92414331", "ensembl_id": "ENSG00000140092" } }, "GRch38": { "90": { "location": "14:91869412-91947987", "ensembl_id": "ENSG00000140092" } } }, "hgnc_date_symbol_changed": "1999-06-25" }, "entity_type": "gene", "entity_name": "FBLN5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12618961", "3232707", "22829427", "11805835", "32757322", "31945625", "23328402", "28332470" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cutis laxa, autosomal recessive, type IA, MIM#219100", "Neuropathy, hereditary, with or without age-related macular degeneration (MIM#608895)" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZP434G232", "LI2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14637", "gene_name": "ATP binding cassette subfamily A member 12", "omim_gene": [ "607800" ], "alias_name": null, "gene_symbol": "ABCA12", "hgnc_symbol": "ABCA12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:215796266-216003151", "ensembl_id": "ENSG00000144452" } }, "GRch38": { "90": { "location": "2:214931542-215138428", "ensembl_id": "ENSG00000144452" } } }, "hgnc_date_symbol_changed": "2001-08-16" }, "entity_type": "gene", "entity_name": "ABCA12", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31168818", "19664001", "31489029" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Ichthyosis, congenital, autosomal recessive 4A (MIM#601277)", "Ichthyosis, congenital, autosomal recessive 4B (harlequin) (MIM#242500)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ARP5", "AGF" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23140", "gene_name": "angiopoietin like 6", "omim_gene": [ "609336" ], "alias_name": [ "angiopoietin-related protein 5" ], "gene_symbol": "ANGPTL6", "hgnc_symbol": "ANGPTL6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:10203014-10213472", "ensembl_id": "ENSG00000130812" } }, "GRch38": { "90": { "location": "19:10092338-10102796", "ensembl_id": "ENSG00000130812" } } }, "hgnc_date_symbol_changed": "2003-09-24" }, "entity_type": "gene", "entity_name": "ANGPTL6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29304371" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cerebral aneurysm" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CAMI", "PHKD", "DD132" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1442", "gene_name": "calmodulin 1", "omim_gene": [ "114180" ], "alias_name": [ "prepro-calmodulin 1", "phosphorylase kinase subunit delta" ], "gene_symbol": "CALM1", "hgnc_symbol": "CALM1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:90862846-90874605", "ensembl_id": "ENSG00000198668" } }, "GRch38": { "90": { "location": "14:90396502-90408261", "ensembl_id": "ENSG00000198668" } } }, "hgnc_date_symbol_changed": "1991-06-05" }, "entity_type": "gene", "entity_name": "CALM1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31170290" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Long QT syndrome 14 MIM#616247", "Ventricular tachycardia, catecholaminergic polymorphic, 4 MIM#614916" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TRA2.10", "MGC26544", "TLX" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6953", "gene_name": "CD46 molecule", "omim_gene": [ "120920" ], "alias_name": null, "gene_symbol": "CD46", "hgnc_symbol": "CD46", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:207925402-207968858", "ensembl_id": "ENSG00000117335" } }, "GRch38": { "90": { "location": "1:207752057-207795513", "ensembl_id": "ENSG00000117335" } } }, "hgnc_date_symbol_changed": "2006-02-09" }, "entity_type": "gene", "entity_name": "CD46", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20301541", "26054645", "26826462" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "{Hemolytic uremic syndrome, atypical, susceptibility to, 2} MIM#612922" ], "mode_of_inheritance": "BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2570", "gene_name": "cytochrome b5 type A", "omim_gene": [ "613218" ], "alias_name": null, "gene_symbol": "CYB5A", "hgnc_symbol": "CYB5A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:71920530-71959251", "ensembl_id": "ENSG00000166347" } }, "GRch38": { "90": { "location": "18:74250847-74292016", "ensembl_id": "ENSG00000166347" } } }, "hgnc_date_symbol_changed": "2006-01-30" }, "entity_type": "gene", "entity_name": "CYB5A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22170710", "32051920" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Methemoglobinaemia and ambiguous genitalia, MIM# 250790" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC33662" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28510", "gene_name": "GLIS family zinc finger 3", "omim_gene": [ "610192" ], "alias_name": null, "gene_symbol": "GLIS3", "hgnc_symbol": "GLIS3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:3824127-4348392", "ensembl_id": "ENSG00000107249" } }, "GRch38": { "90": { "location": "9:3824127-4348392", "ensembl_id": "ENSG00000107249" } } }, "hgnc_date_symbol_changed": "2004-07-16" }, "entity_type": "gene", "entity_name": "GLIS3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21139041", "35410112", "35394098", "34093443" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Diabetes mellitus, neonatal, with congenital hypothyroidism, MIM#610199" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "IGVPB", "IGL5", "14.1", "CD179B" ], "biotype": "protein_coding", "hgnc_id": "HGNC:5870", "gene_name": "immunoglobulin lambda like polypeptide 1", "omim_gene": [ "146770" ], "alias_name": [ "lambda 5" ], "gene_symbol": "IGLL1", "hgnc_symbol": "IGLL1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:23915312-23922495", "ensembl_id": "ENSG00000128322" } }, "GRch38": { "90": { "location": "22:23573125-23580308", "ensembl_id": "ENSG00000128322" } } }, "hgnc_date_symbol_changed": "1991-09-12" }, "entity_type": "gene", "entity_name": "IGLL1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "9419212", "25502423", "27576013" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Agammaglobulinaemia 2, MIM# 613500" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NTE", "sws", "iPLA2delta", "SPG39" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16268", "gene_name": "patatin like phospholipase domain containing 6", "omim_gene": [ "603197" ], "alias_name": [ "neuropathy target esterase" ], "gene_symbol": "PNPLA6", "hgnc_symbol": "PNPLA6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:7598890-7626650", "ensembl_id": "ENSG00000032444" } }, "GRch38": { "90": { "location": "19:7534004-7561764", "ensembl_id": "ENSG00000032444" } } }, "hgnc_date_symbol_changed": "2006-07-05" }, "entity_type": "gene", "entity_name": "PNPLA6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25480986", "24355708", "33818269", "32758583", "30097146" ], "evidence": [ "Expert Review Green", "Expert list", "Expert Review Green", "Expert Review Green", "Expert list", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155", "Spastic paraplegia 39, autosomal recessive MIM#612020" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "dJ257A7.3", "FLJ32666" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21066", "gene_name": "TBC1 domain family member 7", "omim_gene": [ "612655" ], "alias_name": [ "TS complex subunit 3" ], "gene_symbol": "TBC1D7", "hgnc_symbol": "TBC1D7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:13266774-13328815", "ensembl_id": "ENSG00000145979" } }, "GRch38": { "90": { "location": "6:13266542-13328583", "ensembl_id": "ENSG00000145979" } } }, "hgnc_date_symbol_changed": "2003-05-14" }, "entity_type": "gene", "entity_name": "TBC1D7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24515783", "23687350", "36669495" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Macrocephaly/megalencephaly syndrome, autosomal recessive, MIM# 248000" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "APP3", "NPHPL1", "ICP55" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28052", "gene_name": "X-prolyl aminopeptidase 3", "omim_gene": [ "613553" ], "alias_name": [ "Intermediate Cleaving Peptidase 55" ], "gene_symbol": "XPNPEP3", "hgnc_symbol": "XPNPEP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:41253081-41363838", "ensembl_id": "ENSG00000196236" } }, "GRch38": { "90": { "location": "22:40857077-40932815", "ensembl_id": "ENSG00000196236" } } }, "hgnc_date_symbol_changed": "2006-08-02" }, "entity_type": "gene", "entity_name": "XPNPEP3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20179356" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Nephronophthisis-like nephropathy 1, OMIM #613159" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "dJ553F4.3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15992", "gene_name": "zinc finger protein 341", "omim_gene": null, "alias_name": null, "gene_symbol": "ZNF341", "hgnc_symbol": "ZNF341", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:32319463-32380075", "ensembl_id": "ENSG00000131061" } }, "GRch38": { "90": { "location": "20:33731657-33792269", "ensembl_id": "ENSG00000131061" } } }, "hgnc_date_symbol_changed": "2001-09-17" }, "entity_type": "gene", "entity_name": "ZNF341", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29907691", "29907690" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Hyper-IgE recurrent infection syndrome 3, autosomal recessive, MIM# 618282", "Mild facial dysmorphism", "Early onset eczema", "Recurrent bacterial skin infections, abscesses", "Recurrent respiratory infections, lung abscesses and pneumothoraces", "Hyperextensible joints, bone fractures, retention of primary teeth" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SBF", "pHZ-1", "STAF" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12928", "gene_name": "zinc finger protein 143", "omim_gene": [ "603433" ], "alias_name": null, "gene_symbol": "ZNF143", "hgnc_symbol": "ZNF143", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:9481866-9550071", "ensembl_id": "ENSG00000166478" } }, "GRch38": { "90": { "location": "11:9460319-9528524", "ensembl_id": "ENSG00000166478" } } }, "hgnc_date_symbol_changed": "1993-06-07" }, "entity_type": "gene", "entity_name": "ZNF143", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "27349184" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Combined methylmalonic acidemia and homocystinuria, cblX like 1, MONDO:0002012, ZNF143-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "CD51" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6150", "gene_name": "integrin subunit alpha V", "omim_gene": [ "193210" ], "alias_name": null, "gene_symbol": "ITGAV", "hgnc_symbol": "ITGAV", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:187454792-187545628", "ensembl_id": "ENSG00000138448" } }, "GRch38": { "90": { "location": "2:186590065-186680901", "ensembl_id": "ENSG00000138448" } } }, "hgnc_date_symbol_changed": "1988-07-19" }, "entity_type": "gene", "entity_name": "ITGAV", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "39526957" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with speech delay and behavioural abnormalities, MIM# 621372" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "eIF3k", "PRO1474", "HSPC029", "PTD001", "PLAC-24", "M9", "ARG134" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24656", "gene_name": "eukaryotic translation initiation factor 3 subunit K", "omim_gene": [ "609596" ], "alias_name": null, "gene_symbol": "EIF3K", "hgnc_symbol": "EIF3K", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:39109735-39127595", "ensembl_id": "ENSG00000178982" } }, "GRch38": { "90": { "location": "19:38619082-38636955", "ensembl_id": "ENSG00000178982" } } }, "hgnc_date_symbol_changed": "2007-07-27" }, "entity_type": "gene", "entity_name": "EIF3K", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40219605" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "EIF3K-related neurodevelopmental disorder, MONDO:0700092" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FXY2", "TRIM1", "RNF60", "MRX101" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7096", "gene_name": "midline 2", "omim_gene": [ "300204" ], "alias_name": null, "gene_symbol": "MID2", "hgnc_symbol": "MID2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:107068985-107170423", "ensembl_id": "ENSG00000080561" } }, "GRch38": { "90": { "location": "X:107825755-107927193", "ensembl_id": "ENSG00000080561" } } }, "hgnc_date_symbol_changed": "1999-08-25" }, "entity_type": "gene", "entity_name": "MID2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "24115387" ], "evidence": [ "Literature" ], "phenotypes": [ "non-syndromic X-linked intellectual disability MONDO:0019181" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4739", "version_created": "2026-04-12T14:08:16.491946+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 6013, "number_of_strs": 43, "number_of_regions": 7 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "hCAP-D3", "CAP-D3", "hHCP-6", "KIAA0056", "FLJ42888", "hcp-6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28952", "gene_name": "non-SMC condensin II complex subunit D3", "omim_gene": [ "609276" ], "alias_name": null, "gene_symbol": "NCAPD3", "hgnc_symbol": "NCAPD3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:134020014-134095348", "ensembl_id": "ENSG00000151503" } }, "GRch38": { "90": { "location": "11:134150119-134225454", "ensembl_id": "ENSG00000151503" } } }, "hgnc_date_symbol_changed": "2006-09-04" }, "entity_type": "gene", "entity_name": "NCAPD3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27737959" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Microcephaly 22, primary, autosomal recessive, MIM# 617984" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 138, "hash_id": null, "name": "Microcephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with primary microcephaly as well as complex disorders where microcephaly is a significant feature, generally where reported >-3SD.\r\n\r\nThis panel has been compared against the Genomics England 'Severe microcephaly' panel V2.2 with all discrepancies resolved and reciprocal feedback provided to Genomics England, September 2020.", "status": "public", "version": "1.427", "version_created": "2026-04-02T17:28:09.565635+11:00", "relevant_disorders": [ "Microcephaly", "HP:0000252" ], "stats": { "number_of_genes": 383, "number_of_strs": 0, "number_of_regions": 8 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "pHZ-44" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12926", "gene_name": "zinc finger protein 141", "omim_gene": [ "194648" ], "alias_name": null, "gene_symbol": "ZNF141", "hgnc_symbol": "ZNF141", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:331603-378653", "ensembl_id": "ENSG00000131127" } }, "GRch38": { "90": { "location": "4:337814-384864", "ensembl_id": "ENSG00000131127" } } }, "hgnc_date_symbol_changed": "1993-02-11" }, "entity_type": "gene", "entity_name": "ZNF141", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23160277" ], "evidence": [ "Expert Review Red", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Polydactyly, postaxial, type A6, MIM# 615226" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 159, "hash_id": null, "name": "Polydactyly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS. It contains genes that cause syndromic and non-syndromic polydactyly.", "status": "public", "version": "0.301", "version_created": "2026-03-12T11:30:58.449890+11:00", "relevant_disorders": [ "Polydactyly", "HP:0010442" ], "stats": { "number_of_genes": 141, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0036", "NPHP5", "SLSN5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28949", "gene_name": "IQ motif containing B1", "omim_gene": [ "609237" ], "alias_name": [ "nephrocystin-5" ], "gene_symbol": "IQCB1", "hgnc_symbol": "IQCB1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:121488610-121553926", "ensembl_id": "ENSG00000173226" } }, "GRch38": { "90": { "location": "3:121769763-121835079", "ensembl_id": "ENSG00000173226" } } }, "hgnc_date_symbol_changed": "2004-03-05" }, "entity_type": "gene", "entity_name": "IQCB1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15723066", "21220633", "20881296", "21901789", "33512896", "33535056", "29219953" ], "evidence": [ "Expert Review Green", "KidGen_CilioNephronop v38.1.0" ], "phenotypes": [ "Senior-Loken syndrome 5, MIM# 609254", "MONDO:0012225" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 193, "hash_id": null, "name": "Renal Ciliopathies and Nephronophthisis", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel was created by the KidGen consortium and is a consensus panel used by VCGS and KidGen", "status": "public", "version": "1.53", "version_created": "2026-03-19T17:14:29.802874+11:00", "relevant_disorders": [ "Abnormality of renal medullary morphology", "HP:0025361; Renal cyst", "HP:0000107" ], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ36928", "NPHP16" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26724", "gene_name": "ankyrin repeat and sterile alpha motif domain containing 6", "omim_gene": [ "615370" ], "alias_name": null, "gene_symbol": "ANKS6", "hgnc_symbol": "ANKS6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:101493611-101559247", "ensembl_id": "ENSG00000165138" } }, "GRch38": { "90": { "location": "9:98731329-98796965", "ensembl_id": "ENSG00000165138" } } }, "hgnc_date_symbol_changed": "2006-02-17" }, "entity_type": "gene", "entity_name": "ANKS6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23793029", "31678577", "31635528", "26039630", "24610927" ], "evidence": [ "Expert Review Green", "KidGen_CilioNephronop v38.1.0" ], "phenotypes": [ "Nephronophthisis 16, MIM# 615382", "MONDO:0014158" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 193, "hash_id": null, "name": "Renal Ciliopathies and Nephronophthisis", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel was created by the KidGen consortium and is a consensus panel used by VCGS and KidGen", "status": "public", "version": "1.53", "version_created": "2026-03-19T17:14:29.802874+11:00", "relevant_disorders": [ "Abnormality of renal medullary morphology", "HP:0025361; Renal cyst", "HP:0000107" ], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CST6", "PME" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2482", "gene_name": "cystatin B", "omim_gene": [ "601145" ], "alias_name": [ "stefin B" ], "gene_symbol": "CSTB", "hgnc_symbol": "CSTB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "21:45192393-45196326", "ensembl_id": "ENSG00000160213" } }, "GRch38": { "90": { "location": "21:43772511-43776445", "ensembl_id": "ENSG00000160213" } } }, "hgnc_date_symbol_changed": "1996-12-12" }, "entity_type": "gene", "entity_name": "CSTB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32920378", "18028412" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship" ], "phenotypes": [ "Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "5'UTR", "STR" ], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AYP1", "AGS3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24116", "gene_name": "ribonuclease H2 subunit C", "omim_gene": [ "610330" ], "alias_name": [ "Aicardi-Goutieres syndrome 3" ], "gene_symbol": "RNASEH2C", "hgnc_symbol": "RNASEH2C", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:65482367-65488418", "ensembl_id": "ENSG00000172922" } }, "GRch38": { "90": { "location": "11:65714896-65720947", "ensembl_id": "ENSG00000172922" } } }, "hgnc_date_symbol_changed": "2006-08-17" }, "entity_type": "gene", "entity_name": "RNASEH2C", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24183309", "23322642" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship" ], "phenotypes": [ "Aicardi-Goutieres syndrome 3 (MIM# 610329)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EFGM", "GFM", "EGF1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13780", "gene_name": "G elongation factor mitochondrial 1", "omim_gene": [ "606639" ], "alias_name": null, "gene_symbol": "GFM1", "hgnc_symbol": "GFM1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:158362067-158410364", "ensembl_id": "ENSG00000168827" } }, "GRch38": { "90": { "location": "3:158644278-158692575", "ensembl_id": "ENSG00000168827" } } }, "hgnc_date_symbol_changed": "2004-11-25" }, "entity_type": "gene", "entity_name": "GFM1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31680380", "25852744", "26937387" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship" ], "phenotypes": [ "Combined oxidative phosphorylation deficiency 1 MIM#609060" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZp761A052", "DUBA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25402", "gene_name": "OTU deubiquitinase 5", "omim_gene": [ "300713" ], "alias_name": null, "gene_symbol": "OTUD5", "hgnc_symbol": "OTUD5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:48779305-48815648", "ensembl_id": "ENSG00000068308" } }, "GRch38": { "90": { "location": "X:48922028-48958386", "ensembl_id": "ENSG00000068308" } } }, "hgnc_date_symbol_changed": "2005-09-28" }, "entity_type": "gene", "entity_name": "OTUD5", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID:33748114" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Multiple congenital anomalies-neurodevelopmental syndrome, X-linked, MIM# 301056" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4208", "gene_name": "glycine cleavage system protein H", "omim_gene": [ "238330" ], "alias_name": [ "lipoic acid-containing protein" ], "gene_symbol": "GCSH", "hgnc_symbol": "GCSH", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:81115566-81130008", "ensembl_id": "ENSG00000140905" } }, "GRch38": { "90": { "location": "16:81081938-81096425", "ensembl_id": "ENSG00000140905" } } }, "hgnc_date_symbol_changed": "1992-04-08" }, "entity_type": "gene", "entity_name": "GCSH", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33890291", "36190515" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Multiple mitochondrial dysfunctions syndrome 7, MIM#\t620423" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "bA371L19.1", "hRFT2", "RFVT3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16187", "gene_name": "solute carrier family 52 member 3", "omim_gene": [ "613350" ], "alias_name": [ "hypothetical protein LOC113278" ], "gene_symbol": "SLC52A3", "hgnc_symbol": "SLC52A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:740724-749131", "ensembl_id": "ENSG00000101276" } }, "GRch38": { "90": { "location": "20:760080-776015", "ensembl_id": "ENSG00000101276" } } }, "hgnc_date_symbol_changed": "2012-02-29" }, "entity_type": "gene", "entity_name": "SLC52A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29053833", "29193829" ], "evidence": [ "Expert Review Green", "Expert Review Green", "NHS GMS", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Brown-Vialetto-Van Laere syndrome 1 MIM#211530" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ZGRF7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11992", "gene_name": "DNA topoisomerase III alpha", "omim_gene": [ "601243" ], "alias_name": [ "zinc finger, GRF-type containing 7" ], "gene_symbol": "TOP3A", "hgnc_symbol": "TOP3A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:18174742-18218321", "ensembl_id": "ENSG00000177302" } }, "GRch38": { "90": { "location": "17:18271428-18315007", "ensembl_id": "ENSG00000177302" } } }, "hgnc_date_symbol_changed": "1999-03-18" }, "entity_type": "gene", "entity_name": "TOP3A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30057030", "33631320", "29290614" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Mitochondrial Flagship" ], "phenotypes": [ "Microcephaly, growth restriction, and increased sister chromatid exchange 2, MIM# 618097", "Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 5, MIM#618098" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC26694" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28380", "gene_name": "solute carrier family 25 member 42", "omim_gene": [ "610823" ], "alias_name": null, "gene_symbol": "SLC25A42", "hgnc_symbol": "SLC25A42", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:19174808-19223697", "ensembl_id": "ENSG00000181035" } }, "GRch38": { "90": { "location": "19:19063999-19112888", "ensembl_id": "ENSG00000181035" } } }, "hgnc_date_symbol_changed": "2006-09-21" }, "entity_type": "gene", "entity_name": "SLC25A42", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26541337", "29327420", "29923093", "34258143" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Mitochondrial Flagship" ], "phenotypes": [ "Metabolic crises, recurrent, with variable encephalomyopathic features and neurologic regression , MIM#618416" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "founder" ], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:6971", "gene_name": "malate dehydrogenase 2", "omim_gene": [ "154100" ], "alias_name": null, "gene_symbol": "MDH2", "hgnc_symbol": "MDH2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:75677369-75696826", "ensembl_id": "ENSG00000146701" } }, "GRch38": { "90": { "location": "7:76048051-76067508", "ensembl_id": "ENSG00000146701" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "MDH2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "34766628", "27989324" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Mitochondrial Flagship" ], "phenotypes": [ "Developmental and epileptic encephalopathy 51 MIM#617339" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "HLC-8", "MIG3", "FLJ20721", "SPEP1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29601", "gene_name": "chromosome 17 open reading frame 80", "omim_gene": null, "alias_name": [ "sperm-expressed protein 1", "migration-inducing protein 3" ], "gene_symbol": "C17orf80", "hgnc_symbol": "C17orf80", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:71228372-71245091", "ensembl_id": "ENSG00000141219" } }, "GRch38": { "90": { "location": "17:73232233-73248947", "ensembl_id": "ENSG00000141219" } } }, "hgnc_date_symbol_changed": "2012-02-24" }, "entity_type": "gene", "entity_name": "C17orf80", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "41720819" ], "evidence": [ "Expert Review Amber", "Literature", "Literature" ], "phenotypes": [ "Mitochondrial disease, MONDO:0044970" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "new gene name" ], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 438, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11367", "gene_name": "signal transducer and activator of transcription 5B", "omim_gene": [ "604260" ], "alias_name": null, "gene_symbol": "STAT5B", "hgnc_symbol": "STAT5B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:40351186-40428725", "ensembl_id": "ENSG00000173757" } }, "GRch38": { "90": { "location": "17:42199168-42276707", "ensembl_id": "ENSG00000173757" } } }, "hgnc_date_symbol_changed": "1997-01-28" }, "entity_type": "gene", "entity_name": "STAT5B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "29844444" ], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance Immunology Flagship", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Growth hormone insensitivity with immunodeficiency, MIM# 245590" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [ "somatic" ], "panel": { "id": 223, "hash_id": null, "name": "Combined Immunodeficiency", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause combined immunodeficiencies with associated or syndromic features, including genes classified by the International Union of Immunological Societies Inborn Errors of Immunity Committee (July 2024 update). These include genes that fall into the following subcategories:\r\n- Immunodeficiency with Congenital Thrombocytopenia\r\n- DNA Repair Defects\r\n- Thymic Defects with Additional Congenital Anomalies\r\n- Immuno-osseous Dysplasias\r\n- Hyper IgE Syndromes (HIES)\r\n- Defects of Vitamin B12 and Folate Metabolism\r\n- Anhidrotic Ectodermodysplasia with Immunodeficiency (EDA-ID)\r\n- Calcium Channel Defects\r\n- Other Combined immunodeficiencies with syndromic features\r\n- Combined Immunodeficiencies Generally Less Profound than Severe Combined Immunodeficiency (Immunodeficiencies affecting cellular and humoral immunity)\r\n\r\nThis panel was originally developed by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital) for the Melbourne Genomics Immunology Flagship.", "status": "public", "version": "1.145", "version_created": "2026-03-02T21:55:19.238904+11:00", "relevant_disorders": [ "Combined immunodeficiency", "MONDO:0015131; Combined immunodeficiency", "HP:0005387" ], "stats": { "number_of_genes": 170, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ACA31", "SNORA31A" ], "biotype": "snoRNA", "hgnc_id": "HGNC:32621", "gene_name": "small nucleolar RNA, H/ACA box 31", "omim_gene": null, "alias_name": null, "gene_symbol": "SNORA31", "hgnc_symbol": "SNORA31", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:45911615-45911744", "ensembl_id": "ENSG00000199477" } }, "GRch38": { "90": { "location": "13:45337480-45337609", "ensembl_id": "ENSG00000199477" } } }, "hgnc_date_symbol_changed": "2006-04-04" }, "entity_type": "gene", "entity_name": "SNORA31", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31806906" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "{Encephalopathy, acute, infection-induced (herpes-specific), susceptibility to, 1}, MIM#\t619396" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "non-coding gene" ], "panel": { "id": 237, "hash_id": null, "name": "Susceptibility to Viral Infections", "disease_group": "Immunological disorders", "disease_sub_group": "", "description": "This panel was originally developed for the Melbourne Genomics Immunology Flagship by Dr Vanessa Bryant (Walter and Eliza Hall Institute) and Dr Charlotte Slade (Royal Melbourne Hospital). It is currently maintained by VCGS.\r\n\r\nUpdated with the 2019 International Union of Immunological Societies Committee classification, Tangye et al. 2019 and the COVID Human Genetic Effort list, Casanova et al 2020.", "status": "public", "version": "1.10", "version_created": "2026-03-26T15:17:02.053015+11:00", "relevant_disorders": [ "Recurrent viral infections", "HP:0004429; Severe viral infection", "HP:0031691" ], "stats": { "number_of_genes": 54, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SCS", "H-twist", "BPES2", "bHLHa38", "CRS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12428", "gene_name": "twist family bHLH transcription factor 1", "omim_gene": [ "601622" ], "alias_name": [ "Saethre-Chotzen syndrome" ], "gene_symbol": "TWIST1", "hgnc_symbol": "TWIST1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:19060614-19157295", "ensembl_id": "ENSG00000122691" } }, "GRch38": { "90": { "location": "7:19020991-19117672", "ensembl_id": "ENSG00000122691" } } }, "hgnc_date_symbol_changed": "2003-03-28" }, "entity_type": "gene", "entity_name": "TWIST1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20301368" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Saethre-Chotzen syndrome MONDO:0007042" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MRT2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30185", "gene_name": "cereblon", "omim_gene": [ "609262" ], "alias_name": null, "gene_symbol": "CRBN", "hgnc_symbol": "CRBN", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:3190676-3221394", "ensembl_id": "ENSG00000113851" } }, "GRch38": { "90": { "location": "3:3144628-3179727", "ensembl_id": "ENSG00000113851" } } }, "hgnc_date_symbol_changed": "2004-05-19" }, "entity_type": "gene", "entity_name": "CRBN", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15557513", "28143899" ], "evidence": [ "Expert Review Amber", "Genetic Health Queensland" ], "phenotypes": [ "Intellectual developmental disorder, autosomal recessive 2, MIM# 607417" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PKBG", "RAC-gamma", "PRKBG" ], "biotype": "protein_coding", "hgnc_id": "HGNC:393", "gene_name": "AKT serine/threonine kinase 3", "omim_gene": [ "611223" ], "alias_name": [ "protein kinase B, gamma" ], "gene_symbol": "AKT3", "hgnc_symbol": "AKT3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:243651535-244014381", "ensembl_id": "ENSG00000117020" } }, "GRch38": { "90": { "location": "1:243488233-243851079", "ensembl_id": "ENSG00000117020" } } }, "hgnc_date_symbol_changed": "1999-11-16" }, "entity_type": "gene", "entity_name": "AKT3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22729224", "22729223", "35665751", "34354878", "32446860", "31441589" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2, MIM# 615937" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MBS", "M130" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7618", "gene_name": "protein phosphatase 1 regulatory subunit 12A", "omim_gene": [ "602021" ], "alias_name": [ "myosin phosphatase-targeting subunit 1", "myosin binding subunit" ], "gene_symbol": "PPP1R12A", "hgnc_symbol": "PPP1R12A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:80167343-80329240", "ensembl_id": "ENSG00000058272" } }, "GRch38": { "90": { "location": "12:79773563-79935460", "ensembl_id": "ENSG00000058272" } } }, "hgnc_date_symbol_changed": "2001-08-10" }, "entity_type": "gene", "entity_name": "PPP1R12A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31883643" ], "evidence": [ "Expert Review Green", "Research" ], "phenotypes": [ "Genitourinary and/or/brain malformation syndrome MIM#618820" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4816", "gene_name": "histidyl-tRNA synthetase", "omim_gene": [ "142810" ], "alias_name": [ "histidine tRNA ligase 1, cytoplasmic" ], "gene_symbol": "HARS", "hgnc_symbol": "HARS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:140052758-140071609", "ensembl_id": "ENSG00000170445" } }, "GRch38": { "90": { "location": "5:140673173-140692024", "ensembl_id": "ENSG00000170445" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "HARS", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32333447" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "multisystem ataxic syndrome", "mild-severe intellectual disability" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "Ipi3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17956", "gene_name": "WD repeat domain 18", "omim_gene": null, "alias_name": [ "Involved in Processing ITS2 3 homolog (S. cerevisiae)" ], "gene_symbol": "WDR18", "hgnc_symbol": "WDR18", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:983174-994569", "ensembl_id": "ENSG00000065268" } }, "GRch38": { "90": { "location": "19:984271-998438", "ensembl_id": "ENSG00000065268" } } }, "hgnc_date_symbol_changed": "2002-01-10" }, "entity_type": "gene", "entity_name": "WDR18", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 40677927" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Cornelia de Lange syndrome - MONDO:0016033" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DKFZp564B176", "SRrp86", "SRrp508" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17882", "gene_name": "splicing regulatory glutamic acid and lysine rich protein 1", "omim_gene": [ "609268" ], "alias_name": [ "serine-arginine-rich splicing regulatory protein 508" ], "gene_symbol": "SREK1", "hgnc_symbol": "SREK1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:65435799-65479443", "ensembl_id": "ENSG00000153914" } }, "GRch38": { "90": { "location": "5:66139971-66183615", "ensembl_id": "ENSG00000153914" } } }, "hgnc_date_symbol_changed": "2010-09-08" }, "entity_type": "gene", "entity_name": "SREK1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "40549565" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Prader-Willi-like syndrome, SREK1-related MONDO:0008300" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BAF155", "SRG3", "Rsc8", "CRACC1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11104", "gene_name": "SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1", "omim_gene": [ "601732" ], "alias_name": null, "gene_symbol": "SMARCC1", "hgnc_symbol": "SMARCC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:47626762-47823596", "ensembl_id": "ENSG00000173473" } }, "GRch38": { "90": { "location": "3:47585272-47782106", "ensembl_id": "ENSG00000173473" } } }, "hgnc_date_symbol_changed": "1998-05-15" }, "entity_type": "gene", "entity_name": "SMARCC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29983323", "37285932" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "SMARCC1-associated developmental dysgenesis syndrome (MONDO:0700123)" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZp761A0620", "FLJ11413" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19405", "gene_name": "piggyBac transposable element derived 5", "omim_gene": [ "616791" ], "alias_name": null, "gene_symbol": "PGBD5", "hgnc_symbol": "PGBD5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:230457392-230561475", "ensembl_id": "ENSG00000177614" } }, "GRch38": { "90": { "location": "1:230314482-230426371", "ensembl_id": "ENSG00000177614" } } }, "hgnc_date_symbol_changed": "2002-10-23" }, "entity_type": "gene", "entity_name": "PGBD5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "41533792" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM#\t621482" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "HCA127" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24931", "gene_name": "zinc finger C4H2-type containing", "omim_gene": [ "300897" ], "alias_name": null, "gene_symbol": "ZC4H2", "hgnc_symbol": "ZC4H2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:64136250-64254593", "ensembl_id": "ENSG00000126970" } }, "GRch38": { "90": { "location": "X:64915802-65034713", "ensembl_id": "ENSG00000126970" } } }, "hgnc_date_symbol_changed": "2008-10-01" }, "entity_type": "gene", "entity_name": "ZC4H2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23623388", "34322088", "33949289", "31885220", "31206972" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Wieacker-Wolff syndrome, MIM# 314580" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ16237" ], "biotype": "protein_coding", "hgnc_id": "HGNC:33784", "gene_name": "alkylglycerol monooxygenase", "omim_gene": [ "613738" ], "alias_name": null, "gene_symbol": "AGMO", "hgnc_symbol": "AGMO", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:15239943-15601640", "ensembl_id": "ENSG00000187546" } }, "GRch38": { "90": { "location": "7:15200318-15562015", "ensembl_id": "ENSG00000187546" } } }, "hgnc_date_symbol_changed": "2011-01-31" }, "entity_type": "gene", "entity_name": "AGMO", "confidence_level": "3", "penetrance": "Complete", "mode_of_pathogenicity": null, "publications": [ "31555905", "27000257" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, AGMO-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FBP21", "MGC117310" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12739", "gene_name": "WW domain binding protein 4", "omim_gene": [ "604981" ], "alias_name": [ "formin binding protein 21" ], "gene_symbol": "WBP4", "hgnc_symbol": "WBP4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:41635410-41658137", "ensembl_id": "ENSG00000120688" } }, "GRch38": { "90": { "location": "13:41061274-41084006", "ensembl_id": "ENSG00000120688" } } }, "hgnc_date_symbol_changed": "1999-09-16" }, "entity_type": "gene", "entity_name": "WBP4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "37963460" ], "evidence": [ "Expert Review Green", "Other" ], "phenotypes": [ "Neurodevelopmental disorder, MONDO:0700092, WBP4-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.749", "version_created": "2026-04-12T14:10:53.388284+10:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "dJ322G13.2", "ZBTB23" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15808", "gene_name": "GDNF inducible zinc finger protein 1", "omim_gene": [ "613842" ], "alias_name": null, "gene_symbol": "GZF1", "hgnc_symbol": "GZF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:23342787-23353700", "ensembl_id": "ENSG00000125812" } }, "GRch38": { "90": { "location": "20:23362182-23373063", "ensembl_id": "ENSG00000125812" } } }, "hgnc_date_symbol_changed": "2006-09-19" }, "entity_type": "gene", "entity_name": "GZF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "28475863", "33009817" ], "evidence": [ "Expert Review Green", "Literature", "NHS GMS" ], "phenotypes": [ "Joint laxity, short stature, and myopia, MIM# 617662", "Larsen-like syndrome" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "IGFBP8", "CCN2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2500", "gene_name": "connective tissue growth factor", "omim_gene": [ "121009" ], "alias_name": null, "gene_symbol": "CTGF", "hgnc_symbol": "CTGF", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:132269316-132272513", "ensembl_id": "ENSG00000118523" } }, "GRch38": { "90": { "location": "6:131948176-131951373", "ensembl_id": "ENSG00000118523" } } }, "hgnc_date_symbol_changed": "1992-12-01" }, "entity_type": "gene", "entity_name": "CTGF", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "39506047" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Kyphomelic dysplasia MONDO:0008881", "Spondyloepimetaphyseal dysplasia MONDO:0100510" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20071", "DMC", "SMC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21317", "gene_name": "dymeclin", "omim_gene": [ "607461" ], "alias_name": null, "gene_symbol": "DYM", "hgnc_symbol": "DYM", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:46570039-46987717", "ensembl_id": "ENSG00000141627" } }, "GRch38": { "90": { "location": "18:49041474-49461347", "ensembl_id": "ENSG00000141627" } } }, "hgnc_date_symbol_changed": "2005-01-05" }, "entity_type": "gene", "entity_name": "DYM", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert Review Green", "NHS GMS", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Smith-McCort dysplasia 607326", "Dyggve-Melchior-Clausen disease 223800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MER5", "AOP-1", "SP-22" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9354", "gene_name": "peroxiredoxin 3", "omim_gene": [ "604769" ], "alias_name": null, "gene_symbol": "PRDX3", "hgnc_symbol": "PRDX3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:120927215-120938345", "ensembl_id": "ENSG00000165672" } }, "GRch38": { "90": { "location": "10:119167703-119178833", "ensembl_id": "ENSG00000165672" } } }, "hgnc_date_symbol_changed": "1999-08-12" }, "entity_type": "gene", "entity_name": "PRDX3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33889951" ], "evidence": [ "Expert Review Green", "Literature", "Literature" ], "phenotypes": [ "Cerebellar ataxia MONDO:0000437, PRDX3-related" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.203", "version_created": "2026-04-07T13:48:57.123718+10:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 3 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7828", "gene_name": "nitrilase 1", "omim_gene": [ "604618" ], "alias_name": null, "gene_symbol": "NIT1", "hgnc_symbol": "NIT1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:161087876-161095235", "ensembl_id": "ENSG00000158793" } }, "GRch38": { "90": { "location": "1:161118086-161125445", "ensembl_id": "ENSG00000158793" } } }, "hgnc_date_symbol_changed": "1998-04-27" }, "entity_type": "gene", "entity_name": "NIT1", "confidence_level": "3", "penetrance": "unknown", "mode_of_pathogenicity": null, "publications": [ "38430071" ], "evidence": [ "Literature", "Expert Review Green", "Literature" ], "phenotypes": [ "Brain small vessel disease 4, MIM# 621313" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 290, "hash_id": null, "name": "Dystonia and Chorea", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause various types of dystonia and chorea. Including the following:\r\n- Movement disorders where chorea is a prominent feature\r\n- Isolated dystonia is classified as dystonia as the only motor feature except for possible tremor\r\n- Combined dystonia is classified as dystonia with another movement disorder\r\n- Complex dystonia, where dystonia and overlapping hyperkinetic movement disorders (e.g. chorea, myoclonus) co-occur with other neurologic or systemic manifestations, including developmental disability. Dystonia is not necessarily the most prominent disease manifestation and may even be an inconsistent feature.", "status": "public", "version": "0.344", "version_created": "2026-04-06T11:07:45.734922+10:00", "relevant_disorders": [ "Dystonia", "HP:0001332; Chorea", "HP:0002072" ], "stats": { "number_of_genes": 198, "number_of_strs": 9, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1605", "AD035", "DKFZp762K054" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18986", "gene_name": "glucosylceramidase beta 2", "omim_gene": [ "609471" ], "alias_name": [ "bile acid beta-glucosidase", "non-lysosomal glucosylceramidase" ], "gene_symbol": "GBA2", "hgnc_symbol": "GBA2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:35736863-35749983", "ensembl_id": "ENSG00000070610" } }, "GRch38": { "90": { "location": "9:35736866-35749228", "ensembl_id": "ENSG00000070610" } } }, "hgnc_date_symbol_changed": "2002-07-25" }, "entity_type": "gene", "entity_name": "GBA2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "23332916", "23332917" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Spastic paraplegia 46, autosomal recessive, MIM#\t614409" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ALT2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18062", "gene_name": "glutamic--pyruvic transaminase 2", "omim_gene": [ "138210" ], "alias_name": [ "alanine aminotransferase 2" ], "gene_symbol": "GPT2", "hgnc_symbol": "GPT2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:46918290-46965209", "ensembl_id": "ENSG00000166123" } }, "GRch38": { "90": { "location": "16:46884378-46931297", "ensembl_id": "ENSG00000166123" } } }, "hgnc_date_symbol_changed": "2002-03-05" }, "entity_type": "gene", "entity_name": "GPT2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29882329", "31471722", "27601654" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 317, "hash_id": null, "name": "Hereditary Spastic Paraplegia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause both isolated and complicated hereditary spastic paraplegia. The panel was created by merging the HSP panels created by RMH and VCGS, and is a consensus panel used by both.", "status": "public", "version": "1.149", "version_created": "2026-03-19T11:56:36.708923+11:00", "relevant_disorders": [ "Spasticity", "HP:0001257" ], "stats": { "number_of_genes": 176, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SMVT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11041", "gene_name": "solute carrier family 5 member 6", "omim_gene": [ "604024" ], "alias_name": null, "gene_symbol": "SLC5A6", "hgnc_symbol": "SLC5A6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:27422455-27435826", "ensembl_id": "ENSG00000138074" } }, "GRch38": { "90": { "location": "2:27199587-27212958", "ensembl_id": "ENSG00000138074" } } }, "hgnc_date_symbol_changed": "1999-01-19" }, "entity_type": "gene", "entity_name": "SLC5A6", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35013551" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Peripheral motor neuropathy, childhood-onset, biotin-responsive, MIM# 619903" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3070, "hash_id": null, "name": "Hereditary Neuropathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause the following hereditary neuropathies in isolated forms or part of a complex phenotype, including complex neurological phenotypes, metabolic and syndromic disorders: \r\n- Charcot-Marie-Tooth disease or hereditary motor/sensory neuropathy (HMSN) \r\n- distal hereditary motor neuropathy (dHMN)\r\n- distal spinal muscular atrophy (dSMA) \r\n- hereditary sensory and autonomic neuropathy (HSAN)\r\n- small fibre neuropathy (SFN),", "status": "public", "version": "1.190", "version_created": "2026-03-31T19:04:58.660686+11:00", "relevant_disorders": [ "Peripheral neuropathy", "HP:0009830" ], "stats": { "number_of_genes": 277, "number_of_strs": 6, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MRK", "LCK2", "KIAA0936", "MGC46090" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21219", "gene_name": "intestinal cell kinase", "omim_gene": [ "612325" ], "alias_name": [ "serine/threonine-protein kinase ICK", "MAK-related kinase" ], "gene_symbol": "ICK", "hgnc_symbol": "ICK", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:52866077-52926600", "ensembl_id": "ENSG00000112144" } }, "GRch38": { "90": { "location": "6:53001279-53061802", "ensembl_id": "ENSG00000112144" } } }, "hgnc_date_symbol_changed": "2003-08-21" }, "entity_type": "gene", "entity_name": "ICK", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 40615527, 24797473" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Cranioectodermal dysplasia 6, MIM# 621337" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3089, "hash_id": null, "name": "Ectodermal Dysplasia", "disease_group": "Dermatological disorders", "disease_sub_group": "", "description": "This panel contains genes that cause heritable conditions in which there are abnormalities of two or more ectodermal structures such as the hair, teeth, nails, sweat glands, salivary glands, cranial-facial structure, digits and other parts of the body.\r\n\r\nThis is a consensus panel used by RMH and VCGS.\r\n\r\nPlease refer to the Hair Disorders panel for disorders primarily affecting hair.", "status": "public", "version": "0.110", "version_created": "2026-03-31T16:43:36.155380+11:00", "relevant_disorders": [ "Ectodermal dysplasia", "HP:0000968" ], "stats": { "number_of_genes": 61, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MGC2840" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23161", "gene_name": "ALG8, alpha-1,3-glucosyltransferase", "omim_gene": [ "608103" ], "alias_name": [ "dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase" ], "gene_symbol": "ALG8", "hgnc_symbol": "ALG8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:77811982-77850706", "ensembl_id": "ENSG00000159063" } }, "GRch38": { "90": { "location": "11:78100936-78139660", "ensembl_id": "ENSG00000159063" } } }, "hgnc_date_symbol_changed": "2003-10-15" }, "entity_type": "gene", "entity_name": "ALG8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Congenital disorder of glycosylation, type Ih, 608104 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CLC2", "EJM6", "ClC-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2020", "gene_name": "chloride voltage-gated channel 2", "omim_gene": [ "600570" ], "alias_name": null, "gene_symbol": "CLCN2", "hgnc_symbol": "CLCN2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:184063973-184079439", "ensembl_id": "ENSG00000114859" } }, "GRch38": { "90": { "location": "3:184346185-184361651", "ensembl_id": "ENSG00000114859" } } }, "hgnc_date_symbol_changed": "1994-01-28" }, "entity_type": "gene", "entity_name": "CLCN2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Leukoencephalopathy with ataxia, 615651 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NK3R" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11528", "gene_name": "tachykinin receptor 3", "omim_gene": [ "162332" ], "alias_name": [ "neurokinin beta receptor" ], "gene_symbol": "TACR3", "hgnc_symbol": "TACR3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:104507188-104640973", "ensembl_id": "ENSG00000169836" } }, "GRch38": { "90": { "location": "4:103586031-103719816", "ensembl_id": "ENSG00000169836" } } }, "hgnc_date_symbol_changed": "1997-11-28" }, "entity_type": "gene", "entity_name": "TACR3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "20332248", "19079066" ], "evidence": [ "Expert Review Green", "Expert list", "Expert list", "Expert list" ], "phenotypes": [ "Hypogonadotropic hypogonadism 11 with or without anosmia, MIM#\t614840" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3236, "hash_id": null, "name": "Pituitary hormone deficiency", "disease_group": "Endocrine disorders", "disease_sub_group": "Pituitary disorders", "description": "This panel contains genes associated with pituitary hormone deficiency. \r\nIncludes isolated hormone deficiency, combined hormone deficiencies, and panhypopituitarism.\r\n\r\nIt has been compared against the Genomics England PanelApp 'Pituitary hormone deficiency' panel V4.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "0.208", "version_created": "2026-04-02T15:15:10.893013+11:00", "relevant_disorders": [ "Hypopituitarism", "HP:0040075" ], "stats": { "number_of_genes": 118, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KRAS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6407", "gene_name": "KRAS proto-oncogene, GTPase", "omim_gene": [ "190070" ], "alias_name": null, "gene_symbol": "KRAS", "hgnc_symbol": "KRAS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:25357723-25403870", "ensembl_id": "ENSG00000133703" } }, "GRch38": { "90": { "location": "12:25204789-25250936", "ensembl_id": "ENSG00000133703" } } }, "hgnc_date_symbol_changed": "2005-01-24" }, "entity_type": "gene", "entity_name": "KRAS", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments", "publications": [ "PMID: 21396583" ], "evidence": [ "Expert Review Green", "South West GLH", "NHS GMS", "Expert List", "London South GLH" ], "phenotypes": [ "Cardiofaciocutaneous syndrome 2, MIM# 615278", "Noonan syndrome 3, MIM# 609942" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3270, "hash_id": null, "name": "Cardiomyopathy_Paediatric", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "With thanks to Genomics England PanelApp for the original design of this panel.\r\n\r\nThis panel contains genes associated with childhood-onset cardiomyopathy, including as part of syndromic and metabolic conditions. It is maintained by VCGS.", "status": "public", "version": "0.229", "version_created": "2026-03-31T18:53:53.165018+11:00", "relevant_disorders": [ "Cardiomyopathy", "HP:0001638;Abnormality of the myocardium", "HP:0001637" ], "stats": { "number_of_genes": 252, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Cav1.1", "hypoPP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1397", "gene_name": "calcium voltage-gated channel subunit alpha1 S", "omim_gene": [ "114208" ], "alias_name": null, "gene_symbol": "CACNA1S", "hgnc_symbol": "CACNA1S", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:201008642-201081694", "ensembl_id": "ENSG00000081248" } }, "GRch38": { "90": { "location": "1:201039512-201112566", "ensembl_id": "ENSG00000081248" } } }, "hgnc_date_symbol_changed": "1992-03-27" }, "entity_type": "gene", "entity_name": "CACNA1S", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30499100" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "{Malignant hyperthermia susceptibility 5}, MIM#\t601887" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3271, "hash_id": null, "name": "Pharmacogenomics_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is under development, to be used by the Australian Genomics Acute Care Flagship.", "status": "public", "version": "0.50", "version_created": "2020-08-27T20:53:11.205850+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 17, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "ERR2", "ERRbeta", "NR3B2", "ERRb" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3473", "gene_name": "estrogen related receptor beta", "omim_gene": [ "602167" ], "alias_name": null, "gene_symbol": "ESRRB", "hgnc_symbol": "ESRRB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:76776957-76968178", "ensembl_id": "ENSG00000119715" } }, "GRch38": { "90": { "location": "14:76310614-76501841", "ensembl_id": "ENSG00000119715" } } }, "hgnc_date_symbol_changed": "1997-04-25" }, "entity_type": "gene", "entity_name": "ESRRB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Hearing loss" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ11457", "JBTS11", "NPHP12", "IFT139B", "THM1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25660", "gene_name": "tetratricopeptide repeat domain 21B", "omim_gene": [ "612014" ], "alias_name": null, "gene_symbol": "TTC21B", "hgnc_symbol": "TTC21B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:166713985-166810353", "ensembl_id": "ENSG00000123607" } }, "GRch38": { "90": { "location": "2:165857475-165953843", "ensembl_id": "ENSG00000123607" } } }, "hgnc_date_symbol_changed": "2005-01-26" }, "entity_type": "gene", "entity_name": "TTC21B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21258341", "25492405", "18327258", "33875766" ], "evidence": [ "Expert Review Green", "BabySeq Category C gene" ], "phenotypes": [ "Nephronophthisis 12, MIM# 613820", "Short-rib thoracic dysplasia 4 with or without polydactyly, MIM# 613819" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZP586M0122", "FLJ21915", "RPO1-4", "RPA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17264", "gene_name": "RNA polymerase I subunit A", "omim_gene": [ "616404" ], "alias_name": null, "gene_symbol": "POLR1A", "hgnc_symbol": "POLR1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:86247339-86333278", "ensembl_id": "ENSG00000068654" } }, "GRch38": { "90": { "location": "2:86020216-86106155", "ensembl_id": "ENSG00000068654" } } }, "hgnc_date_symbol_changed": "2003-04-01" }, "entity_type": "gene", "entity_name": "POLR1A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25913037" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Acrofacial dysostosis, Cincinnati type MIM#616462" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "bA504H3.4", "DDK1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16205", "gene_name": "mitochondrial genome maintenance exonuclease 1", "omim_gene": [ "615076" ], "alias_name": null, "gene_symbol": "MGME1", "hgnc_symbol": "MGME1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:17949556-17971765", "ensembl_id": "ENSG00000125871" } }, "GRch38": { "90": { "location": "20:17968913-17991122", "ensembl_id": "ENSG00000125871" } } }, "hgnc_date_symbol_changed": "2013-01-11" }, "entity_type": "gene", "entity_name": "MGME1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Mitochondrial DNA depletion syndrome 11, MIM#615084" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3379, "hash_id": null, "name": "Congenital ophthalmoplegia", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with congenital ophthalmoplegia including those associated with congenital fibrosis of the extra-ocular muscles (CFEOM), Duane anomaly, Moebius syndrome, and gaze palsies.\r\n\r\nIn addition, it includes genes associated with conditions where ophthalmoplegia can occur in infancy/early childhood as a common/prominent feature of a more complex syndromic, metabolic or neuromuscular condition.", "status": "public", "version": "1.14", "version_created": "2025-12-14T20:52:23.588623+11:00", "relevant_disorders": [ "Abnormality of eye movement", "HP:0000496" ], "stats": { "number_of_genes": 55, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "DAP12", "PLO-SL", "KARAP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12449", "gene_name": "TYRO protein tyrosine kinase binding protein", "omim_gene": [ "604142" ], "alias_name": [ "killer activating receptor associated protein", "DNAX-activation protein 12" ], "gene_symbol": "TYROBP", "hgnc_symbol": "TYROBP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:36395303-36399197", "ensembl_id": "ENSG00000011600" } }, "GRch38": { "90": { "location": "19:35904401-35908295", "ensembl_id": "ENSG00000011600" } } }, "hgnc_date_symbol_changed": "1998-06-25" }, "entity_type": "gene", "entity_name": "TYROBP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "NSW Health Pathology", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 3437, "hash_id": null, "name": "Incidentalome_PREGEN_DRAFT", "disease_group": "", "disease_sub_group": "", "description": "Imported to facilitate update work. Do not use while labeled as DRAFT", "status": "public", "version": "0.43", "version_created": "2021-01-20T16:42:09.286633+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 173, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CNC1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9388", "gene_name": "protein kinase cAMP-dependent type I regulatory subunit alpha", "omim_gene": [ "188830" ], "alias_name": [ "Carney complex type 1" ], "gene_symbol": "PRKAR1A", "hgnc_symbol": "PRKAR1A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:66507921-66547460", "ensembl_id": "ENSG00000108946" } }, "GRch38": { "90": { "location": "17:68511780-68551319", "ensembl_id": "ENSG00000108946" } } }, "hgnc_date_symbol_changed": "1988-05-11" }, "entity_type": "gene", "entity_name": "PRKAR1A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "NSW Health Pathology", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 3437, "hash_id": null, "name": "Incidentalome_PREGEN_DRAFT", "disease_group": "", "disease_sub_group": "", "description": "Imported to facilitate update work. Do not use while labeled as DRAFT", "status": "public", "version": "0.43", "version_created": "2021-01-20T16:42:09.286633+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 173, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2295", "gene_name": "ceruloplasmin", "omim_gene": [ "117700" ], "alias_name": [ "ferroxidase" ], "gene_symbol": "CP", "hgnc_symbol": "CP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:148880197-148939842", "ensembl_id": "ENSG00000047457" } }, "GRch38": { "90": { "location": "3:149162410-149222055", "ensembl_id": "ENSG00000047457" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "CP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "GeneReviews", "Expert Review Green" ], "phenotypes": [ "Aceruloplasminemia" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3438, "hash_id": null, "name": "Neurodegeneration with brain iron accumulation", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that are associated with neurodegeneration with brain iron accumulation (NBIA) disorders. Depending on the clinical features present, consider applying additional panels such as the Dystonia Superpanel or Mitochondrial Disorders, which contain overlapping differential diagnoses.", "status": "public", "version": "1.3", "version_created": "2025-11-25T11:21:32.539811+11:00", "relevant_disorders": [ "Iron accumulation in brain", "HP:0012675" ], "stats": { "number_of_genes": 24, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:663", "gene_name": "arginase 1", "omim_gene": [ "608313" ], "alias_name": null, "gene_symbol": "ARG1", "hgnc_symbol": "ARG1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:131894284-131905472", "ensembl_id": "ENSG00000118520" } }, "GRch38": { "90": { "location": "6:131573144-131584332", "ensembl_id": "ENSG00000118520" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "ARG1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "2365823", "1598908", "29726057" ], "evidence": [ "Expert Review Green", "NHS GMS" ], "phenotypes": [ "Argininemia MIM#207800", "Urea cycle disorders and inherited hyperammonaemias", "disorder of arginine metabolism" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable" ], "panel": { "id": 3468, "hash_id": null, "name": "Miscellaneous Metabolic Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause miscellaneous metabolic disorders, that are not present on any of the more specific metabolic disorders panels (see the Metabolic Disorders Superpanel for the full list of panels). It contains, but is not limited to, the following groups of conditions:\r\n-Disorders of purine and pyrimidine metabolism\r\n-Organic acidurias, and other disorders of amino acid and peptide metabolism\r\n-Disorders of bile acid metabolism and transport, and other disorders of the metabolism of sterols\r\n-Disorders of nucleotide metabolism\r\n-Disorders of glucose transport, and other disorders of carbohydrate metabolism (excluding glycogen storage disorders)\r\n-Disorders of zinc and manganese metabolism\r\n-Disorders of vitamins and cofactors\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.60", "version_created": "2026-01-15T15:39:27.439934+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 149, "number_of_strs": 1, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2918", "gene_name": "distal-less homeobox 5", "omim_gene": [ "600028" ], "alias_name": null, "gene_symbol": "DLX5", "hgnc_symbol": "DLX5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:96649704-96654409", "ensembl_id": "ENSG00000105880" } }, "GRch38": { "90": { "location": "7:97020392-97025097", "ensembl_id": "ENSG00000105880" } } }, "hgnc_date_symbol_changed": "1994-05-24" }, "entity_type": "gene", "entity_name": "DLX5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "22121204", "24496061", "25196357", "20534536", "12112878", "41760400" ], "evidence": [ "Expert Review Green", "Expert list", "Expert list", "NHS GMS" ], "phenotypes": [ "Split-hand/foot malformation 1 with sensorineural hearing loss 220600" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3729, "hash_id": null, "name": "Hand and foot malformations", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel contains non-syndromic and syndromic causes of hand and foot malformations, including: brachydactyly, syndactyly, clinodactyly, ectrodactyly, and oligodactyly. Genes that cause polydactyly and synpolydactyly are excluded and can be found on the Polydactyly panel.", "status": "public", "version": "0.89", "version_created": "2026-04-07T13:49:34.993963+10:00", "relevant_disorders": [ "Abnormal hand morphology", "HP:0005922; Abnormal foot morphology", "HP:0001760" ], "stats": { "number_of_genes": 101, "number_of_strs": 1, "number_of_regions": 5 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BLOC2S2", "AIBP63", "RU2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17022", "gene_name": "HPS5, biogenesis of lysosomal organelles complex 2 subunit 2", "omim_gene": [ "607521" ], "alias_name": [ "alpha-integrin-binding protein 63", "Ruby-eye protein 2 homolog" ], "gene_symbol": "HPS5", "hgnc_symbol": "HPS5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:18300223-18343745", "ensembl_id": "ENSG00000110756" } }, "GRch38": { "90": { "location": "11:18278668-18322198", "ensembl_id": "ENSG00000110756" } } }, "hgnc_date_symbol_changed": "2002-06-13" }, "entity_type": "gene", "entity_name": "HPS5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12548288", "18182080", "27593200", "26785811", "28296950", "32725903" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "NHS Genomic Medicine Service" ], "phenotypes": [ "Hermansky-Pudlak syndrome 5 (MIM#614074)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3762, "hash_id": null, "name": "Congenital nystagmus", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with isolated or syndromic nystagmus presenting in infancy or early childhood.", "status": "public", "version": "1.24", "version_created": "2026-01-26T13:26:36.043723+11:00", "relevant_disorders": [ "Nystagmus HP:0000639" ], "stats": { "number_of_genes": 84, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CEMCOX2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2263", "gene_name": "COX15, cytochrome c oxidase assembly homolog", "omim_gene": [ "603646" ], "alias_name": null, "gene_symbol": "COX15", "hgnc_symbol": "COX15", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:101471601-101491857", "ensembl_id": "ENSG00000014919" } }, "GRch38": { "90": { "location": "10:99711844-99732100", "ensembl_id": "ENSG00000014919" } } }, "hgnc_date_symbol_changed": "1998-07-03" }, "entity_type": "gene", "entity_name": "COX15", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21412973", "33746038", "32232962" ], "evidence": [ "Expert Review Amber", "Genomics England PanelApp" ], "phenotypes": [ "Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "hUNC18", "MUNC18-1", "UNC18", "rbSec1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11444", "gene_name": "syntaxin binding protein 1", "omim_gene": [ "602926" ], "alias_name": [ "syntaxin-binding protein 1" ], "gene_symbol": "STXBP1", "hgnc_symbol": "STXBP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:130374544-130457460", "ensembl_id": "ENSG00000136854" } }, "GRch38": { "90": { "location": "9:127579370-127696027", "ensembl_id": "ENSG00000136854" } } }, "hgnc_date_symbol_changed": "1996-12-27" }, "entity_type": "gene", "entity_name": "STXBP1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31855252", "18469812" ], "evidence": [ "Expert Review Red", "Genomics England PanelApp" ], "phenotypes": [ "Developmental and epileptic encephalopathy 4 (MIM#612164)" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Kop", "HAI-2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11247", "gene_name": "serine peptidase inhibitor, Kunitz type 2", "omim_gene": [ "605124" ], "alias_name": [ "placental bikunin" ], "gene_symbol": "SPINT2", "hgnc_symbol": "SPINT2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:38734675-38783254", "ensembl_id": "ENSG00000167642" } }, "GRch38": { "90": { "location": "19:38244035-38292614", "ensembl_id": "ENSG00000167642" } } }, "hgnc_date_symbol_changed": "1999-07-23" }, "entity_type": "gene", "entity_name": "SPINT2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "19185281", "20009592", "24142340", "30445423", "33547739", "33374714", "33029133" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Diarrhoea 3, secretory sodium, congenital, syndromic - MIM#270420", "congenital secretory sodium diarrhea 3 - MONDO#0010036" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.558", "version_created": "2026-04-07T13:44:14.990434+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 2207, "number_of_strs": 3, "number_of_regions": 6 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Talpid3", "JBTS23" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19960", "gene_name": "KIAA0586", "omim_gene": [ "610178" ], "alias_name": null, "gene_symbol": "KIAA0586", "hgnc_symbol": "KIAA0586", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:58894103-59015216", "ensembl_id": "ENSG00000100578" } }, "GRch38": { "90": { "location": "14:58427385-58551289", "ensembl_id": "ENSG00000100578" } } }, "hgnc_date_symbol_changed": "2003-11-21" }, "entity_type": "gene", "entity_name": "KIAA0586", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26386044", "28125082", "36580738", "39063141" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Short-rib thoracic dysplasia 14 with polydactyly (MIM#616546)", "Joubert syndrome 23 (MIM#616490)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:7060", "gene_name": "matrix Gla protein", "omim_gene": [ "154870" ], "alias_name": null, "gene_symbol": "MGP", "hgnc_symbol": "MGP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:15034115-15038860", "ensembl_id": "ENSG00000111341" } }, "GRch38": { "90": { "location": "12:14881181-14885926", "ensembl_id": "ENSG00000111341" } } }, "hgnc_date_symbol_changed": "1991-08-01" }, "entity_type": "gene", "entity_name": "MGP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "37675773" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Keutel syndrome, 245150 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20796", "MZM1L" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28072", "gene_name": "LYR motif containing 7", "omim_gene": [ "615831" ], "alias_name": null, "gene_symbol": "LYRM7", "hgnc_symbol": "LYRM7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:130506503-130541119", "ensembl_id": "ENSG00000186687" } }, "GRch38": { "90": { "location": "5:131170810-131205426", "ensembl_id": "ENSG00000186687" } } }, "hgnc_date_symbol_changed": "2006-10-17" }, "entity_type": "gene", "entity_name": "LYRM7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "26912632", "24014394" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Mitochondrial complex III deficiency, nuclear type 8, MIM#615838, Autosomal recessive" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:8853", "gene_name": "peroxisomal biogenesis factor 11 beta", "omim_gene": [ "603867" ], "alias_name": null, "gene_symbol": "PEX11B", "hgnc_symbol": "PEX11B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:145516252-145523730", "ensembl_id": "ENSG00000131779" } }, "GRch38": { "90": { "location": "1:145911350-145918837", "ensembl_id": "ENSG00000131779" } } }, "hgnc_date_symbol_changed": "1998-11-11" }, "entity_type": "gene", "entity_name": "PEX11B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20301621", "22581968", "31724321", "38423277", "39092477", "28129423", "33558817" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Peroxisome biogenesis disorder 14B MIM#614920" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA1630", "MGC3090", "DKFZP762M115", "CMT2Q" ], "biotype": "protein_coding", "hgnc_id": "HGNC:23537", "gene_name": "dehydrogenase E1 and transketolase domain containing 1", "omim_gene": [ "614984" ], "alias_name": null, "gene_symbol": "DHTKD1", "hgnc_symbol": "DHTKD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:12110971-12165224", "ensembl_id": "ENSG00000181192" } }, "GRch38": { "90": { "location": "10:12068972-12123225", "ensembl_id": "ENSG00000181192" } } }, "hgnc_date_symbol_changed": "2003-11-24" }, "entity_type": "gene", "entity_name": "DHTKD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "26141459", "25860818", "23141293" ], "evidence": [ "Expert Review Green", "ClinGen" ], "phenotypes": [ "2-aminoadipic 2-oxoadipic aciduria MONDO:0008774" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3929, "hash_id": null, "name": "Aminoacidopathy", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes associated with inborn errors in the metabolism of amino acids. It has been aligned with the classifications by the ClinGen Aminoacidopathy GCEP.\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.143", "version_created": "2026-04-01T10:30:06.755640+11:00", "relevant_disorders": [ "Abnormality of amino acid metabolism", "HP:0004337" ], "stats": { "number_of_genes": 134, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CAV", "CAVA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1377", "gene_name": "carbonic anhydrase 5A", "omim_gene": [ "114761" ], "alias_name": null, "gene_symbol": "CA5A", "hgnc_symbol": "CA5A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:87921625-87970135", "ensembl_id": "ENSG00000174990" } }, "GRch38": { "90": { "location": "16:87881546-87936529", "ensembl_id": "ENSG00000174990" } } }, "hgnc_date_symbol_changed": "1993-10-15" }, "entity_type": "gene", "entity_name": "CA5A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BeginNGS" ], "phenotypes": [ "Hyperammonaemia due to carbonic anhydrase VA deficiency, MIM#\t615751" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "metabolic" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:2201", "gene_name": "collagen type III alpha 1 chain", "omim_gene": [ "120180" ], "alias_name": null, "gene_symbol": "COL3A1", "hgnc_symbol": "COL3A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:189839046-189877472", "ensembl_id": "ENSG00000168542" } }, "GRch38": { "90": { "location": "2:188974320-189012746", "ensembl_id": "ENSG00000168542" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "COL3A1", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Amber", "BabySeq Category A gene" ], "phenotypes": [ "Ehlers-Danlos syndrome, vascular type, MIM# 130050" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "cardiac" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:12665", "gene_name": "vinculin", "omim_gene": [ "193065" ], "alias_name": [ "metavinculin" ], "gene_symbol": "VCL", "hgnc_symbol": "VCL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:75757872-75879918", "ensembl_id": "ENSG00000035403" } }, "GRch38": { "90": { "location": "10:73995193-74121363", "ensembl_id": "ENSG00000035403" } } }, "hgnc_date_symbol_changed": "1990-09-10" }, "entity_type": "gene", "entity_name": "VCL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11815424", "26458567", "17785437", "31983221", "32516855", "26406308", "24062880" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Cardiomyopathy, dilated, 1W, MIM# 611407" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GHBP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4263", "gene_name": "growth hormone receptor", "omim_gene": [ "600946" ], "alias_name": [ "growth hormone binding protein" ], "gene_symbol": "GHR", "hgnc_symbol": "GHR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:42423879-42721979", "ensembl_id": "ENSG00000112964" } }, "GRch38": { "90": { "location": "5:42423777-42721878", "ensembl_id": "ENSG00000112964" } } }, "hgnc_date_symbol_changed": "1989-06-30" }, "entity_type": "gene", "entity_name": "GHR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "37474955", "20583548", "31429861" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Laron dwarfism, MIM#262500" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:23663", "gene_name": "vitamin K epoxide reductase complex subunit 1", "omim_gene": [ "608547" ], "alias_name": null, "gene_symbol": "VKORC1", "hgnc_symbol": "VKORC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:31102163-31107301", "ensembl_id": "ENSG00000167397" } }, "GRch38": { "90": { "location": "16:31090842-31095980", "ensembl_id": "ENSG00000167397" } } }, "hgnc_date_symbol_changed": "2004-02-04" }, "entity_type": "gene", "entity_name": "VKORC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "14765194" ], "evidence": [ "Expert Review Green" ], "phenotypes": [ "vitamin K-dependent clotting factors, combined deficiency of, type 2 MONDO:0011837", "Other disorders of vitamin metabolism" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4257, "hash_id": null, "name": "Vitamin metabolism disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "The gene panel contains genes that cause inborn errors of vitamin metabolism.\r\n\r\nThis panel is a component of the Metabolic Disorders Superpanel.", "status": "public", "version": "1.7", "version_created": "2024-09-18T09:35:00.495806+10:00", "relevant_disorders": [ "Abnormality of vitamin metabolism", "HP:0100508" ], "stats": { "number_of_genes": 62, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20041" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17993", "gene_name": "transient receptor potential cation channel subfamily M member 4", "omim_gene": [ "606936" ], "alias_name": null, "gene_symbol": "TRPM4", "hgnc_symbol": "TRPM4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:49660998-49715093", "ensembl_id": "ENSG00000130529" } }, "GRch38": { "90": { "location": "19:49157741-49211836", "ensembl_id": "ENSG00000130529" } } }, "hgnc_date_symbol_changed": "2002-01-11" }, "entity_type": "gene", "entity_name": "TRPM4", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "41195386", "19726882", "26820365", "21887725", "32681584", "20562447", "25531103", "27207958", "29568272", "29748318", "36352534", "35205305" ], "evidence": [ "Expert Review Amber", "NHS GMS" ], "phenotypes": [ "progressive familial heart block type IB MONDO:0011474" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4422, "hash_id": null, "name": "Cardiac conduction disease", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel contains genes associated with cardiac conduction disease, including heart block and abnormal atrioventricular conduction. It contains all the genes associated with Sick sinus syndrome.\r\n\r\nThis panel is based on the PanelApp UK \"Progressive cardiac conduction disease\" panel, with thanks to Genomics England. It is a constituent of the Arrhythmia Superpanel and Adult Cardiac Superpanel.", "status": "public", "version": "1.6", "version_created": "2026-02-19T13:33:52.737749+11:00", "relevant_disorders": [ "Cardiac conduction abnormality", "HP:0031546" ], "stats": { "number_of_genes": 20, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "IKK-gamma", "NEMO", "Fip3p", "FIP-3", "FIP3", "ZC2HC9" ], "biotype": null, "hgnc_id": "HGNC:5961", "gene_name": "inhibitor of nuclear factor kappa B kinase subunit gamma", "omim_gene": [ "300248" ], "alias_name": null, "gene_symbol": "IKBKG", "hgnc_symbol": "IKBKG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:153769414-153796782", "ensembl_id": "ENSG00000073009" } }, "GRch38": { "90": { "location": "X:154541199-154565046", "ensembl_id": "ENSG00000269335" } } }, "hgnc_date_symbol_changed": "1998-09-30" }, "entity_type": "gene", "entity_name": "IKBKG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Incontinentia pigmenti, MIM# 308300" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [ "technically challenging" ], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.140", "version_created": "2026-04-06T10:51:58.181866+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 264, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD230", "PRP", "AltPrP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9449", "gene_name": "prion protein", "omim_gene": [ "176640" ], "alias_name": [ "Creutzfeldt-Jakob disease", "Gerstmann-Strausler-Scheinker syndrome", "fatal familial insomnia", "p27-30" ], "gene_symbol": "PRNP", "hgnc_symbol": "PRNP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:4666882-4682236", "ensembl_id": "ENSG00000171867" } }, "GRch38": { "90": { "location": "20:4686236-4701590", "ensembl_id": "ENSG00000171867" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "str", "entity_name": "PRNP_CJD_octapeptide", "confidence_level": "3", "penetrance": null, "publications": [ "2159587", "20301407" ], "evidence": [ "Literature", "Expert Review Green", "Expert Review Green", "Literature" ], "phenotypes": [ "Creutzfeldt-Jakob disease MIM#123400", "Gerstmann-Straussler disease MIM#137440" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GGTGGTGGCTGGGGGCAGCCTCAT", "chromosome": "20", "grch37_coordinates": [ 4680026, 4680073 ], "grch38_coordinates": [ 4699380, 4699427 ], "normal_repeats": 4, "pathogenic_repeats": 5, "tags": [], "panel": { "id": 298, "hash_id": null, "name": "Leukodystrophy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause white matter disorders (including leukoencephalopathies) of paediatric, adolescent, and adult onset. The panel was developed by RMH and is a consensus panel used by VCGS.", "status": "public", "version": "0.394", "version_created": "2026-04-07T13:49:15.516142+10:00", "relevant_disorders": [ "Leukodystrophy", "HP:0002415; Abnormal cerebral white matter morphology", "HP:0002500; Abnormal CNS myelination", "HP:0011400" ], "stats": { "number_of_genes": 262, "number_of_strs": 3, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] } } ] }