Entity Search List
Search Entities
GET /api/v1/entities/?format=api&page=9
{ "count": 36022, "next": "https://panelapp-aus.org/api/v1/entities/?format=api&page=10", "previous": "https://panelapp-aus.org/api/v1/entities/?format=api&page=8", "results": [ { "gene_data": { "alias": [ "FLJ14566", "AGO61" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25902", "gene_name": "protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)", "omim_gene": [ "614828" ], "alias_name": null, "gene_symbol": "POMGNT2", "hgnc_symbol": "POMGNT2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:43120724-43147568", "ensembl_id": "ENSG00000144647" } }, "GRch38": { "90": { "location": "3:43079232-43106076", "ensembl_id": "ENSG00000144647" } } }, "hgnc_date_symbol_changed": "2013-08-22" }, "entity_type": "gene", "entity_name": "POMGNT2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Brain Malformations Flagship" ], "phenotypes": [ "Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 8, MIM# 614830" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 6, "hash_id": null, "name": "Cobblestone Malformations", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and used by the Australian Genomics Brain Malformations flagship. It is maintained by VCGS.\r\n\r\nCobblestone lissencephaly is characterised by a nodular brain surface, ocular anomalies, and congenital muscular disorders. Cobblestone cortex results from overmigration of the neuroblasts and glial cells beyond the external glial limitations into the subarachnoid space.\r\n\r\nPlease also consider the Lissencephaly and Band Heterotopia panel and the broader Malformations of cortical development superpanel if features are not entirely typical.", "status": "public", "version": "1.1", "version_created": "2022-10-07T18:15:15.150864+11:00", "relevant_disorders": [ "Abnormal cortical gyration HP:0002536" ], "stats": { "number_of_genes": 13, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:1070", "gene_name": "bone morphogenetic protein 3", "omim_gene": [ "112263" ], "alias_name": [ "osteogenin" ], "gene_symbol": "BMP3", "hgnc_symbol": "BMP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:81952119-81978685", "ensembl_id": "ENSG00000152785" } }, "GRch38": { "90": { "location": "4:81030965-81057531", "ensembl_id": "ENSG00000152785" } } }, "hgnc_date_symbol_changed": "1990-06-11" }, "entity_type": "gene", "entity_name": "BMP3", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35089417" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "coloboma, MONDO:0001476", "microphthalmia, MONDO:0021129" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 42, "hash_id": null, "name": "Anophthalmia_Microphthalmia_Coloboma", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS, and contains genes associated with isolated and syndromic anophthalmia, microphthalmia and coloboma.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Anophthalmia or Microphthalmia' v1.31 and 'Ocular coloboma' v1.38 panels, with discrepancies reviewed and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.57", "version_created": "2026-03-03T11:23:37.804849+11:00", "relevant_disorders": [ "Anophthalmia", "HP:0000528;Microphthalmia", "HP:0000568;Coloboma", "HP:0000589" ], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FLJ11838" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25686", "gene_name": "phosphopantothenoylcysteine synthetase", "omim_gene": [ "609853" ], "alias_name": null, "gene_symbol": "PPCS", "hgnc_symbol": "PPCS", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:42921788-42939056", "ensembl_id": "ENSG00000127125" } }, "GRch38": { "90": { "location": "1:42456117-42473385", "ensembl_id": "ENSG00000127125" } } }, "hgnc_date_symbol_changed": "2005-07-25" }, "entity_type": "gene", "entity_name": "PPCS", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29754768" ], "evidence": [ "Expert Review Red", "Expert list" ], "phenotypes": [ "Cardiomyopathy, dilated, 2C, MIM#\t618189" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 95, "hash_id": null, "name": "Dilated Cardiomyopathy", "disease_group": "Cardiovascular disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes typically associated with isolated dilated cardiomyopathy, with onset in adolescence or adulthood. For early onset dilated cardiomyopathy, or in the presence of additional features suggestive of an underlying metabolic or syndromic disorder please consider the Cardiomyopathy_Paediatric panel. Where the type of cardiomyopathy is unclear, consider using the Cardiomyopathy Superpanel.\r\n\r\nThis panel has been compared against the Genomics England 'Dilated Cardiomyopathy - teen and adult' panel with all discrepancies resolved and reciprocal feedback provided to Genomics England 5/8/2020.\r\n\r\nThe panel is aligned with the assessments of DCM genes by ClinGen, Jordan E et al, 2021, PMID 33947203.", "status": "public", "version": "1.66", "version_created": "2026-04-02T19:34:23.537467+11:00", "relevant_disorders": [ "Dilated cardiomyopathy", "HP:0001644" ], "stats": { "number_of_genes": 69, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "COUP-TFII", "COUPTFB", "SVP40", "NF-E3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7976", "gene_name": "nuclear receptor subfamily 2 group F member 2", "omim_gene": [ "107773" ], "alias_name": null, "gene_symbol": "NR2F2", "hgnc_symbol": "NR2F2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:96869167-96883492", "ensembl_id": "ENSG00000185551" } }, "GRch38": { "90": { "location": "15:96325938-96340263", "ensembl_id": "ENSG00000185551" } } }, "hgnc_date_symbol_changed": "1995-03-21" }, "entity_type": "gene", "entity_name": "NR2F2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "29478779", "31687637" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "46XX sex reversal 5, MIM# 618901" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.46", "version_created": "2026-04-02T12:35:34.329595+11:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FGF-13" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3673", "gene_name": "fibroblast growth factor 17", "omim_gene": [ "603725" ], "alias_name": null, "gene_symbol": "FGF17", "hgnc_symbol": "FGF17", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:21899909-21906320", "ensembl_id": "ENSG00000158815" } }, "GRch38": { "90": { "location": "8:22042398-22048809", "ensembl_id": "ENSG00000158815" } } }, "hgnc_date_symbol_changed": "1998-12-22" }, "entity_type": "gene", "entity_name": "FGF17", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "23643382", "31748124" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.46", "version_created": "2026-04-02T12:35:34.329595+11:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "P450c21B", "CA21H", "CPS1", "CAH1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2600", "gene_name": "cytochrome P450 family 21 subfamily A member 2", "omim_gene": [ "613815" ], "alias_name": [ "Steroid 21-monooxygenase" ], "gene_symbol": "CYP21A2", "hgnc_symbol": "CYP21A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:32006042-32009447", "ensembl_id": "ENSG00000231852" } }, "GRch38": { "90": { "location": "6:32038265-32041670", "ensembl_id": "ENSG00000231852" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "CYP21A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Adrenal hyperplasia, congenital, due to 21-hydroxylase deficiency, 201910", "Hyperandrogenism, nonclassic type, due to 21-hydroxylase deficiency, 201910" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.46", "version_created": "2026-04-02T12:35:34.329595+11:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CD220" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6091", "gene_name": "insulin receptor", "omim_gene": [ "147670" ], "alias_name": null, "gene_symbol": "INSR", "hgnc_symbol": "INSR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:7112266-7294045", "ensembl_id": "ENSG00000171105" } }, "GRch38": { "90": { "location": "19:7112255-7294034", "ensembl_id": "ENSG00000171105" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "INSR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "15161766", "26691667", "31989990" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Hyperinsulinemic hypoglycemia, familial, 5, MIM#\t609968" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 118, "hash_id": null, "name": "Hyperinsulinism", "disease_group": "Endocrine disorders", "disease_sub_group": "", "description": "This panel was developed by and is maintained by VCGS and RMH.\r\n\r\nThis panel contains genes associated with hyperinsulinism (non-syndromic and syndromic). \r\n\r\nIt has been compared against the Genomics England PanelApp 'Congenital hyperinsulinism' panel V3.5, with all discrepancies reviewed and resolved (August 2025).\r\n\r\nFor severe, persistent hypoglycaemia, consider also applying the Metabolic Disorders Superpanel, or more specifically, the Glycogen Storage Diseases and Fatty Acid Oxidation Defects panels.\r\n\r\nIf features of the following diagnoses, request alternate genetic test listed:\r\na) Beckwith-Wiedeman syndrome - request BWS methylation studies\r\nb) Congenital central hypoventilation syndrome - request PHOX2B poly-A expansion repeat testing", "status": "public", "version": "1.51", "version_created": "2026-03-09T16:58:00.909830+11:00", "relevant_disorders": [ "Hyperinsulinaemia", "HP:0000842;Hypoglycemia", "HP:0001943" ], "stats": { "number_of_genes": 35, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "HSPC159", "GRP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25012", "gene_name": "galectin like", "omim_gene": null, "alias_name": [ "galectin-related protein" ], "gene_symbol": "LGALSL", "hgnc_symbol": "LGALSL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:64681103-64688515", "ensembl_id": "ENSG00000119862" } }, "GRch38": { "90": { "location": "2:64453969-64461381", "ensembl_id": "ENSG00000119862" } } }, "hgnc_date_symbol_changed": "2011-08-15" }, "entity_type": "gene", "entity_name": "LGALSL", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30940688" ], "evidence": [ "Expert Review Amber", "ClinGen" ], "phenotypes": [ "Amyotrophic lateral sclerosis\tMONDO:0004976" ], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 126, "hash_id": null, "name": "Incidentalome", "disease_group": "", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nIt contains genes associated with adult-onset cardiac, cancer and neurodegenerative disorders.\r\n\r\nThese genes are excluded from the Mendeliome panel to enable the use of the Mendeliome for panel-agnostic analysis in complex paediatric cases, while minimising the chance of incidental findings related to adult-onset conditions.\r\n\r\nIf analysis of these genes is required, the relevant panel should be requested (e.g. Adult Additional Findings; Neurodegenerative Disease_Adult Onset; Breast Cancer etc).", "status": "public", "version": "0.433", "version_created": "2026-03-25T17:03:27.624542+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 161, "number_of_strs": 2, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ARA267", "FLJ22263", "KMT3B" ], "biotype": "protein_coding", "hgnc_id": "HGNC:14234", "gene_name": "nuclear receptor binding SET domain protein 1", "omim_gene": [ "606681" ], "alias_name": null, "gene_symbol": "NSD1", "hgnc_symbol": "NSD1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:176560026-176727216", "ensembl_id": "ENSG00000165671" } }, "GRch38": { "90": { "location": "5:177133025-177300215", "ensembl_id": "ENSG00000165671" } } }, "hgnc_date_symbol_changed": "2002-02-25" }, "entity_type": "gene", "entity_name": "NSD1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 135, "hash_id": null, "name": "Macrocephaly_Megalencephaly", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.161", "version_created": "2026-01-12T09:38:37.890372+11:00", "relevant_disorders": [ "Macrocephaly", "HP:0000256; Megalencephaly", "HP:0001355" ], "stats": { "number_of_genes": 151, "number_of_strs": 0, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "JBTS12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30497", "gene_name": "kinesin family member 7", "omim_gene": [ "611254" ], "alias_name": null, "gene_symbol": "KIF7", "hgnc_symbol": "KIF7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:90152020-90198682", "ensembl_id": "ENSG00000166813" } }, "GRch38": { "90": { "location": "15:89608789-89655451", "ensembl_id": "ENSG00000166813" } } }, "hgnc_date_symbol_changed": "2005-02-07" }, "entity_type": "gene", "entity_name": "KIF7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21552264", "21633164", "19666503", "30445565", "26648833", "26349186", "26174511", "25714560" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Joubert syndrome 12, MIM# 200990", "Acrocallosal syndrome, MIM# 200990", "MONDO:0008708", "Hydrolethalus syndrome 2, MIM# 614120" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3342", "gene_name": "engrailed homeobox 1", "omim_gene": [ "131290" ], "alias_name": null, "gene_symbol": "EN1", "hgnc_symbol": "EN1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:119599747-119605254", "ensembl_id": "ENSG00000163064" } }, "GRch38": { "90": { "location": "2:118842171-118847678", "ensembl_id": "ENSG00000163064" } } }, "hgnc_date_symbol_changed": "1989-05-08" }, "entity_type": "gene", "entity_name": "EN1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "33568816" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "ENDOVE syndrome, limb-only type, MIM# 619217", "ENDOVE syndrome, limb-brain type, MIM# 619218" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "SV/CNV", "5'UTR" ], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0304", "MLL2", "TRX2", "HRX2", "WBP7", "MLL1B", "MLL4", "CXXC10" ], "biotype": "protein_coding", "hgnc_id": "HGNC:15840", "gene_name": "lysine methyltransferase 2B", "omim_gene": [ "606834" ], "alias_name": [ "myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4" ], "gene_symbol": "KMT2B", "hgnc_symbol": "KMT2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:36208921-36229779", "ensembl_id": "ENSG00000272333" } }, "GRch38": { "90": { "location": "19:35718019-35738878", "ensembl_id": "ENSG00000272333" } } }, "hgnc_date_symbol_changed": "2013-05-09" }, "entity_type": "gene", "entity_name": "KMT2B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27839873", "27992417", "33150406" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Dystonia 28, childhood-onset 617284", "MONDO:0015004" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "B14.7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20371", "gene_name": "NADH:ubiquinone oxidoreductase subunit A11", "omim_gene": [ "612638" ], "alias_name": [ "complex I B14.7 subunit" ], "gene_symbol": "NDUFA11", "hgnc_symbol": "NDUFA11", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:5891287-5904017", "ensembl_id": "ENSG00000174886" } }, "GRch38": { "90": { "location": "19:5891276-5904006", "ensembl_id": "ENSG00000174886" } } }, "hgnc_date_symbol_changed": "2003-12-03" }, "entity_type": "gene", "entity_name": "NDUFA11", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "18306244", "31074871" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Mitochondrial complex I deficiency, nuclear type 14, MIM#618236" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PKCC", "MGC57564" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9402", "gene_name": "protein kinase C gamma", "omim_gene": [ "176980" ], "alias_name": [ "PKC-gamma" ], "gene_symbol": "PRKCG", "hgnc_symbol": "PRKCG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:54382444-54410906", "ensembl_id": "ENSG00000126583" } }, "GRch38": { "90": { "location": "19:53879190-53907652", "ensembl_id": "ENSG00000126583" } } }, "hgnc_date_symbol_changed": "1991-08-02" }, "entity_type": "gene", "entity_name": "PRKCG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12644968", "14676051", "14694043", "16193476", "33739604", "34292398" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Spinocerebellar ataxia 14, MIM# 605361" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "M-SemaK", "KIAA0331", "coll-5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10727", "gene_name": "semaphorin 3E", "omim_gene": [ "608166" ], "alias_name": [ "M-sema H" ], "gene_symbol": "SEMA3E", "hgnc_symbol": "SEMA3E", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:82993222-83278326", "ensembl_id": "ENSG00000170381" } }, "GRch38": { "90": { "location": "7:83363906-83649010", "ensembl_id": "ENSG00000170381" } } }, "hgnc_date_symbol_changed": "1999-06-25" }, "entity_type": "gene", "entity_name": "SEMA3E", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15235037", "31691538", "31464029", "35628442", "32441320" ], "evidence": [ "Expert Review Amber", "Victorian Clinical Genetics Services" ], "phenotypes": [ "CHARGE syndrome, MIM#214800" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:16808", "gene_name": "ubiquitin protein ligase E3 component n-recognin 1", "omim_gene": [ "605981" ], "alias_name": null, "gene_symbol": "UBR1", "hgnc_symbol": "UBR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:43235095-43398311", "ensembl_id": "ENSG00000159459" } }, "GRch38": { "90": { "location": "15:42942897-43106113", "ensembl_id": "ENSG00000159459" } } }, "hgnc_date_symbol_changed": "2002-01-25" }, "entity_type": "gene", "entity_name": "UBR1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24599544" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Johanson-Blizzard syndrome (MIM#243800)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PPI5PIV", "CORS1", "pharbin" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21474", "gene_name": "inositol polyphosphate-5-phosphatase E", "omim_gene": [ "613037" ], "alias_name": null, "gene_symbol": "INPP5E", "hgnc_symbol": "INPP5E", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:139323071-139334274", "ensembl_id": "ENSG00000148384" } }, "GRch38": { "90": { "location": "9:136428619-136439823", "ensembl_id": "ENSG00000148384" } } }, "hgnc_date_symbol_changed": "2003-06-13" }, "entity_type": "gene", "entity_name": "INPP5E", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "34211432", "19668216", "32139166", "29230161", "29052317", "27998989", "27401686", "19668215" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Joubert syndrome 1, MIM# 213300", "MONDO:0008944", "Mental retardation, truncal obesity, retinal dystrophy, and micropenis, MIM# 610156", "MONDO:0012423" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MAR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6116", "gene_name": "interferon regulatory factor 1", "omim_gene": [ "147575" ], "alias_name": [ "interferon regulatory factor-1" ], "gene_symbol": "IRF1", "hgnc_symbol": "IRF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:131817301-131826490", "ensembl_id": "ENSG00000125347" } }, "GRch38": { "90": { "location": "5:132481609-132490798", "ensembl_id": "ENSG00000125347" } } }, "hgnc_date_symbol_changed": "1991-05-09" }, "entity_type": "gene", "entity_name": "IRF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "36736301" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Immunodeficiency 117, mycobacteriosis, autosomal recessive, MIM# 620668" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 137, "hash_id": null, "name": "Mendeliome", "disease_group": "", "disease_sub_group": "", "description": "The Mendeliome contains genes currently associated with Mendelian gene disorders.\r\n\r\nThe Mendeliome is intended to be used to facilitate panel-agnostic analysis, particularly in complex paediatric patients with multi-system features, while still limiting analysis to genes with published evidence for gene-disease association and minimising the chance of incidental findings. It therefore excludes genes listed in the Incidentalome, such as those associated with some cardiac disorders, cancer predisposition syndromes, and neurodegenerative diseases. If analysis of these genes is required, the relevant disease-specific panel (e.g. Adult Additional Findings, Neurodegenerative Disease_Adult Onset, Regression, Breast Cancer) should be requested.\r\n\r\nPlease note that mitochondrially-encoded genes may only be analysed as part of some genomic tests, e.g. WGS with appropriate accreditation in place. If uncertain, please contact your test provider.\r\n\r\nSTRs are currently on this panel as 'grey' due to lack of clinical accreditation for STR analysis in Australian laboratories.\r\n\r\nThis panel was originally developed by VCGS and is a consensus panel used by RMH.", "status": "public", "version": "1.4716", "version_created": "2026-04-04T15:36:29.134157+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 6012, "number_of_strs": 43, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GGPPS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4249", "gene_name": "geranylgeranyl diphosphate synthase 1", "omim_gene": [ "606982" ], "alias_name": null, "gene_symbol": "GGPS1", "hgnc_symbol": "GGPS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:235490665-235507847", "ensembl_id": "ENSG00000152904" } }, "GRch38": { "90": { "location": "1:235327350-235344532", "ensembl_id": "ENSG00000152904" } } }, "hgnc_date_symbol_changed": "1999-08-26" }, "entity_type": "gene", "entity_name": "GGPS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32403198" ], "evidence": [ "Expert Review Green", "Literature", "Expert Review Green", "Literature" ], "phenotypes": [ "Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518", "Muscular dystrophy", "Deafness", "Ovarian insufficiency" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 141, "hash_id": null, "name": "Muscular dystrophy and myopathy_Paediatric", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and RMH.\r\n\r\nIt contains genes typically associated with congenital muscular dystrophies and myopathies, which are characterised by weakness at birth, muscle biopsy showing dystrophic or myopathic changes, raised CK, and sometimes structural brain abnormalities. It also contains some genes that cause disorders with overlapping clinical features.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.122", "version_created": "2026-04-02T11:45:25.115390+11:00", "relevant_disorders": [ "Muscular dystrophy", "HP:0003560; Elevated circulating creatine kinase concentration", "HP:0003236; Myopathy", "HP:0003198" ], "stats": { "number_of_genes": 146, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "SVMT", "SVAT" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10935", "gene_name": "solute carrier family 18 member A2", "omim_gene": [ "193001" ], "alias_name": null, "gene_symbol": "SLC18A2", "hgnc_symbol": "SLC18A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:119000604-119038941", "ensembl_id": "ENSG00000165646" } }, "GRch38": { "90": { "location": "10:117241093-117279430", "ensembl_id": "ENSG00000165646" } } }, "hgnc_date_symbol_changed": "1994-05-25" }, "entity_type": "gene", "entity_name": "SLC18A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "23363473", "31240161", "26497564", "9427250", "11463816", "9427251" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Parkinsonism-dystonia, infantile, 2, MIM#\t618049" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 145, "hash_id": null, "name": "Neurotransmitter Defects", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThe panel contains genes associated with neurotransmitter disorders, a heterogeneous group of disorders involving defects in the metabolism of monoamines (dopamine, norepinephrine, epinephrine and serotonin), GABA and glycine. The clinical presentations were highly variable, and may include seizures, neurodevelopmental delay, movement disorders, gait abnormalities, hypotonia, autonomic features. Measurement of neurotransmitter metabolites in cerebral spinal fluid (CSF) may be helpful in delineating the metabolic defects.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Neurotransmitter disorders' panel V1.6 with all discrepancies resolved and reciprocal feedback provided to Genomics England.", "status": "public", "version": "1.8", "version_created": "2026-01-09T20:59:22.980216+11:00", "relevant_disorders": [ "Abnormal CSF metabolite concentration", "HP:0025454" ], "stats": { "number_of_genes": 41, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "osterix", "OSX" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17321", "gene_name": "Sp7 transcription factor", "omim_gene": [ "606633" ], "alias_name": null, "gene_symbol": "SP7", "hgnc_symbol": "SP7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:53720362-53739099", "ensembl_id": "ENSG00000170374" } }, "GRch38": { "90": { "location": "12:53326575-53345315", "ensembl_id": "ENSG00000170374" } } }, "hgnc_date_symbol_changed": "2002-09-23" }, "entity_type": "gene", "entity_name": "SP7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20579626", "29382611", "35367406", "34091789", "32413570" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Osteogenesis imperfecta type 12, MONDO:0013460", "Osteogenesis imperfecta, type XII, OMIM:613849" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 147, "hash_id": null, "name": "Osteogenesis Imperfecta and Osteoporosis", "disease_group": "Skeletal disorders; Endocrine disorders", "disease_sub_group": "", "description": "This panel contains genes associated with osteogenesis imperfecta and osteoporosis. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Osteogenesis imperfecta' panel V5.1, with all discrepancies reviewed and resolved (November 2025).", "status": "public", "version": "1.18", "version_created": "2026-02-22T14:59:29.563350+11:00", "relevant_disorders": [ "Increased susceptibility to fractures", "HP:0002659" ], "stats": { "number_of_genes": 48, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ11856", "PAR1", "GPCR41", "D15Ertd747e", "RFVT2", "hRFT3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30224", "gene_name": "solute carrier family 52 member 2", "omim_gene": [ "607882" ], "alias_name": null, "gene_symbol": "SLC52A2", "hgnc_symbol": "SLC52A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:145577795-145584932", "ensembl_id": "ENSG00000185803" } }, "GRch38": { "90": { "location": "8:144354135-144361272", "ensembl_id": "ENSG00000185803" } } }, "hgnc_date_symbol_changed": "2012-02-29" }, "entity_type": "gene", "entity_name": "SLC52A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "PMID: 22864630", "29961509", "30377535", "29287867" ], "evidence": [ "Expert Review Green", "Expert Review" ], "phenotypes": [ "Brown-Vialetto-Van Laere syndrome 2" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 149, "hash_id": null, "name": "Optic Atrophy", "disease_group": "Ophthalmological disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and RMH and contains genes associated with isolated and complex optic atrophy.", "status": "public", "version": "1.72", "version_created": "2026-03-31T18:57:17.873049+11:00", "relevant_disorders": [ "Optic atrophy", "HP:0000648" ], "stats": { "number_of_genes": 80, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "AC", "PHP32", "FLJ21558", "ACDase" ], "biotype": "protein_coding", "hgnc_id": "HGNC:735", "gene_name": "N-acylsphingosine amidohydrolase 1", "omim_gene": [ "613468" ], "alias_name": [ "acylsphingosine deacylase", "acid ceramidase" ], "gene_symbol": "ASAH1", "hgnc_symbol": "ASAH1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:17913934-17942494", "ensembl_id": "ENSG00000104763" } }, "GRch38": { "90": { "location": "8:18055992-18084998", "ensembl_id": "ENSG00000104763" } } }, "hgnc_date_symbol_changed": "2002-09-13" }, "entity_type": "gene", "entity_name": "ASAH1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Farber lipogranulomatosis, MIM# 228000" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 181, "hash_id": null, "name": "Lysosomal Storage Disorder", "disease_group": "Metabolic conditions", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.\r\n\r\nThe lysosomal storage diseases are a group of progressive metabolic disorders that are caused by enzyme deficiencies within the lysosome. The abnormal storage process leads to a broad spectrum of somatic and/or neurological clinical manifestations depending on the specific substrate and site of accumulation. Examples include the mucopolysaccharidoses, mucolipidoses, oligosaccharidoses, Pompe disease, Gaucher disease, Fabry disease, the Niemann-Pick disorders, and neuronal ceroid lipofuscinoses.\r\n\r\nIf the clinical presentation is not specific for a lysosomal storage disorder, please consider the broader Metabolic Disorders Superpanel.", "status": "public", "version": "1.31", "version_created": "2026-03-31T16:05:25.488597+11:00", "relevant_disorders": [ "Lysosomal storage disorder", "MONDO:0002561; Visceromegaly", "HP:0003271" ], "stats": { "number_of_genes": 80, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SLSN4", "KIAA0673", "POC10" ], "biotype": "protein_coding", "hgnc_id": "HGNC:19104", "gene_name": "nephrocystin 4", "omim_gene": [ "607215" ], "alias_name": [ "nephroretinin", "POC10 centriolar protein homolog (Chlamydomonas)" ], "gene_symbol": "NPHP4", "hgnc_symbol": "NPHP4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:5922871-6052533", "ensembl_id": "ENSG00000131697" } }, "GRch38": { "90": { "location": "1:5862811-5992473", "ensembl_id": "ENSG00000131697" } } }, "hgnc_date_symbol_changed": "2002-10-03" }, "entity_type": "gene", "entity_name": "NPHP4", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12244321", "12205563", "34013113" ], "evidence": [ "Expert Review Green", "KidGen_CilioNephronop v38.1.0" ], "phenotypes": [ "Nephronophthisis 4, MIM# 606966", "Senior-Loken syndrome 4, MIM# 606996" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 193, "hash_id": null, "name": "Renal Ciliopathies and Nephronophthisis", "disease_group": "Renal and urinary tract disorders", "disease_sub_group": "", "description": "This panel was created by the KidGen consortium and is a consensus panel used by VCGS and KidGen", "status": "public", "version": "1.53", "version_created": "2026-03-19T17:14:29.802874+11:00", "relevant_disorders": [ "Abnormality of renal medullary morphology", "HP:0025361; Renal cyst", "HP:0000107" ], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "KidGen", "slug": "kidgen", "description": "Panel used by the KidGen Collaborative." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "OCRL1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8108", "gene_name": "OCRL, inositol polyphosphate-5-phosphatase", "omim_gene": [ "300535" ], "alias_name": null, "gene_symbol": "OCRL", "hgnc_symbol": "OCRL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:128673826-128726538", "ensembl_id": "ENSG00000122126" } }, "GRch38": { "90": { "location": "X:129539849-129592561", "ensembl_id": "ENSG00000122126" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "OCRL", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35919034" ], "evidence": [ "Expert Review Red", "Literature" ], "phenotypes": [ "Lowe syndrome MIM#309000" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GluA2", "GLURB" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4572", "gene_name": "glutamate ionotropic receptor AMPA type subunit 2", "omim_gene": [ "138247" ], "alias_name": null, "gene_symbol": "GRIA2", "hgnc_symbol": "GRIA2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:158125334-158287227", "ensembl_id": "ENSG00000120251" } }, "GRch38": { "90": { "location": "4:157204182-157366075", "ensembl_id": "ENSG00000120251" } } }, "hgnc_date_symbol_changed": "1992-02-26" }, "entity_type": "gene", "entity_name": "GRIA2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31300657" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Intellectual disability", "autism", "Rett-like features", "epileptic encephalopathy", "Neurodevelopmental disorder with language impairment and behavioral abnormalities, MIM#\t618917" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "EJM5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4075", "gene_name": "gamma-aminobutyric acid type A receptor alpha1 subunit", "omim_gene": [ "137160" ], "alias_name": [ "GABA(A) receptor, alpha 1" ], "gene_symbol": "GABRA1", "hgnc_symbol": "GABRA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:161274197-161326975", "ensembl_id": "ENSG00000022355" } }, "GRch38": { "90": { "location": "5:161847063-161899981", "ensembl_id": "ENSG00000022355" } } }, "hgnc_date_symbol_changed": "1989-06-02" }, "entity_type": "gene", "entity_name": "GABRA1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11992121", "21714819", "24623842", "30842224" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Epilepsy Flagship" ], "phenotypes": [ "Epileptic encephalopathy, early infantile, 19 615744", "Rett syndrome", "Rett-like phenotypes", "idiopathic generalized Epilepsy", "Dravet syndrome" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NOV" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9099", "gene_name": "plexin A1", "omim_gene": [ "601055" ], "alias_name": null, "gene_symbol": "PLXNA1", "hgnc_symbol": "PLXNA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:126707437-126756235", "ensembl_id": "ENSG00000114554" } }, "GRch38": { "90": { "location": "3:126988594-127037392", "ensembl_id": "ENSG00000114554" } } }, "hgnc_date_symbol_changed": "1998-08-13" }, "entity_type": "gene", "entity_name": "PLXNA1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34054129" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Dworschak-Punetha neurodevelopmental syndrome, MIM# 619955" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 202, "hash_id": null, "name": "Genetic Epilepsy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "The panel contains genes causing isolated genetic epilepsy as well as genes causing complex disorders where epilepsy is a prominent and/or common feature. However, if clinical features suggestive of a metabolic or other multi-system disorder are present, we recommend also applying the other clinically relevant panels (e.g. mitochondrial) for completeness.\r\n\r\nThis panel was used by the Australian Genomics Epilepsy Flagship and is a consensus panel used and maintained by VCGS and RMH. It is a consensus panel for the Gene-STEPs study (International Precision Child Health Partnership).\r\n\r\nThis panel has been compared with the Genomics England Genetic Epilepsy panel and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, Feb 2020.", "status": "public", "version": "1.408", "version_created": "2026-04-02T11:46:13.244668+11:00", "relevant_disorders": [ "Seizure", "HP:0001250; Epileptic encephalopathy", "HP:0200134; EEG abnormality", "HP:0002353" ], "stats": { "number_of_genes": 1154, "number_of_strs": 9, "number_of_regions": 13 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "COX1", "COI" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7419", "gene_name": "mitochondrially encoded cytochrome c oxidase I", "omim_gene": [ "516030" ], "alias_name": null, "gene_symbol": "MT-CO1", "hgnc_symbol": "MT-CO1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "MT:5904-7445", "ensembl_id": "ENSG00000198804" } }, "GRch38": { "90": { "location": "MT:5904-7445", "ensembl_id": "ENSG00000198804" } } }, "hgnc_date_symbol_changed": "2005-02-16" }, "entity_type": "gene", "entity_name": "MT-CO1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "30743023", "39460813", "24956508", "10441567", "10980727", "15751226", "16284789", "18977334", "22832341", "18276892", "30030519" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related" ], "mode_of_inheritance": "MITOCHONDRIAL", "tags": [ "mtDNA" ], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 437, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "TRNS1" ], "biotype": "Mt_tRNA", "hgnc_id": "HGNC:7497", "gene_name": "mitochondrially encoded tRNA serine 1 (UCN)", "omim_gene": [ "590080" ], "alias_name": null, "gene_symbol": "MT-TS1", "hgnc_symbol": "MT-TS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "MT:7446-7514", "ensembl_id": "ENSG00000210151" } }, "GRch38": { "90": { "location": "MT:7446-7514", "ensembl_id": "ENSG00000210151" } } }, "hgnc_date_symbol_changed": "2005-02-16" }, "entity_type": "gene", "entity_name": "MT-TS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "7669057", "9778262", "14605505", "23696415", "33279600", "7581383" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Mitochondrial disease (MONDO:0044970), MT-TS1-related" ], "mode_of_inheritance": "MITOCHONDRIAL", "tags": [ "mtDNA" ], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 437, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "FMT1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29666", "gene_name": "mitochondrial methionyl-tRNA formyltransferase", "omim_gene": [ "611766" ], "alias_name": null, "gene_symbol": "MTFMT", "hgnc_symbol": "MTFMT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:65294845-65321977", "ensembl_id": "ENSG00000103707" } }, "GRch38": { "90": { "location": "15:65001512-65029639", "ensembl_id": "ENSG00000103707" } } }, "hgnc_date_symbol_changed": "2005-08-09" }, "entity_type": "gene", "entity_name": "MTFMT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "21907147", "23499752", "24461907", "22499348" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Mitochondrial Flagship" ], "phenotypes": [ "Combined oxidative phosphorylation deficiency 15, MIM# 614947", "Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 203, "hash_id": null, "name": "Mitochondrial disease", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel was developed by the Australian Genomics Mitochondrial Disease Flagship and was further refined by merging the panels used by VCGS and RMH.\r\n\r\nThis panel contains: (1) disorders of oxidative phosphorylation (OXPHOS) subunits and their assembly factors, (2) defects of mitochondrial DNA, RNA and protein synthesis, (3) defects in the substrate-generating upstream reactions of OXPHOS, (4) defects in relevant cofactors and (5) defects in mitochondrial homeostasis (Mayr et al, 2015, PMID:25778941) as well as (6) a small number of other conditions that can mimic mitochondrial disorders.\r\n\r\nPlease note the panel contains mitochondrially encoded genes. These may only be sequenced and analysed using particular assays such as mitochondrial genome sequencing or whole genome sequencing. Please check with the testing laboratory whether these genes are included in analysis.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Mitochondrial Disorders panel, and all discrepant gene classifications have been resolved with reciprocal feedback provided to Genomics England 23/03/2020.\r\n\r\nUpdated following literature review 17/12/2025.", "status": "public", "version": "1.16", "version_created": "2026-03-13T18:22:35.610861+11:00", "relevant_disorders": [ "Increased serum lactate", "HP:0002151; Abnormality of mitochondrial metabolism", "HP:0003287" ], "stats": { "number_of_genes": 437, "number_of_strs": 1, "number_of_regions": 1 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FREAC3", "ARA", "IGDA", "IHG1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3800", "gene_name": "forkhead box C1", "omim_gene": [ "601090" ], "alias_name": null, "gene_symbol": "FOXC1", "hgnc_symbol": "FOXC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:1610681-1614127", "ensembl_id": "ENSG00000054598" } }, "GRch38": { "90": { "location": "6:1609972-1613897", "ensembl_id": "ENSG00000054598" } } }, "hgnc_date_symbol_changed": "1995-06-05" }, "entity_type": "gene", "entity_name": "FOXC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIAA0321" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20761", "gene_name": "zinc finger FYVE-type containing 26", "omim_gene": [ "612012" ], "alias_name": [ "spastizin", "FYVE-CENT" ], "gene_symbol": "ZFYVE26", "hgnc_symbol": "ZFYVE26", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "14:68194091-68283307", "ensembl_id": "ENSG00000072121" } }, "GRch38": { "90": { "location": "14:67727374-67816590", "ensembl_id": "ENSG00000072121" } } }, "hgnc_date_symbol_changed": "2003-04-01" }, "entity_type": "gene", "entity_name": "ZFYVE26", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Victorian Clinical Genetics Services", "Expert Review Green" ], "phenotypes": [], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 205, "hash_id": null, "name": "Callosome", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS.", "status": "public", "version": "0.593", "version_created": "2026-04-02T11:47:10.809612+11:00", "relevant_disorders": [ "Abnormal corpus callosum morphology", "HP:0001273" ], "stats": { "number_of_genes": 459, "number_of_strs": 2, "number_of_regions": 3 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "PRPC8", "Prp8", "hPrp8", "SNRNP220" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17340", "gene_name": "pre-mRNA processing factor 8", "omim_gene": [ "607300" ], "alias_name": null, "gene_symbol": "PRPF8", "hgnc_symbol": "PRPF8", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:1553923-1588176", "ensembl_id": "ENSG00000174231" } }, "GRch38": { "90": { "location": "17:1650629-1684882", "ensembl_id": "ENSG00000174231" } } }, "hgnc_date_symbol_changed": "2001-12-11" }, "entity_type": "gene", "entity_name": "PRPF8", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35543142" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder MONDO:0700092, PRPF8-related", "Retinitis pigmentosa 13 - MIM#600059" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "QP-C", "QCR7", "UQCR6" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12582", "gene_name": "ubiquinol-cytochrome c reductase binding protein", "omim_gene": [ "191330" ], "alias_name": [ "ubiquinol-cytochrome c reductase, complex III subunit VI", "cytochrome b-c1 complex subunit 7" ], "gene_symbol": "UQCRB", "hgnc_symbol": "UQCRB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:97238148-97247862", "ensembl_id": "ENSG00000156467" } }, "GRch38": { "90": { "location": "8:96225920-96235634", "ensembl_id": "ENSG00000156467" } } }, "hgnc_date_symbol_changed": "1991-08-20" }, "entity_type": "gene", "entity_name": "UQCRB", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "PubMed: 12709789", "28604960" ], "evidence": [ "Expert Review Red", "Expert list" ], "phenotypes": [ "Mitochondrial complex III deficiency, nuclear type 3", "OMIM #615158" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RENT3B", "UPF3X", "HUPF3B" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20439", "gene_name": "UPF3B, regulator of nonsense mediated mRNA decay", "omim_gene": [ "300298" ], "alias_name": null, "gene_symbol": "UPF3B", "hgnc_symbol": "UPF3B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:118967985-118986961", "ensembl_id": "ENSG00000125351" } }, "GRch38": { "90": { "location": "X:119805311-119852998", "ensembl_id": "ENSG00000125351" } } }, "hgnc_date_symbol_changed": "2003-02-07" }, "entity_type": "gene", "entity_name": "UPF3B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19377476", "17704778", "31737052", "28948974", "32667670" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Mental retardation, X-linked, syndromic 14, MIM# 300676" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:14543", "gene_name": "WNK lysine deficient protein kinase 3", "omim_gene": [ "300358" ], "alias_name": null, "gene_symbol": "WNK3", "hgnc_symbol": "WNK3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:54219256-54385075", "ensembl_id": "ENSG00000196632" } }, "GRch38": { "90": { "location": "X:54192823-54358642", "ensembl_id": "ENSG00000196632" } } }, "hgnc_date_symbol_changed": "2005-01-22" }, "entity_type": "gene", "entity_name": "WNK3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "35678782" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Prieto syndrome, MIM# 309610" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ22490", "CSPP", "JBTS21" ], "biotype": "protein_coding", "hgnc_id": "HGNC:26193", "gene_name": "centrosome and spindle pole associated protein 1", "omim_gene": [ "611654" ], "alias_name": null, "gene_symbol": "CSPP1", "hgnc_symbol": "CSPP1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:67974661-68108498", "ensembl_id": "ENSG00000104218" } }, "GRch38": { "90": { "location": "8:67062426-67196263", "ensembl_id": "ENSG00000104218" } } }, "hgnc_date_symbol_changed": "2005-09-06" }, "entity_type": "gene", "entity_name": "CSPP1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "24360808", "24360803", "24360807", "25997910" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Joubert syndrome 21, MIM# 615636", "MONDO:0014288" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "norrin" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7678", "gene_name": "NDP, norrin cystine knot growth factor", "omim_gene": [ "300658" ], "alias_name": null, "gene_symbol": "NDP", "hgnc_symbol": "NDP", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:43808022-43832750", "ensembl_id": "ENSG00000124479" } }, "GRch38": { "90": { "location": "X:43948776-43973504", "ensembl_id": "ENSG00000124479" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "NDP", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Norrie disease MONDO:0010691" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "L-SOX5", "MGC35153" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11201", "gene_name": "SRY-box 5", "omim_gene": [ "604975" ], "alias_name": null, "gene_symbol": "SOX5", "hgnc_symbol": "SOX5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:23682440-24103966", "ensembl_id": "ENSG00000134532" } }, "GRch38": { "90": { "location": "12:23529500-23951032", "ensembl_id": "ENSG00000134532" } } }, "hgnc_date_symbol_changed": "1997-07-07" }, "entity_type": "gene", "entity_name": "SOX5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31578471" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Lamb-Shaffer syndrome, MIM#616803" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "SV/CNV" ], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "GAA1", "hGAA1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4446", "gene_name": "glycosylphosphatidylinositol anchor attachment 1", "omim_gene": [ "603048" ], "alias_name": [ "GPI transamidase subunit" ], "gene_symbol": "GPAA1", "hgnc_symbol": "GPAA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:145137493-145141119", "ensembl_id": "ENSG00000197858" } }, "GRch38": { "90": { "location": "8:144082590-144086216", "ensembl_id": "ENSG00000197858" } } }, "hgnc_date_symbol_changed": "1998-12-09" }, "entity_type": "gene", "entity_name": "GPAA1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "29100095" ], "evidence": [ "Expert Review Green", "Genetic Health Queensland" ], "phenotypes": [ "Glycosylphosphatidylinositol biosynthesis defect 15, MIM# 617810" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 250, "hash_id": null, "name": "Intellectual disability syndromic and non-syndromic", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel was created by merging the ID panels used by Genetic Health Queensland and by the Victorian Clinical Genetics Services. Discrepant gene classifications reviewed and resolved by Chirag Patel and Zornitza Stark.\r\n\r\nThis is a consensus panel used by VCGS, GHQ and RMH.\r\n\r\nThis panel has been compared against the Genomics England PanelApp Intellectual Disability panel, and all discrepancies have been resolved, with reciprocal reviews provided to Genomics England, 11/3/2020.", "status": "public", "version": "1.745", "version_created": "2026-04-03T15:53:29.044094+11:00", "relevant_disorders": [ "Intellectual disability", "HP:0001249; Neurodevelopmental delay", "HP:0012758" ], "stats": { "number_of_genes": 2523, "number_of_strs": 10, "number_of_regions": 57 }, "types": [ { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3666", "gene_name": "fibroblast growth factor 10", "omim_gene": [ "602115" ], "alias_name": null, "gene_symbol": "FGF10", "hgnc_symbol": "FGF10", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:44303646-44389808", "ensembl_id": "ENSG00000070193" } }, "GRch38": { "90": { "location": "5:44303544-44389706", "ensembl_id": "ENSG00000070193" } } }, "hgnc_date_symbol_changed": "1996-12-16" }, "entity_type": "gene", "entity_name": "FGF10", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Illumina TruGenome Clinical Sequencing Services", "UKGTN", "Radboud University Medical Center, Nijmegen", "Expert Review Green", "NHS GMS", "Expert list", "Emory Genetics Laboratory" ], "phenotypes": [ "LADD syndrome 149730" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10715", "BBS2L1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18758", "gene_name": "Bardet-Biedl syndrome 7", "omim_gene": [ "607590" ], "alias_name": null, "gene_symbol": "BBS7", "hgnc_symbol": "BBS7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:122745595-122791652", "ensembl_id": "ENSG00000138686" } }, "GRch38": { "90": { "location": "4:121824440-121870497", "ensembl_id": "ENSG00000138686" } } }, "hgnc_date_symbol_changed": "2003-02-05" }, "entity_type": "gene", "entity_name": "BBS7", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert list", "Expert Review Green", "Emory Genetics Laboratory", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Bardet-Biedl syndrome 7, 615984", "Polydactyly" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 258, "hash_id": null, "name": "Skeletal dysplasia", "disease_group": "Skeletal disorders", "disease_sub_group": "Skeletal dysplasias", "description": "This panel contains genes associated with skeletal dysplasias. \r\n\r\nIt has been compared against the Genomics England PanelApp 'Skeletal dysplasia' panel V8.6, with all discrepancies reviewed and resolved (January 2026).\r\n\r\nDepending on the specific clinical features present, consider applying the Osteogenesis Imperfecta, Osteoporosis and Osteopetrosis, and Hypophosphataemia or rickets panels.", "status": "public", "version": "0.430", "version_created": "2026-04-02T18:26:54.505675+11:00", "relevant_disorders": [ "Skeletal dysplasia", "HP:0002652" ], "stats": { "number_of_genes": 633, "number_of_strs": 4, "number_of_regions": 6 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10514" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25538", "gene_name": "aspartyl-tRNA synthetase 2, mitochondrial", "omim_gene": [ "610956" ], "alias_name": [ "aspartate tRNA ligase 2, mitochondrial" ], "gene_symbol": "DARS2", "hgnc_symbol": "DARS2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:173793641-173827684", "ensembl_id": "ENSG00000117593" } }, "GRch38": { "90": { "location": "1:173824503-173858546", "ensembl_id": "ENSG00000117593" } } }, "hgnc_date_symbol_changed": "2005-06-28" }, "entity_type": "gene", "entity_name": "DARS2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Royal Melbourne Hospital", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation", "Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 271, "hash_id": null, "name": "Ataxia", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause conditions where ataxia is a prominent feature of the phenotype. This is a consensus panel used and maintained by RMH and VCGS.", "status": "public", "version": "1.202", "version_created": "2026-04-02T15:02:17.166617+11:00", "relevant_disorders": [ "Ataxia", "HP:0001251" ], "stats": { "number_of_genes": 328, "number_of_strs": 21, "number_of_regions": 2 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "JM2", "XPID", "AIID", "PIDX", "DIETER", "SCURFIN" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6106", "gene_name": "forkhead box P3", "omim_gene": [ "300292" ], "alias_name": null, "gene_symbol": "FOXP3", "hgnc_symbol": "FOXP3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:49106897-49121288", "ensembl_id": "ENSG00000049768" } }, "GRch38": { "90": { "location": "X:49250436-49264826", "ensembl_id": "ENSG00000049768" } } }, "hgnc_date_symbol_changed": "2002-09-20" }, "entity_type": "gene", "entity_name": "FOXP3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "11137992", "32234571", "11137993", "33614561" ], "evidence": [ "Expert Review Green", "UKGTN" ], "phenotypes": [ "immune dysregulation-polyendocrinopathy-enteropathy-X-linked syndrome MONDO:0010580" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3093, "hash_id": null, "name": "Monogenic Diabetes", "disease_group": "Endocrine disorders", "disease_sub_group": "", "description": "This panel contains genes associated with monogenic diabetes, including: \r\n-familial diabetes\r\n-neonatal diabetes\r\n-maturity onset diabetes of the young\r\n-insulin resistance (including lipodystrophy)\r\n\r\nIt has been compared against the following Genomics England PanelApp panels with all discrepancies reviewed and resolved (February 2026) : monogenic diabetes (V3.8), familial diabetes (V1.68), neonatal diabetes (V5.14), multi-organ autoimmune diabetes (V1.12), diabetes with additional phenotypes suggestive of a monogenic aetiology (V1.68), and insulin resistance (including lipodystrophy)(V1.18). \r\n\r\nFor a high suspicion of a mitochondrial DNA disorder: \r\nrequest a specific assay for mitochondrially encoded genes (such as mitochondrial genome sequencing or whole genome sequencing).", "status": "public", "version": "0.222", "version_created": "2026-04-01T16:48:42.206624+11:00", "relevant_disorders": [ "Diabetes mellitus", "HP:0000819" ], "stats": { "number_of_genes": 109, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZP434K046" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25302", "gene_name": "coenzyme Q9", "omim_gene": [ "612837" ], "alias_name": null, "gene_symbol": "COQ9", "hgnc_symbol": "COQ9", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:57481337-57495187", "ensembl_id": "ENSG00000088682" } }, "GRch38": { "90": { "location": "16:57447425-57461275", "ensembl_id": "ENSG00000088682" } } }, "hgnc_date_symbol_changed": "2006-01-13" }, "entity_type": "gene", "entity_name": "COQ9", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "19375058", "26081641", "31821167", "11562630" ], "evidence": [ "Expert Review Red", "NHS GMS" ], "phenotypes": [ "encephalopathy-hypertrophic cardiomyopathy-renal tubular disease syndrome MONDO:0013840" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3093, "hash_id": null, "name": "Monogenic Diabetes", "disease_group": "Endocrine disorders", "disease_sub_group": "", "description": "This panel contains genes associated with monogenic diabetes, including: \r\n-familial diabetes\r\n-neonatal diabetes\r\n-maturity onset diabetes of the young\r\n-insulin resistance (including lipodystrophy)\r\n\r\nIt has been compared against the following Genomics England PanelApp panels with all discrepancies reviewed and resolved (February 2026) : monogenic diabetes (V3.8), familial diabetes (V1.68), neonatal diabetes (V5.14), multi-organ autoimmune diabetes (V1.12), diabetes with additional phenotypes suggestive of a monogenic aetiology (V1.68), and insulin resistance (including lipodystrophy)(V1.18). \r\n\r\nFor a high suspicion of a mitochondrial DNA disorder: \r\nrequest a specific assay for mitochondrially encoded genes (such as mitochondrial genome sequencing or whole genome sequencing).", "status": "public", "version": "0.222", "version_created": "2026-04-01T16:48:42.206624+11:00", "relevant_disorders": [ "Diabetes mellitus", "HP:0000819" ], "stats": { "number_of_genes": 109, "number_of_strs": 0, "number_of_regions": 2 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20069", "ORF1", "JBTS3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21575", "gene_name": "Abelson helper integration site 1", "omim_gene": [ "608894" ], "alias_name": [ "Jouberin" ], "gene_symbol": "AHI1", "hgnc_symbol": "AHI1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:135604670-135818914", "ensembl_id": "ENSG00000135541" } }, "GRch38": { "90": { "location": "6:135283532-135497776", "ensembl_id": "ENSG00000135541" } } }, "hgnc_date_symbol_changed": "2003-08-22" }, "entity_type": "gene", "entity_name": "AHI1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Joubert syndrome-3, 608629 (3)" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3139, "hash_id": null, "name": "Mackenzie's Mission_Reproductive Carrier Screening", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been developed by Mackenzie's Mission, a reproductive carrier screening project that will offer testing to 10,000 couples.\r\n\r\nCriteria used to select genes are: the condition should be life-limiting or disabling, with childhood onset, such that couples would be likely to take steps to avoid having an affected child; and/or be one for which early diagnosis and intervention would substantially change outcome (PMID: 32678339).\r\n\r\nThe panel is managed by Mackenzie's Mission. Please note this panel is no longer in use but represents a historical record of the gene list used by Mackenzie's Mission.", "status": "public", "version": "0.111", "version_created": "2025-11-21T16:50:54.555702+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1335, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "New South Wales Health Pathology", "slug": "new-south-wales-health-pathology", "description": "New South Wales Health Pathology" }, { "name": "PathWest", "slug": "pathwest", "description": "PathWest" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RNF55", "c-Cbl" ], "biotype": "protein_coding", "hgnc_id": "HGNC:1541", "gene_name": "Cbl proto-oncogene", "omim_gene": [ "165360" ], "alias_name": [ "oncogene CBL2" ], "gene_symbol": "CBL", "hgnc_symbol": "CBL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:119076752-119178859", "ensembl_id": "ENSG00000110395" } }, "GRch38": { "90": { "location": "11:119206276-119313926", "ensembl_id": "ENSG00000110395" } } }, "hgnc_date_symbol_changed": "1989-06-30" }, "entity_type": "gene", "entity_name": "CBL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments", "publications": [ "25283271", "28343148", "28589114" ], "evidence": [ "Expert Review Green", "Expert Review Green", "Genomics England PanelApp", "Victorian Clinical Genetics Services" ], "phenotypes": [ "early-onset moyamoya angiopathy", "Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia, 613563" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3144, "hash_id": null, "name": "Cerebral vascular malformations", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes associated with cerebral vascular malformations, including:\r\nVein of Galen malformation\r\nCerebral vascular malformations\r\nMoyamoya disease\r\n\r\nConsider applying the Stroke and Aortopathy_Connective Tissue Disorders panels due to overlap in clinical features.\r\nWith thanks to the Genomics England PanelApp team for the original design.", "status": "public", "version": "1.12", "version_created": "2026-01-22T10:52:30.127872+11:00", "relevant_disorders": [ "Abnormal cerebral vascular morphology HP:0100659" ], "stats": { "number_of_genes": 54, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SCLH", "DC", "LISX", "DBCN", "XLIS" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2714", "gene_name": "doublecortin", "omim_gene": [ "300121" ], "alias_name": [ "doublecortex" ], "gene_symbol": "DCX", "hgnc_symbol": "DCX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:110537007-110655603", "ensembl_id": "ENSG00000077279" } }, "GRch38": { "90": { "location": "X:111293779-111412429", "ensembl_id": "ENSG00000077279" } } }, "hgnc_date_symbol_changed": "1998-03-24" }, "entity_type": "gene", "entity_name": "DCX", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "Expert Review Green", "Genomics England PanelApp", "Victorian Clinical Genetics Services" ], "phenotypes": [ "lissencephaly spectrum disorders MONDO:0018838" ], "mode_of_inheritance": "", "tags": [], "panel": { "id": 3144, "hash_id": null, "name": "Cerebral vascular malformations", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes associated with cerebral vascular malformations, including:\r\nVein of Galen malformation\r\nCerebral vascular malformations\r\nMoyamoya disease\r\n\r\nConsider applying the Stroke and Aortopathy_Connective Tissue Disorders panels due to overlap in clinical features.\r\nWith thanks to the Genomics England PanelApp team for the original design.", "status": "public", "version": "1.12", "version_created": "2026-01-22T10:52:30.127872+11:00", "relevant_disorders": [ "Abnormal cerebral vascular morphology HP:0100659" ], "stats": { "number_of_genes": 54, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "EIF-2Balpha", "EIF-2B", "EIF2BA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3257", "gene_name": "eukaryotic translation initiation factor 2B subunit alpha", "omim_gene": [ "606686" ], "alias_name": null, "gene_symbol": "EIF2B1", "hgnc_symbol": "EIF2B1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:124104953-124118313", "ensembl_id": "ENSG00000111361" } }, "GRch38": { "90": { "location": "12:123620406-123633766", "ensembl_id": "ENSG00000111361" } } }, "hgnc_date_symbol_changed": "1991-03-04" }, "entity_type": "gene", "entity_name": "EIF2B1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Leukoencephalopathy with vanishing white matter" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CRYPTIC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18292", "gene_name": "cripto, FRL-1, cryptic family 1", "omim_gene": [ "605194" ], "alias_name": null, "gene_symbol": "CFC1", "hgnc_symbol": "CFC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:131350339-131357123", "ensembl_id": "ENSG00000136698" } }, "GRch38": { "90": { "location": "2:130592168-130599575", "ensembl_id": "ENSG00000136698" } } }, "hgnc_date_symbol_changed": "2004-02-04" }, "entity_type": "gene", "entity_name": "CFC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Congenital heart defects" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:4180", "gene_name": "1,4-alpha-glucan branching enzyme 1", "omim_gene": [ "607839" ], "alias_name": [ "glycogen branching enzyme", "Andersen disease", "glycogen storage disease type IV" ], "gene_symbol": "GBE1", "hgnc_symbol": "GBE1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:81538850-81811312", "ensembl_id": "ENSG00000114480" } }, "GRch38": { "90": { "location": "3:81489699-81762161", "ensembl_id": "ENSG00000114480" } } }, "hgnc_date_symbol_changed": "1993-06-21" }, "entity_type": "gene", "entity_name": "GBE1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene", "BabySeq Category A gene" ], "phenotypes": [ "Polyglucosan body disease, adult form", "Glycogen storage disease IV" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "BLOC2S2", "AIBP63", "RU2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:17022", "gene_name": "HPS5, biogenesis of lysosomal organelles complex 2 subunit 2", "omim_gene": [ "607521" ], "alias_name": [ "alpha-integrin-binding protein 63", "Ruby-eye protein 2 homolog" ], "gene_symbol": "HPS5", "hgnc_symbol": "HPS5", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "11:18300223-18343745", "ensembl_id": "ENSG00000110756" } }, "GRch38": { "90": { "location": "11:18278668-18322198", "ensembl_id": "ENSG00000110756" } } }, "hgnc_date_symbol_changed": "2002-06-13" }, "entity_type": "gene", "entity_name": "HPS5", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Hermansky-Pudlak syndrome 5" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "MGC50831" ], "biotype": "protein_coding", "hgnc_id": "HGNC:28741", "gene_name": "immunoglobulin like domain containing receptor 1", "omim_gene": [ "609739" ], "alias_name": null, "gene_symbol": "ILDR1", "hgnc_symbol": "ILDR1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:121706170-121741051", "ensembl_id": "ENSG00000145103" } }, "GRch38": { "90": { "location": "3:121987323-122022204", "ensembl_id": "ENSG00000145103" } } }, "hgnc_date_symbol_changed": "2004-07-27" }, "entity_type": "gene", "entity_name": "ILDR1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Deafness, autosomal recessive" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "D22S674" ], "biotype": "protein_coding", "hgnc_id": "HGNC:7631", "gene_name": "alpha-N-acetylgalactosaminidase", "omim_gene": [ "104170" ], "alias_name": null, "gene_symbol": "NAGA", "hgnc_symbol": "NAGA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:42454358-42466846", "ensembl_id": "ENSG00000198951" } }, "GRch38": { "90": { "location": "22:42058354-42070842", "ensembl_id": "ENSG00000198951" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "NAGA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "N-acetylgalactosaminidase alpha deficiency" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NFL", "CMT1F", "CMT2E", "NF68", "PPP1R110" ], "biotype": null, "hgnc_id": "HGNC:7739", "gene_name": "neurofilament light", "omim_gene": [ "162280" ], "alias_name": [ "protein phosphatase 1, regulatory subunit 110" ], "gene_symbol": "NEFL", "hgnc_symbol": "NEFL", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "8:24808468-24814624", "ensembl_id": "ENSG00000104725" } }, "GRch38": { "90": { "location": "8:24950955-24957110", "ensembl_id": "ENSG00000277586" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "NEFL", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "BabySeq Category A gene", "Expert Review Green" ], "phenotypes": [ "Charcot-Marie-Tooth disease" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FREAC2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3810", "gene_name": "forkhead box F2", "omim_gene": [ "603250" ], "alias_name": null, "gene_symbol": "FOXF2", "hgnc_symbol": "FOXF2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:1390069-1395832", "ensembl_id": "ENSG00000137273" } }, "GRch38": { "90": { "location": "6:1389834-1395597", "ensembl_id": "ENSG00000137273" } } }, "hgnc_date_symbol_changed": "1995-06-05" }, "entity_type": "gene", "entity_name": "FOXF2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category C gene" ], "phenotypes": [ "Disorders of sex development with cleft palate" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3302, "hash_id": null, "name": "Additional findings_Paediatric", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is for use by the Acute Care Genomics flagship, Additional Findings sub-study.\r\n\r\nIt is based on the newborn screening list devised by the BabySeq project (PMID: 28079900):\r\nCategory A genes have been annotated Green: high penetrance childhood onset disorders, definitive evidence for gene-disease association\r\nCategory B genes have been annotated Amber: moderate penetrance/evidence, but actionable in childhood\r\nCategory C genes have been annotated Red: limited gene-disease association. These genes are not analysed.\r\n\r\nThe panel also incorporates the Paediatric Additional Findings Treatable and Untreatable panels developed by Melbourne Genomic Health Alliance for the BabyBeyond project (PMID: 31974413), and the panel used by the NC Nexus study (PMID:30851990).", "status": "public", "version": "0.280", "version_created": "2026-01-16T11:59:53.863455+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1425, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "L27" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10328", "gene_name": "ribosomal protein L27", "omim_gene": [ "607526" ], "alias_name": [ "60S ribosomal protein L27" ], "gene_symbol": "RPL27", "hgnc_symbol": "RPL27", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:41150290-41154976", "ensembl_id": "ENSG00000131469" } }, "GRch38": { "90": { "location": "17:42998273-43002959", "ensembl_id": "ENSG00000131469" } } }, "hgnc_date_symbol_changed": "1994-05-16" }, "entity_type": "gene", "entity_name": "RPL27", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "25424902" ], "evidence": [ "Expert Review Red", "London South GLH", "Wessex and West Midlands GLH", "NHS GMS", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Diamond-Blackfan anemia 16, MIM# 617408" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3366, "hash_id": null, "name": "Red cell disorders", "disease_group": "Haematological disorders", "disease_sub_group": "", "description": "This panel contains genes associated with red cell disorders, including anaemias and erythrocytosis.\r\n\r\nPlease refer to the Bone Marrow Failure panel if there is suspicion of pancytopaenia, and to the Diamond Blackfan Anaemia panel if specific features of DBA are present.\r\n\r\nWith thanks to Genomics England PanelApp/NHS Genomic Medicine Service for the original design of this panel.", "status": "public", "version": "1.52", "version_created": "2026-03-28T15:18:36.006857+11:00", "relevant_disorders": [ "Abnormal erythrocyte morphology", "HP:0001877" ], "stats": { "number_of_genes": 116, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CDGAP" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29216", "gene_name": "Rho GTPase activating protein 31", "omim_gene": [ "610911" ], "alias_name": null, "gene_symbol": "ARHGAP31", "hgnc_symbol": "ARHGAP31", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:119013220-119139561", "ensembl_id": "ENSG00000031081" } }, "GRch38": { "90": { "location": "3:119294373-119420714", "ensembl_id": "ENSG00000031081" } } }, "hgnc_date_symbol_changed": "2010-02-19" }, "entity_type": "gene", "entity_name": "ARHGAP31", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green" ], "phenotypes": [ "AOS1", "ADAMS-OLIVER SYNDROME 1" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DERMO1", "Dermo-1", "bHLHa39" ], "biotype": "protein_coding", "hgnc_id": "HGNC:20670", "gene_name": "twist family bHLH transcription factor 2", "omim_gene": [ "607556" ], "alias_name": null, "gene_symbol": "TWIST2", "hgnc_symbol": "TWIST2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:239756673-239795893", "ensembl_id": "ENSG00000233608" } }, "GRch38": { "90": { "location": "2:238848032-238910543", "ensembl_id": "ENSG00000233608" } } }, "hgnc_date_symbol_changed": "2003-03-25" }, "entity_type": "gene", "entity_name": "TWIST2", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red" ], "phenotypes": [ "BARBER-SAY SYNDROME", "BBRSAY" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown", "tags": [], "panel": { "id": 3368, "hash_id": null, "name": "Clefting disorders", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "Dysmorphic disorders", "description": "This panel contains genes associated with syndromic and non-syndromic cleft lip and palate.\r\n\r\nWith thanks to Genomics England PanelApp for the original design of this panel. The panel incorporates the 'Cleft Lip' and 'Cleft Palate' panels developed by VCGS.", "status": "public", "version": "0.312", "version_created": "2026-02-24T14:38:08.760295+11:00", "relevant_disorders": [ "Oral cleft HP:0000202" ], "stats": { "number_of_genes": 314, "number_of_strs": 2, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10140", "MTO2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25481", "gene_name": "tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase", "omim_gene": [ "610230" ], "alias_name": null, "gene_symbol": "TRMU", "hgnc_symbol": "TRMU", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:46726772-46753237", "ensembl_id": "ENSG00000100416" } }, "GRch38": { "90": { "location": "22:46330875-46357340", "ensembl_id": "ENSG00000100416" } } }, "hgnc_date_symbol_changed": "2005-08-11" }, "entity_type": "gene", "entity_name": "TRMU", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "19732863" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Liver failure, transient infantile, MIM#\t613070" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3400, "hash_id": null, "name": "Liver Failure_Paediatric", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel includes primary liver disorders as well as metabolic and other multi-system disorders that have been reported to cause liver failure in children.\r\n\r\nPlease also consider using the Cholestasis panel if clinically indicated.", "status": "public", "version": "1.33", "version_created": "2026-01-08T17:48:33.703909+11:00", "relevant_disorders": [ "Liver failure", "HP:0001399" ], "stats": { "number_of_genes": 68, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0328" ], "biotype": "protein_coding", "hgnc_id": "HGNC:428", "gene_name": "ALMS1, centrosome and basal body associated protein", "omim_gene": [ "606844" ], "alias_name": null, "gene_symbol": "ALMS1", "hgnc_symbol": "ALMS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:73612886-73837920", "ensembl_id": "ENSG00000116127" } }, "GRch38": { "90": { "location": "2:73385758-73610793", "ensembl_id": "ENSG00000116127" } } }, "hgnc_date_symbol_changed": "1998-10-12" }, "entity_type": "gene", "entity_name": "ALMS1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "25296579" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "Alstrom syndrome, MIM#\t203800" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3400, "hash_id": null, "name": "Liver Failure_Paediatric", "disease_group": "Gastroenterological disorders", "disease_sub_group": "", "description": "This panel includes primary liver disorders as well as metabolic and other multi-system disorders that have been reported to cause liver failure in children.\r\n\r\nPlease also consider using the Cholestasis panel if clinically indicated.", "status": "public", "version": "1.33", "version_created": "2026-01-08T17:48:33.703909+11:00", "relevant_disorders": [ "Liver failure", "HP:0001399" ], "stats": { "number_of_genes": 68, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "GPI3" ], "biotype": "protein_coding", "hgnc_id": "HGNC:8957", "gene_name": "phosphatidylinositol glycan anchor biosynthesis class A", "omim_gene": [ "311770" ], "alias_name": [ "paroxysmal nocturnal hemoglobinuria", "phosphatidylinositol N-acetylglucosaminyltransferase" ], "gene_symbol": "PIGA", "hgnc_symbol": "PIGA", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:15337573-15353676", "ensembl_id": "ENSG00000165195" } }, "GRch38": { "90": { "location": "X:15319451-15335580", "ensembl_id": "ENSG00000165195" } } }, "hgnc_date_symbol_changed": "1993-10-28" }, "entity_type": "gene", "entity_name": "PIGA", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "34875027" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neurodevelopmental disorder with epilepsy and hemochromatosis, MIM# 301072" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3469, "hash_id": null, "name": "Metal Metabolism Disorders", "disease_group": "Metabolic disorders", "disease_sub_group": "", "description": "This panel contains genes that cause inborn errors of molybdenum, copper, iron, manganese, zinc, selenium, and magnesium metabolism. \r\nThis panel was based on the Genomics England/NHS Genomics Medicine Service 'Iron metabolism disorders' panel. It is part of the Metabolic Disorders Superpanel.", "status": "public", "version": "0.54", "version_created": "2026-02-17T14:35:14.331246+11:00", "relevant_disorders": [ "Abnormality of iron homeostasis", "HP:0011031;Abnormal blood transition element cation concentration", "HP:0011030" ], "stats": { "number_of_genes": 51, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "KIAA0243", "LAM", "hamartin" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12362", "gene_name": "TSC complex subunit 1", "omim_gene": [ "605284" ], "alias_name": [ "hamartin" ], "gene_symbol": "TSC1", "hgnc_symbol": "TSC1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:135766735-135820020", "ensembl_id": "ENSG00000165699" } }, "GRch38": { "90": { "location": "9:132891348-132944633", "ensembl_id": "ENSG00000165699" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "TSC1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Tuberous sclerosis-1, MIM# 191100" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "dJ40E16.7" ], "biotype": "protein_coding", "hgnc_id": "HGNC:12412", "gene_name": "tubulin beta 2A class IIa", "omim_gene": [ "615101" ], "alias_name": [ "class IIa beta-tubulin" ], "gene_symbol": "TUBB2A", "hgnc_symbol": "TUBB2A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "6:3153903-3157760", "ensembl_id": "ENSG00000137267" } }, "GRch38": { "90": { "location": "6:3153669-3157526", "ensembl_id": "ENSG00000137267" } } }, "hgnc_date_symbol_changed": "2005-11-03" }, "entity_type": "gene", "entity_name": "TUBB2A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "Other", "publications": [ "28840640", "30016746", "25326637", "27770045", "24702957", "32571897" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Cortical dysplasia, complex, with other brain malformations 5, OMIM:615763", "Complex cortical dysplasia with other brain malformations 5, MONDO:0014337" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ14466", "CRACM1" ], "biotype": null, "hgnc_id": "HGNC:25896", "gene_name": "ORAI calcium release-activated calcium modulator 1", "omim_gene": [ "610277" ], "alias_name": [ "calcium release-activated calcium modulator 1" ], "gene_symbol": "ORAI1", "hgnc_symbol": "ORAI1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:122064455-122080583", "ensembl_id": "ENSG00000182500" } }, "GRch38": { "90": { "location": "12:121626550-121642677", "ensembl_id": "ENSG00000276045" } } }, "hgnc_date_symbol_changed": "2007-08-14" }, "entity_type": "gene", "entity_name": "ORAI1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31448844" ], "evidence": [ "Expert Review Green", "Literature", "Expert list" ], "phenotypes": [ "Myopathy, tubular aggregate, 2 - #615883" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "KIF4-G1", "KIF4", "HSA271784", "FLJ12530", "FLJ12655", "FLJ14204", "FLJ20631", "MRX100" ], "biotype": "protein_coding", "hgnc_id": "HGNC:13339", "gene_name": "kinesin family member 4A", "omim_gene": [ "300521" ], "alias_name": [ "chromokinesin" ], "gene_symbol": "KIF4A", "hgnc_symbol": "KIF4A", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:69509879-69640682", "ensembl_id": "ENSG00000090889" } }, "GRch38": { "90": { "location": "X:70290090-70420832", "ensembl_id": "ENSG00000090889" } } }, "hgnc_date_symbol_changed": "2000-09-19" }, "entity_type": "gene", "entity_name": "KIF4A", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "24812067", "34346154", "30679815" ], "evidence": [ "Expert Review Green", "Literature", "Expert list" ], "phenotypes": [ "Intellectual developmental disorder, X-linked 100\t- OMIM# 300923", "Hydrocephalus" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "ERK", "ERK2", "p41mapk", "MAPK2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6871", "gene_name": "mitogen-activated protein kinase 1", "omim_gene": [ "176948" ], "alias_name": null, "gene_symbol": "MAPK1", "hgnc_symbol": "MAPK1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "22:22108789-22221970", "ensembl_id": "ENSG00000100030" } }, "GRch38": { "90": { "location": "22:21754500-21867680", "ensembl_id": "ENSG00000100030" } } }, "hgnc_date_symbol_changed": "1993-11-05" }, "entity_type": "gene", "entity_name": "MAPK1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "32721402" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Noonan syndrome 13 - MIM#619087" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:177", "gene_name": "aminoacylase 1", "omim_gene": [ "104620" ], "alias_name": null, "gene_symbol": "ACY1", "hgnc_symbol": "ACY1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:52009066-52023213", "ensembl_id": "ENSG00000243989" } }, "GRch38": { "90": { "location": "3:51983278-51989202", "ensembl_id": "ENSG00000243989" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "ACY1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Aminoacylase 1 deficiency, MIM# 609924" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "TM7LN4", "TM7XN1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:4512", "gene_name": "adhesion G protein-coupled receptor G1", "omim_gene": [ "604110" ], "alias_name": null, "gene_symbol": "ADGRG1", "hgnc_symbol": "ADGRG1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "16:57644564-57698944", "ensembl_id": "ENSG00000205336" } }, "GRch38": { "90": { "location": "16:57610652-57665580", "ensembl_id": "ENSG00000205336" } } }, "hgnc_date_symbol_changed": "2015-03-03" }, "entity_type": "gene", "entity_name": "ADGRG1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "16240336" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Victorian Clinical Genetics Services", "Australian Genomics Health Alliance Brain Malformations Flagship" ], "phenotypes": [ "Polymicrogyria, bilateral frontoparietal, MIM#606854" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "SV/CNV", "5'UTR" ], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CLF-1", "CLF", "CISS", "CISS1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2364", "gene_name": "cytokine receptor like factor 1", "omim_gene": [ "604237" ], "alias_name": [ "cold-induced sweating syndrome" ], "gene_symbol": "CRLF1", "hgnc_symbol": "CRLF1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:18683030-18718551", "ensembl_id": "ENSG00000006016" } }, "GRch38": { "90": { "location": "19:18572220-18607741", "ensembl_id": "ENSG00000006016" } } }, "hgnc_date_symbol_changed": "1999-02-26" }, "entity_type": "gene", "entity_name": "CRLF1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "12509788", "17436251", "17436252" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Cold-induced sweating syndrome 1, MIM#272430" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CP1B" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2597", "gene_name": "cytochrome P450 family 1 subfamily B member 1", "omim_gene": [ "601771" ], "alias_name": null, "gene_symbol": "CYP1B1", "hgnc_symbol": "CYP1B1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:38294116-38337044", "ensembl_id": "ENSG00000138061" } }, "GRch38": { "90": { "location": "2:38066973-38109902", "ensembl_id": "ENSG00000138061" } } }, "hgnc_date_symbol_changed": "1994-12-20" }, "entity_type": "gene", "entity_name": "CYP1B1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "32499604", "32224865" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Anterior segment dysgenesis 6, multiple subtypes, MIM# 617315", "Glaucoma 3A, primary open angle, congenital, juvenile, or adult onset, MIM# 231300" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:14938", "gene_name": "phosphatidylinositol glycan anchor biosynthesis class T", "omim_gene": [ "610272" ], "alias_name": [ "GPI transamidase subunit" ], "gene_symbol": "PIGT", "hgnc_symbol": "PIGT", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "20:44044717-44054884", "ensembl_id": "ENSG00000124155" } }, "GRch38": { "90": { "location": "20:45416067-45456934", "ensembl_id": "ENSG00000124155" } } }, "hgnc_date_symbol_changed": "2001-03-27" }, "entity_type": "gene", "entity_name": "PIGT", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30976099", "25943031", "24906948", "24906948", "24906948", "28728837", "28728837", "28728837" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp", "Genetic Health Queensland" ], "phenotypes": [ "Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ20831" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29242", "gene_name": "SH3 and PX domains 2B", "omim_gene": [ "613293" ], "alias_name": null, "gene_symbol": "SH3PXD2B", "hgnc_symbol": "SH3PXD2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:171752185-171881527", "ensembl_id": "ENSG00000174705" } }, "GRch38": { "90": { "location": "5:172325000-172454523", "ensembl_id": "ENSG00000174705" } } }, "hgnc_date_symbol_changed": "2006-02-13" }, "entity_type": "gene", "entity_name": "SH3PXD2B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "15523657", "24105366" ], "evidence": [ "Expert Review Green", "Genomics England PanelApp" ], "phenotypes": [ "Frank-ter Haar syndrome, MIM#249420" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RAB39", "RAH", "NARR" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16519", "gene_name": "RAB34, member RAS oncogene family", "omim_gene": [ "610917" ], "alias_name": [ "nine-amino acid residue-repeats" ], "gene_symbol": "RAB34", "hgnc_symbol": "RAB34", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:27041299-27045447", "ensembl_id": "ENSG00000109113" } }, "GRch38": { "90": { "location": "17:28714281-28718429", "ensembl_id": "ENSG00000109113" } } }, "hgnc_date_symbol_changed": "2001-09-14" }, "entity_type": "gene", "entity_name": "RAB34", "confidence_level": "3", "penetrance": "Complete", "mode_of_pathogenicity": null, "publications": [ "PMID: 37384395" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Orofaciodigital syndrome 20, MIM#620718" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "FLJ10385", "TCAB1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25522", "gene_name": "WD repeat containing antisense to TP53", "omim_gene": [ "612661" ], "alias_name": [ "telomerase cajal body protein 1", "WD-encoding RNA antisense to p53" ], "gene_symbol": "WRAP53", "hgnc_symbol": "WRAP53", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "17:7589389-7606820", "ensembl_id": "ENSG00000141499" } }, "GRch38": { "90": { "location": "17:7686071-7703502", "ensembl_id": "ENSG00000141499" } } }, "hgnc_date_symbol_changed": "2009-02-16" }, "entity_type": "gene", "entity_name": "WRAP53", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "IBMDx Study", "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Dyskeratosis congenita, autosomal recessive 3, MIM# 613988" ], "mode_of_inheritance": "Unknown", "tags": [], "panel": { "id": 3829, "hash_id": null, "name": "IBMDx study", "disease_group": "", "disease_sub_group": "", "description": "The inherited bone marrow diseases (IBMD) are a diverse group of diseases featuring single or multi-lineage cytopaenias and numerous potential associated manifestations including multi-organ syndromic features, a predisposition to haematological malignancy and/or a bleeding phenotype.\r\n\r\nThis panel is appropriate to be used for the following phenotypes of IBMD :\r\n-\tFanconi anaemia (excluding BRCA1, BRCA2, BRIP1 due to their more common association with familial breast cancer risk than FA) \r\n-\tDiamond-Blackfan anaemia\r\n-\tDyskeratosis congenita / telomere biology disorders\r\n-\tShwachman-Diamond syndrome\r\n-\tSevere congenital neutropenia\r\n-\tThrombocytopenia-absent radius syndrome\r\n-\tCongenital amegakaryocytic thrombocytopenia\r\n-\tAdenosine deaminase deficiency\r\n-\tGATA2 deficiency syndrome\r\n-\tSAMD9 / SAMD9L related disorders \r\n-\tCongenital dyserythropoietic anaemia\r\n-\tCongenital sideroblastic anaemia\r\n-\tBernard-Soulier syndrome\r\n\r\nThis panel is being used in the IBMDx study (NCT05196789) – “Diagnosis, discovery and novel phenotype characterisation using multimodal genomics in patients with inherited bone marrow failure and related disorders”\r\n\r\nSome heritable diseases associated with cytopaenias and/or bleeding (for example thalassaemia/haemoglobinopathies and haemophilia) are not assessed with this panel.", "status": "public", "version": "0.42", "version_created": "2026-03-19T18:45:41.236506+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 101, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Research", "slug": "research", "description": "Research panels" } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3018", "gene_name": "solute carrier family 26 member 3", "omim_gene": [ "126650" ], "alias_name": null, "gene_symbol": "SLC26A3", "hgnc_symbol": "SLC26A3", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:107405912-107443670", "ensembl_id": "ENSG00000091138" } }, "GRch38": { "90": { "location": "7:107765467-107803225", "ensembl_id": "ENSG00000091138" } } }, "hgnc_date_symbol_changed": "1993-04-01" }, "entity_type": "gene", "entity_name": "SLC26A3", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "31325522", "19861545", "11524734" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Diarrhoea 1, secretory chloride, congenital MIM#214700" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:11006", "gene_name": "solute carrier family 2 member 2", "omim_gene": [ "138160" ], "alias_name": null, "gene_symbol": "SLC2A2", "hgnc_symbol": "SLC2A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "3:170714137-170744539", "ensembl_id": "ENSG00000163581" } }, "GRch38": { "90": { "location": "3:170996348-171026750", "ensembl_id": "ENSG00000163581" } } }, "hgnc_date_symbol_changed": "1989-01-13" }, "entity_type": "gene", "entity_name": "SLC2A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "30950137", "22145468" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Fanconi-Bickel syndrome, MIM# 227810" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RX" ], "biotype": "protein_coding", "hgnc_id": "HGNC:18662", "gene_name": "retina and anterior neural fold homeobox", "omim_gene": [ "601881" ], "alias_name": null, "gene_symbol": "RAX", "hgnc_symbol": "RAX", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "18:56934267-56941318", "ensembl_id": "ENSG00000134438" } }, "GRch38": { "90": { "location": "18:59267035-59274086", "ensembl_id": "ENSG00000134438" } } }, "hgnc_date_symbol_changed": "2002-05-22" }, "entity_type": "gene", "entity_name": "RAX", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "14662654", "18783408", "30811539", "24033328", "22736936", "28831107" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Microphthalmia, syndromic 16, MIM #611038" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "p180" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9173", "gene_name": "DNA polymerase alpha 1, catalytic subunit", "omim_gene": [ "312040" ], "alias_name": null, "gene_symbol": "POLA1", "hgnc_symbol": "POLA1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "X:24712036-25015103", "ensembl_id": "ENSG00000101868" } }, "GRch38": { "90": { "location": "X:24693919-24996986", "ensembl_id": "ENSG00000101868" } } }, "hgnc_date_symbol_changed": "2006-09-26" }, "entity_type": "gene", "entity_name": "POLA1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "27019227", "31006512" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Pigmentary disorder, reticulate, with systemic manifestations, X-linked, MIM#301220", "Van Esch-O'Driscoll syndrome, MIM #301030" ], "mode_of_inheritance": "X-LINKED: hemizygous mutation in males, biallelic mutations in females", "tags": [], "panel": { "id": 3861, "hash_id": null, "name": "Prepair 1000+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.16", "version_created": "2026-04-02T17:30:09.498472+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1389, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DKFZP564I122", "cblC" ], "biotype": "protein_coding", "hgnc_id": "HGNC:24525", "gene_name": "methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria", "omim_gene": [ "609831" ], "alias_name": null, "gene_symbol": "MMACHC", "hgnc_symbol": "MMACHC", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:45965725-45976739", "ensembl_id": "ENSG00000132763" } }, "GRch38": { "90": { "location": "1:45500053-45513382", "ensembl_id": "ENSG00000132763" } } }, "hgnc_date_symbol_changed": "2006-01-12" }, "entity_type": "gene", "entity_name": "MMACHC", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BabySeq Category A gene", "BeginNGS" ], "phenotypes": [ "Methylmalonic aciduria and homocystinuria, cblC type, MIM#277400" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "metabolic" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "NKCC2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10910", "gene_name": "solute carrier family 12 member 1", "omim_gene": [ "600839" ], "alias_name": null, "gene_symbol": "SLC12A1", "hgnc_symbol": "SLC12A1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:48483861-48596275", "ensembl_id": "ENSG00000074803" } }, "GRch38": { "90": { "location": "15:48191664-48304078", "ensembl_id": "ENSG00000074803" } } }, "hgnc_date_symbol_changed": "1994-02-16" }, "entity_type": "gene", "entity_name": "SLC12A1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BabySeq Category A gene" ], "phenotypes": [ "Bartter syndrome, type 1, MIM# 601678" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "renal" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DIC1", "PCD", "CILD1" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2954", "gene_name": "dynein axonemal intermediate chain 1", "omim_gene": [ "604366" ], "alias_name": null, "gene_symbol": "DNAI1", "hgnc_symbol": "DNAI1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:34457412-34520982", "ensembl_id": "ENSG00000122735" } }, "GRch38": { "90": { "location": "9:34457414-34520989", "ensembl_id": "ENSG00000122735" } } }, "hgnc_date_symbol_changed": "2000-06-16" }, "entity_type": "gene", "entity_name": "DNAI1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category A gene" ], "phenotypes": [ "Ciliary dyskinesia, primary, 1, with or without situs inversus, MIM# 244400" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "CSB", "RAD26", "ARMD5" ], "biotype": "protein_coding", "hgnc_id": "HGNC:3438", "gene_name": "ERCC excision repair 6, chromatin remodeling factor", "omim_gene": [ "609413" ], "alias_name": [ "Cockayne syndrome B protein" ], "gene_symbol": "ERCC6", "hgnc_symbol": "ERCC6", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:50663414-50747584", "ensembl_id": "ENSG00000225830" } }, "GRch38": { "90": { "location": "10:49455368-49539538", "ensembl_id": "ENSG00000225830" } } }, "hgnc_date_symbol_changed": "1989-06-30" }, "entity_type": "gene", "entity_name": "ERCC6", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Red", "BabySeq Category A gene" ], "phenotypes": [ "Cerebrooculofacioskeletal syndrome 1, MIM# 214150 MONDO:0008955", "Cockayne syndrome, type B, MIM# 133540 MONDO:0019570", "De Sanctis-Cacchione syndrome, MIM# 278800 MONDO:0010217", "UV-sensitive syndrome 1, MIM# 600630 MONDO:0010909" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "LDLCQ2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:6547", "gene_name": "low density lipoprotein receptor", "omim_gene": [ "606945" ], "alias_name": [ "familial hypercholesterolemia" ], "gene_symbol": "LDLR", "hgnc_symbol": "LDLR", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:11200038-11244492", "ensembl_id": "ENSG00000130164" } }, "GRch38": { "90": { "location": "19:11089362-11133816", "ensembl_id": "ENSG00000130164" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "LDLR", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "BabySeq Category A gene" ], "phenotypes": [ "Hypercholesterolemia, familial, 1, MIM# 143890" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [ "treatable", "metabolic" ], "panel": { "id": 3931, "hash_id": null, "name": "Genomic newborn screening: BabyScreen+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel has been curated for use by the BabyScreen+ newborn screening project.\r\n\r\nCriteria used in condition selection:\r\n-Analytical validity:the variant spectrum is currently reliably detectable by accredited WGS pipelines.\r\n-Clinical validity: the gene-disease relationship is well established (generally corresponding to Strong/Definitive by ClinGen criteria)\r\n-Disease onset: exclusively or predominantly in childhood (<5 years)\r\n-Disease severity: causing significant morbidity or mortality\r\n-Diseases with an effective treatment available that alters the natural history of disease (e.g. medication, dietary supplement, enzyme replacement therapy, transplantation, gene therapy)\r\n\r\nDesirable: non-genetic confirmatory testing available\r\n\r\nSources used in the development of this panel: gene lists developed by BabySeq, NC-Nexus, BeginNGS, BabyBeyond, Acute Care Additional Paediatric Findings, Guardian, Generation Study; additional resources rx-genes (PMID 33350578), TreatableID app (PMID 33845862), ClinGen Pediatric Actionability consensus assertions (definitive, strong and moderate; December 2022).\r\n\r\nVersion 1.0 of the panel was used in the BabyScreen+ study (PMID 38275146, 41068466)", "status": "public", "version": "1.148", "version_created": "2026-03-31T15:17:11.094244+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 1723, "number_of_strs": 0, "number_of_regions": 0 }, "types": [], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:10681", "gene_name": "succinate dehydrogenase complex iron sulfur subunit B", "omim_gene": [ "185470" ], "alias_name": [ "iron-sulfur subunit of complex II", "succinate dehydrogenase [ubiquinone] iron-sulfur subunit" ], "gene_symbol": "SDHB", "hgnc_symbol": "SDHB", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "1:17345217-17380665", "ensembl_id": "ENSG00000117118" } }, "GRch38": { "90": { "location": "1:17018722-17054170", "ensembl_id": "ENSG00000117118" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "SDHB", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Melbourne Genomics Health Alliance" ], "phenotypes": [ "Paragangliomas 4, MIM# 115310" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "SUFUH", "SUFUXL", "PRO1280" ], "biotype": "protein_coding", "hgnc_id": "HGNC:16466", "gene_name": "SUFU negative regulator of hedgehog signaling", "omim_gene": [ "607035" ], "alias_name": null, "gene_symbol": "SUFU", "hgnc_symbol": "SUFU", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:104263744-104393292", "ensembl_id": "ENSG00000107882" } }, "GRch38": { "90": { "location": "10:102503987-102633535", "ensembl_id": "ENSG00000107882" } } }, "hgnc_date_symbol_changed": "2001-08-28" }, "entity_type": "gene", "entity_name": "SUFU", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert Review Green", "Expert List" ], "phenotypes": [ "SUFU-related neurodevelopmental disorder" ], "mode_of_inheritance": "BOTH monoallelic and biallelic, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "P450IIC19", "CPCJ" ], "biotype": "protein_coding", "hgnc_id": "HGNC:2621", "gene_name": "cytochrome P450 family 2 subfamily C member 19", "omim_gene": [ "124020" ], "alias_name": null, "gene_symbol": "CYP2C19", "hgnc_symbol": "CYP2C19", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "10:96447911-96613017", "ensembl_id": "ENSG00000165841" } }, "GRch38": { "90": { "location": "10:94762624-94853260", "ensembl_id": "ENSG00000165841" } } }, "hgnc_date_symbol_changed": "1992-04-06" }, "entity_type": "gene", "entity_name": "CYP2C19", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "12464799" ], "evidence": [ "Expert Review Green", "Expert list" ], "phenotypes": [ "DRUG METABOLISM, POOR, CYP2C19-RELATED, MEPHENYTOIN, POOR METABOLISM OF, INCLUDED OMEPRAZOLE, POOR METABOLISM OF, INCLUDED PROGUANIL, POOR METABOLISM OF, INCLUDED CLOPIDOGREL, POOR METABOLISM OF, INCLUDED MIM#609535" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:3694", "gene_name": "fibrinogen gamma chain", "omim_gene": [ "134850" ], "alias_name": null, "gene_symbol": "FGG", "hgnc_symbol": "FGG", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:155525286-155534119", "ensembl_id": "ENSG00000171557" } }, "GRch38": { "90": { "location": "4:154604134-154612967", "ensembl_id": "ENSG00000171557" } } }, "hgnc_date_symbol_changed": "2001-06-22" }, "entity_type": "gene", "entity_name": "FGG", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "3337908", "11001903", "11001902" ], "evidence": [ "Expert Review Green", "Victorian Clinical Genetics Services" ], "phenotypes": [ "Afibrinogenaemia, congenital, MIM# 202400", "Hypofibrinogenaemia, congenital, MIM# 202400", "Dysfibrinogenemia, congenital, MIM# 616004" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RB", "PPP1R130" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9884", "gene_name": "RB transcriptional corepressor 1", "omim_gene": [ "614041" ], "alias_name": [ "prepro-retinoblastoma-associated protein", "protein phosphatase 1, regulatory subunit 130" ], "gene_symbol": "RB1", "hgnc_symbol": "RB1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "13:48877887-49056122", "ensembl_id": "ENSG00000139687" } }, "GRch38": { "90": { "location": "13:48303751-48481986", "ensembl_id": "ENSG00000139687" } } }, "hgnc_date_symbol_changed": "1986-01-01" }, "entity_type": "gene", "entity_name": "RB1", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [], "evidence": [ "Expert list", "Expert Review Green" ], "phenotypes": [ "Retinoblastoma MONDO:0008380" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4126, "hash_id": null, "name": "Transplant Co-Morbidity", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel was built for the Melbourne Genomics Health Alliance Transplant Clinical Change Project. It contains genes from the following panels, that may be actionable in the study cohort:\r\n- cardiomyopathy and arrhythmia adult superpanels\r\n- additional findings adult panel, minus STK11, MUTYH, BTD, OTC, GAA, RPE65\r\n- AD nonsyndromic monogenic diabetes genes\r\n- dyslipidaemia\r\n- osteogenesis imperfecta\r\n- bleeding & platelet disorders\r\n- melanoma", "status": "public", "version": "0.21", "version_created": "2026-01-16T12:00:12.269232+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 278, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Melbourne Genomics", "slug": "melbourne-genomics", "description": "Panel used by a Melbourne Genomics project." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "DTDST" ], "biotype": "protein_coding", "hgnc_id": "HGNC:10994", "gene_name": "solute carrier family 26 member 2", "omim_gene": [ "606718" ], "alias_name": null, "gene_symbol": "SLC26A2", "hgnc_symbol": "SLC26A2", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "5:149340300-149373018", "ensembl_id": "ENSG00000155850" } }, "GRch38": { "90": { "location": "5:149960737-149993455", "ensembl_id": "ENSG00000155850" } } }, "hgnc_date_symbol_changed": "1990-09-10" }, "entity_type": "gene", "entity_name": "SLC26A2", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": "", "publications": [ "20301483", "20301689", "11241838", "8723100" ], "evidence": [ "Expert Review Green", "Mackenzie's Mission" ], "phenotypes": [ "Achondrogenesis Ib MIM#600972", "Atelosteogenesis, type II MIM#256050", "De la Chapelle dysplasia MIM#256050", "Diastrophic dysplasia MIM#222600", "Diastrophic dysplasia, broad bone-platyspondylic variant MIM#222600", "Epiphyseal dysplasia, multiple, 4 MIM#226900" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4225, "hash_id": null, "name": "Prepair 500+", "disease_group": "Screening", "disease_sub_group": "", "description": "This panel is a subset of the prepair 1000+ panel that was originally developed as part of the Australian Reproductive Genetic Carrier Screening Research Project, also known as Mackenzie’s Mission (Kirk et al 2020; PMID: 32678339).\r\n\r\nIt has been further revised by Victorian Clinical Genetics Services based on research findings and experience of the clinical and laboratory teams. Genes included are associated with conditions that have an onset in childhood, are able to be screened using existing technology, have a severe impact on the affected individual, and have limited and/or burdensome treatment.\r\n\r\nGenes associated with treatable conditions are only included if the conditions are not covered by newborn screening in Australia.\r\n\r\nPlease note only Green genes are analysed and reported.", "status": "public", "version": "2.0", "version_created": "2025-05-30T02:52:12.758302+10:00", "relevant_disorders": [], "stats": { "number_of_genes": 629, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "Ly74", "TROP1", "GA733-2", "EGP34", "EGP40", "EGP-2", "KSA", "CD326", "Ep-CAM", "HEA125", "KS1/4", "MK-1", "MH99", "MOC31", "323/A3", "17-1A", "TACST-1", "CO-17A", "ESA" ], "biotype": "protein_coding", "hgnc_id": "HGNC:11529", "gene_name": "epithelial cell adhesion molecule", "omim_gene": [ "185535" ], "alias_name": null, "gene_symbol": "EPCAM", "hgnc_symbol": "EPCAM", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:47572297-47614740", "ensembl_id": "ENSG00000119888" } }, "GRch38": { "90": { "location": "2:47345158-47387601", "ensembl_id": "ENSG00000119888" } } }, "hgnc_date_symbol_changed": "2008-12-16" }, "entity_type": "gene", "entity_name": "EPCAM", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Green", "Expert Review", "Expert list" ], "phenotypes": [ "Malignant pancreatic neoplasm, MONDO:0009831", "Lynch syndrome 8, MONDO:0013196", "Lynch syndrome 8, MIM#613244" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [], "panel": { "id": 4370, "hash_id": null, "name": "Pancreatic Cancer", "disease_group": "Cancer Predisposition", "disease_sub_group": "", "description": "This panel contains genes associated with pancreatic cancer. \r\n\r\nFurther information on the testing criteria for pancreatic cancer can be found at eviQ: \r\nhttps://www.eviq.org.au/cancer-genetics/adult/genetic-testing-using-cancer-gene-panels/3906-pancreatic-cancer-panel-testing\r\n\r\nOnly ‘Green’ genes should be tested and analysed for clinical testing, as they have sufficient peer-reviewed published evidence of association with pancreatic cancer and are clinically actionable for diagnostic and/or predictive genetic testing.\r\n\r\nEnsure testing includes copy number variant (CNV) analysis, as CNVs contribute to a clinically significant proportion of pathogenic variants associated with familial risk of cancer.\r\n\r\nThis panel has been compared against the Genomics England PanelApp and aligned with any assessments by ClinGen.\r\n\r\nThis panel has been developed under the guidance of experts in cancer genetics (Dr Helen Mar Fan and Dr Nicola Poplawski).", "status": "public", "version": "1.1", "version_created": "2024-11-01T16:32:06.575750+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 12, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Cancer Germline", "slug": "cancer-germline", "description": "Germline cancer panel" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Adult Genetics Unit, Royal Adelaide Hospital", "slug": "adult-genetics-unit-royal-adelaide-hospital", "description": "Adult Genetics Unit, Royal Adelaide Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "MLH2" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9121", "gene_name": "PMS1 homolog 1, mismatch repair system component", "omim_gene": [ "600258" ], "alias_name": null, "gene_symbol": "PMS1", "hgnc_symbol": "PMS1", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "2:190649107-190742355", "ensembl_id": "ENSG00000064933" } }, "GRch38": { "90": { "location": "2:189784085-189877629", "ensembl_id": "ENSG00000064933" } } }, "hgnc_date_symbol_changed": "1994-12-13" }, "entity_type": "gene", "entity_name": "PMS1", "confidence_level": "1", "penetrance": null, "mode_of_pathogenicity": null, "publications": [], "evidence": [ "Expert Review Red", "ClinGen" ], "phenotypes": [ "Lynch syndrome, MONDO:0005835" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "tags": [ "refuted" ], "panel": { "id": 4371, "hash_id": null, "name": "Colorectal Cancer and Polyposis", "disease_group": "Cancer Predisposition", "disease_sub_group": "", "description": "This panel contains genes associated with colorectal cancer and polyposis. \r\n\r\nFurther information on the testing criteria for colorectal cancer and polyposis can be found at eviQ: \r\nhttps://www.eviq.org.au/cancer-genetics/adult/genetic-testing-using-cancer-gene-panels/4116-gastrointestinal-polyposis-and-colorectal-can\r\n\r\nOnly ‘Green’ genes should be tested and analysed for clinical testing, as they have sufficient peer-reviewed published evidence of association with colorectal cancer and polyposis and are clinically actionable for diagnostic and/or predictive genetic testing.\r\n\r\nEnsure testing includes copy number variant (CNV) analysis, as CNVs contribute to a clinically significant proportion of pathogenic variants associated with familial risk of cancer.\r\n\r\nThis panel has been compared against the Genomics England PanelApp and aligned with any assessments by ClinGen.\r\n\r\nThis panel has been developed under the guidance of experts in cancer genetics (Dr Helen Mar Fan and Dr Nicola Poplawski).", "status": "public", "version": "1.4", "version_created": "2025-11-20T12:31:46.390137+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 22, "number_of_strs": 0, "number_of_regions": 0 }, "types": [ { "name": "Cancer Germline", "slug": "cancer-germline", "description": "Germline cancer panel" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Adult Genetics Unit, Royal Adelaide Hospital", "slug": "adult-genetics-unit-royal-adelaide-hospital", "description": "Adult Genetics Unit, Royal Adelaide Hospital" } ], "child_panel_ids": [] }, "transcript": [] }, { "gene_data": { "alias": [ "LOC283677", "FLJ27520", "FLJ36860", "FLJ44083", "CT147" ], "biotype": "protein_coding", "hgnc_id": "HGNC:25065", "gene_name": "REC114 meiotic recombination protein", "omim_gene": null, "alias_name": null, "gene_symbol": "REC114", "hgnc_symbol": "REC114", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "15:73735499-73852355", "ensembl_id": "ENSG00000183324" } }, "GRch38": { "90": { "location": "15:73443158-73560014", "ensembl_id": "ENSG00000183324" } } }, "hgnc_date_symbol_changed": "2014-05-09" }, "entity_type": "gene", "entity_name": "REC114", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "31704776", "30388401", "38148155" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Oocyte/zygote/embryo maturation arrest 10, #MIM 619176" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.137", "version_created": "2026-03-31T15:48:32.205924+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 264, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "IPOA8" ], "biotype": "protein_coding", "hgnc_id": "HGNC:21839", "gene_name": "karyopherin subunit alpha 7", "omim_gene": [ "614107" ], "alias_name": [ "importin alpha 8" ], "gene_symbol": "KPNA7", "hgnc_symbol": "KPNA7", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:98771197-98805129", "ensembl_id": "ENSG00000185467" } }, "GRch38": { "90": { "location": "7:99173574-99207506", "ensembl_id": "ENSG00000185467" } } }, "hgnc_date_symbol_changed": "2009-04-07" }, "entity_type": "gene", "entity_name": "KPNA7", "confidence_level": "2", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "36647821" ], "evidence": [ "Expert Review Amber", "Literature" ], "phenotypes": [ "Oocyte/zygote/embryo maturation arrest 17, #MIM 620319" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.137", "version_created": "2026-03-31T15:48:32.205924+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 264, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [ "RPC2", "FLJ10388" ], "biotype": "protein_coding", "hgnc_id": "HGNC:30348", "gene_name": "RNA polymerase III subunit B", "omim_gene": [ "614366" ], "alias_name": null, "gene_symbol": "POLR3B", "hgnc_symbol": "POLR3B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "12:106751436-106903976", "ensembl_id": "ENSG00000013503" } }, "GRch38": { "90": { "location": "12:106357658-106510198", "ensembl_id": "ENSG00000013503" } } }, "hgnc_date_symbol_changed": "2004-04-21" }, "entity_type": "gene", "entity_name": "POLR3B", "confidence_level": "3", "penetrance": null, "mode_of_pathogenicity": null, "publications": [ "25339210", "27512013", "26113998", "22036171", "22036172", "32319736", "26113998" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 614381" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "tags": [], "panel": { "id": 4455, "hash_id": null, "name": "Infertility and Recurrent Pregnancy Loss", "disease_group": "", "disease_sub_group": "", "description": "Recurrent pregnancy loss (RPL) and infertility are genetically heterogeneous and overlapping conditions that contribute significantly to adverse reproductive outcomes. This panel has been developed to address the lack of a dedicated diagnostic gene panel specifically targeting recurrent pregnancy loss and/or infertility. This panel includes genes associated with a broad spectrum of male and female infertility phenotypes, as well as those implicated in recurrent pregnancy loss (RPL).\r\n\r\nFor male infertility, it covers genes involved in spermatogenic failure and fertilization defects. For female infertility, it includes genes associated with primary ovarian insufficiency/failure and ovarian dysgenesis. This panel also includes genes associated with infertility phenotypes that affect both sexes, such as hypogonadotropic hypogonadism, gonadal dysgenesis, Persistent Mullerian duct syndrome, and primary ciliary dyskinesia. Genes associated with RPL primarily involve in oocyte, zygote, and embryo maturation arrest (OZEMA), as well as defective implantation and placentation.\r\n\r\nSources used to generate this panel includes literature review and publicly available databases (e.g., OMIM, FeRGI database, Intolerome Gene List).\r\n\r\nPlease also consider the Fetal anomalies panel where appropriate, particularly in cases of pregnancy losses occurring beyond 20 weeks’ gestation.\r\n\r\nWe would like to thank Jasmine Chew (University of Western Australia), Prof Gina Ravenscroft (Harry Perkins Institute of Medical Research), Dr Harmony Clayton (PathWest Laboratory Medicine, Perth) and Audrey Rick (Harry Perkins Institute of Medical Research) for the development of this panel.", "status": "public", "version": "1.137", "version_created": "2026-03-31T15:48:32.205924+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 264, "number_of_strs": 0, "number_of_regions": 1 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] }, "transcript": null }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:5102", "gene_name": "homeobox A13", "omim_gene": [ "142959" ], "alias_name": null, "gene_symbol": "HOXA13", "hgnc_symbol": "HOXA13", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "7:27233122-27239725", "ensembl_id": "ENSG00000106031" } }, "GRch38": { "90": { "location": "7:27193503-27200106", "ensembl_id": "ENSG00000106031" } } }, "hgnc_date_symbol_changed": "1990-07-05" }, "entity_type": "str", "entity_name": "HOXA13_HFGS_GCN3", "confidence_level": "3", "penetrance": null, "publications": [ "10839976", "12073020", "33811808" ], "evidence": [ "Expert list", "Expert Review Green", "Expert Review Green", "Expert list" ], "phenotypes": [ "Hand-foot-uterus syndrome MIM#140000" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "7", "grch37_coordinates": [ 27239298, 27239351 ], "grch38_coordinates": [ 27199679, 27199732 ], "normal_repeats": 18, "pathogenic_repeats": 24, "tags": [ "paediatric-onset" ], "panel": { "id": 99, "hash_id": null, "name": "Differences of Sex Development", "disease_group": "Dysmorphic and congenital abnormality syndromes", "disease_sub_group": "", "description": "This panel was developed and is maintained by VCGS and contains genes associated with atypical development of the internal and external genitalia, including genes that cause hypogonadotropic hypogonadism.\r\n\r\nThis panel has been compared against the Genomics England PanelApp 'Disorders of Sex Development', and 'Hypogonadotropic hypogonadism idiopathic' panels, with all differences reviewed and reciprocal feedback provided to Genomics England, 18/6/2020. Comparison undertaken with NHS GMS 'Hypogonadotropic hypogonadism' panel with all differences reviewed and reciprocal feedback provided to Genomics England 01/11/2023. Further round of comparison and discordance resolution undertaken 4/12/2024.", "status": "public", "version": "1.46", "version_created": "2026-04-02T12:35:34.329595+11:00", "relevant_disorders": [ "Abnormality of the genital system", "HP:0000078" ], "stats": { "number_of_genes": 141, "number_of_strs": 1, "number_of_regions": 2 }, "types": [ { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Genetic Health Queensland", "slug": "genetic-health-queensland", "description": "Panel used by GHQ." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "S3-12" ], "biotype": "protein_coding", "hgnc_id": "HGNC:29393", "gene_name": "perilipin 4", "omim_gene": [ "613247" ], "alias_name": null, "gene_symbol": "PLIN4", "hgnc_symbol": "PLIN4", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "19:4502204-4517716", "ensembl_id": "ENSG00000167676" } }, "GRch38": { "90": { "location": "19:4502180-4518465", "ensembl_id": "ENSG00000167676" } } }, "hgnc_date_symbol_changed": "2009-08-12" }, "entity_type": "str", "entity_name": "PLIN4_MRUPAV_33-mer", "confidence_level": "3", "penetrance": null, "publications": [ "32451610", "37145156", "36151849", "35499779" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "myopathy, distal, with rimmed vacuoles MONDO:0014945" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC", "chromosome": "19", "grch37_coordinates": [ 4510975, 4511073 ], "grch38_coordinates": [ 4510963, 4511061 ], "normal_repeats": 31, "pathogenic_repeats": 39, "tags": [], "panel": { "id": 3071, "hash_id": null, "name": "Limb-Girdle Muscular Dystrophy and Distal Myopathy", "disease_group": "Neurology and neurodevelopmental disorders", "disease_sub_group": "", "description": "This panel contains genes that cause limb-girdle muscular dystrophy (LGMD), distal myopathy, and LGMD-like differential diagnoses. It was developed and maintained by the Royal Melbourne Hospital and is a consensus panel used by VCGS.\r\n\r\nPlease use the Myopathy_SuperPanel if a broader differential diagnosis is being considered.", "status": "public", "version": "1.65", "version_created": "2026-01-21T10:59:30.179226+11:00", "relevant_disorders": [ "Limb-girdle muscular dystrophy", "MONDO:0016971; Proximal muscle weakness", "HP:0003701; Distal myopathy MONDO:0018949" ], "stats": { "number_of_genes": 102, "number_of_strs": 10, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [], "biotype": "protein_coding", "hgnc_id": "HGNC:13997", "gene_name": "PR/SET domain 12", "omim_gene": [ "616458" ], "alias_name": [ "PR-domain containing protein 12", "PR-domain zinc finger protein 12" ], "gene_symbol": "PRDM12", "hgnc_symbol": "PRDM12", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "9:133539981-133558368", "ensembl_id": "ENSG00000130711" } }, "GRch38": { "90": { "location": "9:130664594-130682981", "ensembl_id": "ENSG00000130711" } } }, "hgnc_date_symbol_changed": "2000-11-28" }, "entity_type": "str", "entity_name": "PRDM12_HSAN8_GCC", "confidence_level": "3", "penetrance": null, "publications": [ "26005867" ], "evidence": [ "Expert Review Green", "Literature" ], "phenotypes": [ "Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488" ], "mode_of_inheritance": "BIALLELIC, autosomal or pseudoautosomal", "repeated_sequence": "GCC", "chromosome": "9", "grch37_coordinates": [ 133556993, 133557026 ], "grch38_coordinates": [ 130681606, 130681639 ], "normal_repeats": 14, "pathogenic_repeats": 18, "tags": [ "paediatric-onset" ], "panel": { "id": 3597, "hash_id": null, "name": "Repeat Disorders", "disease_group": "", "disease_sub_group": "", "description": "This panel contains reported short tandem repeat (STR) expansion disorders. The naming convention of the STRs is based on the name of the condition or fragile site that the expansion is associated with. \r\nThe panel was developed by RMH and WEHI, and is maintained by RMH.\r\n\r\nThis panel is used as a research panel by the Australian Genomics Acute Care study.", "status": "public", "version": "0.272", "version_created": "2026-01-02T15:16:39.779953+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 0, "number_of_strs": 76, "number_of_regions": 0 }, "types": [ { "name": "Royal Melbourne Hospital", "slug": "royal-melbourne-hospital", "description": "Royal Melbourne Hospital" }, { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Australian Genomics", "slug": "australian-genomics", "description": "Panel used by Australian Genomics project." } ], "child_panel_ids": [] } }, { "gene_data": { "alias": [ "Phox2b", "NBPhox" ], "biotype": "protein_coding", "hgnc_id": "HGNC:9143", "gene_name": "paired like homeobox 2b", "omim_gene": [ "603851" ], "alias_name": null, "gene_symbol": "PHOX2B", "hgnc_symbol": "PHOX2B", "hgnc_release": "2017-11-03", "ensembl_genes": { "GRch37": { "82": { "location": "4:41746099-41750987", "ensembl_id": "ENSG00000109132" } }, "GRch38": { "90": { "location": "4:41744082-41748970", "ensembl_id": "ENSG00000109132" } } }, "hgnc_date_symbol_changed": "2003-02-14" }, "entity_type": "str", "entity_name": "PHOX2B_CCHS_GCN", "confidence_level": "3", "penetrance": null, "publications": [ "12640453", "34012823", "20301600", "18798833" ], "evidence": [ "Expert list", "Expert Review Green", "Expert list" ], "phenotypes": [ "Central hypoventilation syndrome, congenital, with or without Hirschsprung disease MIM#209880" ], "mode_of_inheritance": "MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted", "repeated_sequence": "GCN", "chromosome": "4", "grch37_coordinates": [ 41747989, 41748048 ], "grch38_coordinates": [ 41745972, 41746031 ], "normal_repeats": 20, "pathogenic_repeats": 25, "tags": [ "paediatric-onset" ], "panel": { "id": 3763, "hash_id": null, "name": "Fetal anomalies", "disease_group": "", "disease_sub_group": "", "description": "The Fetal Anomalies panel is intended to be used in the prenatal setting where multidisciplinary review (e.g. clinical geneticist, maternal-fetal medicine specialist, genetic pathologist, clinical scientist, paediatric subspecialist) considers a monogenic disorder is likely based on the presenting clinical features. It can also be used to direct analysis as part of fetal molecular autopsy.\r\n\r\nCommon example clinical indications include:\r\n• Multiple structural anomalies\r\n• Suspected skeletal dysplasias (IUGR of placental origin should be excluded)\r\n• Large echogenic kidneys (in the absence of ureter or bladder outlet obstruction)\r\n• Major CNS abnormalities (excluding neural tube defects)\r\n• Multiple contractures (excluding isolated bilateral talipes)\r\n• Nuchal translucency of greater than 6.5mm plus another anomaly (that can include a minor finding)\r\n• Isolated non-immune fetal hydrops (detected at or after the routine 18-20-week scan in the second or third trimesters), defined as fluid/oedema in at least two compartments (e.g. skin, pleural, pericardial or ascites).\r\n\r\nChromosomal microarray is strongly recommended prior to genomic testing.\r\n\r\nMore targeted panels such as Hydrops, Ventriculomegaly, Arhthrogryposis are also available.\r\n\r\nThis panel is based on a targeted virtual gene panel for developmental disorders developed by the PAGE (Prenatal Assessment of Genomes and Exomes) group, Lord et al 2019, and subsequent refinement by Genomics England/NHS Genomic Medicine Service. It incorporates panels used in the Melbourne Genomics Perinatal Molecular Autopsy study.", "status": "public", "version": "1.556", "version_created": "2026-04-02T15:01:45.343217+11:00", "relevant_disorders": [], "stats": { "number_of_genes": 2206, "number_of_strs": 3, "number_of_regions": 5 }, "types": [ { "name": "Rare Disease", "slug": "rare-disease", "description": "Rare disease panels" }, { "name": "Victorian Clinical Genetics Services", "slug": "victorian-clinical-genetics-services", "description": "Panel used by VCGS." } ], "child_panel_ids": [] } } ] }