Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
ACTA2	gene	ACTA2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Aortic aneurysm, familial thoracic 6, MIM# 611788;Multisystemic smooth muscle dysfunction syndrome, MIM# 613834				30724374		False	3	100;0;0	1.48	True		ENSG00000107796	ENSG00000107796	HGNC:130													
ANXA11	gene	ANXA11	Expert list;Expert Review Green	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy and brain white matter abnormalities, MIM# 619733;Amyotrophic lateral sclerosis 23, MIM# 617839				28469040;29845112;30109997;34048612		False	3	100;0;0	1.48	True		ENSG00000122359	ENSG00000122359	HGNC:535													
APC	gene	APC	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Adenomatous polyposis coli, MIM# 175100						False	3	100;0;0	1.48	True		ENSG00000134982	ENSG00000134982	HGNC:583													
APOB	gene	APOB	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypercholesterolemia, familial, 2, MIM# 144010						False	3	100;0;0	1.48	True		ENSG00000084674	ENSG00000084674	HGNC:603													
APOE	gene	APOE	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease 2, MIM# 104310;Hyperlipoproteinemia, type III (MIM#617347);Sea-blue histiocyte disease (MIM#269600)				27014949;34058468;33679311;33679311		False	3	33;67;0	1.48	True		ENSG00000130203	ENSG00000130203	HGNC:613													
APP	gene	APP	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer's Disease (MIM#104300)				17121991;1520398;15365148;15668448;1671712;1678058		False	3	100;0;0	1.48	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000142192	ENSG00000142192	HGNC:620													
ATP13A2	gene	ATP13A2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome, MIM# 606693						False	3	100;0;0	1.48	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP7B	gene	ATP7B	Expert Review Green;Expert Review Red;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Wilson Disease (MONDO:0010200;MIM #277900)				8298639;9554743;10790207;7626145;16133174		False	3	67;0;33	1.48	False		ENSG00000123191	ENSG00000123191	HGNC:870													
BAP1	gene	BAP1	Expert list;Expert Review Green	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tumor predisposition syndrome, MIM# 614327				21941004;23684012;21874000;21874003		False	3	100;0;0	1.48	True		ENSG00000163930	ENSG00000163930	HGNC:950													
BARD1	gene	BARD1	Expert list;Expert Review;Expert Review Green	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Breast cancer, MONDO:0007254;BARD1-related cancer predisposition, MONDO:0700267;Breast cancer, susceptibility to, MIM#114480						False	3	100;0;0	1.48	False		ENSG00000138376	ENSG00000138376	HGNC:952													
BGN	gene	BGN	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Meester-Loeys syndrome, MIM# 300989;Spondyloepimetaphyseal dysplasia, X-linked, MIM# 300106				30071989;27632686;17502576		False	3	100;0;0	1.48	True		ENSG00000182492	ENSG00000182492	HGNC:1044													
BRCA1	gene	BRCA1	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Breast-ovarian cancer, familial, 1, MIM# 604370						False	3	100;0;0	1.48	True		ENSG00000012048	ENSG00000012048	HGNC:1100													
BRCA2	gene	BRCA2	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Breast-ovarian cancer, familial, 2, MIM#612555						False	3	100;0;0	1.48	True		ENSG00000139618	ENSG00000139618	HGNC:1101													
CACNA1C	gene	CACNA1C	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypertrophic cardiomyopathy;congenital heart defects;conduction abnormalities;Timothy syndrome, MIM# 601005;Long QT syndrome 8, MIM# 618447				26253506;28490369;28866666		False	3	100;0;0	1.48	True		ENSG00000151067	ENSG00000151067	HGNC:1390													
CACNA1S	gene	CACNA1S	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Malignant hyperthermia susceptibility 5, MIM# 601887						False	3	100;0;0	1.48	True		ENSG00000081248	ENSG00000081248	HGNC:1397													
CASQ2	gene	CASQ2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Ventricular tachycardia, catecholaminergic polymorphic, 2, MIM# 611938				611938		False	3	100;0;0	1.48	True		ENSG00000118729	ENSG00000118729	HGNC:1513													
CDH1	gene	CDH1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted							False	3	0;0;0	1.48	False		ENSG00000039068	ENSG00000039068	HGNC:1748													
CHCHD2	gene	CHCHD2	Expert list;Expert Review Green	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 22, autosomal dominant MIM#616710				32068847;25662902;31600778;26705026		False	3	100;0;0	1.48	True		ENSG00000106153	ENSG00000106153	HGNC:21645													
CHEK2	gene	CHEK2	Expert Review Green;Other	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Li-Fraumeni syndrome 2 (MIM#609265);{Breast cancer, susceptibility to} (MIM#114480);{Colorectal cancer, susceptibility to} (MIM#114500);{Prostate cancer, familial, susceptibility to} (MIM#176807)				36529819		False	3	100;0;0	1.48	True		ENSG00000183765	ENSG00000183765	HGNC:16627													
CHMP2B	gene	CHMP2B	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795;MONDO:0010936)				20301378;16041373		False	3	100;0;0	1.48	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000083937	ENSG00000083937	HGNC:24537													
COL3A1	gene	COL3A1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Ehlers-Danlos syndrome, vascular type, MIM# 130050;Polymicrogyria with or without vascular-type EDS, MIM# 618343				28742248;19455184;25205403;30071989;25758994		False	3	100;0;0	1.48	True		ENSG00000168542	ENSG00000168542	HGNC:2201													
DAGLB	gene	DAGLB	Expert Review Green;Literature	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Parkinson disease, MONDO:0005180, DALGB-related				35715418;40244389		False	3	100;0;0	1.48	True		ENSG00000164535	ENSG00000164535	HGNC:28923													
DDX41	gene	DDX41	Expert list;Expert Review Green	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"{Myeloproliferative/lymphoproliferative neoplasms, familial (multiple types), susceptibility to} MIM#	616871"						False	3	100;0;0	1.48	True		ENSG00000183258	ENSG00000183258	HGNC:18674													
DICER1	gene	DICER1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted							False	3	0;0;0	1.48	False		ENSG00000100697	ENSG00000100697	HGNC:17098													
DSC2	gene	DSC2	Expert Review Green;Literature;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Arrhythmogenic right ventricular dysplasia 11, MIM# 610476;Arrhythmogenic right ventricular dysplasia 11 with mild palmoplantar keratoderma and woolly hair, MIM# 610476				33831308;17963498;21062920;23863954;17186466;18957847;17033975;28339476		False	3	50;50;0	1.48	True		ENSG00000134755	ENSG00000134755	HGNC:3036													
DSG2	gene	DSG2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Arrhythmogenic right ventricular dysplasia 10, MIM# 610193;Cardiomyopathy, dilated, 1BB, MIM# 612877				33949662;18678517;21859740;28764973;35941102;33831308		False	3	100;0;0	1.48	True		ENSG00000046604	ENSG00000046604	HGNC:3049													
DSP	gene	DSP	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Arrhythmogenic right ventricular dysplasia 8, MIM# 607450;Dilated cardiomyopathy with woolly hair, keratoderma, and tooth agenesis, MIM# 615821;Cardiomyopathy, dilated, with woolly hair and keratoderma, MIM# 605676;Epidermolysis bullosa, lethal acantholytic, MIM# 609638				15941723;25765472;23954618;20864495;21397041;24938629;22240500;31073624;30345701;11063735;33831308		False	3	100;0;0	1.48	True		ENSG00000096696	ENSG00000096696	HGNC:3052													
FBN1	gene	FBN1	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Acromicric dysplasia (102370);Ectopia lentis, familial (129600);Geleophysic dysplasia 2 (614185);Marfan lipodystrophy syndrome (616914);Marfan syndrome (154700);MASS syndrome (604308);Stiff skin syndrome (184900);Weill-Marchesani syndrome 2, dominant (608328)				29357934		False	3	100;0;0	1.48	True		ENSG00000166147	ENSG00000166147	HGNC:3603													
FTL	gene	FTL	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration with brain iron accumulation 3, MIM# 606159				11438811;18854324;15099026;15173247		False	3	100;0;0	1.48	True		ENSG00000087086	ENSG00000087086	HGNC:3999													
FUS	gene	FUS	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030				32941707;32770214;19251628;19251627		False	3	100;0;0	1.48	True		ENSG00000089280	ENSG00000089280	HGNC:4010													
GBA1	gene	GBA1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson's disease, MONDO:0005180, GBA-related				35639160		False	3	0;100;0	1.48	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GLA	gene	GLA	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Fabry disease 301500;Fabry disease, cardiac variant 301500				8878432;31613176;30681346		False	3	67;0;33	1.48	True	Other	ENSG00000102393	ENSG00000102393	HGNC:4296													
GRN	gene	GRN	ClinGen;Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923				18184915;23596077;20301545;17436289		False	3	100;0;0	1.48	True		ENSG00000030582	ENSG00000030582	HGNC:4601													
HCN4	gene	HCN4	ClinGen;Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Sick sinus syndrome 2, MIM# 163800;Aortopathy				12750403;15123648;16407510;17646576;25145518;30071989;27173043		False	3	50;50;0	1.48	True		ENSG00000138622	ENSG00000138622	HGNC:16882													
HOXB13	gene	HOXB13	Expert list;Expert Review;Expert Review Green;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Prostate cancer, MONDO:0008315;Prostate cancer, susceptibility to, MIM#610997				PMID: 22236224, 30730552, 38766261		False	3	100;0;0	1.48	False		ENSG00000159184	ENSG00000159184	HGNC:5112													
ITM2B	gene	ITM2B	Expert list;Expert Review Green	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Dementia, familial British MIM#176500;Dementia, familial Danish	MIM#117300"				10391242;10781099;20385796;33814452		False	3	100;0;0	1.48	True	Other	ENSG00000136156	ENSG00000136156	HGNC:6174													
KCNE1	gene	KCNE1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Jervell and Lange-Nielsen syndrome 2, MIM# 612347;Long QT syndrome 5, MIM# 613695						False	3	50;50;0	1.48	True		ENSG00000180509	ENSG00000180509	HGNC:6240													
KCNH2	gene	KCNH2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Long QT syndrome 2, MIM# 613688;Short QT syndrome , MIM#1 609620				31983240		False	3	100;0;0	1.48	True		ENSG00000055118	ENSG00000055118	HGNC:6251													
KCNQ1	gene	KCNQ1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Long QT syndrome 1, MIM# 192500;Short QT syndrome 2, MIM# 609621;Jervell and Lange-Nielsen syndrome, MIM# 220400;Atrial fibrillation, familial, 3, MIM# 607554						False	3	100;0;0	1.48	True		ENSG00000053918	ENSG00000053918	HGNC:6294													
LDLR	gene	LDLR	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypercholesterolemia, familial, 1, MIM# 143890				10978268		False	3	100;0;0	1.48	True		ENSG00000130164	ENSG00000130164	HGNC:6547													
LMNA	gene	LMNA	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cardiomyopathy, dilated, 1A, MIM# 115200;Arrhythmogenic right ventricular cardiomyopathy;Lipodystrophy, familial partial, type 2, MIM# 151660;Emery-Dreifuss muscular dystrophy 2, MIM#181350;Mandibuloacral dysplasia 248370;Restrictive dermopathy, lethal 275210;Hutchinson-Gilford progeria 176670;Muscular dystrophy, congenital 613205				22199124;25837155;26620845		False	3	100;0;0	1.48	True		ENSG00000160789	ENSG00000160789	HGNC:6636													
LRP10	gene	LRP10	Expert Review Green;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease MONDO:0005180				36434476;33913039;32613234;32597809;30964957;30597596;29887161		False	3	100;0;0	1.48	False		ENSG00000197324	ENSG00000197324	HGNC:14553													
LRRK2	gene	LRRK2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson Disease type 8 (MONDO:0005180, MIM#607060)				20301387;17200152;15541308;16172858;17060595;31038182;27521182;28487191		False	3	100;0;0	1.48	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000188906	ENSG00000188906	HGNC:18618													
LZTR1	gene	LZTR1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Schwannomatosis-2, susceptibility to MIM#615670;Noonan syndrome 10 MIM# 616564;Noonan syndrome 2, MIM# 605275						False	3	100;0;0	1.48	True		ENSG00000099949	ENSG00000099949	HGNC:6742													
MAPT	gene	MAPT	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Supranuclear palsy, progressive (MIM# 601104) AD;Supranuclear palsy, progressive atypical (MIM# 260540) AR				20838030;11220749		False	3	100;0;0	1.48	True		ENSG00000186868	ENSG00000186868	HGNC:6893													
MBD4	gene	MBD4	Expert Review Green;Literature	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Tumor predisposition syndrome 2 MIM#619975;Hereditary neoplastic syndrome, MBD4-associated MONDO:0015356				35460607		False	3	50;50;0	1.48	True		ENSG00000129071	ENSG00000129071	HGNC:6919													
MEN1	gene	MEN1	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Multiple endocrine neoplasia 1, MIM# 131100						False	3	100;0;0	1.48	True		ENSG00000133895	ENSG00000133895	HGNC:7010													
MLH1	gene	MLH1	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	mismatch repair cancer syndrome 1 MONDO:0010159						False	3	100;0;0	1.48	True		ENSG00000076242	ENSG00000076242	HGNC:7127													
MSH2	gene	MSH2	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	100;0;0	1.48	False		ENSG00000095002	ENSG00000095002	HGNC:7325													
MSH6	gene	MSH6	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	100;0;0	1.48	False		ENSG00000116062	ENSG00000116062	HGNC:7329													
MUTYH	gene	MUTYH	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	100;0;0	1.48	False		ENSG00000132781	ENSG00000132781	HGNC:7527													
MYBPC3	gene	MYBPC3	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cardiomyopathy, dilated, 1MM, MIM#615396;Cardiomyopathy, hypertrophic, 4, MIM# 115197						False	3	75;25;0	1.48	True		ENSG00000134571	ENSG00000134571	HGNC:7551													
MYH11	gene	MYH11	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Visceral myopathy 2, MIM# 619350;Megacystis microcolon intestinal hypoperistalsis syndrome, autosomal recessive, MIM#619351;Aortic aneurysm, familial thoracic 4, MIM# 132900				30071989;16444274;17666408;27081537;31944481		False	3	100;0;0	1.48	True		ENSG00000133392	ENSG00000133392	HGNC:7569													
MYH7	gene	MYH7	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cardiomyopathy, dilated, 1S, MIM# 613426;MONDO:0013262;Cardiomyopathy, hypertrophic, 1, MIM# 192600;Laing distal myopathy, MIM# 160500;Myopathy, myosin storage, autosomal dominant, MIM# 608358;Myopathy, myosin storage, autosomal recessive, MIM# 255160				21483645;30874888;21846512;30384889;25935763;24558114;27000522;31179125;24119082;27965028;33947203;30681346;15322983		False	3	100;0;0	1.48	True		ENSG00000092054	ENSG00000092054	HGNC:7577													
MYL2	gene	MYL2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Myopathy, myofibrillar, 12, infantile-onset, with cardiomyopathy, MIM# 619424;Cardiomyopathy, hypertrophic, 10, MIM# 608758				23365102;32453731;30681346		False	3	100;0;0	1.48	True		ENSG00000111245	ENSG00000111245	HGNC:7583													
MYL3	gene	MYL3	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cardiomyopathy, hypertrophic, 8, MIM# 608751				30681346		False	3	100;0;0	1.48	True		ENSG00000160808	ENSG00000160808	HGNC:7584													
MYLK	gene	MYLK	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aortic aneurysm, familial thoracic 7, MIM#613780;Megacystis-microcolon-intestinal hypoperistalsis syndrome, MIM#249210				28602422;30071989;27586135;21055718;25907466		False	3	100;0;0	1.48	True		ENSG00000065534	ENSG00000065534	HGNC:7590													
NF2	gene	NF2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurofibromatosis, type 2, MIM# 101000				33075808		False	3	100;0;0	1.48	True		ENSG00000186575	ENSG00000186575	HGNC:7773													
NOTCH3	gene	NOTCH3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310				31960911		False	3	100;0;0	1.48	True		ENSG00000074181	ENSG00000074181	HGNC:7883													
NPC1	gene	NPC1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	0;100;0	1.48	False		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC2	gene	NPC2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	100;0;0	1.48	False		ENSG00000119655	ENSG00000119655	HGNC:14537													
NTHL1	gene	NTHL1	Expert Review Green;Literature	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	NTHL1-associated cancer syndrome				33454955		False	3	100;0;0	1.48	True		ENSG00000065057	ENSG00000065057	HGNC:8028													
OPTN	gene	OPTN	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MONDO: 0013264, MIM#613435)				20428114;31838784;27493188		False	3	100;0;0	1.48	True		ENSG00000123240	ENSG00000123240	HGNC:17142													
PALB2	gene	PALB2	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	100;0;0	1.48	False		ENSG00000083093	ENSG00000083093	HGNC:26144													
PANK2	gene	PANK2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 1 (MIM#234200)				24600523;23447832;19480328		False	3	100;0;0	1.48	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PARK7	gene	PARK7	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 7, autosomal recessive early-onset MIM#606324				11462174;11835383;16240358;20301402;29644727		False	3	50;50;0	1.48	True		ENSG00000116288	ENSG00000116288	HGNC:16369													
PCSK9	gene	PCSK9	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Familial Hypercholesterolemia 3 (MONDO:0011369;MIM# 603776);Low-density lipoprotein cholesterol level quantitative trait locus-1 (LDLCQ1;MIM# 603776)				24404629;18354137;12730697;15654334;16909389		False	3	100;0;0	1.48	True		ENSG00000169174	ENSG00000169174	HGNC:20001													
PICALM	gene	PICALM	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	0;0;0	1.48	False		ENSG00000073921	ENSG00000073921	HGNC:15514													
PINK1	gene	PINK1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 6, early onset MIM#605909				29644727;15955953		False	3	100;0;0	1.48	True		ENSG00000158828	ENSG00000158828	HGNC:14581													
PKP2	gene	PKP2	Expert Review Green;Literature;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Arrhythmogenic right ventricular dysplasia 9, MIM# 609040;Dilated cardiomyopathy, MONDO:0005021, PKP2-related				30562116;35059364;38050058;15489853;16567567		False	3	50;50;0	1.48	True		ENSG00000057294	ENSG00000057294	HGNC:9024													
PLA2G6	gene	PLA2G6	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 14, autosomal recessive 612953				25634434;26836416;22406380;20938027		False	3	0;100;0	1.48	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PMS2	gene	PMS2	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Colorectal cancer, hereditary nonpolyposis, type 4, MIM# 614337;Mismatch repair cancer syndrome 4, MIM# 619101						False	3	100;0;0	1.48	True		ENSG00000122512	ENSG00000122512	HGNC:9122													
POT1	gene	POT1	Expert list;Expert Review Green	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Telomere syndrome, MONDO:0100137, POT1-related				(PMID:27528712;PMID: 29693246;PMID: 34769003;PMID: 36467798;PMID: 33216348;PMID: 24686849;PMID:24686846;PMID: 26403419;PMID: 32492864)		False	3	100;0;0	1.48	True		ENSG00000128513	ENSG00000128513	HGNC:17284													
PRKAG2	gene	PRKAG2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiomyopathy, hypertrophic 6, MIM# 600858;Glycogen storage disease of heart, lethal congenital, MIM# 261740				15877279;17667862;32646569;30681346		False	3	50;0;50	1.48	True		ENSG00000106617	ENSG00000106617	HGNC:9386													
PRKN	gene	PRKN	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Parkinson disease, juvenile, type 2 MIM#600116				29644727		False	3	100;0;0	1.48	True		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRNP	gene	PRNP	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Prion Disease (MIM#176640);Creutzfeldt-Jakob disease (MIM#123400)				27910931;19571725, 20301407;6351815		False	3	100;0;0	1.48	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PSEN1	gene	PSEN1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease, type 3 (MONDO:0011913;MIM#607822)				20301340;7596406;16033913		False	3	100;0;0	1.48	True		ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN2	gene	PSEN2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	100;0;0	1.48	False		ENSG00000143801	ENSG00000143801	HGNC:9509													
PTEN	gene	PTEN	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cowden syndrome 1, MIM# 158350				32588888		False	3	100;0;0	1.48	True		ENSG00000171862	ENSG00000171862	HGNC:9588													
RAD51D	gene	RAD51D	Expert Review Green;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	{Breast-ovarian cancer, familial, susceptibility to, 4} 614291				PMID: 28646019;31937788;26057125		False	3	100;0;0	1.48	True		ENSG00000185379	ENSG00000185379	HGNC:9823													
RB1	gene	RB1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	0;0;0	1.48	False		ENSG00000139687	ENSG00000139687	HGNC:9884													
RET	gene	RET	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	100;0;0	1.48	False		ENSG00000165731	ENSG00000165731	HGNC:9967													
RNF43	gene	RNF43	Expert list;Expert Review;Expert Review Green;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Colorectal cancer, MONDO:0005575;Polyposis, MONDO:0000147;Sessile serrated polyposis cancer syndrome, MONDO:0014919;Sessile serrated polyposis cancer syndrome, MIM#617108;Hereditary haemochromatosis, MONDO:0006507, RNF43-related				24512911;34541672;27329244;27081527;29330307;41024252		False	3	50;0;50	1.48	True		ENSG00000108375	ENSG00000108375	HGNC:18505													
RYR2	gene	RYR2	Expert Review Green;Literature;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ventricular tachycardia, catecholaminergic polymorphic, 1, MIM# 604772;Arrhythmogenic right ventricular dysplasia 2, MIM# 600996;Hypertrophic cardiomyopathy				11159936;25041964;29543670;11208676;12093772		False	3	67;33;0	1.48	True		ENSG00000198626	ENSG00000198626	HGNC:10484													
SCN5A	gene	SCN5A	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Long QT syndrome 3 (MIM#603830);Sick sinus syndrome 1, MIM# 608567;Ventricular fibrillation, familial, 1, MIM# 603829;Brugada syndrome 1, MIM# 601144;Heart block, progressive, type IA, MIM# 113900;Cardiomyopathy, dilated, 1E, MIM# 601154;SCN5A-related cardiac rhythm disorder MONDO:1010181				15671429;15671429;19808398;21596231;20458009;22675453;22766342;22999724;29871609;29506689;31514951;31930659;31520233;17512504;21824921;30218094		False	3	100;0;0	1.48	True		ENSG00000183873	ENSG00000183873	HGNC:10593													
SDHAF2	gene	SDHAF2	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	Paragangliomas 2, MIM# 601650						False	3	100;0;0	1.48	True		ENSG00000167985	ENSG00000167985	HGNC:26034													
SDHB	gene	SDHB	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paragangliomas 4, MIM# 115310						False	3	100;0;0	1.48	True		ENSG00000117118	ENSG00000117118	HGNC:10681													
SDHC	gene	SDHC	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paragangliomas 3, MIM# 605373						False	3	100;0;0	1.48	True		ENSG00000143252	ENSG00000143252	HGNC:10682													
SDHD	gene	SDHD	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	Paragangliomas 1, with or without deafness, MIM# 168000;Pheochromocytoma, MIM# 171300						False	3	100;0;0	1.48	True		ENSG00000204370	ENSG00000204370	HGNC:10683													
SETX	gene	SETX	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic Lateral Sclerosis 4, juvenile (MIM#602433)				15106121;9497266		False	3	50;0;50	1.48	True		ENSG00000107290	ENSG00000107290	HGNC:445													
SMAD3	gene	SMAD3	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Loeys-Dietz syndrome 3, MIM# 613795				21217753;30661052;30071989		False	3	100;0;0	1.48	True		ENSG00000166949	ENSG00000166949	HGNC:6769													
SNCA	gene	SNCA	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)	Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543)				32849182;26858591;32740728		False	3	100;0;0	1.48	True		ENSG00000145335	ENSG00000145335	HGNC:11138													
SNCAIP	gene	SNCAIP	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	0;0;100	1.48	False		ENSG00000064692	ENSG00000064692	HGNC:11139													
SOD1	gene	SOD1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 1 MIM#105400;Spastic tetraplegia and axial hypotonia, progressive MIM#618598				8625408;21545237;16503123;19252762;20577002		False	3	50;0;50	1.48	True		ENSG00000142168	ENSG00000142168	HGNC:11179													
SPG11	gene	SPG11	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 5, juvenile, MIM# 602099				27318863;28237315;18079167;20110243		False	3	100;0;0	1.48	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
STK11	gene	STK11	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Peutz-Jeghers syndrome, MIM# 175200						False	3	100;0;0	1.48	True		ENSG00000118046	ENSG00000118046	HGNC:11389													
TARDBP	gene	TARDBP	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 10, with or without FTD;Frontotemporal lobar degeneration, TARDBP-related (MIM#612069;MONDO: 0012790)				18309045;19609911		False	3	100;0;0	1.48	True		ENSG00000120948	ENSG00000120948	HGNC:11571													
TBK1	gene	TBK1	Expert Review;Expert Review Green	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 4 (MIM#616439), AD				25803835;26581300;31000212;25943890		False	3	100;0;0	1.48	True		ENSG00000183735	ENSG00000183735	HGNC:11584													
TGFBR1	gene	TGFBR1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Loeys-Dietz syndrome 1, MIM# 609192				30071989;27879313		False	3	100;0;0	1.48	True		ENSG00000106799	ENSG00000106799	HGNC:11772													
TGFBR2	gene	TGFBR2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Loeys-Dietz syndrome 2 , MIM#610168				30071989;27879313		False	3	100;0;0	1.48	True		ENSG00000163513	ENSG00000163513	HGNC:11773													
THSD4	gene	THSD4	Expert Review Green;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Aortic aneurysm, familial thoracic 12, MIM# 619825				32855533		False	3	100;0;0	1.48	True		ENSG00000187720	ENSG00000187720	HGNC:25835													
TMEM43	gene	TMEM43	Expert Review Green;Literature;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Arrhythmogenic right ventricular dysplasia 5, MIM# 604400;Auditory neuropathy, autosomal dominant 3, MIM# 619832;Emery-Dreifuss muscular dystrophy 7 (MIM#614302)				18313022;21214875;23812740;22725725;24598986;29980933;34050020;21391237;30311943;33831308		False	3	50;50;0	1.48	True		ENSG00000170876	ENSG00000170876	HGNC:28472													
TNNI3	gene	TNNI3	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cardiomyopathy, dilated, 1FF, MIM#613286;Cardiomyopathy, hypertrophic, 7, MIM# 613690;Cardiomyopathy, familial restrictive, MIM#1115210				35838873;22464770;31568572;19590045;20215591;21846512;2226790;30681346;15607392		False	3	100;0;0	1.48	True		ENSG00000129991	ENSG00000129991	HGNC:11947													
TNNT2	gene	TNNT2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiomyopathy, dilated, 1D, MIM# 601494;Cardiomyopathy, hypertrophic, 2, MIM# 115195;Cardiomyopathy, familial restrictive, 3, MIM# 612422;Left ventricular noncompaction 6, MIM# 601494				33947203;11106718;20978592;20031601;15542288;17556660;30681346		False	3	100;0;0	1.48	True		ENSG00000118194	ENSG00000118194	HGNC:11949													
TP53	gene	TP53	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	100;0;0	1.48	False		ENSG00000141510	ENSG00000141510	HGNC:11998													
TPM1	gene	TPM1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiomyopathy, dilated, 1Y, MIM# 611878;Cardiomyopathy, hypertrophic, 3, MIM# 115196				11273725;23147248;20117437;15249230;20215591;21483645;31983221;28600229		False	3	100;0;0	1.48	True		ENSG00000140416	ENSG00000140416	HGNC:12010													
TRIM28	gene	TRIM28	Expert Review Green;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Wilm's tumour				30694527		False	3	100;0;0	1.48	True		ENSG00000130726	ENSG00000130726	HGNC:16384													
TSC1	gene	TSC1	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tuberous sclerosis-1, MIM# 191100						False	3	100;0;0	1.48	True		ENSG00000165699	ENSG00000165699	HGNC:12362													
TSC2	gene	TSC2	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tuberous sclerosis-2, MIM# 613254						False	3	100;0;0	1.48	True		ENSG00000103197	ENSG00000103197	HGNC:12363													
TTN	gene	TTN	ClinGen;Expert Review Green	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dilated cardiomyopathy 1G, MONDO:0011400;TTN-related myopathy, MONDO:0100175;Myopathy, myofibrillar, 9, with early respiratory failure, MONDO:0011362;Tibial muscular dystrophy, MONDO:0010870;TTN-related myopathy, dominant-negative TTNsv, MONDO:1060225				25589632;28045975;22335739;33947203		False	3	75;25;0	1.48	True		ENSG00000155657	ENSG00000155657	HGNC:12403													
UBQLN2	gene	UBQLN2	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MONDO: 0010459;MIM#300857)				21857683;31319884;26152284;25388785		False	3	0;100;0	1.48	True		ENSG00000188021	ENSG00000188021	HGNC:12509													
UCHL1	gene	UCHL1	Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 79A, autosomal dominant, MIM# 620221;Spastic paraplegia 79, autosomal recessive, MIM# 615491;MONDO:0014209;Neurodegenerative disease, MONDO:0005559, UCHL1-related				23359680;3340629;28007905;32656641;29735986;28007905;35986737		False	3	50;0;50	1.48	True		ENSG00000154277	ENSG00000154277	HGNC:12513													
UQCRC1	gene	UQCRC1	Expert Review Green;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinsonism with polyneuropathy, MONDO:0036193				33141179;33248804;41783485;39752790;33070102;30788857		False	3	50;50;0	1.48	True		ENSG00000010256	ENSG00000010256	HGNC:12585													
VAPB	gene	VAPB	Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	3	0;50;50	1.48	False		ENSG00000124164	ENSG00000124164	HGNC:12649													
VCP	gene	VCP	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or Amyotrophic lateral sclerosis 6 (MONDO:0013501;MIM 613954);Inclusion body myopathy with early-onset Paget Disease and FTD [IBMPFD] (MONDO:0000507MIM 167320)				21145000;33004675		False	3	100;0;0	1.48	True		ENSG00000165280	ENSG00000165280	HGNC:12666													
VHL	gene	VHL	Expert Review Green;Melbourne Genomics Health Alliance;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	von Hippel-Lindau syndrome , MIM#193300						False	3	100;0;0	1.48	True		ENSG00000134086	ENSG00000134086	HGNC:12687													
VPS13A	gene	VPS13A	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Choreoacanthocytosis MIM#200150				26813249;15824261;30140251;31192303		False	3	100;0;0	1.48	True		ENSG00000197969	ENSG00000197969	HGNC:1908													
WT1	gene	WT1	Expert Review Green;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Denys-Drash syndrome, MIM# 194080;Frasier syndrome, MIM#136680;Wilms tumor, type 1, MIM#194070;Nephrotic syndrome, type 4, MIM#256370						False	3	100;0;0	1.48	True		ENSG00000184937	ENSG00000184937	HGNC:12796													
XK	gene	XK	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Incidentalome			X-LINKED: hemizygous mutation in males, biallelic mutations in females	McLeod Syndrome with or without chronic granulomatous disease (MIM#300842)				20301528;17133513		False	3	100;0;0	1.48	True		ENSG00000047597	ENSG00000047597	HGNC:12811													
ANG	gene	ANG	Expert Review Amber;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic Lateral Sclerosis (MONDO: 0012753;MIM#611895)				17886298;16501576;18087731;20301623;19153377		False	2	50;0;50	1.48	True		ENSG00000214274	ENSG00000214274	HGNC:483													
CCNF	gene	CCNF	Expert list;Expert Review Amber	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141				27080313;31577344		False	2	0;100;0	1.48	True		ENSG00000162063	ENSG00000162063	HGNC:1591													
CLCC1	gene	CLCC1	Expert Review Amber;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis MONDO:0004976				37916886;37142673		False	2	0;100;0	1.48	False		ENSG00000121940	ENSG00000121940	HGNC:29675													
DNAJC7	gene	DNAJC7	Expert Review Amber;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis				31768050;40802071		False	2	0;100;0	1.48	True		ENSG00000168259	ENSG00000168259	HGNC:12392													
GLT8D1	gene	GLT8D1	ClinGen;Expert Review Amber	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis MONDO:0004976				30811981;35525134;34746377;33714647;31653410;35873773;33581933		False	2	0;100;0	1.48	True		ENSG00000016864	ENSG00000016864	HGNC:24870													
LGALSL	gene	LGALSL	ClinGen;Expert Review Amber	Incidentalome			Unknown	"Amyotrophic lateral sclerosis	MONDO:0004976"				30940688		False	2	0;100;0	1.48	True		ENSG00000119862	ENSG00000119862	HGNC:25012													
PCDHA9	gene	PCDHA9	Expert Review Amber;Literature	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	amyotrophic lateral sclerosis MONDO:0004976				38467605		False	2	0;100;0	1.48	True		ENSG00000204961	ENSG00000204961	HGNC:8675													
RBM12	gene	RBM12	Expert Review Amber;Victorian Clinical Genetics Services	Incidentalome			Unknown	Schizophrenia 19 (MIM#617629)						False	2	0;100;0	1.48	True		ENSG00000244462	ENSG00000244462	HGNC:9898													
SORL1	gene	SORL1	Expert Review Amber;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease, MONDO:0004975, SORL1-related				27026413;39226352;40182695		False	2	0;50;50	1.48	True		ENSG00000137642	ENSG00000137642	HGNC:11185													
SS18L1	gene	SS18L1	Expert Review;Expert Review Amber	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis (MONDO:0004976)				25888396;24360741;23708140;30976389		False	2	0;100;0	1.48	True		ENSG00000184402	ENSG00000184402	HGNC:15592													
TAF15	gene	TAF15	ClinGen;Expert Review Amber	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis MONDO:0004976;frontotemporal dementia MONDO:0017276				28889094;21438137;22065782;27810362;28889094		False	2	0;100;0	1.48	True		-	ENSG00000270647	HGNC:11547													
TUBA4A	gene	TUBA4A	Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208				28069311;25374358;26675813		False	2	0;100;0	1.48	True		ENSG00000127824	ENSG00000127824	HGNC:12407													
UBQLN4	gene	UBQLN4	Expert Review;Expert Review Amber	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis MONDO:0004976				28463112;30804504		False	2	0;100;0	1.48	True		ENSG00000160803	ENSG00000160803	HGNC:1237													
WNK2	gene	WNK2	Expert Review Amber;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Serrated polyposis syndrome				PMID: 36270769		False	2	0;100;0	1.48	True		ENSG00000165238	ENSG00000165238	HGNC:14542													
A2M	gene	A2M	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease, MONDO:0004975						False	1	0;0;100	1.48	True		ENSG00000175899	ENSG00000175899	HGNC:7													
AKAP9	gene	AKAP9	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Long QT syndrome 11, MIM# 611820				31983240		False	1	0;0;100	1.48	True		ENSG00000127914	ENSG00000127914	HGNC:379													
ALG10B	gene	ALG10B	ClinGen	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	long QT syndrome MONDO:0002442				37071726		False	1	0;0;100	1.48	False		ENSG00000175548	ENSG00000175548	HGNC:31088													
ANK2	gene	ANK2	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Long QT syndrome 4, MIM# 600919				31983240		False	1	0;0;100	1.48	True		ENSG00000145362	ENSG00000145362	HGNC:493													
BRD9	gene	BRD9	Expert Review Red;Literature	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Early onset Parkinson Disease MONDO:0017279				40959972		False	1	0;0;100	1.48	True		ENSG00000028310	ENSG00000028310	HGNC:25818													
CACNB2	gene	CACNB2	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Brugada syndrome 4, MIM# 611876				29959160		False	1	0;0;100	1.48	True		ENSG00000165995	ENSG00000165995	HGNC:1402													
CALHM1	gene	CALHM1	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	1	0;0;100	1.48	True		ENSG00000185933	ENSG00000185933	HGNC:23494													
CLU	gene	CLU	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			Unknown	Alzheimer's Disease (MIM#104300)						False	1	0;0;100	1.48	True		ENSG00000120885	ENSG00000120885	HGNC:2095													
DLST	gene	DLST	Expert list;Expert Review;Expert Review Red;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paragangliomas 7, MONDO:0032771;Pheochromocytoma, MONDO:0008233;Hereditary pheochromocytoma-paraganglioma, MONDO:0017366;Pheochromocytoma/paraganglioma syndrome 7, MIM#618475				PMID: 30929736, 33180916		False	1	0;0;100	1.48	False		ENSG00000119689	ENSG00000119689	HGNC:2911													
GPD1L	gene	GPD1L	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Brugada syndrome 2, MIM# 611777				17967977;19666841		False	1	0;0;100	1.48	True		ENSG00000152642	ENSG00000152642	HGNC:28956													
KCNE2	gene	KCNE2	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Long QT syndrome 6, MIM# 613693				31983240;28794082;31983240		False	1	0;67;33	1.48	True		ENSG00000159197	ENSG00000159197	HGNC:6242													
MLH3	gene	MLH3	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Colorectal cancer, hereditary nonpolyposis, type 7, MIM# 614385						False	1	0;0;100	1.48	True		ENSG00000119684	ENSG00000119684	HGNC:7128													
NR4A2	gene	NR4A2	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	1	0;0;100	1.48	True		ENSG00000153234	ENSG00000153234	HGNC:7981													
PBRM1	gene	PBRM1	Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	renal cell carcinoma MONDO:0005086				25911086		False	1	0;0;100	1.48	False		ENSG00000163939	ENSG00000163939	HGNC:30064													
PCP4	gene	PCP4	Expert Review Red;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Familial amyotrophic lateral sclerosis, MONDO:0005144, PCP4-related				39852553		False	1	0;0;100	1.48	True		ENSG00000183036	ENSG00000183036	HGNC:8742													
PLA2G2A	gene	PLA2G2A	Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	colorectal cancer MONDO:0005575				9272153;8912789		False	1	0;0;100	1.48	False		ENSG00000188257	ENSG00000188257	HGNC:9031													
RABL3	gene	RABL3	Expert Review Red;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	pancreatic carcinoma				31406347;33353859;33724601		False	1	100;0;0	1.48	True		ENSG00000144840	ENSG00000144840	HGNC:18072													
RNASEL	gene	RNASEL	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	1	0;0;0	1.48	True		ENSG00000135828	ENSG00000135828	HGNC:10050													
RRAD	gene	RRAD	Expert Review Red;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Brugada syndrome, MONDO:0015263, RRAD-related				34185406;31114854		False	1	0;0;100	1.48	True		ENSG00000166592	ENSG00000166592	HGNC:10446													
SCN3B	gene	SCN3B	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			Unknown							False	1	0;0;0	1.48	False		ENSG00000166257	ENSG00000166257	HGNC:20665													
SCN4B	gene	SCN4B	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Long QT syndrome 10, MIM#	611819"				31983240		False	1	0;0;100	1.48	True		ENSG00000177098	ENSG00000177098	HGNC:10592													
SFPQ	gene	SFPQ	Expert Review Red;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis, MONDO:0004976, SFPQ-related				28392072		False	1	0;0;100	1.48	True		ENSG00000116560	ENSG00000116560	HGNC:10774													
SLC25A11	gene	SLC25A11	Expert list;Expert Review;Expert Review Red;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paragangliomas 6, MONDO:0032767;Pheochromocytoma, MONDO:0008233;Hereditary pheochromocytoma-paraganglioma, MONDO:0017366;Pheochromocytoma/paraganglioma syndrome 6, MIM#618464				PMID: 29431636		False	1	0;0;100	1.48	False		ENSG00000108528	ENSG00000108528	HGNC:10981													
SNCB	gene	SNCB	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dementia, Lewy body, MIM#127750				15365127;20697047		False	1	0;50;50	1.48	True		ENSG00000074317	ENSG00000074317	HGNC:11140													
SNTA1	gene	SNTA1	Expert Review Red;Victorian Clinical Genetics Services	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Long QT syndrome 12, MIM# 612955				31983240		False	1	0;0;100	1.48	True		ENSG00000101400	ENSG00000101400	HGNC:11167													
TMEM168	gene	TMEM168	ClinGen	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Brugada syndrome MONDO:0015263				https://search.clinicalgenome.org/CCID:009114		False	1	0;0;100	1.48	False		ENSG00000146802	ENSG00000146802	HGNC:25826													
TMEM230	gene	TMEM230	Expert Review;Expert Review Red	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 21, MONDO:0005180				30804554;27270108;28115417;28017548;30804555;30804556;31323517		False	1	0;0;100	1.48	True		ENSG00000089063	ENSG00000089063	HGNC:15876													
VEZF1	gene	VEZF1	Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	dilated cardiomyopathy MONDO:0005021				36657711		False	1	0;0;100	1.48	False		ENSG00000136451	ENSG00000136451	HGNC:12949													
AR_SBMA_CAG	str	AR	Expert Review Green;Expert list;Expert list	Incidentalome			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Spinal and bulbar muscular atrophy of Kennedy MIM#313200				2062380;20301508;29325606		False	3	100;0;0	1.48	True		ENSG00000169083	ENSG00000169083	HGNC:644	X	66765160	66765225	67545318	67545383	CAG	34	38					
ATN1_DRPLA_CAG	str	ATN1	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370				8136840;8136826;29325606;20301664		False	3	100;0;0	1.48	True		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
ATXN10_SCA10_ATTCT	str	ATXN10	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 10 MIM#603516				20301354;11017075		False	3	100;0;0	1.48	True		ENSG00000130638	ENSG00000130638	HGNC:10549	22	46191235	46191304	45795355	45795424	ATTCT	32	800					
ATXN1_SCA1_CAG	str	ATXN1	Expert list;Expert Review Green;Expert Review Green;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 1 MIM#164400				8358429;29325606;20301363		False	3	100;0;0	1.48	False		ENSG00000124788	ENSG00000124788	HGNC:10548	6	16327918	16327953	16327687	16327722	CAG	35	39					
ATXN2_SCA2_CAG	str	ATXN2	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 2 MIM#183090				8896555;29325606;20301452		False	3	100;0;0	1.48	True		ENSG00000204842	ENSG00000204842	HGNC:10555	12	112036755	112036823	111598951	111599019	CAG	31	35					
ATXN3_SCA3_CAG	str	ATXN3	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3				7874163;20301375;29325606		False	3	100;0;0	1.48	True		ENSG00000066427	ENSG00000066427	HGNC:7106	14	92537355	92537396	92071011	92071052	CAG	44	60					
ATXN7_SCA7_CAG	str	ATXN7	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 7 MIM#164500				8908515;29325606;20301433		False	3	100;0;0	1.48	True		ENSG00000163635	ENSG00000163635	HGNC:10560	3	63898362	63898391	63912686	63912715	CAG	27	37					
ATXN8OS_SCA8_CTG	str	ATXN8OS	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 8 MIM#608768				20301445;10192387		False	3	100;0;0	1.48	True		ENSG00000230223	ENSG00000230223	HGNC:10561	13	70713486	70713560	70139354	70139428	CTG	50	80					
BEAN1_SCA31_TGGAA	str	BEAN1	Expert list;Expert Review Green;Expert Review Green;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 31 MIM#117210				19878914;31755042		False	3	100;0;0	1.48	False		ENSG00000166546	ENSG00000166546	HGNC:24160	16	66524301	66524302	66490398	66490399	TGGAA	22	80					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550				25577942;21944779;21944778		False	3	100;0;0	1.48	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
CACNA1A_SCA6_CAG	str	CACNA1A	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500				8988170;20301319;29325606		False	3	100;0;0	1.48	True		ENSG00000141837	ENSG00000141837	HGNC:1388	19	13318673	13318691	13207859	13207897	CAG	18	20					
CSTB_EPM1_CCCCGCCCCGCG	str	CSTB	Expert Review Green;Expert list;Expert list	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800				29325606;20301321;9126745		False	3	100;0;0	1.48	True		ENSG00000160213	ENSG00000160213	HGNC:2482	21	45196325	45196360	43776444	43776479	CCCCGCCCCGCG	3	30					
DAB1_SCA37_ATTTC	str	DAB1	Expert list;Expert Review Green;Expert Review Green;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 37 MIM#615945				28686858;31145571		False	3	100;0;0	1.48	False		ENSG00000173406	ENSG00000173406	HGNC:2661	1	57832716	57832797	57367044	57367121	ATTTC	0	31					
FGF14_SCA27B_GAA	str	FGF14	Expert Review Green;Literature;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs)				37165652;36516086;36493768		False	3	100;0;0	1.48	True		ENSG00000102466	ENSG00000102466	HGNC:3671	13	102813926	102814076	102161576	102161726	GAA	249	300					
FMR1_FXTAS_CGG	str	FMR1	Expert Review Green;Expert list;Expert list	Incidentalome			X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Fragile X tremor/ataxia syndrome MIM#300623				23765048;25227148;11445641		False	3	100;0;0	1.48	True		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	55					
FXN_FRDA_GAA	str	FXN	Expert list;Expert Review Green;Expert Review Green;Expert list	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300				20301458;8596916		False	3	100;0;0	1.48	False		ENSG00000165060	ENSG00000165060	HGNC:3951	9	71652203	71652220	69037287	69037304	GAA	33	66					
HSF1_ET_CCCCGCNCCGCCT_CCNCGCCT	str	HSF1	Expert Review Green;Literature;Literature;Literature;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Essential tremor, MONDO:0003233				40581632		False	3	100;0;0	1.48	True		ENSG00000185122	ENSG00000185122	HGNC:5224	8	145537313	145537466	144313626	144313808	CCCCGCNCCGCCT	500	700					
HTT_HD_CAG	str	HTT	Expert Review Green;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease MIM#143100				8458085;20301482;29325606		False	3	100;0;0	1.48	True		ENSG00000197386	ENSG00000197386	HGNC:4851	4	3076604	3076666	3074877	3074939	CAG	26	40					
JPH3_HDL2_CTG	str	JPH3	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438				11558794;20301701		False	3	100;0;0	1.48	True		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
LRP12_ALS_CGG	str	LRP12	Expert Review Green;Literature;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Amyotrophic lateral sclerosis MONDO:0004976;Amyotrophic lateral sclerosis 28, MIM#	620452"				37339631		False	3	100;0;0	1.48	True		ENSG00000147650	ENSG00000147650	HGNC:31708	8	105601201	105601227	104588973	104588999	CGG	50	61					
NOP56_SCA36_GGCCTG	str	NOP56	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 36 MIM#614153				21683323		False	3	100;0;0	1.48	True		ENSG00000101361	ENSG00000101361	HGNC:15911	20	2633380	2633403	2652734	2652757	GGCCTG	14	650					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866				31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	1.48	True		-	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
NUTM2B-AS1_OPDM_CCG	str	NUTM2B-AS1	Expert Review Green;Literature;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngeal myopathy with leukoencephalopathy 1 MIM#618637				31332380;37923380;39308795;38159879		False	3	100;0;0	1.48	True		ENSG00000225484	ENSG00000225484	HGNC:51204	10	81586142	81586159	79826386	79826403	CCG	16	35					
PABPN1_OPMD_GCN	str	PABPN1	Expert Review Green;Expert list;Expert list	Incidentalome			BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Oculopharyngeal muscular dystrophy MIM#164300				9462747;20301305		False	3	100;0;0	1.48	True		ENSG00000100836	ENSG00000100836	HGNC:8565	14	23790682	23790711	23321473	23321502	GCN	10	11					
PLIN4_MRUPAV_33-mer	str	PLIN4	Expert Review Green;Literature;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	myopathy, distal, with rimmed vacuoles MONDO:0014945				32451610;37145156;36151849;35499779		False	3	100;0;0	1.48	True		ENSG00000167676	ENSG00000167676	HGNC:29393	19	4510975	4511073	4510963	4511061	ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC	31	39					
PPP2R2B_SCA12_CAG	str	PPP2R2B	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 12 MIM#604326				27864267;33811808;10581021		False	3	100;0;0	1.48	True		ENSG00000156475	ENSG00000156475	HGNC:9305	5	146258292	146258321	146878729	146878758	CAG	32	51					
PRNP_CJD_octapeptide	str	PRNP	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	1.48	True		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
RFC1_CANVAS_ANNGN	str	RFC1	Expert Review Green;Expert list;Expert list	Incidentalome			BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575				30926972;32851396;33237689;31230722;33237689;32694621;33103729;35355059		False	3	100;0;0	1.48	True		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	ANNGN	0	400					
RILPL1_OPDM4_CGG	str	RILPL1	Expert Review Green;Literature;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy MONDO:0025193				35148830;35700120		False	3	100;0;0	1.48	True		ENSG00000188026	ENSG00000188026	HGNC:26814	12	124018270	124018296	123533723	123533749	CGG	16	139					
TAF1_XDP_CCCTCT	str	TAF1	Expert Review Green;Expert list;Expert list	Incidentalome			X-LINKED: hemizygous mutation in males, biallelic mutations in females	Dystonia-Parkinsonism, X-linked MIM#314250				17273961;29229810		False	3	100;0;0	1.48	True		ENSG00000147133	ENSG00000147133	HGNC:11535	X	70672905	70672979	71453055	71453129	CCCTCT	13	30					
TBP_SCA17_CAG	str	TBP	Expert Review Green;Expert list;Expert list	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136				10484774;20301611;29325606		False	3	100;0;0	1.48	True		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
ZFHX3_SCA4_GGC	str	ZFHX3	Expert Review Green;Literature;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	spinocerebellar ataxia type 4 MONDO:0010847				38035881;38197134		False	3	100;0;0	1.48	True		ENSG00000140836	ENSG00000140836	HGNC:777	16	72821594	72821657	72787695	72787758	GGC	30	48					
EP400_SCA_CAG	str	EP400	Expert Review Amber;Literature;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia, EP400-related MONDO:0000437				10.1101/2025.01.06.631535		False	2	0;100;0	1.48	True		ENSG00000183495	ENSG00000183495	HGNC:11958	12	132547069	132547156	132062524	132062611	CAG	39	71					
TBC1D7_OPDM_CGG	str	TBC1D7	Expert Review Amber;Literature;Literature	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy, TBC1D7-related MONDO:0025193				41959811		False	2	0;100;0	1.48	True		ENSG00000145979	ENSG00000145979	HGNC:21066	6	13328708	13328835	13328476	13328603	CGG	60	83					
THAP11_SCA51_CAG	str	THAP11	Expert Review Amber;Other;Other	Incidentalome			MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 51 MONDO:0975800				15368101;24677642;34165550;38113319;40459937;39651830;37148549		False	2	0;100;0	1.48	True		ENSG00000168286	ENSG00000168286	HGNC:23194	16	67876766	67876853	67842863	67842950	CAG	39	47					
NIPA1_ALS_GCG	str	NIPA1	Expert Review Red;Literature;Literature	Incidentalome			Unknown	Amyotrophic lateral sclerosis				30342764;22378146		False	1	50;0;50	1.48	True		ENSG00000170113	ENSG00000170113	HGNC:17043	15	23086366	23086390	22786677	22786701	GCG	8	9					
