Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
DHODH	gene	DHODH	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BIALLELIC, autosomal or pseudoautosomal	Miller syndrome, MIM# 263750			Craniofacial dysostosis;HP:0004439	19915526;20220176;33262786;27370710		False	3	100;0;0	2.0	True		ENSG00000102967	ENSG00000102967	HGNC:2867													
EDNRA	gene	EDNRA	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mandibulofacial dysostosis with alopecia, MIM# 616367			Craniofacial dysostosis;HP:0004439	25772936;27671791		False	3	100;0;0	2.0	True		ENSG00000151617	ENSG00000151617	HGNC:3179													
EFTUD2	gene	EFTUD2	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mandibulofacial dysostosis, Guion-Almeida type, MIM# 610536;Mandibulofacial dysostosis-microcephaly syndrome MONDO:0012516			Craniofacial dysostosis;HP:0004439	22305528;23188108;33601405;33262786;26507355		False	3	100;0;0	2.0	True		ENSG00000108883	ENSG00000108883	HGNC:30858													
EIF4A3	gene	EIF4A3	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BIALLELIC, autosomal or pseudoautosomal	Robin sequence with cleft mandible and limb anomalies, MIM# 268305;Richieri-Costa-Pereira syndrome			Craniofacial dysostosis;HP:0004439	24360810		False	3	100;0;0	2.0	True		ENSG00000141543	ENSG00000141543	HGNC:18683													
EVC	gene	EVC	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Weyers acrofacial dysostosis, MIM# 193530;Ellis-van Creveld syndrome, MIM# 225500			Craniofacial dysostosis;HP:0004439	10700184;23220543		False	3	100;0;0	2.0	True		ENSG00000072840	ENSG00000072840	HGNC:3497													
EVC2	gene	EVC2	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Ellis-van Creveld syndrome, MIM# 225500;Weyers acrofacial dysostosis, MIM# 193530			Craniofacial dysostosis;HP:0004439	16404586;19810119		False	3	100;0;0	2.0	True		ENSG00000173040	ENSG00000173040	HGNC:19747													
FOXI3	gene	FOXI3	Expert Review Green;Literature	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Craniofacial microsomia 2, MIM# 620444			Craniofacial dysostosis;HP:0004439	36260083;37041148		False	3	100;0;0	2.0	True		ENSG00000214336	ENSG00000214336	HGNC:35123													
GNAI3	gene	GNAI3	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Auriculocondylar syndrome 1, OMIM #602483			Craniofacial dysostosis;HP:0004439	22560091		False	3	100;0;0	2.0	True		ENSG00000065135	ENSG00000065135	HGNC:4387													
GSC	gene	GSC	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BIALLELIC, autosomal or pseudoautosomal	Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities, MIM# 602471			Craniofacial dysostosis;HP:0004439	24290375		False	3	100;0;0	2.0	True		ENSG00000133937	ENSG00000133937	HGNC:4612													
MTX2	gene	MTX2	Expert Review Green;Literature	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BIALLELIC, autosomal or pseudoautosomal	Mandibuloacral dysplasia progeroid syndrome, MIM# 619127;Mandibuloacral dysplasia;lipodystrophy;arterial calcification			Craniofacial dysostosis;HP:0004439	32917887		False	3	100;0;0	2.0	True		ENSG00000128654	ENSG00000128654	HGNC:7506													
MYT1	gene	MYT1	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Craniofacial microsomia;OAV spectrum			Craniofacial dysostosis;HP:0004439	28612832;32871052;27358179		False	3	100;0;0	2.0	True		ENSG00000196132	ENSG00000196132	HGNC:7622													
PBX1	gene	PBX1	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, MIM# 617641			Craniofacial dysostosis;HP:0004439	28566479;29036646		False	3	100;0;0	2.0	True		ENSG00000185630	ENSG00000185630	HGNC:8632													
PLCB4	gene	PLCB4	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Auriculocondylar syndrome 2A, MIM# 614669;Auriculocondylar syndrome 2B, MIM# 620458			Craniofacial dysostosis;HP:0004439	22560091;23315542;33131036;32201334;28328130;27007857;23913798		False	3	100;0;0	2.0	True	Other	ENSG00000101333	ENSG00000101333	HGNC:9059													
POLD1	gene	POLD1	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome, MIM# 615381			Craniofacial dysostosis;HP:0004439	31629014;31449058;23770608;33618333;33369179;32826474;30023403;29199204;28791128		False	3	100;0;0	2.0	True		ENSG00000062822	ENSG00000062822	HGNC:9175													
POLR1A	gene	POLR1A	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Acrofacial dysostosis, Cincinnati type, MIM# 616462			Craniofacial dysostosis;HP:0004439	25913037		False	3	100;0;0	2.0	True		ENSG00000068654	ENSG00000068654	HGNC:17264													
POLR1B	gene	POLR1B	Expert Review Green;Literature	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Treacher-Collins syndrome type 4			Craniofacial dysostosis;HP:0004439	31649276		False	3	100;0;0	2.0	True		ENSG00000125630	ENSG00000125630	HGNC:20454													
POLR1C	gene	POLR1C	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BIALLELIC, autosomal or pseudoautosomal	Treacher Collins syndrome 3, MIM# 248390			Craniofacial dysostosis;HP:0004439	21131976;30957429		False	3	100;0;0	2.0	True		ENSG00000171453	ENSG00000171453	HGNC:20194													
POLR1D	gene	POLR1D	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Treacher Collins syndrome 2, MIM# 613717			Craniofacial dysostosis;HP:0004439	21131976;24603435;27448281;25790162		False	3	100;0;0	2.0	True		ENSG00000186184	ENSG00000186184	HGNC:20422													
PRRX1	gene	PRRX1	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Agnathia-otocephaly complex, MIM# 202650			Craniofacial dysostosis;HP:0004439	21294718;22211708;22674740;23444262		False	3	100;0;0	2.0	True		ENSG00000116132	ENSG00000116132	HGNC:9142													
RBM10	gene	RBM10	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	X-LINKED: hemizygous mutation in males, biallelic mutations in females	TARP syndrome, MIM# 311900			Craniofacial dysostosis;HP:0004439	20451169;24259342;30450804;30189253;33340101		False	3	100;0;0	2.0	True		ENSG00000182872	ENSG00000182872	HGNC:9896													
RPS28	gene	RPS28	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Diamond Blackfan anaemia 15 with mandibulofacial dysostosis, MIM# 606164			Craniofacial dysostosis;HP:0004439	24942156;40135709		False	3	100;0;0	2.0	True		ENSG00000233927	ENSG00000233927	HGNC:10418													
SF3B2	gene	SF3B2	Expert Review Green;Literature	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Craniofacial microsomia, MIM#164210			Craniofacial dysostosis;HP:0004439	34344887		False	3	100;0;0	2.0	True		ENSG00000087365	ENSG00000087365	HGNC:10769													
SF3B4	gene	SF3B4	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Acrofacial dysostosis 1, Nager type, MIM# 154400			Craniofacial dysostosis;HP:0004439	22541558;23568615;24003905		False	3	100;0;0	2.0	True		ENSG00000143368	ENSG00000143368	HGNC:10771													
SNRPB	gene	SNRPB	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebrocostomandibular syndrome, MIM# 117650			Craniofacial dysostosis;HP:0004439	25047197;25504470;26971886		False	3	100;0;0	2.0	True		ENSG00000125835	ENSG00000125835	HGNC:11153													
TCOF1	gene	TCOF1	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Treacher Collins syndrome 1, MIM# 154500			Craniofacial dysostosis;HP:0004439	12444270;15150774;21951868		False	3	100;0;0	2.0	True		ENSG00000070814	ENSG00000070814	HGNC:11654													
TMCO1	gene	TMCO1	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BIALLELIC, autosomal or pseudoautosomal	Craniofacial dysmorphism, skeletal anomalies, and mental retardation syndrome, MIM# 213980			Craniofacial dysostosis;HP:0004439	20018682;23320496;17351359;30556256;31102500		False	3	100;0;0	2.0	True		ENSG00000143183	ENSG00000143183	HGNC:18188													
TXNL4A	gene	TXNL4A	Expert Review Green;Victorian Clinical Genetics Services	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BIALLELIC, autosomal or pseudoautosomal	Burn-McKeown syndrome, MIM# 608572;Choanal atresia - deafness - cardiac defects - dysmorphism syndrome, MONDO:0012064			Craniofacial dysostosis;HP:0004439	25434003		False	3	100;0;0	2.0	True		ENSG00000141759	ENSG00000141759	HGNC:30551													
VGLL2	gene	VGLL2	Expert Review Green;Other	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BIALLELIC, autosomal or pseudoautosomal	Syngnathia, MONDO:0015409, VGLL2-related			Craniofacial dysostosis;HP:0004439			False	3	100;0;0	2.0	True		ENSG00000170162	ENSG00000170162	HGNC:20232													
EIF4A3_RCPS_complex	str	EIF4A3	Expert Review Green;Expert list	Mandibulofacial Acrofacial dysostosis		Dysmorphic and congenital abnormality syndromes	BIALLELIC, autosomal or pseudoautosomal	Robin sequence with cleft mandible and limb anomalies MIM#268305;Richieri-Costa-Pereira syndrome			Craniofacial dysostosis;HP:0004439	24360810;29112243		False	3	100;0;0	2.0	True		ENSG00000141543	ENSG00000141543	HGNC:18683	17	78120803	78120938	80147004	80147139	TCGGCAGCGGCGCAGCGAGG	21	14					
