Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
AAAS	gene	AAAS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Achalasia-addisonianism-alacrimia syndrome, MIM#231550			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000094914	ENSG00000094914	HGNC:13666													
AARS1	gene	AARS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 29, MIM# 616339			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28493438;25817015		False	3	100;0;0	2.156	True		ENSG00000090861	ENSG00000090861	HGNC:20													
ABAT	gene	ABAT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GABA-transaminase deficiency, MIM#613163			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10407778;20052547;27596361;28411234,		False	3	0;0;0	2.156	True		ENSG00000183044	ENSG00000183044	HGNC:23													
ABCA2	gene	ABCA2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with poor growth and with or without seizures or ataxia, 618808			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30237576;29302074;31047799		False	3	100;0;0	2.156	True		ENSG00000107331	ENSG00000107331	HGNC:32													
ABCC9	gene	ABCC9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual disability and myopathy syndrome, MIM# 619719;Hypertrichotic osteochondrodysplasia, MIM# 239850 Cantu syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000069431	ENSG00000069431	HGNC:60													
ABCD1	gene	ABCD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Adrenoleukodystrophy, MIM# 300100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000101986	ENSG00000101986	HGNC:61													
ABCD4	gene	ABCD4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria and homocystinuria, cblJ type, MIM# 614857			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22922874;31113616;30651581;28572511;33729671		False	3	100;0;0	2.156	True		ENSG00000119688	ENSG00000119688	HGNC:68													
ABHD16A	gene	ABHD16A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34587489		False	3	100;0;0	2.156	True		ENSG00000204427	ENSG00000204427	HGNC:13921													
ABHD5	gene	ABHD5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chanarin-Dorfman syndrome MIM#275630;neutral lipid storage disease with ichthyosis;non-bullous congenital ichthyosiform erythroderma			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30795549		False	3	100;0;0	2.156	True		ENSG00000011198	ENSG00000011198	HGNC:21396													
ACAD9	gene	ACAD9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 20 MIM#611126			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30025539		False	3	100;0;0	2.156	True		ENSG00000177646	ENSG00000177646	HGNC:21497													
ACADM	gene	ACADM	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acyl-CoA dehydrogenase, medium chain, deficiency of, MIM# 201450			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000117054	ENSG00000117054	HGNC:89													
ACBD6	gene	ACBD6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36457943;21937992;35446914		False	3	100;0;0	2.156	True		ENSG00000230124	ENSG00000230124	HGNC:23339													
ACO2	gene	ACO2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile cerebellar-retinal degeneration, MIM#614559			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22405087;25351951;30689204;32519519;25351951		False	3	100;0;0	2.156	True		ENSG00000100412	ENSG00000100412	HGNC:118													
ACOX1	gene	ACOX1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470;Mitchell syndrome, MIM# 618960			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32169171;17458872		False	3	100;0;0	2.156	True		ENSG00000161533	ENSG00000161533	HGNC:119													
ACSL4	gene	ACSL4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mental retardation, X-linked 63, MIM# 300387 XLD			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11889465;12525535		False	3	100;0;0	2.156	True		ENSG00000068366	ENSG00000068366	HGNC:3571													
ACTB	gene	ACTB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Baraitser-Winter syndrome 1, MIM# 243310;Thrombocytopenia 8, with dysmorphic features and developmental delay, MIM# 620475;ACTB-related neurodevelopment disorder			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29220674		False	3	100;0;0	2.156	True		ENSG00000075624	ENSG00000075624	HGNC:132													
ACTG1	gene	ACTG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Baraitser-Winter syndrome 2, MIM#614583			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000184009	ENSG00000184009	HGNC:144													
ACTL6A	gene	ACTL6A	Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ACTL6A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28649782		False	3	100;0;0	2.156	True		ENSG00000136518	ENSG00000136518	HGNC:24124													
ACTL6B	gene	ACTL6B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 76, MIM#	618468;Intellectual developmental disorder with severe speech and ambulation defects, MIM#	618470"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31134736;31031012;30656450;30237576		False	3	100;0;0	2.156	True		ENSG00000077080	ENSG00000077080	HGNC:160													
ACY1	gene	ACY1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aminoacylase 1 deficiency, MIM# 609924			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16274666;16465618;17562838;24117009		False	3	100;0;0	2.156	True		ENSG00000243989	ENSG00000243989	HGNC:177													
ADAM22	gene	ADAM22	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 61 (MIM#617933)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27066583;30237576		False	3	50;50;0	2.156	True		ENSG00000008277	ENSG00000008277	HGNC:201													
ADAMTS10	gene	ADAMTS10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Weill-Marchesani syndrome 1, recessive, MIM#277600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000142303	ENSG00000142303	HGNC:13201													
ADAR	gene	ADAR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 6, MIM# 615010			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000160710	ENSG00000160710	HGNC:225													
ADARB1	gene	ADARB1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862;Intellectual disability;microcephaly;seizures			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32220291;32719099		False	3	100;0;0	2.156	True		ENSG00000197381	ENSG00000197381	HGNC:226													
ADAT3	gene	ADAT3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 36, MIM#615286			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23620220;26842963;29796286		False	3	100;0;0	2.156	True		ENSG00000213638	ENSG00000213638	HGNC:25151													
ADD3	gene	ADD3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral palsy, spastic quadriplegic, 3, MIM#617008			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29768408;23836506		False	3	100;0;0	2.156	True		ENSG00000148700	ENSG00000148700	HGNC:245													
ADGRG1	gene	ADGRG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polymicrogyria, bilateral frontoparietal, MIM# 606854			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16240336		False	3	100;0;0	2.156	True		ENSG00000205336	ENSG00000205336	HGNC:4512													
ADGRL1	gene	ADGRL1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay, behavioral abnormalities, and neuropsychiatric disorders, MIM# 620065			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35907405		False	3	100;0;0	2.156	True		ENSG00000072071	ENSG00000072071	HGNC:20973													
ADK	gene	ADK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermethioninemia due to adenosine kinase deficiency, MIM# 614300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21963049;17120046		False	3	100;0;0	2.156	True		ENSG00000156110	ENSG00000156110	HGNC:257													
ADNP	gene	ADNP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Helsmoortel-van der Aa syndrome MIM#615873;MONDO:0014379			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24531329;25057125;25533962;29724491;29911927		False	3	100;0;0	2.156	True		ENSG00000101126	ENSG00000101126	HGNC:15766													
ADSL	gene	ADSL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adenylosuccinase deficiency, MIM# 103050			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000239900	ENSG00000239900	HGNC:291													
AFF2	gene	AFF2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual disability, X-linked, FRAXE type 309548			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8334699;21739600;22773736		False	3	100;0;0	2.156	True		ENSG00000155966	ENSG00000155966	HGNC:3776													
AFF3	gene	AFF3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	KINSSHIP syndrome, MIM# 619297;Neurodevelopmental disorder, MONDO:0700092, AFF3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31388108;33961779;38811945		False	3	100;0;0	2.156	True		ENSG00000144218	ENSG00000144218	HGNC:6473													
AFF4	gene	AFF4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CHOPS syndrome, MIM#616368;MONDO:0014609			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25730767;33248856;31630891;31058441		False	3	100;0;0	2.156	True	Other	ENSG00000072364	ENSG00000072364	HGNC:17869													
AFG2A	gene	AFG2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hearing loss, seizures, and brain abnormalities  MIM#616577			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30009132;29343804		False	3	100;0;0	2.156	True		ENSG00000145375	ENSG00000145375	HGNC:18119													
AFG2B	gene	AFG2B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34626583		False	3	100;0;0	2.156	True		ENSG00000171763	ENSG00000171763	HGNC:28762													
AGA	gene	AGA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aspartylglucosaminuria, MIM#208400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000038002	ENSG00000038002	HGNC:318													
AGMO	gene	AGMO	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, AGMO-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31555905;27000257		False	3	100;0;0	2.156	True		ENSG00000187546	ENSG00000187546	HGNC:33784													
AGO1	gene	AGO1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with language delay and behavioral abnormalities, with or without seizures, MIM# 620292			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30213762;22495306;23020937;25363768;25356899;27620904;29346770;28135719		False	3	100;0;0	2.156	True		ENSG00000092847	ENSG00000092847	HGNC:3262													
AGO2	gene	AGO2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lessel-Kreienkamp syndrome (LESKRES), MIM#619149;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33199684		False	3	100;0;0	2.156	True		ENSG00000123908	ENSG00000123908	HGNC:3263													
AGTPBP1	gene	AGTPBP1	Expert Review Green;NHS GMS	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30420557, 28600779, 30976113, 38153683, 28325758		False	3	100;0;0	2.156	True		ENSG00000135049	ENSG00000135049	HGNC:17258													
AHCY	gene	AHCY	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase, MIM#613752			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31957987;27671891;30121674;28779239		False	3	100;0;0	2.156	True		ENSG00000101444	ENSG00000101444	HGNC:343													
AHDC1	gene	AHDC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Xia-Gibbs syndrome, MIM# 615829;AHDC1-related intellectual disability, obstructive sleep apnoea, mild dysmorphism syndrome MONDO:0014358			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24791903;27148574;30152016		False	3	100;0;0	2.156	True		ENSG00000126705	ENSG00000126705	HGNC:25230													
AHI1	gene	AHI1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert Syndrome 3 OMIM #608629			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15322546;16453322;21937992		False	3	100;0;0	2.156	True		ENSG00000135541	ENSG00000135541	HGNC:21575													
AIFM1	gene	AIFM1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Combined oxidative phosphorylation deficiency 6, 300816;Cowchock syndrome, 310490;Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000156709	ENSG00000156709	HGNC:8768													
AIMP1	gene	AIMP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;Leukodystrophy, hypomyelinating, 3, MIM# 260600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26173967;21092922;24958424;33402283;32531460;30486714;30477741		False	3	100;0;0	2.156	True		ENSG00000164022	ENSG00000164022	HGNC:10648													
AIRIM	gene	AIRIM	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, C1orf109-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40760247		False	3	100;0;0	2.156	True		ENSG00000116922	ENSG00000116922	HGNC:26039													
AJAP1	gene	AJAP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, MONDO:0700092, AJAP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38985877		False	3	100;0;0	2.156	True		ENSG00000196581	ENSG00000196581	HGNC:30801													
AKT3	gene	AKT3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2, MIM# 615937			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22729224;22729223;35665751;34354878;32446860;31441589		False	3	100;0;0	2.156	True		ENSG00000117020	ENSG00000117020	HGNC:393													
ALDH18A1	gene	ALDH18A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 9B, autosomal recessive, MIM# 616586			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000059573	ENSG00000059573	HGNC:9722													
ALDH3A2	gene	ALDH3A2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sjogren-Larsson syndrome MIM#270200;spasticity;ichthyosis;intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31273323		False	3	100;0;0	2.156	True		ENSG00000072210	ENSG00000072210	HGNC:403													
ALDH4A1	gene	ALDH4A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperprolinemia, type II MIM#239510;disorders of ornithine or proline metabolism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9700195;34037900;31884946		False	3	100;0;0	2.156	True		ENSG00000159423	ENSG00000159423	HGNC:406													
ALDH5A1	gene	ALDH5A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinic semialdehyde dehydrogenase deficiency, MIM# 271980			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	14635103		False	3	100;0;0	2.156	True		ENSG00000112294	ENSG00000112294	HGNC:408													
ALDH7A1	gene	ALDH7A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, pyridoxine-dependent, MIM# 266100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33200442		False	3	100;0;0	2.156	True		ENSG00000164904	ENSG00000164904	HGNC:877													
ALG1	gene	ALG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ik, MIM# 608540			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26931382		False	3	100;0;0	2.156	True		ENSG00000033011	ENSG00000033011	HGNC:18294													
ALG11	gene	ALG11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ip, MIM# 613661			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30676690		False	3	100;0;0	2.156	True		ENSG00000253710	ENSG00000253710	HGNC:32456													
ALG12	gene	ALG12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ig, MIM# 607143			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31481313		False	3	100;0;0	2.156	True		ENSG00000182858	ENSG00000182858	HGNC:19358													
ALG13	gene	ALG13	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Congenital disorder of glycosylation, type Is (MIM# 300884)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23033978;23934111;24781210;24896178;25732998;26138355;26482601;28940310;32238909		False	3	100;0;0	2.156	True		ENSG00000101901	ENSG00000101901	HGNC:30881													
ALG14	gene	ALG14	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual  developmental disorder with epilepsy, behavioral abnormalities, and coarse facies (IDDEBF), MIM#619031;Myopathy, epilepsy, and progressive cerebral atrophy, MIM# 619036			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30221345, 23404334, 28733338, 33751823, 34971077		False	3	100;0;0	2.156	True		ENSG00000172339	ENSG00000172339	HGNC:28287													
ALG2	gene	ALG2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenic syndrome, congenital, 14, with tubular aggregates, MIM# 616228;Congenital disorder of glycosylation, type Ii, MIM# 607906			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	50;0;50	2.156	True		ENSG00000119523	ENSG00000119523	HGNC:23159													
ALG3	gene	ALG3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Id, MIM# 601110			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31067009		False	3	100;0;0	2.156	True		ENSG00000214160	ENSG00000214160	HGNC:23056													
ALG6	gene	ALG6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ic (MIM#603147)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10914684;27498540		False	3	100;0;0	2.156	True		ENSG00000088035	ENSG00000088035	HGNC:23157													
ALG8	gene	ALG8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ih, MIM# 608104			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26066342;35716054		False	3	100;0;0	2.156	True		ENSG00000159063	ENSG00000159063	HGNC:23161													
ALG9	gene	ALG9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Il, MIM#608776			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28932688		False	3	100;0;0	2.156	True		ENSG00000086848	ENSG00000086848	HGNC:15672													
ALKBH8	gene	ALKBH8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 71, MIM#618504			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31079898		False	3	100;0;0	2.156	True		ENSG00000137760	ENSG00000137760	HGNC:25189													
ALMS1	gene	ALMS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alstrom syndrome, MIM# 203800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27142762;25846608;18154657;25296579;17146208;17940554;22043170;31889847;2231654;8418611;8181924;8556827;9663233;25864795;8556827;11941369		False	3	50;0;50	2.156	True		ENSG00000116127	ENSG00000116127	HGNC:428													
AMER1	gene	AMER1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Osteopathia striata with cranial sclerosis, OMIM:300373			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19079258;22987541;23401208;28497491;32879452;35186393;20950377;22043478		False	3	100;0;0	2.156	True		ENSG00000184675	ENSG00000184675	HGNC:26837													
AMOTL1	gene	AMOTL1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Craniofaciocardiohepatic syndrome, MIM# 621192			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36751037		False	3	100;0;0	2.156	True		ENSG00000166025	ENSG00000166025	HGNC:17811													
AMPD2	gene	AMPD2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 9, MIM#615809			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23911318;27066553		False	3	100;0;0	2.156	True		ENSG00000116337	ENSG00000116337	HGNC:469													
AMT	gene	AMT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycine encephalopathy MIM#605899			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000145020	ENSG00000145020	HGNC:473													
ANK2	gene	ANK2	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Complex neurodevelopmental disorder, MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22542183;25363768;27479843;28554332;30564305;30755392;31981491;33004838;33057194		False	3	100;0;0	2.156	True		ENSG00000145362	ENSG00000145362	HGNC:493													
ANK3	gene	ANK3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mental retardation, autosomal recessive, 37 615493;Intellectual disability, autosomal dominant			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23390136;28687526		False	3	100;0;0	2.156	True		ENSG00000151150	ENSG00000151150	HGNC:494													
ANKRD11	gene	ANKRD11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	KBG syndrome, MIM # 148050			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000167522	ENSG00000167522	HGNC:21316													
ANKRD17	gene	ANKRD17	Expert Review Green;Research	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chopra-Amiel-Gordan syndrome, MIM# 619504;Intellectual disability;dysmorphic features			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33909992		False	3	50;50;0	2.156	True		ENSG00000132466	ENSG00000132466	HGNC:23575													
ANKS1B	gene	ANKS1B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092 ANKS1B related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31388001;38129387		False	3	100;0;0	2.156	True		ENSG00000185046	ENSG00000185046	HGNC:24600													
ANO4	gene	ANO4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, ANO4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38744284		False	3	100;0;0	2.156	True		ENSG00000151572	ENSG00000151572	HGNC:23837													
AP1B1	gene	AP1B1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;enteropathy;deafness;ichthyosis;keratoderma			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31630788;31630791		False	3	100;0;0	2.156	True		ENSG00000100280	ENSG00000100280	HGNC:554													
AP1G1	gene	AP1G1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Usmani-Riazuddin syndrome, autosomal dominant, MIM# 619467;Usmani-Riazuddin syndrome, autosomal recessive, MIM# 619548;Neurodevelopmental disorder (NDD);Intellectual Disability;Epilepsy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34102099		False	3	100;0;0	2.156	True		ENSG00000166747	ENSG00000166747	HGNC:555													
AP1S1	gene	AP1S1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	MEDNIK syndrome, MIM# 609313			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30244301;24754424;19057675;23423674		False	3	100;0;0	2.156	True		ENSG00000106367	ENSG00000106367	HGNC:559													
AP1S2	gene	AP1S2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Pettigrew syndrome, MIM# 304340			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17186471;17617514;19377476;30714330;23756445		False	3	100;0;0	2.156	True		ENSG00000182287	ENSG00000182287	HGNC:560													
AP2M1	gene	AP2M1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder 60 with seizures, MIM#	618587"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31104773		False	3	100;0;0	2.156	True		ENSG00000161203	ENSG00000161203	HGNC:564													
AP2S1	gene	AP2S1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, AP2S1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31981491;33057194;35982160;35982159		False	3	50;50;0	2.156	True		ENSG00000042753	ENSG00000042753	HGNC:565													
AP3B1	gene	AP3B1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hermansky-Pudlak syndrome 2, MIM# 608233;MONDO:0011997			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10024875;11809908;14566336		False	3	100;0;0	2.156	True		ENSG00000132842	ENSG00000132842	HGNC:566													
AP3B2	gene	AP3B2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Early-onset epileptic encephalopathy with optic atrophy, MIM#617276			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27889060		False	3	100;0;0	2.156	True		ENSG00000103723	ENSG00000103723	HGNC:567													
AP4B1	gene	AP4B1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 47, autosomal recessive, MIM# 614066			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21620353;22290197;24700674;24781758;32979048;32171285;32166732;31525725;31525725		False	3	100;0;0	2.156	True		ENSG00000134262	ENSG00000134262	HGNC:572													
AP4E1	gene	AP4E1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 51, autosomal recessive, MIM# 613744			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20972249;21620353;21937992		False	3	100;0;0	2.156	True		ENSG00000081014	ENSG00000081014	HGNC:573													
AP4M1	gene	AP4M1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 50, autosomal recessive, MIM# 612936			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19559397;21937992;21937992;32979048;31915823;29096665;28464862;25496299		False	3	100;0;0	2.156	True		ENSG00000221838	ENSG00000221838	HGNC:574													
AP4S1	gene	AP4S1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 52, autosomal recessive, MIM# 614067			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21620353;25552650;32979048;32216065;31915823;30283821;27444738		False	3	100;0;0	2.156	True		ENSG00000100478	ENSG00000100478	HGNC:575													
APC2	gene	APC2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia, complex, with other brain malformations 10, MIM#618677			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31585108		False	3	100;0;0	2.156	True		ENSG00000115266	ENSG00000115266	HGNC:24036													
ARCN1	gene	ARCN1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Short stature, rhizomelic, with microcephaly, micrognathia, and developmental delay (MIM#617164)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27476655;33154040;35300924		False	3	100;0;0	2.156	True		ENSG00000095139	ENSG00000095139	HGNC:649													
ARF1	gene	ARF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Periventricular nodular heterotopia 8, MIM# 618185			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28868155;34353862		False	3	100;0;0	2.156	True		ENSG00000143761	ENSG00000143761	HGNC:652													
ARF3	gene	ARF3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO:0700092), ARF3-related;Global developmental delay;Intellectual disability;Seizures;Morphological abnormality of the central nervous system			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34346499;36369169		False	3	50;50;0	2.156	True		ENSG00000134287	ENSG00000134287	HGNC:654													
ARFGEF1	gene	ARFGEF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay, impaired speech, and behavioral abnormalities, MIM# 619964			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34113008		False	3	100;0;0	2.156	True		ENSG00000066777	ENSG00000066777	HGNC:15772													
ARFGEF2	gene	ARFGEF2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Periventricular heterotopia with microcephaly (MIM#608097)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25160555;26126837;23812912		False	3	100;0;0	2.156	True		ENSG00000124198	ENSG00000124198	HGNC:15853													
ARG1	gene	ARG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Argininaemia MIM#207800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000118520	ENSG00000118520	HGNC:663													
ARHGAP35	gene	ARHGAP35	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, ARHGAP35-related MONDO#0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194		False	3	50;50;0	2.156	True		ENSG00000160007	ENSG00000160007	HGNC:4591													
ARHGEF9	gene	ARHGEF9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Developmental and epileptic encephalopathy 8, MIM# 300607			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31942680;30048823;29130122;28620718;33600053;32939676		False	3	100;0;0	2.156	True		ENSG00000131089	ENSG00000131089	HGNC:14561													
ARID1A	gene	ARID1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 2 (MIM#614607)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23929686;22426308;25168959		False	3	100;0;0	2.156	True		ENSG00000117713	ENSG00000117713	HGNC:11110													
ARID1B	gene	ARID1B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 1, MIM 135900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25674384;30349098;26506440		False	3	100;0;0	2.156	True		ENSG00000049618	ENSG00000049618	HGNC:18040													
ARID2	gene	ARID2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Coffin-Siris syndrome 6, MIM#	617808"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26238514;30838730;29698805;28884947;28124119		False	3	100;0;0	2.156	True		ENSG00000189079	ENSG00000189079	HGNC:18037													
ARL13B	gene	ARL13B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 8, MIM# 612291			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18674751;25138100;26092869;27894351;29255182;17488627		False	3	100;0;0	2.156	True		ENSG00000169379	ENSG00000169379	HGNC:25419													
ARL6	gene	ARL6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 3, MIM# 600151			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15258860;32361989;31888296;25402481		False	3	100;0;0	2.156	True		ENSG00000113966	ENSG00000113966	HGNC:13210													
ARMC9	gene	ARMC9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 30, MIM# 617622			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28625504		False	3	100;0;0	2.156	True		ENSG00000135931	ENSG00000135931	HGNC:20730													
ARPC4	gene	ARPC4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay, language impairment, and ocular abnormalities, MIM# 620141			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35047857		False	3	100;0;0	2.156	True		ENSG00000241553	ENSG00000241553	HGNC:707													
ARSA	gene	ARSA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy, MIM# 250100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARSB	gene	ARSB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type VI (Maroteaux-Lamy), MIM# 253200;MONDO:0009661			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11668612		False	3	100;0;0	2.156	True		ENSG00000113273	ENSG00000113273	HGNC:714													
ARSL	gene	ARSL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Chondrodysplasia punctata, X-linked recessive, MIM# 302950			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301713		False	3	100;0;0	2.156	True		ENSG00000157399	ENSG00000157399	HGNC:719													
ARV1	gene	ARV1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 38, MIM# 617020			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35227294;27270415;25558065		False	3	100;0;0	2.156	True		ENSG00000173409	ENSG00000173409	HGNC:29561													
ARX	gene	ARX	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Lissencephaly, X-linked 2, MIM# 300215			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000004848	ENSG00000004848	HGNC:18060													
ASAH1	gene	ASAH1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Farber lipogranulomatosis MIM #228000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32875576		False	3	100;0;0	2.156	True		ENSG00000104763	ENSG00000104763	HGNC:735													
ASCC3	gene	ASCC3	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 81, MIM# 620700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21937992;35047834		False	3	100;0;0	2.156	True		ENSG00000112249	ENSG00000112249	HGNC:18697													
ASH1L	gene	ASH1L	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 52, MIM#617796			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23033978;25961944;28394464;28191889;27824329		False	3	100;0;0	2.156	True		ENSG00000116539	ENSG00000116539	HGNC:19088													
ASL	gene	ASL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Argininosuccinic aciduria, MIM#207900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000126522	ENSG00000126522	HGNC:746													
ASNS	gene	ASNS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Asparagine synthetase deficiency, MIM#615574			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000070669	ENSG00000070669	HGNC:753													
ASPA	gene	ASPA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Canavan disease MIM#271900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000108381	ENSG00000108381	HGNC:756													
ASPM	gene	ASPM	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 5, primary, autosomal recessive, MIM#608716			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29243349;19028728		False	3	100;0;0	2.156	True		ENSG00000066279	ENSG00000066279	HGNC:19048													
ASS1	gene	ASS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Citrullinemia MIM#215700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000130707	ENSG00000130707	HGNC:758													
ASTN1	gene	ASTN1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), ASTN1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29706646;27431290;26539891;41544630		False	3	100;0;0	2.156	True		ENSG00000152092	ENSG00000152092	HGNC:773													
ASXL1	gene	ASXL1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bohring-Opitz syndrome , MIM#605039			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29446906;21706002		False	3	100;0;0	2.156	True		ENSG00000171456	ENSG00000171456	HGNC:18318													
ASXL2	gene	ASXL2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Shashi-Pena syndrome, MIM# 617190			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27693232;33751773		False	3	100;0;0	2.156	True		ENSG00000143970	ENSG00000143970	HGNC:23805													
ASXL3	gene	ASXL3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bainbridge-Ropers syndrome (OMIM # 615485)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28100473;27901041;23383720		False	3	100;0;0	2.156	True		ENSG00000141431	ENSG00000141431	HGNC:29357													
ATAD1	gene	ATAD1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperekplexia 4, MIM#618011			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28180185		False	3	100;0;0	2.156	True		ENSG00000138138	ENSG00000138138	HGNC:25903													
ATAD3A	gene	ATAD3A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Harel-Yoon syndrome, MIM# 617183;Pontocerebellar hypoplasia, hypotonia, and respiratory insufficiency syndrome, neonatal lethal (PHRINL SYNDROME) 618810			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27640307;32004445;28549128		False	3	100;0;0	2.156	True	Other	ENSG00000197785	ENSG00000197785	HGNC:25567													
ATG12	gene	ATG12	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	ATG12-related neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41895291		False	3	100;0;0	2.156	True		ENSG00000145782	ENSG00000145782	HGNC:588													
ATG4D	gene	ATG4D	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, ATG4D-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36765070		False	3	100;0;0	2.156	True		ENSG00000130734	ENSG00000130734	HGNC:20789													
ATG7	gene	ATG7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, SCAR31, MIM#619422			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34161705		False	3	100;0;0	2.156	True		ENSG00000197548	ENSG00000197548	HGNC:16935													
ATIC	gene	ATIC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	AICA-ribosiduria due to ATIC deficiency, MIM# 608688			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15114530;32557644		False	3	100;0;0	2.156	True		ENSG00000138363	ENSG00000138363	HGNC:794													
ATN1	gene	ATN1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital hypotonia, epilepsy, developmental delay, and digital anomalies, MIM#618494			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30827498		False	3	100;0;0	2.156	True		ENSG00000111676	ENSG00000111676	HGNC:3033													
ATP1A1	gene	ATP1A1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;seizures;hypomagnesaemia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30388404		False	3	100;0;0	2.156	True		ENSG00000163399	ENSG00000163399	HGNC:799													
ATP1A2	gene	ATP1A2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alternating hemiplegia of childhood 1, MIM# 104290;Developmental and epileptic encephalopathy 98, MIM# 619605			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33880529		False	3	100;0;0	2.156	True		ENSG00000018625	ENSG00000018625	HGNC:800													
ATP1A3	gene	ATP1A3	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33880529, 15260953, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	2.156	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP2B1	gene	ATP2B1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 66, MIM# 619910			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35358416		False	3	100;0;0	2.156	True		ENSG00000070961	ENSG00000070961	HGNC:814													
ATP2B2	gene	ATP2B2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37675773		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000157087	ENSG00000157087	HGNC:815													
ATP2B3	gene	ATP2B3	Expert Review Green;GeneReviews;Genetic Health Queensland;Royal Melbourne Hospital	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Spinocerebellar ataxia, X-linked 1, MIM#302500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22912398;27653636		False	3	50;0;50	2.156	True		ENSG00000067842	ENSG00000067842	HGNC:816													
ATP5F1A	gene	ATP5F1A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34483339;34954817;40859057		False	3	100;0;0	2.156	True		ENSG00000152234	ENSG00000152234	HGNC:823													
ATP5PO	gene	ATP5PO	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 7, MIM# 620359			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35621276;34954817		False	3	100;0;0	2.156	True		ENSG00000241837	ENSG00000241837	HGNC:850													
ATP6AP1	gene	ATP6AP1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Immunodeficiency 47, MIM#300972			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27231034		False	3	100;0;0	2.156	True		ENSG00000071553	ENSG00000071553	HGNC:868													
ATP6AP2	gene	ATP6AP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Congenital disorder of glycosylation, type IIr MIM#301045 Intellectual developmental disorder, X-linked, syndromic, Hedera type MIM#300423			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000182220	ENSG00000182220	HGNC:18305													
ATP6V0A1	gene	ATP6V0A1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30842224;33057194;34909687		False	3	50;50;0	2.156	True		ENSG00000033627	ENSG00000033627	HGNC:865													
ATP6V0A2	gene	ATP6V0A2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cutis laxa, autosomal recessive, type IIA, MIM# 219200;Wrinkly skin syndrome, MIM#278250			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000185344	ENSG00000185344	HGNC:18481													
ATP6V0C	gene	ATP6V0C	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, early-onset, with or without developmental delay, MIM#620465;Epilepsy;Intellectual Disability;microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33190975;33090716		False	3	50;50;0	2.156	True		ENSG00000185883	ENSG00000185883	HGNC:855													
ATP6V1A	gene	ATP6V1A	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epileptic encephalopathy, infantile or early childhood, 3 618012;Cutis laxa, autosomal recessive, type IID 617403			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29668857;28065471		False	3	100;0;0	2.156	True	Other	ENSG00000114573	ENSG00000114573	HGNC:851													
ATP6V1B2	gene	ATP6V1B2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Zimmermann-Laband syndrome 2, MIM# 616455			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000147416	ENSG00000147416	HGNC:854													
ATP7A	gene	ATP7A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Menkes disease MIM#309400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000165240	ENSG00000165240	HGNC:869													
ATP8A2	gene	ATP8A2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22892528;31612321		False	3	0;0;0	2.156	True		ENSG00000132932	ENSG00000132932	HGNC:13533													
ATP9A	gene	ATP9A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with poor growth and behavioural abnormalities, MIM# 620242			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34379057;34764295;36604604;40226306		False	3	100;0;0	2.156	True		ENSG00000054793	ENSG00000054793	HGNC:13540													
ATR	gene	ATR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seckel syndrome 1, MIM# 210600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000175054	ENSG00000175054	HGNC:882													
ATRX	gene	ATRX	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	ATR-X-related syndrome MONDO:0016980			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000085224	ENSG00000085224	HGNC:886													
ATXN7L3	gene	ATXN7L3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Harel-Tora neurodevelopmental syndrome, MIM# 621377			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38753057		False	3	100;0;0	2.156	True		ENSG00000087152	ENSG00000087152	HGNC:25416													
AUH	gene	AUH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type I, MIM# 250950			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000148090	ENSG00000148090	HGNC:890													
AUTS2	gene	AUTS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 26, MIM# 615834			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23332918;25205402;31474318;39953909		False	3	100;0;0	2.156	True		ENSG00000158321	ENSG00000158321	HGNC:14262													
AXIN1	gene	AXIN1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Craniometadiaphyseal osteosclerosis with hip dysplasia, MIM# 620558			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37582359		False	3	100;0;0	2.156	True		ENSG00000103126	ENSG00000103126	HGNC:903													
B3GALNT2	gene	B3GALNT2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181;MONDO:0014071			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23453667;33290285;29791932;29273094;28688748;28303321		False	3	100;0;0	2.156	True		ENSG00000162885	ENSG00000162885	HGNC:28596													
B3GLCT	gene	B3GLCT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peters Plus Syndrome (MIM 261540);Peters anomaly;Growth retardation;Brachydactyly;ID			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301637;16909395;17032646;18199743;25544610		False	3	100;0;0	2.156	True		ENSG00000187676	ENSG00000187676	HGNC:20207													
B4GALNT1	gene	B4GALNT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 26, autosomal recessive (MIM #609195)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000135454	ENSG00000135454	HGNC:4117													
B4GALT1	gene	B4GALT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Iid, MIM#607091			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11901181;30653653;21920538		False	3	100;0;0	2.156	True		ENSG00000086062	ENSG00000086062	HGNC:924													
B4GALT7	gene	B4GALT7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ehlers-Danlos syndrome, spondylodysplastic type, 1, MIM# 130070			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23956117;24755949;31278392;31614862;31862401		False	3	0;100;0	2.156	True		ENSG00000027847	ENSG00000027847	HGNC:930													
B9D1	gene	B9D1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ciliopathy, MONDO:0005308, B9D1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24886560;21493627;40565534;40933483		False	3	50;50;0	2.156	True		ENSG00000108641	ENSG00000108641	HGNC:24123													
B9D2	gene	B9D2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 34, MIM#614175;Meckel syndrome 10, MIM#614175			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26092869;21763481		False	3	100;0;0	2.156	True		ENSG00000123810	ENSG00000123810	HGNC:28636													
BAIAP2	gene	BAIAP2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 120, MIM# 621468			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41133935;38149472		False	3	100;0;0	2.156	True		ENSG00000175866	ENSG00000175866	HGNC:947													
BAP1	gene	BAP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Kury-Isidor syndrome	, MIM#619762"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35051358		False	3	100;0;0	2.156	True		ENSG00000163930	ENSG00000163930	HGNC:950													
BBIP1	gene	BBIP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 18, MIM#615995			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24026985;32055034;37239474		False	3	100;0;0	2.156	True		ENSG00000214413	ENSG00000214413	HGNC:28093													
BBS1	gene	BBS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 1 MONDO:0008854			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12118255;12677556;12567324		False	3	100;0;0	2.156	True		ENSG00000174483	ENSG00000174483	HGNC:966													
BBS10	gene	BBS10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 10 MONDO:0014438			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16582908;20805367;27245532		False	3	100;0;0	2.156	True		ENSG00000179941	ENSG00000179941	HGNC:26291													
BBS12	gene	BBS12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 12 MONDO:0014440			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17160889;20827784		False	3	100;0;0	2.156	True		ENSG00000181004	ENSG00000181004	HGNC:26648													
BBS2	gene	BBS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 2 MONDO:0014432			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11285252;11567139		False	3	100;0;0	2.156	True		ENSG00000125124	ENSG00000125124	HGNC:967													
BBS4	gene	BBS4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 4, MIM#615982;MONDO:0014433			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12016587;11381270		False	3	100;0;0	2.156	True		ENSG00000140463	ENSG00000140463	HGNC:969													
BBS5	gene	BBS5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 5, MIM#615983;MONDO:0014434			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19252258;15137946;10053027;15637713		False	3	100;0;0	2.156	True		ENSG00000163093	ENSG00000163093	HGNC:970													
BBS7	gene	BBS7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 7, MIM# 615984;MONDO:0014435			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12567324;21937992;19797195		False	3	100;0;0	2.156	True		ENSG00000138686	ENSG00000138686	HGNC:18758													
BBS9	gene	BBS9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 9, MIM#615986;MONDO:0014437			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16380913;22353939;32686083;32037757		False	3	100;0;0	2.156	True		ENSG00000122507	ENSG00000122507	HGNC:30000													
BCAP31	gene	BCAP31	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Deafness, dystonia, and cerebral hypomyelination, MIM# 300475			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24011989;31330203;33603160		False	3	100;0;0	2.156	True		ENSG00000185825	ENSG00000185825	HGNC:16695													
BCAS3	gene	BCAS3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hengel-Maroofian-Schols syndrome, MIM# 619641			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34022130		False	3	100;0;0	2.156	True		ENSG00000141376	ENSG00000141376	HGNC:14347													
BCKDHA	gene	BCKDHA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	maple syrup urine disease type 1A MONDO:0023691			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7883996;7672509;34288399		False	3	100;0;0	2.156	True		ENSG00000248098	ENSG00000248098	HGNC:986													
BCKDHB	gene	BCKDHB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	maple syrup urine disease type 1B MONDO:0023692			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7672509;11509994;14742428		False	3	100;0;0	2.156	True		ENSG00000083123	ENSG00000083123	HGNC:987													
BCKDK	gene	BCKDK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Branched-chain ketoacid dehydrogenase kinase deficiency MIM#614923			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16875466;22956686		False	3	100;0;0	2.156	True		ENSG00000103507	ENSG00000103507	HGNC:16902													
BCL11A	gene	BCL11A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dias-Logan syndrome, MIM# 617101			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27453576;32903878		False	3	100;0;0	2.156	True		ENSG00000119866	ENSG00000119866	HGNC:13221													
BCL11B	gene	BCL11B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder with dysmorphic facies, speech delay, and T-cell abnormalities, MIM#	618092"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29985992		False	3	100;0;0	2.156	True		ENSG00000127152	ENSG00000127152	HGNC:13222													
BCOR	gene	BCOR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Microphthalmia, syndromic 2, MIM# 300166;Oculofaciocardiodental syndrome;Lenz microphthalmia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29974297		False	3	100;0;0	2.156	True		ENSG00000183337	ENSG00000183337	HGNC:20893													
BCS1L	gene	BCS1L	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bjornstad syndrome MONDO:0009872			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9777342;17314340;11528392;30582773;30582773;25914718		False	3	100;0;0	2.156	True		ENSG00000074582	ENSG00000074582	HGNC:1020													
BHLHE22	gene	BHLHE22	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, BHLHE22-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39502664		False	3	100;0;0	2.156	True		ENSG00000180828	ENSG00000180828	HGNC:11963													
BICRA	gene	BICRA	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome-12, MIM#619325;Developmental delay, intellectual disability, autism spectrum disorder,behavioral abnormalities, dysmorphic features			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33232675		False	3	100;0;0	2.156	True		ENSG00000063169	ENSG00000063169	HGNC:4332													
BLOC1S1	gene	BLOC1S1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, BLOC1S1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33875846;41887224		False	3	100;0;0	2.156	True		ENSG00000135441	ENSG00000135441	HGNC:4200													
BLTP1	gene	BLTP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alkuraya-Kucinskas syndrome, MIM# 617822			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29290337;30906834		False	3	100;0;0	2.156	True		ENSG00000138688	ENSG00000138688	HGNC:26953													
BMAL1	gene	BMAL1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, BMAL1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40720646		False	3	100;0;0	2.156	True		ENSG00000133794	ENSG00000133794	HGNC:701													
BMP4	gene	BMP4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microphthalmia, syndromic 6, MIM# 607932			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31053785		False	3	50;50;0	2.156	True		ENSG00000125378	ENSG00000125378	HGNC:1071													
BOLA3	gene	BOLA3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia (MMDS2, OMIM #614299)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24334290;29654549;21944046;22562699;26741492;24334290		False	3	100;0;0	2.156	True		ENSG00000163170	ENSG00000163170	HGNC:24415													
BORCS5	gene	BORCS5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysosomal storage disease, MONDO:0002561, BORCS5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40385417		False	3	100;0;0	2.156	True		ENSG00000165714	ENSG00000165714	HGNC:17950													
BORCS8	gene	BORCS8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38128568		False	3	100;0;0	2.156	True		ENSG00000254901	ENSG00000254901	HGNC:37247													
BPTF	gene	BPTF	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dysmorphic facies and distal limb anomalies AD, MIM#617755			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28942966;33522091		False	3	100;0;0	2.156	True		ENSG00000171634	ENSG00000171634	HGNC:3581													
BRAF	gene	BRAF	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiofaciocutaneous syndrome (MIM# 115150);Noonan syndrome (MIM# 613706);LEOPARD syndrome (MIM# 613707)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10610177;16474404;19206169		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000157764	ENSG00000157764	HGNC:1097													
BRAT1	gene	BRAT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26483087;26494257;27282546		False	3	100;0;0	2.156	True		ENSG00000106009	ENSG00000106009	HGNC:21701													
BRD4	gene	BRD4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cornelia de Lange syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29379197;30302754;11997514;34035299		False	3	50;0;50	2.156	True		ENSG00000141867	ENSG00000141867	HGNC:13575													
BRF1	gene	BRF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellofaciodental syndrome, MIM# 616202			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25561519;25561519;27748960		False	3	100;0;0	2.156	True		ENSG00000185024	ENSG00000185024	HGNC:11551													
BRF2	gene	BRF2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO:0002254, BRF2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40229899		False	3	100;0;0	2.156	True		ENSG00000104221	ENSG00000104221	HGNC:17298													
BRPF1	gene	BRPF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with dysmorphic facies and ptosis, MIM# 617333;MONDO:0015022			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27939640;27939639;32652122		False	3	100;0;0	2.156	True		ENSG00000156983	ENSG00000156983	HGNC:14255													
BRSK1	gene	BRSK1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, BRSK1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41035394		False	3	100;0;0	2.156	True		ENSG00000160469	ENSG00000160469	HGNC:18994													
BRSK2	gene	BRSK2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, BRSK2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30879638		False	3	100;0;0	2.156	True		ENSG00000174672	ENSG00000174672	HGNC:11405													
BRWD3	gene	BRWD3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked 93, MIM # 300659			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17668385;30628072;24462886		False	3	100;0;0	2.156	True		ENSG00000165288	ENSG00000165288	HGNC:17342													
BSCL2	gene	BSCL2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	congenital generalized lipodystrophy type 2 MONDO:0010020			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12362029;26072926;28916377		False	3	100;0;0	2.156	True		ENSG00000168000	ENSG00000168000	HGNC:15832													
BSN	gene	BSN	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), BSN-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40393460		False	3	100;0;0	2.156	True		ENSG00000164061	ENSG00000164061	HGNC:1117													
BSND	gene	BSND	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bartter syndrome, type 4a, MIM#602522			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	0;100;0	2.156	True		ENSG00000162399	ENSG00000162399	HGNC:16512													
BTD	gene	BTD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	biotinidase deficiency MONDO:0009665			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7550325;9375914;37751899;32741581		False	3	100;0;0	2.156	True		ENSG00000169814	ENSG00000169814	HGNC:1122													
BUB1B	gene	BUB1B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mosaic variegated aneuploidy syndrome 1, MIM# 257300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21190457;15475955;15098245		False	3	50;50;0	2.156	True		ENSG00000156970	ENSG00000156970	HGNC:1149													
C12orf57	gene	C12orf57	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Temtamy syndrome MIM#218340			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29383837;31853307		False	3	100;0;0	2.156	True		ENSG00000111678	ENSG00000111678	HGNC:29521													
C2CD3	gene	C2CD3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Orofaciodigital syndrome XIV, MIM# 615948			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30097616;27094867;26477546;24997988		False	3	100;0;0	2.156	True		ENSG00000168014	ENSG00000168014	HGNC:24564													
C2orf69	gene	C2orf69	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34038740;33945503		False	3	100;0;0	2.156	True		ENSG00000178074	ENSG00000178074	HGNC:26799													
CA2	gene	CA2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Osteopetrosis, autosomal recessive 3, with renal tubular acidosis, MIM#259730			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000104267	ENSG00000104267	HGNC:1373													
CA8	gene	CA8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3, MIM#613227			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21937992;19461874		False	3	100;0;0	2.156	True		ENSG00000178538	ENSG00000178538	HGNC:1382													
CACHD1	gene	CACHD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	syndromic complex neurodevelopmental disorder MONDO:0800439			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38158856		False	3	100;0;0	2.156	True		ENSG00000158966	ENSG00000158966	HGNC:29314													
CACNA1A	gene	CACNA1A	Australian Genomics Health Alliance Epilepsy Flagship;Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	developmental and epileptic encephalopathy, 42 MONDO:0014917			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27476654;33985586;36063114		False	3	100;0;0	2.156	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1B	gene	CACNA1B	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements, MIM# 618497			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30982612		False	3	100;0;0	2.156	True		ENSG00000148408	ENSG00000148408	HGNC:1389													
CACNA1C	gene	CACNA1C	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, language delay, and skeletal defects with or without seizures, MIM# 620029			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34163037		False	3	100;0;0	2.156	True		ENSG00000151067	ENSG00000151067	HGNC:1390													
CACNA1D	gene	CACNA1D	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Primary aldosteronism, seizures, and neurologic abnormalities, MIM# 615474;intellectual disability;autism;epilepsy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31921405;28472301;25620733		False	3	100;0;0	2.156	True		ENSG00000157388	ENSG00000157388	HGNC:1391													
CACNA1E	gene	CACNA1E	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 69, MIM#618285			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30343943		False	3	100;0;0	2.156	True		ENSG00000198216	ENSG00000198216	HGNC:1392													
CACNA1G	gene	CACNA1G	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM#618087			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29878067		False	3	100;0;0	2.156	True		ENSG00000006283	ENSG00000006283	HGNC:1394													
CACNA1I	gene	CACNA1I	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with variable intellectual disability and speech impairment, with or without seizures (NEDISS), MIM#620114			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33704440		False	3	100;0;0	2.156	True	Other	ENSG00000100346	ENSG00000100346	HGNC:1396													
CACNA2D2	gene	CACNA2D2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar atrophy with seizures and variable developmental delay, MIM#618501			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23339110;24358150;30410802;29997391;31402629;11487633;11756448;4177347;14660671;15331424		False	3	100;0;0	2.156	True		ENSG00000007402	ENSG00000007402	HGNC:1400													
CAD	gene	CAD	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 50, MIM# MIM 616457			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25678555;28007989;30914295		False	3	100;0;0	2.156	True		ENSG00000084774	ENSG00000084774	HGNC:1424													
CAMK2A	gene	CAMK2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Mental retardation, autosomal recessive 63 MIM#618095;Mental retardation, autosomal dominant 53 MIM#617798			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32600977;29784083;29560374		False	3	100;0;0	2.156	True		ENSG00000070808	ENSG00000070808	HGNC:1460													
CAMK2B	gene	CAMK2B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 54, MIM# 617799			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29100089;29560374;32875707		False	3	100;0;0	2.156	True		ENSG00000058404	ENSG00000058404	HGNC:1461													
CAMK2D	gene	CAMK2D	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO#0700092), CAMK2D-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38272033		False	3	100;0;0	2.156	True		ENSG00000145349	ENSG00000145349	HGNC:1462													
CAMK4	gene	CAMK4	Expert Review Green;Literature;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, CAMK4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30262571;33098801;33211350;37070062;37644014		False	3	100;0;0	2.156	True		ENSG00000152495	ENSG00000152495	HGNC:1464													
CAMSAP1	gene	CAMSAP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia, complex, with other brain malformations 12, MIM# 620316			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36283405		False	3	100;0;0	2.156	True		ENSG00000130559	ENSG00000130559	HGNC:19946													
CAMTA1	gene	CAMTA1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebellar ataxia, nonprogressive, with mental retardation (614756 AD)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32157189;22693284		False	3	100;0;0	2.156	True		ENSG00000171735	ENSG00000171735	HGNC:18806													
CAPN15	gene	CAPN15	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Oculogastrointestinal neurodevelopmental syndrome, MIM# 619318			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33410501;32885237		False	3	100;0;0	2.156	True		ENSG00000103326	ENSG00000103326	HGNC:11182													
CAPRIN1	gene	CAPRIN1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with language impairment, autism, and attention deficit-hyperactivity disorder, MIM# 620782;Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35979925;35977029;28135719;31398340;36136249		False	3	67;33;0	2.156	True		ENSG00000135387	ENSG00000135387	HGNC:6743													
CAPZA2	gene	CAPZA2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CAPZA2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32338762;32338762;38374166;35856264		False	3	50;50;0	2.156	True		ENSG00000198898	ENSG00000198898	HGNC:1490													
CARS1	gene	CARS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;microcephaly;brittle hair and nails			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID:  30824121		False	3	100;0;0	2.156	True		ENSG00000110619	ENSG00000110619	HGNC:1493													
CARS2	gene	CARS2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 27, MIM#616672			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30139652;25787132		False	3	100;0;0	2.156	True		ENSG00000134905	ENSG00000134905	HGNC:25695													
CASK	gene	CASK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	FG syndrome 4 MIM#300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749;Intellectual disability, with or without nystagmus MIM#300422			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24278995		False	3	100;0;0	2.156	True		ENSG00000147044	ENSG00000147044	HGNC:1497													
CASP2	gene	CASP2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 80, with variant lissencephaly, MIM# 620653			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37880421		False	3	100;0;0	2.156	True		ENSG00000106144	ENSG00000106144	HGNC:1503													
CBL	gene	CBL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CBL-related disorder MONDO:0013308			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20694012;20543203;11315197		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000110395	ENSG00000110395	HGNC:1541													
CBS	gene	CBS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria (MIM# 236200)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000160200	ENSG00000160200	HGNC:1550													
CBX1	gene	CBX1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092), CBX1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37087635		False	3	100;0;0	2.156	True		ENSG00000108468	ENSG00000108468	HGNC:1551													
CBY1	gene	CBY1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	intellectual disability;cerebellar ataxia;molar tooth sign;polydactyly;Joubert syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33131181;25103236;25220153		False	3	100;0;0	2.156	True		ENSG00000100211	ENSG00000100211	HGNC:1307													
CC2D1A	gene	CC2D1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive mental retardation, (MIM#608443)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25066123		False	3	100;0;0	2.156	True		ENSG00000132024	ENSG00000132024	HGNC:30237													
CC2D2A	gene	CC2D2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	COACH syndrome 2, MIM# 619111;Joubert syndrome 9, MIM#612285;Meckel syndrome 6, MIM#612284			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000048342	ENSG00000048342	HGNC:29253													
CCBE1	gene	CCBE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hennekam lymphangiectasia- lymphoedema syndrome MIM# 235510;lymphangiectasia and lymphoedema;facial abnormalities;dysmorphic features;hypoalbuminaemia;intellectual disability;hypoglobulinaemia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19935664;19911200;19287381;25925991;27345729;21778431		False	3	100;0;0	2.156	True		ENSG00000183287	ENSG00000183287	HGNC:29426													
CCDC186	gene	CCDC186	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, CCDC186-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33259146;37569695;40633195		False	3	100;0;0	2.156	True		ENSG00000165813	ENSG00000165813	HGNC:24349													
CCDC22	gene	CCDC22	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Ritscher-Schinzel syndrome 2, MIM# 300963			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21826058;24916641;34020006;33059814;31971710		False	3	100;0;0	2.156	True		ENSG00000101997	ENSG00000101997	HGNC:28909													
CCDC47	gene	CCDC47	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trichohepatoneurodevelopmental syndrome, 618268			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30401460		False	3	100;0;0	2.156	True		ENSG00000108588	ENSG00000108588	HGNC:24856													
CCDC82	gene	CCDC82	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, CCDC82-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35373332;35118659;27457812		False	3	100;0;0	2.156	True		ENSG00000149231	ENSG00000149231	HGNC:26282													
CCDC88A	gene	CCDC88A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PEHO syndrome-like, MIM# 617507			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26917597;30392057		False	3	100;0;0	2.156	True		ENSG00000115355	ENSG00000115355	HGNC:25523													
CCDC88C	gene	CCDC88C	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hydrocephalus, nonsyndromic, autosomal recessive 236600 AR			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25062847;30398676		False	3	50;50;0	2.156	True		ENSG00000015133	ENSG00000015133	HGNC:19967													
CCND2	gene	CCND2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3, MIM# 615938;Neurodevelopmental disorder, CCND2-related MONDO: 0700092;Microcephaly, MONDO: 0001149			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	0;0;0	2.156	True		ENSG00000118971	ENSG00000118971	HGNC:1583													
CCNK	gene	CCNK	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CCNK-related neurodevelopmental disorder-severe intellectual disability-facial dysmorphism syndrome  MONDO:0035775			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41101726;37597256;30122539		False	3	100;0;0	2.156	True		ENSG00000090061	ENSG00000090061	HGNC:1596													
CCT3	gene	CCT3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, CCT3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39480921		False	3	100;0;0	2.156	True		ENSG00000163468	ENSG00000163468	HGNC:1616													
CCT6A	gene	CCT6A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, CCT6A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39480921		False	3	100;0;0	2.156	False		ENSG00000146731	ENSG00000146731	HGNC:1620													
CDC42	gene	CDC42	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Takenouchi-Kosaki syndrome, MIM#616737			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29925821;26708094;26386261;29394990		False	3	100;0;0	2.156	True		ENSG00000070831	ENSG00000070831	HGNC:1736													
CDC42BPB	gene	CDC42BPB	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chilton-Okur-Chung neurodevelopmental syndrome, MIM# 619841			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32031333		False	3	100;0;0	2.156	True		ENSG00000198752	ENSG00000198752	HGNC:1738													
CDH11	gene	CDH11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Elsahy-Waters syndrome, MIM# 211380;Teebi hypertelorism syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33811546;27431290;28988429;29271567;33811546		False	3	100;0;0	2.156	True		ENSG00000140937	ENSG00000140937	HGNC:1750													
CDH2	gene	CDH2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual disability;corpus callosum abnormalities;congenital abnormalities;Agenesis of corpus callosum, cardiac, ocular, and genital syndrome, MIM#	618929"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31585109		False	3	100;0;0	2.156	True		ENSG00000170558	ENSG00000170558	HGNC:1759													
CDK10	gene	CDK10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Al Kaissi syndrome MIM#617694			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28886341		False	3	100;0;0	2.156	True		ENSG00000185324	ENSG00000185324	HGNC:1770													
CDK13	gene	CDK13	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder, 617360			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29021403;29393965;30904094		False	3	100;0;0	2.156	True		ENSG00000065883	ENSG00000065883	HGNC:1733													
CDK16	gene	CDK16	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder (MONDO#0700092) CDK16-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25644381;36323681;31981491		False	3	50;50;0	2.156	True		ENSG00000102225	ENSG00000102225	HGNC:8749													
CDK19	gene	CDK19	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual disability;epileptic encephalopathy;Epileptic encephalopathy, early infantile, 87, MIM#	618916"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32330417		False	3	100;0;0	2.156	True		ENSG00000155111	ENSG00000155111	HGNC:19338													
CDK4	gene	CDK4	Expert Review Green;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 31, primary, autosomal recessive, MIM# 621507			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40210435;41856556		False	3	50;50;0	2.156	True		ENSG00000135446	ENSG00000135446	HGNC:1773													
CDK5RAP2	gene	CDK5RAP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 3, primary, autosomal recessive, MIM# 604804;MONDO:0011488			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15793586;22887808;23995685;23726037;27761245;20460369;32677750;32015000		False	3	100;0;0	2.156	True		ENSG00000136861	ENSG00000136861	HGNC:18672													
CDK6	gene	CDK6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 12, primary, autosomal recessive, MONDO:0014484			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23918663;40801391;41856556		False	3	50;50;0	2.156	True		ENSG00000105810	ENSG00000105810	HGNC:1777													
CDK8	gene	CDK8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;dysmorphism;congenital abnormalities;seizures			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30905399		False	3	100;0;0	2.156	True		ENSG00000132964	ENSG00000132964	HGNC:1779													
CDKL5	gene	CDKL5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Developmental and epileptic encephalopathy 2, MIM# 300672			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19793311		False	3	100;0;0	2.156	True		ENSG00000008086	ENSG00000008086	HGNC:11411													
CDON	gene	CDON	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	holoprosencephaly 11 MONDO:0013642			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21802063;26728615;31502381;32729136;26529631		False	3	100;0;0	2.156	True		ENSG00000064309	ENSG00000064309	HGNC:17104													
CECR2	gene	CECR2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CECR2-related;neural tube defects, susceptibility to MONDO:0020705, CECR2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41964217;37424722		False	3	100;0;0	2.156	False		ENSG00000099954	ENSG00000099954	HGNC:1840													
CELF2	gene	CELF2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 97, MIM#619561			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33131106		False	3	100;0;0	2.156	True		ENSG00000048740	ENSG00000048740	HGNC:2550													
CELF4	gene	CELF4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CELF4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40108438		False	3	100;0;0	2.156	True		ENSG00000101489	ENSG00000101489	HGNC:14015													
CELSR1	gene	CELSR1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), CELSR1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41530147;36453712		False	3	100;0;0	2.156	False		ENSG00000075275	ENSG00000075275	HGNC:1850													
CELSR3	gene	CELSR3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO#0700092), CELSR3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38429302		False	3	100;0;0	2.156	True		ENSG00000008300	ENSG00000008300	HGNC:3230													
CENPF	gene	CENPF	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Stromme syndrome (MIM#243605)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35488810;31953238;26820108		False	3	100;0;0	2.156	True		ENSG00000117724	ENSG00000117724	HGNC:1857													
CEP104	gene	CEP104	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 25, MIM# 616781;MONDO:0014770;Neurodevelopmental disorder;MONDO:0014770, CEP104-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26477546;34196201;35359234		False	3	100;0;0	2.156	True		ENSG00000116198	ENSG00000116198	HGNC:24866													
CEP120	gene	CEP120	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 31 (MIM 617761);Short-rib thoracic dysplasia 13 with or without polydactyly (MIM 616300)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27208211		False	3	100;0;0	2.156	True		ENSG00000168944	ENSG00000168944	HGNC:26690													
CEP135	gene	CEP135	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephalic primordial dwarfism;Microcephaly 8, primary, autosomal recessive, 614673			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30214071;22521416		False	3	100;0;0	2.156	True		ENSG00000174799	ENSG00000174799	HGNC:29086													
CEP152	gene	CEP152	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 9, primary, autosomal recessive, MIM# 614852;MONDO:0013923;Seckel syndrome 5, MIM# 613823;MONDO:0013443			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20598275;22775483;21131973;23199753		False	3	100;0;0	2.156	True		ENSG00000103995	ENSG00000103995	HGNC:29298													
CEP164	gene	CEP164	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome;Nephronophthisis 15, MIM# 614845;Oro-facio-digital syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34132027;34013113;32055034;27708425;22863007		False	3	100;0;0	2.156	True		ENSG00000110274	ENSG00000110274	HGNC:29182													
CEP290	gene	CEP290	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 5, MIM# 610188;Meckel syndrome 4, MIM# 611134;Bardet-Biedl syndrome 14, MIM# 615991			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16682973;16682970;17705300;33370260;32600475		False	3	100;0;0	2.156	True		ENSG00000198707	ENSG00000198707	HGNC:29021													
CEP295	gene	CEP295	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seckel syndrome 11, OMIM # 620767			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38154379		False	3	100;0;0	2.156	True		ENSG00000166004	ENSG00000166004	HGNC:29366													
CEP41	gene	CEP41	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 15, MIM# 614464			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22246503		False	3	100;0;0	2.156	True		ENSG00000106477	ENSG00000106477	HGNC:12370													
CEP55	gene	CEP55	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multinucleated neurons, anhydramnios, renal dysplasia, cerebellar hypoplasia, and hydranencephaly, MIM#	236500;Microcephaly;Intellectual disability"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32100459		False	3	100;0;0	2.156	True		ENSG00000138180	ENSG00000138180	HGNC:1161													
CEP57	gene	CEP57	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mosaic variegated aneuploidy syndrome 2, #MIM 614114			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24259107;21552266;32861809;30147898		False	3	100;0;0	2.156	True		ENSG00000166037	ENSG00000166037	HGNC:30794													
CEP76	gene	CEP76	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038;Joubert syndrome;Bardet-Biedl syndrome;retinitis pigmentosa			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000101624	ENSG00000101624	HGNC:25727													
CEP83	gene	CEP83	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Nephronophthisis 18, MIM# 615862;MONDO:0014374;Retinal dystrophy;ID			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24882706;33938610		False	3	100;0;0	2.156	True		ENSG00000173588	ENSG00000173588	HGNC:17966													
CEP85L	gene	CEP85L	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lissencephaly, posterior predominant			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32097630		False	3	100;0;0	2.156	True		ENSG00000111860	ENSG00000111860	HGNC:21638													
CERT1	gene	CERT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, speech delay, and dysmorphic facies (MIM#616351)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25533962;36976648		False	3	100;0;0	2.156	True	Other	ENSG00000113163	ENSG00000113163	HGNC:2205													
CHAMP1	gene	CHAMP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 40 (MIM#616579)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27148580;26340335		False	3	100;0;0	2.156	True		ENSG00000198824	ENSG00000198824	HGNC:20311													
CHASERR	gene	CHASERR	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dysmorphic facies, absent speech and ambulation, and brain abnormalities, MIM# 621012			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39442041		False	3	100;0;0	2.156	True		ENSG00000272888	ENSG00000272888	HGNC:48626													
CHD1	gene	CHD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Pilarowski-Bjornsson syndrome, MIM#617682			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28866611		False	3	100;0;0	2.156	True		ENSG00000153922	ENSG00000153922	HGNC:1915													
CHD2	gene	CHD2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 94, MIM# 615369			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26677509		False	3	100;0;0	2.156	True		ENSG00000173575	ENSG00000173575	HGNC:1917													
CHD3	gene	CHD3	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Snijders Blok-Campeau syndrome, MONDO:0032600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30397230		False	3	50;50;0	2.156	True		ENSG00000170004	ENSG00000170004	HGNC:1918													
CHD4	gene	CHD4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Sifrim-Hitz-Weiss syndrome, MIM 617159			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31388190		False	3	100;0;0	2.156	True		ENSG00000111642	ENSG00000111642	HGNC:1919													
CHD5	gene	CHD5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Epilepsy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33944996		False	3	100;0;0	2.156	True		ENSG00000116254	ENSG00000116254	HGNC:16816													
CHD7	gene	CHD7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CHARGE syndrome, MIM# 214800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000171316	ENSG00000171316	HGNC:20626													
CHD8	gene	CHD8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Autism, susceptibility to, 18} 615032;Neurodevelopmental disorder, MONDO:0700092, CHD8-associated			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31980904		False	3	100;0;0	2.156	True		ENSG00000100888	ENSG00000100888	HGNC:20153													
CHKA	gene	CHKA	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, movement abnormalities, and seizures, MIM#620023			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35202461		False	3	100;0;0	2.156	True		ENSG00000110721	ENSG00000110721	HGNC:1937													
CHKB	gene	CHKB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, congenital, megaconial type, MIM# 602541			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21665002;23692895;24997086		False	3	100;0;0	2.156	True		ENSG00000100288	ENSG00000100288	HGNC:1938													
CHMP1A	gene	CHMP1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 8, MIM# 614961			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23023333		False	3	100;0;0	2.156	True		ENSG00000131165	ENSG00000131165	HGNC:8740													
CHTF18	gene	CHTF18	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO#0700092, CHTF18-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40717333		False	3	50;50;0	2.156	True		ENSG00000127586	ENSG00000127586	HGNC:18435													
CIC	gene	CIC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 45 MIM#617600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28288114;21076407		False	3	100;0;0	2.156	True		ENSG00000079432	ENSG00000079432	HGNC:14214													
CIT	gene	CIT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 17, primary, autosomal recessive (MIM#617090)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27453578;27503289;27453579		False	3	100;0;0	2.156	True		ENSG00000122966	ENSG00000122966	HGNC:1985													
CKAP2L	gene	CKAP2L	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Filippi syndrome, MIM# 272440			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25439729;33913579;29473684		False	3	100;0;0	2.156	True		ENSG00000169607	ENSG00000169607	HGNC:26877													
CLCN3	gene	CLCN3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512;Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34186028		False	3	100;0;0	2.156	True	Other	ENSG00000109572	ENSG00000109572	HGNC:2021													
CLCN4	gene	CLCN4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Raynaud-Claes syndrome, MIM#300114;intellectual disability;epilepsy;autistic features;mood disorders;cerebral white matter changes;progressive appendicular spasticity			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27550844		False	3	100;0;0	2.156	True		ENSG00000073464	ENSG00000073464	HGNC:2022													
CLCN6	gene	CLCN6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, hypotonia, respiratory insufficiency and brain imaging abnormalities, MIM# 619173;Developmental delay;neurodegeneration			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33217309		False	3	100;0;0	2.156	True		ENSG00000011021	ENSG00000011021	HGNC:2024													
CLCNKB	gene	CLCNKB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Other	Bartter syndrome, type 3, MIM#607364;Bartter syndrome, type 4b, digenic, MIM#613090			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18310267;29254190		False	3	100;0;0	2.156	True		ENSG00000184908	ENSG00000184908	HGNC:2027													
CLDN5	gene	CLDN5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disorder, MONDO:0002254, CLDN5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36477332		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000184113	ENSG00000184113	HGNC:2047													
CLN3	gene	CLN3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 3 MIM#204200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000188603	ENSG00000188603	HGNC:2074													
CLN5	gene	CLN5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 5, MIM# 256731;MONDO:0009745			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20157158		False	3	100;0;0	2.156	True		ENSG00000102805	ENSG00000102805	HGNC:2076													
CLN6	gene	CLN6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 6, MIM# 601780			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000128973	ENSG00000128973	HGNC:2077													
CLN8	gene	CLN8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neuronal ceroid lipofuscinosis MONDO:0016295			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000182372	ENSG00000182372	HGNC:2079													
CLP1	gene	CLP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 10, MIM# 615803			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24766809;29307788		False	3	100;0;0	2.156	True		ENSG00000172409	ENSG00000172409	HGNC:16999													
CLPB	gene	CLPB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271;3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25597510;34140661		False	3	100;0;0	2.156	True		ENSG00000162129	ENSG00000162129	HGNC:30664													
CLTC	gene	CLTC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 56, MIM# 617854			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29100083;26822784		False	3	100;0;0	2.156	True		ENSG00000141367	ENSG00000141367	HGNC:2092													
CMIP	gene	CMIP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42386996;28504353;22689534		False	3	100;0;0	2.156	True		ENSG00000153815	ENSG00000153815	HGNC:24319													
CNKSR2	gene	CNKSR2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, Houge type, MIM# 301008			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34266427		False	3	100;0;0	2.156	True		ENSG00000149970	ENSG00000149970	HGNC:19701													
CNNM2	gene	CNNM2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Hypomagnesemia 6, renal MIM#613882;Hypomagnesemia, seizures, and mental retardation MIM#616418			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34604137;35170241		False	3	100;0;0	2.156	True		ENSG00000148842	ENSG00000148842	HGNC:103													
CNOT1	gene	CNOT1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Vissers-Bodmer syndrome, MIM#619033;Holoprosencephaly 12, with or without pancreatic agenesis	618500"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31006510;21679367;31006513;32553196		False	3	100;0;0	2.156	True		ENSG00000125107	ENSG00000125107	HGNC:7877													
CNOT2	gene	CNOT2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder with nasal speech, dysmorphic facies, and variable skeletal anomalies	618608"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31512373;31145527;28135719		False	3	100;0;0	2.156	True		ENSG00000111596	ENSG00000111596	HGNC:7878													
CNOT3	gene	CNOT3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with speech delay, autism, and dysmorphic facies 618672			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31201375		False	3	100;0;0	2.156	True		ENSG00000088038	ENSG00000088038	HGNC:7879													
CNOT9	gene	CNOT9	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37092538		False	3	100;0;0	2.156	True		ENSG00000144580	ENSG00000144580	HGNC:10445													
CNP	gene	CNP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 20, MIM# 619071			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32128616;12590258;40396300		False	3	50;50;0	2.156	True		ENSG00000173786	ENSG00000173786	HGNC:2158													
CNPY3	gene	CNPY3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 60 (MIM 617929)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29394991;30237576		False	3	100;0;0	2.156	True		ENSG00000137161	ENSG00000137161	HGNC:11968													
CNTNAP1	gene	CNTNAP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelinating neuropathy, congenital, 3, MIM#618186;Lethal congenital contracture syndrome 7, MIM# 616286			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28374019;29511323;27668699		False	3	100;0;0	2.156	True		ENSG00000108797	ENSG00000108797	HGNC:8011													
CNTNAP2	gene	CNTNAP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia-focal epilepsy syndrome, MIM# 610042			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16571880;19896112;27439707		False	3	100;0;0	2.156	True		ENSG00000174469	ENSG00000174469	HGNC:13830													
COA8	gene	COA8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 17, MIM#619061			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25175347		False	3	100;0;0	2.156	True		ENSG00000256053	ENSG00000256053	HGNC:20492													
COASY	gene	COASY	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 6 615643;Pontocerebellar hypoplasia, type 12 618266			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24360804;30089828		False	3	100;0;0	2.156	True		ENSG00000068120	ENSG00000068120	HGNC:29932													
COG1	gene	COG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIg, MIM# 611209			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16537452;19008299;17904886;11980916		False	3	100;0;0	2.156	True		ENSG00000166685	ENSG00000166685	HGNC:6545													
COG4	gene	COG4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Saul-Wilson syndrome, OMIM #618150;Congenital disorder of glycosylation, type IIj, OMIM #613489			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31949312;30290151;19494034;21185756		False	3	100;0;0	2.156	True		ENSG00000103051	ENSG00000103051	HGNC:18620													
COG5	gene	COG5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIi, MIM# 613612			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23228021;31572517;32174980		False	3	100;0;0	2.156	True		ENSG00000164597	ENSG00000164597	HGNC:14857													
COG6	gene	COG6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Iil, MIM#614576			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000133103	ENSG00000133103	HGNC:18621													
COG7	gene	COG7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIe , MIM#608779			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15107842;17356545;28883096		False	3	100;0;0	2.156	True		ENSG00000168434	ENSG00000168434	HGNC:18622													
COG8	gene	COG8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIh, MIM# 611182			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17220172;28619360;30690882;17331980		False	3	100;0;0	2.156	True		ENSG00000213380	ENSG00000213380	HGNC:18623													
COL4A1	gene	COL4A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	COL4A1-related disorder MONDO:0800461			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30413629;33912663;36786861;32042920		False	3	100;0;0	2.156	True		ENSG00000187498	ENSG00000187498	HGNC:2202													
COL4A2	gene	COL4A2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Brain small vessel disease 2, MIM#	614483;familial porencephaly MONDO:0020496"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36324412;39016117		False	3	100;0;0	2.156	True		ENSG00000134871	ENSG00000134871	HGNC:2203													
COLEC11	gene	COLEC11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3MC syndrome 2, MIM# 265050			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21258343;26789649;28301481		False	3	100;0;0	2.156	True		ENSG00000118004	ENSG00000118004	HGNC:17213													
COPB1	gene	COPB1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Baralle-Macken syndrome, MIM# 619255			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33632302;40396222		False	3	100;0;0	2.156	True		ENSG00000129083	ENSG00000129083	HGNC:2231													
COPB2	gene	COPB2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Osteoporosis, childhood- or juvenile-onset, with developmental delay, MIM# 619884			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34450031		False	3	50;50;0	2.156	True		ENSG00000184432	ENSG00000184432	HGNC:2232													
COQ4	gene	COQ4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 7, MIM# 616276;neonatal encephalomyopathy-cardiomyopathy-respiratory distress syndrome MONDO:0014562			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34656997		False	3	100;0;0	2.156	True		ENSG00000167113	ENSG00000167113	HGNC:19693													
COQ5	gene	COQ5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 9 MIM#619028			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29044765;37599337;21937992;41199775;36266294		False	3	50;0;50	2.156	True		ENSG00000110871	ENSG00000110871	HGNC:28722													
COQ8A	gene	COQ8A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	coenzyme Q10 deficiency MONDO:0018151			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31621627;31741144		False	3	100;0;0	2.156	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
COX10	gene	COX10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 3, MIM# 619046			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10767350;12928484;15455402;27290639		False	3	100;0;0	2.156	True		ENSG00000006695	ENSG00000006695	HGNC:2260													
COX11	gene	COX11	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease (MONDO:0044970), COX11-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36030551		False	3	100;0;0	2.156	True		ENSG00000166260	ENSG00000166260	HGNC:2261													
COX15	gene	COX15	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33746038;32232962;26959537;21412973;12474143;15235026		False	3	100;0;0	2.156	True		ENSG00000014919	ENSG00000014919	HGNC:2263													
COX4I1	gene	COX4I1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 16, MIM#619060			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28766551;22592081;31290619;40095452;41203052		False	3	100;0;0	2.156	True		ENSG00000131143	ENSG00000131143	HGNC:2265													
COXFA4	gene	COXFA4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 39967265		False	3	100;0;0	2.156	True		ENSG00000189043	ENSG00000189043	HGNC:7687													
CPAP	gene	CPAP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 6, primary, autosomal recessive, MIM# 608393, MONDO:0012029;Seckel syndrome 4, MIM# 613676, MONDO:0013358			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20522431;23166506;15793586;20978018;22775483;32677750;32549991;34068194		False	3	100;0;0	2.156	True		ENSG00000151849	ENSG00000151849	HGNC:17272													
CPE	gene	CPE	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder and hypogonadotropic hypogonadism, MIM#	619326"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26120850;32936766;34383079		False	3	100;0;0	2.156	True		ENSG00000109472	ENSG00000109472	HGNC:2303													
CPLANE1	gene	CPLANE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 17, MIM# 614615;MONDO:0013824;Orofaciodigital syndrome VI, MIM# 277170			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22425360;24178751		False	3	100;0;0	2.156	True		ENSG00000197603	ENSG00000197603	HGNC:25801													
CPS1	gene	CPS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carbamoylphosphate synthetase I deficiency MIM#237300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8486760;17310273;21120950;31268178		False	3	100;0;0	2.156	True		ENSG00000021826	ENSG00000021826	HGNC:2323													
CPSF3	gene	CPSF3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, hypotonia, and seizures (NEDMHS), MIM#619876			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35121750		False	3	100;0;0	2.156	True		ENSG00000119203	ENSG00000119203	HGNC:2326													
CRADD	gene	CRADD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 34, with variant lissencephaly, MIM# 614499			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27773430		False	3	100;0;0	2.156	True		ENSG00000169372	ENSG00000169372	HGNC:2340													
CRB2	gene	CRB2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ventriculomegaly with cystic kidney disease, MIM# 219730			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25557780;33687977;32051522;30212996;33575434;31438467;30593785		False	3	100;0;0	2.156	True		ENSG00000148204	ENSG00000148204	HGNC:18688													
CREBBP	gene	CREBBP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Rubinstein-Taybi syndrome 1, MIM# 180849;Menke-Hennekam syndrome 1, MIM# 618332			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10699051;17855048;27311832;29460469		False	3	100;0;0	2.156	True		ENSG00000005339	ENSG00000005339	HGNC:2348													
CRELD1	gene	CRELD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Jeffries-Lakhani neurodevelopmental syndrome, MIM# 620771			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37947183		False	3	100;0;0	2.156	True		ENSG00000163703	ENSG00000163703	HGNC:14630													
CRIPT	gene	CRIPT	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short stature with microcephaly and distinctive facies (MIM#615789) : Rothmund-Thomson syndrome MONDO:0010002			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37013901		False	3	100;0;0	2.156	True		ENSG00000119878	ENSG00000119878	HGNC:14312													
CRLS1	gene	CRLS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 57, MIM# 620167			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35147173		False	3	100;0;0	2.156	True		ENSG00000088766	ENSG00000088766	HGNC:16148													
CRMP1	gene	CRMP1	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, MONDO:0700092, CRMP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36511780;39758889		False	3	100;0;0	2.156	True		ENSG00000072832	ENSG00000072832	HGNC:2365													
CRNKL1	gene	CRNKL1	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40857589		False	3	100;0;0	2.156	True		ENSG00000101343	ENSG00000101343	HGNC:15762													
CRPPA	gene	CRPPA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23288328		False	3	100;0;0	2.156	True		ENSG00000214960	ENSG00000214960	HGNC:37276													
CSDE1	gene	CSDE1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CSDE1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31579823		False	3	100;0;0	2.156	True		ENSG00000009307	ENSG00000009307	HGNC:29905													
CSMD1	gene	CSMD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID 38816421		False	3	100;0;0	2.156	True		ENSG00000183117	ENSG00000183117	HGNC:14026													
CSNK2A1	gene	CSNK2A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Okur-Chung neurodevelopmental syndrome, MIM# 617062			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27048600;29240241;29383814		False	3	100;0;0	2.156	True		ENSG00000101266	ENSG00000101266	HGNC:2457													
CSNK2B	gene	CSNK2B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28585349;28762608		False	3	100;0;0	2.156	True		ENSG00000204435	ENSG00000204435	HGNC:2460													
CSPP1	gene	CSPP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 21, MIM# 615636;MONDO:0014288			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24360808;24360803;24360807;25997910		False	3	100;0;0	2.156	True		ENSG00000104218	ENSG00000104218	HGNC:26193													
CTBP1	gene	CTBP1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, 617915			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27094857;28955726;31041561		False	3	0;0;0	2.156	True		ENSG00000159692	ENSG00000159692	HGNC:2494													
CTCF	gene	CTCF	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 21 (MIM#615502)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23746550;31239556		False	3	100;0;0	2.156	True		ENSG00000102974	ENSG00000102974	HGNC:13723													
CTDP1	gene	CTDP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	congenital cataracts-facial dysmorphism-neuropathy syndrome MONDO:0011402			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301787		False	3	100;0;0	2.156	True		ENSG00000060069	ENSG00000060069	HGNC:2498													
CTNNA2	gene	CTNNA2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia, complex, with other brain malformations 9, MIM#618174			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30013181		False	3	100;0;0	2.156	True		ENSG00000066032	ENSG00000066032	HGNC:2510													
CTNNB1	gene	CTNNB1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with spastic diplegia and visual defects , MIM#615075			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23033978;24614104;25326669;27915094		False	3	100;0;0	2.156	True		ENSG00000168036	ENSG00000168036	HGNC:2514													
CTNND2	gene	CTNND2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CTNND2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25839933;29127138;25807484;38604781;25473103;31814264;41502569		False	3	100;0;0	2.156	True		ENSG00000169862	ENSG00000169862	HGNC:2516													
CTR9	gene	CTR9	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), CTR9-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35499524;35717577		False	3	100;0;0	2.156	True		ENSG00000198730	ENSG00000198730	HGNC:16850													
CTSA	gene	CTSA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galactosialidosis MONDO:0009737			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23915561;36713078		False	3	100;0;0	2.156	True		ENSG00000064601	ENSG00000064601	HGNC:9251													
CTSD	gene	CTSD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neuronal ceroid lipofuscinosis MONDO:0016295			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000117984	ENSG00000117984	HGNC:2529													
CTU2	gene	CTU2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome, MIM#618142			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27480277;26633546		False	3	100;0;0	2.156	True		ENSG00000174177	ENSG00000174177	HGNC:28005													
CUL1	gene	CUL1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CUL1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 41189326		False	3	100;0;0	2.156	True		ENSG00000055130	ENSG00000055130	HGNC:2551													
CUL3	gene	CUL3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with or without autism or seizures, MIM# 619239;Global developmental delay;Intellectual disability;Seizures;Abnormality of cardiovascular system morphology;Abnormality of the palate			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32341456		False	3	100;0;0	2.156	True		ENSG00000036257	ENSG00000036257	HGNC:2553													
CUL4B	gene	CUL4B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked, syndromic 15 (Cabezas type), MIM# 300354			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17236139;19377476		False	3	100;0;0	2.156	True		ENSG00000158290	ENSG00000158290	HGNC:2555													
CUX1	gene	CUX1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Global developmental delay with or without impaired intellectual development, MIM#618330			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25059644;20510857;30014507		False	3	100;0;0	2.156	True		ENSG00000257923	ENSG00000257923	HGNC:2557													
CUX2	gene	CUX2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 67, MIM#618141			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29630738;29795476		False	3	100;0;0	2.156	True		ENSG00000111249	ENSG00000111249	HGNC:19347													
CWC27	gene	CWC27	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Retinitis pigmentosa with or without skeletal anomalies, MIM# 250410			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28285769;31481716		False	3	100;0;0	2.156	True		ENSG00000153015	ENSG00000153015	HGNC:10664													
CWF19L1	gene	CWF19L1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 17, MIM#616127;intellectual disability, developmental delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25361784;15981765;26197978;27016154;30167849		False	3	100;0;0	2.156	True		ENSG00000095485	ENSG00000095485	HGNC:25613													
CYB5R3	gene	CYB5R3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methemoglobinemia MONDO:0001117			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38303731		False	3	100;0;0	2.156	True		ENSG00000100243	ENSG00000100243	HGNC:2873													
CYFIP2	gene	CYFIP2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 65, MIM#618008;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29534297;30664714		False	3	100;0;0	2.156	True		ENSG00000055163	ENSG00000055163	HGNC:13760													
D2HGDH	gene	D2HGDH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-2-hydroxyglutaric aciduria MIM#600721			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15609246;16081310;31349060;20020533;38825343		False	3	100;0;0	2.156	True		ENSG00000180902	ENSG00000180902	HGNC:28358													
DAG1	gene	DAG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25934851;29337005;24052401;21388311;25503980;30450679;12140559;21388311		False	3	50;50;0	2.156	True		ENSG00000173402	ENSG00000173402	HGNC:2666													
DAGLA	gene	DAGLA	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuroocular syndrome 2, paroxysmal type, MIM# 168885			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35737950		False	3	100;0;0	2.156	True		ENSG00000134780	ENSG00000134780	HGNC:1165													
DARS1	gene	DARS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25527264;23643384		False	3	100;0;0	2.156	True		ENSG00000115866	ENSG00000115866	HGNC:2678													
DARS2	gene	DARS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17384640;21815884;20506600		False	3	100;0;0	2.156	True		ENSG00000117593	ENSG00000117593	HGNC:25538													
DBT	gene	DBT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Maple syrup urine disease, type II (MIM#248600)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000137992	ENSG00000137992	HGNC:2698													
DCAF17	gene	DCAF17	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Woodhouse-Sakati syndrome, MIM# 241080			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19026396;20507343;35002959;34877714;34732557;34590781		False	3	100;0;0	2.156	True		ENSG00000115827	ENSG00000115827	HGNC:25784													
DCHS1	gene	DCHS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Van Maldergem syndrome 1, MIM# 601390			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27262615;22473091;24056717;29046692		False	3	100;0;0	2.156	True		ENSG00000166341	ENSG00000166341	HGNC:13681													
DCPS	gene	DCPS	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Al-Raqad syndrome, MIM#616459			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25701870;30289615;25712129		False	3	100;0;0	2.156	True		ENSG00000110063	ENSG00000110063	HGNC:29812													
DCX	gene	DCX	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Lissencephaly, X-linked, MIM# 300067;Subcortical laminal heterotopia, X-linked 300067			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26743950;11468322;20726879;20301364;12552055;9489699		False	3	100;0;0	2.156	True		ENSG00000077279	ENSG00000077279	HGNC:2714													
DDB1	gene	DDB1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	White-Kernohan syndrome, MIM# 619426			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33743206		False	3	100;0;0	2.156	True		ENSG00000167986	ENSG00000167986	HGNC:2717													
DDC	gene	DDC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37824694		False	3	100;0;0	2.156	True		ENSG00000132437	ENSG00000132437	HGNC:2719													
DDHD2	gene	DDHD2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary spastic paraplegia 54 MONDO:0014018			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23486545;23176823;36090575;26113134;25417924		False	3	100;0;0	2.156	True		ENSG00000085788	ENSG00000085788	HGNC:29106													
DDOST	gene	DDOST	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	DDOST-congenital disorder of glycosylation MONDO:0013789			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22305527;34462534;36214423;37848450;33413482;36631682		False	3	50;50;0	2.156	True		ENSG00000244038	ENSG00000244038	HGNC:2728													
DDX11	gene	DDX11	ClinGen;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Warsaw breakage syndrome, MONDO:0013252			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20137776, 23033317, 30216658, 30924321, 32855419, 36703504, 26089203		False	3	100;0;0	2.156	True		ENSG00000013573	ENSG00000013573	HGNC:2736													
DDX17	gene	DDX17	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092), DDX17-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://www.medrxiv.org/search/DDX17		False	3	100;0;0	2.156	True		ENSG00000100201	ENSG00000100201	HGNC:2740													
DDX23	gene	DDX23	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, DDX23-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194;34050707		False	3	50;50;0	2.156	True		ENSG00000174243	ENSG00000174243	HGNC:17347													
DDX39B	gene	DDX39B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, DDX39B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39918047		False	3	100;0;0	2.156	True		ENSG00000198563	ENSG00000198563	HGNC:13917													
DDX3X	gene	DDX3X	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30266093;26235985;25533962;33528536;30936465;31274575;30817323		False	3	100;0;0	2.156	True		ENSG00000215301	ENSG00000215301	HGNC:2745													
DDX41	gene	DDX41	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Inherited retinal dystrophy, MONDO:0019118, DDX41-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41646732		False	3	100;0;0	2.156	True		ENSG00000183258	ENSG00000183258	HGNC:18674													
DDX59	gene	DDX59	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Orofaciodigital syndrome V, MIM#174300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28711741;23972372;29127725		False	3	100;0;0	2.156	True		ENSG00000118197	ENSG00000118197	HGNC:25360													
DDX6	gene	DDX6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with impaired language and dysmorphic facies, MIM#618653			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31422817,		False	3	100;0;0	2.156	True		ENSG00000110367	ENSG00000110367	HGNC:2747													
DEAF1	gene	DEAF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, impaired expressive language, and with or without seizures 617171;Vulto-van Silfout-de Vries syndrome 615828			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30923367;24726472;26048982;28940898;26834045		False	3	100;0;0	2.156	True		ENSG00000177030	ENSG00000177030	HGNC:14677													
DEGS1	gene	DEGS1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy hypomyelinating 18, MIM#618404			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31186544;30620337;30620338		False	3	100;0;0	2.156	True		ENSG00000143753	ENSG00000143753	HGNC:13709													
DENND2B	gene	DENND2B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), DENND2B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40717498		False	3	100;0;0	2.156	True		ENSG00000166444	ENSG00000166444	HGNC:11350													
DENND5A	gene	DENND5A	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 49, MIM#	617281"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27431290;27866705		False	3	100;0;0	2.156	True		ENSG00000184014	ENSG00000184014	HGNC:19344													
DENND5B	gene	DENND5B	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with white matter anomalies, MONDO:0700092, DENND5B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38387458		False	3	100;0;0	2.156	True		ENSG00000170456	ENSG00000170456	HGNC:28338													
DEPDC5	gene	DEPDC5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial focal, with variable foci 1, MIM#604364			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31444548;23542697;23542701		False	3	100;0;0	2.156	True		ENSG00000100150	ENSG00000100150	HGNC:18423													
DHCR24	gene	DHCR24	ClinGen;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Desmosterolosis, MONDO:0011217			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936		False	3	100;0;0	2.156	True		ENSG00000116133	ENSG00000116133	HGNC:2859													
DHCR7	gene	DHCR7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Smith-Lemli-Opitz syndrome MONDO:0010035			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:004643		False	3	100;0;0	2.156	True		ENSG00000172893	ENSG00000172893	HGNC:2860													
DHDDS	gene	DHDDS	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay and seizures with or without movement abnormalities, MIM#617836			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29100083, 36628425, 34382076		False	3	100;0;0	2.156	True		ENSG00000117682	ENSG00000117682	HGNC:20603													
DHFR	gene	DHFR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Megaloblastic anemia due to dihydrofolate reductase deficiency, MIM# 613839			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21310276;21310277		False	3	100;0;0	2.156	True		ENSG00000228716	ENSG00000228716	HGNC:2861													
DHPS	gene	DHPS	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures and speech and walking impairment, MIM#618480			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30661771		False	3	100;0;0	2.156	True		ENSG00000095059	ENSG00000095059	HGNC:2869													
DHRSX	gene	DHRSX	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type 1DD, MIM# 301133			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38821050		False	3	100;0;0	2.156	True		ENSG00000169084	ENSG00000169084	HGNC:18399													
DHX30	gene	DHX30	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with severe motor impairment and absent language, MIM#617804			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29100085		False	3	100;0;0	2.156	True		ENSG00000132153	ENSG00000132153	HGNC:16716													
DHX37	gene	DHX37	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with brain anomalies and with or without vertebral or cardiac anomalies, MIM#618731			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 26539891;31256877		False	3	100;0;0	2.156	True		ENSG00000150990	ENSG00000150990	HGNC:17210													
DHX9	gene	DHX9	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 75, MIM# 620988			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37467750		False	3	100;0;0	2.156	True		ENSG00000135829	ENSG00000135829	HGNC:2750													
DIAPH1	gene	DIAPH1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive microcephaly-seizures-cortical blindness-developmental delay syndrome, MONDO:0014714			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24781755, 26463574, 33662367, 36212620, 39076976, 39120629		False	3	67;33;0	2.156	True		ENSG00000131504	ENSG00000131504	HGNC:2876													
DIP2C	gene	DIP2C	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092), DIP2C-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38421105		False	3	100;0;0	2.156	True		ENSG00000151240	ENSG00000151240	HGNC:29150													
DIS3L2	gene	DIS3L2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perlman syndrome MONDO:0009965			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16278893;22306653;28328139		False	3	100;0;0	2.156	True		ENSG00000144535	ENSG00000144535	HGNC:28648													
DISP1	gene	DISP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Holoprosencephaly 10, MIM# 621143			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19184110;26748417;23542665;38529886		False	3	100;0;0	2.156	True		ENSG00000154309	ENSG00000154309	HGNC:19711													
DKC1	gene	DKC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	DKC1-related disorder MONDO:0100152			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:004651		False	3	100;0;0	2.156	True		ENSG00000130826	ENSG00000130826	HGNC:2890													
DLAT	gene	DLAT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase E2 deficiency, MIM#245348			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39007626;29093066;16049940		False	3	50;50;0	2.156	True		ENSG00000150768	ENSG00000150768	HGNC:2896													
DLD	gene	DLD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dihydrolipoamide dehydrogenase deficiency MIM#246900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34745891;33092611;8968745		False	3	100;0;0	2.156	True		ENSG00000091140	ENSG00000091140	HGNC:2898													
DLG3	gene	DLG3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 90 MIM#300850			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28777483;24721225		False	3	100;0;0	2.156	True		ENSG00000082458	ENSG00000082458	HGNC:2902													
DLG4	gene	DLG4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder 62, MIM#	618793"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33597769;27479843;25123844;19617690;29460436;23020937;28135719		False	3	100;0;0	2.156	True		ENSG00000132535	ENSG00000132535	HGNC:2903													
DLL1	gene	DLL1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;autism;seizures;variable brain abnormalities;scoliosis			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31353024		False	3	100;0;0	2.156	True		ENSG00000198719	ENSG00000198719	HGNC:2908													
DMAP1	gene	DMAP1	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DMAP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	50;50;0	2.156	True		ENSG00000178028	ENSG00000178028	HGNC:18291													
DMD	gene	DMD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Duchenne muscular dystrophy MIM#310200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000198947	ENSG00000198947	HGNC:2928													
DMXL2	gene	DMXL2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 81, MIM#	618663"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31688942;30237576		False	3	100;0;0	2.156	True		ENSG00000104093	ENSG00000104093	HGNC:2938													
DNAJC12	gene	DNAJC12	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000108176	ENSG00000108176	HGNC:28908													
DNAJC19	gene	DNAJC19	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria type 5 MONDO:0012435			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000205981	ENSG00000205981	HGNC:30528													
DNM1	gene	DNM1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 31A, autosomal dominant, MIM# 616346;Developmental and epileptic encephalopathy 31B, autosomal recessive, MIM# 620352			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25262651;27066543;33372033;34172529;36553519;37900685		False	3	100;0;0	2.156	True		ENSG00000106976	ENSG00000106976	HGNC:2972													
DNM1L	gene	DNM1L	ClinGen;Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748		False	3	100;0;0	2.156	True	Other	ENSG00000087470	ENSG00000087470	HGNC:2973													
DNMT3A	gene	DNMT3A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tatton-Brown-Rahman syndrome, MIM#615879;primordial dwarfism with intellectual disability and microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30478443;24614070		False	3	100;0;0	2.156	True		ENSG00000119772	ENSG00000119772	HGNC:2978													
DNMT3B	gene	DNMT3B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	immunodeficiency-centromeric instability-facial anomalies syndrome 1 MONDO:0009454			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000088305	ENSG00000088305	HGNC:2979													
DOCK3	gene	DOCK3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28195318;29130632;30976111		False	3	100;0;0	2.156	True		ENSG00000088538	ENSG00000088538	HGNC:2989													
DOCK4	gene	DOCK4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, DOCK4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38526744		False	3	50;0;50	2.156	True		ENSG00000128512	ENSG00000128512	HGNC:19192													
DOCK6	gene	DOCK6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adams-Oliver syndrome 2, MIM#614219			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000130158	ENSG00000130158	HGNC:19189													
DOCK7	gene	DOCK7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 23 MIM#615859;MONDO:0014371			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24814191;30771731;30807358		False	3	100;0;0	2.156	True		ENSG00000116641	ENSG00000116641	HGNC:19190													
DOHH	gene	DOHH	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, cerebral atrophy, and visual impairment, MIM# 620066			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35858628		False	3	100;0;0	2.156	True		ENSG00000129932	ENSG00000129932	HGNC:28662													
DOLK	gene	DOLK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	DK1-CDG, MONDO:0012556;Congenital disorder of glycosylation, type Im, MIM# 610768			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17273964;22242004;23890587;30653653;28816422;24144945		False	3	100;0;0	2.156	True		ENSG00000175283	ENSG00000175283	HGNC:23406													
DOP1A	gene	DOP1A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DOP1A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42164854;38818041		False	3	100;0;0	2.156	True		ENSG00000083097	ENSG00000083097	HGNC:21194													
DOT1L	gene	DOT1L	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Nil-Deshwan neurodevelopmental syndrome, MIM# 621265			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37827158		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000104885	ENSG00000104885	HGNC:24948													
DPAGT1	gene	DPAGT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ij, MIM# 608093;DPAGT1-CDG MONDO:0011964			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12872255;22492991;22304930;31153949;30653653;30117111		False	3	100;0;0	2.156	True		ENSG00000172269	ENSG00000172269	HGNC:2995													
DPF2	gene	DPF2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 7, MIM#618027			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29429572;31706665		False	3	100;0;0	2.156	True		ENSG00000133884	ENSG00000133884	HGNC:9964													
DPH1	gene	DPH1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental delay with short stature, dysmorphic facial features, and sparse hair, MIM#616901			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29362492;29410513;25558065;26220823		False	3	100;0;0	2.156	True		ENSG00000108963	ENSG00000108963	HGNC:3003													
DPH2	gene	DPH2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental delay with short stature, dysmorphic facial features, and sparse hair 2, MIM# 620062;Diphthamide-deficiency syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32576952;27421267;40130534		False	3	50;50;0	2.156	True		ENSG00000132768	ENSG00000132768	HGNC:3004													
DPH5	gene	DPH5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with short stature, prominent forehead, and feeding difficulties	620070"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000117543	ENSG00000117543	HGNC:24270													
DPM1	gene	DPM1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ie, MIM# 608799			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10642602;23856421;16641202;15669674;10642597		False	3	100;0;0	2.156	True		ENSG00000000419	ENSG00000000419	HGNC:3005													
DPM2	gene	DPM2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Iu, MIM#615042			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23109149		False	3	100;0;0	2.156	True		ENSG00000136908	ENSG00000136908	HGNC:3006													
DPYS	gene	DPYS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dihydropyrimidinuria, MIM#222748			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000147647	ENSG00000147647	HGNC:3013													
DPYSL5	gene	DPYSL5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ritscher-Schinzel syndrome 4, MIM# 619435;Neurodevelopmental disorder with corpus callosum agenesis and cerebellar abnormalities			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33894126		False	3	100;0;0	2.156	True		ENSG00000157851	ENSG00000157851	HGNC:20637													
DRD1	gene	DRD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DRD1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41966088;37048120		False	3	100;0;0	2.156	True		ENSG00000184845	ENSG00000184845	HGNC:3020													
DRG1	gene	DRG1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Tan-Almurshedi syndrome, MIM# 620641			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37179472		False	3	100;0;0	2.156	True		ENSG00000185721	ENSG00000185721	HGNC:3029													
DSCAM	gene	DSCAM	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), DSCAM-related;Autism MONDO:0005260			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42063257;28600779;33170561;34253863;32807774;21904980;28191889;27824329;30095639;23671607		False	3	100;0;0	2.156	True		ENSG00000171587	ENSG00000171587	HGNC:3039													
DTYMK	gene	DTYMK	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, with progressive microcephaly (MIM# 619847)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31271740;34918187		False	3	50;0;50	2.156	True		ENSG00000168393	ENSG00000168393	HGNC:3061													
DYM	gene	DYM	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dyggve-Melchior-Clausen disease, MIM#223800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000141627	ENSG00000141627	HGNC:21317													
DYNC1H1	gene	DYNC1H1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	dyneinopathy MONDO:1040031			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000197102	ENSG00000197102	HGNC:2961													
DYNC1I2	gene	DYNC1I2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with microcephaly and structural brain anomalies	, MIM#618492"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31079899		False	3	100;0;0	2.156	True		ENSG00000077380	ENSG00000077380	HGNC:2964													
DYRK1A	gene	DYRK1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 7 (MIM#614104)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25707398		False	3	100;0;0	2.156	True		ENSG00000157540	ENSG00000157540	HGNC:3091													
EARS2	gene	EARS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 12, MIM#614924			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22492562		False	3	100;0;0	2.156	True		ENSG00000103356	ENSG00000103356	HGNC:29419													
EBF3	gene	EBF3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypotonia, ataxia, and delayed development syndrome, MIM# 617330			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28017373;28017372;28017370;32366537		False	3	100;0;0	2.156	True		ENSG00000108001	ENSG00000108001	HGNC:19087													
EBP	gene	EBP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Chondrodysplasia punctata, X-linked dominant MIM#302960;Conradi-Hunermann syndrome;MEND syndrome, MIM#300960			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000147155	ENSG00000147155	HGNC:3133													
EDEM3	gene	EDEM3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type 2V, MIM# 619493			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34143952		False	3	100;0;0	2.156	True		ENSG00000116406	ENSG00000116406	HGNC:16787													
EED	gene	EED	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cohen-Gibson syndrome, MIM# 617561			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25787343;27193220;27868325;28229514		False	3	100;0;0	2.156	True		ENSG00000074266	ENSG00000074266	HGNC:3188													
EEF1A2	gene	EEF1A2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 38, MIM# 616393;MONDO:0014617;Developmental and epileptic encephalopathy 33, MIM# 616409;MONDO:0014625			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24697219;32196822;32160274;32062104;31893083		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000101210	ENSG00000101210	HGNC:3192													
EEF1B2	gene	EEF1B2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092;non-syndromic ID and seizures;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31845318;21937992;35015920		False	3	50;50;0	2.156	True		ENSG00000114942	ENSG00000114942	HGNC:3208													
EEF1D	gene	EEF1D	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092, EEF1D-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38083972;36576126;30787422;28097321		False	3	50;50;0	2.156	True		ENSG00000104529	ENSG00000104529	HGNC:3211													
EEF2	gene	EEF2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder;macrocephaly;hydrocephalus			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33355653		False	3	100;0;0	2.156	True		ENSG00000167658	ENSG00000167658	HGNC:3214													
EEFSEC	gene	EEFSEC	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39753114		False	3	100;0;0	2.156	True		ENSG00000132394	ENSG00000132394	HGNC:24614													
EFTUD2	gene	EFTUD2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mandibulofacial dysostosis, Guion-Almeida type, MIM# 610536;Mandibulofacial dysostosis-microcephaly syndrome MONDO:0012516			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22305528;23188108;33601405;33262786;26507355		False	3	100;0;0	2.156	True		ENSG00000108883	ENSG00000108883	HGNC:30858													
EHMT1	gene	EHMT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Kleefstra syndrome 1, MIM# 610253;MONDO:0027407			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16826528;19264732;19293338;22670143;30448833		False	3	100;0;0	2.156	True		ENSG00000181090	ENSG00000181090	HGNC:24650													
EHMT2	gene	EHMT2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Kleefstra syndrome, MONDO:0012455, EHMT2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42434347;42386776;39674972		False	3	100;0;0	2.156	True		ENSG00000204371	ENSG00000204371	HGNC:14129													
EIF1AX	gene	EIF1AX	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder, MONDO:0700092, EIF1AX-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42337333		False	3	100;0;0	2.156	True		ENSG00000173674	ENSG00000173674	HGNC:3250													
EIF2AK2	gene	EIF2AK2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32197074		False	3	100;0;0	2.156	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
EIF2AK3	gene	EIF2AK3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20202148		False	3	100;0;0	2.156	True		ENSG00000172071	ENSG00000172071	HGNC:3255													
EIF2S3	gene	EIF2S3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	MEHMO syndrome, MIM# 300148			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23063529;27333055;28055140;32799315		False	3	100;0;0	2.156	True		ENSG00000130741	ENSG00000130741	HGNC:3267													
EIF3A	gene	EIF3A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disease (MONDO:0002254), EIF3A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41033306		False	3	100;0;0	2.156	True		ENSG00000107581	ENSG00000107581	HGNC:3271													
EIF3B	gene	EIF3B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disease (MONDO:0002254), EIF3B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41033306		False	3	100;0;0	2.156	True		ENSG00000106263	ENSG00000106263	HGNC:3280													
EIF3F	gene	EIF3F	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mental retardation, autosomal recessive 67, MIM#	618295"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30409806;33736665		False	3	100;0;0	2.156	True		ENSG00000175390	ENSG00000175390	HGNC:3275													
EIF4A2	gene	EIF4A2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36528028		False	3	100;0;0	2.156	True	Other	ENSG00000156976	ENSG00000156976	HGNC:3284													
EIF4A3	gene	EIF4A3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Robin sequence with cleft mandible and limb anomalies, MIM# 268305;Richieri-Costa-Pereira syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24360810		False	3	100;0;0	2.156	True		ENSG00000141543	ENSG00000141543	HGNC:18683													
EIF5A	gene	EIF5A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Faundes-Banka syndrome, MIM# 619376;Intellectual disability;microcephaly;dysmorphism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33547280		False	3	100;0;0	2.156	True		ENSG00000132507	ENSG00000132507	HGNC:3300													
EIPR1	gene	EIPR1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with spasticity, hypoplasia of the corpus callosum, and recurrent infections, MIM# 621622			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41058046		False	3	100;0;0	2.156	True		ENSG00000032389	ENSG00000032389	HGNC:12383													
ELAC2	gene	ELAC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 17, MIM#615440			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23849775;31045291		False	3	100;0;0	2.156	True		ENSG00000006744	ENSG00000006744	HGNC:14198													
ELAVL2	gene	ELAVL2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ELAVL2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42556336		False	3	100;0;0	2.156	True		ENSG00000107105	ENSG00000107105	HGNC:3313													
ELOVL4	gene	ELOVL4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	congenital ichthyosis-intellectual disability-spastic quadriplegia syndrome MONDO:0013760			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37592902		False	3	100;0;0	2.156	True		ENSG00000118402	ENSG00000118402	HGNC:14415													
ELP2	gene	ELP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	intellectual disability, autosomal recessive 58 MONDO:0014996			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33510603: 33976153: 33393008: 34653680: 25847581		False	3	100;0;0	2.156	True		ENSG00000134759	ENSG00000134759	HGNC:18248													
EMC1	gene	EMC1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Cerebellar atrophy, visual impairment, and psychomotor retardation, MIM#	616875"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26942288;29271071;35234901		False	3	100;0;0	2.156	True		ENSG00000127463	ENSG00000127463	HGNC:28957													
EMC10	gene	EMC10	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with dysmorphic facies and variable seizures, MIM# 619264			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33531666;35684946;37318954;40150819		False	3	50;0;50	2.156	True		ENSG00000161671	ENSG00000161671	HGNC:27609													
EML1	gene	EML1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Band heterotopia (MIM# 600348)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31710781		False	3	100;0;0	2.156	True		ENSG00000066629	ENSG00000066629	HGNC:3330													
ENTPD1	gene	ENTPD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 64, autosomal recessive, MIM#	615683"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35471564		False	3	100;0;0	2.156	True		ENSG00000138185	ENSG00000138185	HGNC:3363													
EP300	gene	EP300	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Rubinstein-Taybi syndrome MONDO:0019188			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:004751		False	3	100;0;0	2.156	True		ENSG00000100393	ENSG00000100393	HGNC:3373													
EP400	gene	EP400	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder with or without early-onset generalized epilepsy - MONDO:0030930			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39708813		False	3	100;0;0	2.156	True		ENSG00000183495	ENSG00000183495	HGNC:11958													
EPB41L3	gene	EPB41L3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities MONDO:0030063			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39292993		False	3	100;0;0	2.156	True		ENSG00000082397	ENSG00000082397	HGNC:3380													
EPG5	gene	EPG5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Vici syndrome, MIM# 242840			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23222957;26917586;41053928;36410285;40192014		False	3	100;0;0	2.156	True		ENSG00000152223	ENSG00000152223	HGNC:29331													
EPRS1	gene	EPRS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 15 (MIM#617951)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29576217, 36411955		False	3	100;0;0	2.156	True		ENSG00000136628	ENSG00000136628	HGNC:3418													
ERCC1	gene	ERCC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrooculofacioskeletal syndrome 4, MIM# 610758;MONDO:0012554			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17273966;23623389;32557569;26085086;33315086		False	3	100;0;0	2.156	True		ENSG00000012061	ENSG00000012061	HGNC:3433													
ERCC2	gene	ERCC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	xeroderma pigmentosum group D MONDO:0010212;trichothiodystrophy 1, photosensitive MONDO:0011125;cerebrooculofacioskeletal syndrome 2 MONDO:0012553			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301571		False	3	100;0;0	2.156	True		ENSG00000104884	ENSG00000104884	HGNC:3434													
ERCC3	gene	ERCC3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	xeroderma pigmentosum group B MONDO:0012531			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301571		False	3	100;0;0	2.156	True		ENSG00000163161	ENSG00000163161	HGNC:3435													
ERCC5	gene	ERCC5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrooculofacioskeletal syndrome 3, MIM# 616570;MONDO:0014696;Xeroderma pigmentosum, group G, MIM# 278780;MONDO:0010216			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7951246;9096355;9096355;24700531;33766032;33219753		False	3	100;0;0	2.156	True		ENSG00000134899	ENSG00000134899	HGNC:3437													
ERCC6	gene	ERCC6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne spectrum with or without cerebrooculofacioskeletal syndrome MONDO:0100506			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301516		False	3	100;0;0	2.156	True		ENSG00000225830	ENSG00000225830	HGNC:3438													
ERCC6L2	gene	ERCC6L2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	pancytopenia-developmental delay syndrome MONDO:0014317			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24507776;27185855;28815563;29633571;36790458		False	3	50;50;0	2.156	True		ENSG00000182150	ENSG00000182150	HGNC:26922													
ERCC8	gene	ERCC8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne syndrome type 1 MONDO:0019569			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301516		False	3	100;0;0	2.156	True		ENSG00000049167	ENSG00000049167	HGNC:3439													
ERF	gene	ERF	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chitayat syndrome, MIM#617180;Craniosynostosis 4, MIM#600775			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	50;0;50	2.156	True		ENSG00000105722	ENSG00000105722	HGNC:3444													
ERI1	gene	ERI1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hoxha-Aliu syndrome, MIM# 620662			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37352860		False	3	100;0;0	2.156	True		ENSG00000104626	ENSG00000104626	HGNC:23994													
ERLIN2	gene	ERLIN2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 18, autosomal recessive, MIM#611225			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000147475	ENSG00000147475	HGNC:1356													
ESAM	gene	ESAM	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with intracranial haemorrhage, seizures, and spasticity, MIM# 620371			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36996813		False	3	100;0;0	2.156	True		ENSG00000149564	ENSG00000149564	HGNC:17474													
ESCO2	gene	ESCO2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Roberts-SC phocomelia syndrome MONDO:0100253			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301332		False	3	100;0;0	2.156	True		ENSG00000171320	ENSG00000171320	HGNC:27230													
ESRRG	gene	ESRRG	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Movement disorder, congenital nonprogressive, with ataxia and eye movement abnormalities, MIM# 621639			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41265451		False	3	100;0;0	2.156	True		ENSG00000196482	ENSG00000196482	HGNC:3474													
ETFA	gene	ETFA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIA, MIM#231680			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000140374	ENSG00000140374	HGNC:3481													
ETFB	gene	ETFB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIB, MIM#231680			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000105379	ENSG00000105379	HGNC:3482													
ETFDH	gene	ETFDH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIC, MIM#231680			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000171503	ENSG00000171503	HGNC:3483													
ETHE1	gene	ETHE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ethylmalonic encephalopathy , MIM#602473			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	14732903;28933811		False	3	100;0;0	2.156	True		ENSG00000105755	ENSG00000105755	HGNC:23287													
EXOC7	gene	EXOC7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	brain atrophy;seizures;developmental delay;microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 32103185		False	3	100;0;0	2.156	True		ENSG00000182473	ENSG00000182473	HGNC:23214													
EXOC8	gene	EXOC8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder with microcephaly, seizures, and brain atrophy MONDO:0033662			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32103185;22700954;36344539;35460391		False	3	100;0;0	2.156	True		ENSG00000116903	ENSG00000116903	HGNC:24659													
EXOSC3	gene	EXOSC3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 1B, MIM# 614678			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22544365;23975261;25149867;23284067		False	3	100;0;0	2.156	True		ENSG00000107371	ENSG00000107371	HGNC:17944													
EXOSC8	gene	EXOSC8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 1C, MIM#616081			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24989451;29656927		False	3	100;0;0	2.156	True		ENSG00000120699	ENSG00000120699	HGNC:17035													
EXT2	gene	EXT2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seizures, scoliosis, and macrocephaly syndrome, MIM#616682			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30288735;30075207;26246518		False	3	100;0;0	2.156	True		ENSG00000151348	ENSG00000151348	HGNC:3513													
EXTL3	gene	EXTL3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunoskeletal dysplasia with neurodevelopmental abnormalities, MIM# 617425			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28132690;28148688		False	3	100;0;0	2.156	True		ENSG00000012232	ENSG00000012232	HGNC:3518													
EZH1	gene	EZH1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), EZH1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37433783		False	3	100;0;0	2.156	True		ENSG00000108799	ENSG00000108799	HGNC:3526													
EZH2	gene	EZH2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Weaver syndrome MIM#277590			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29244146;23865096		False	3	100;0;0	2.156	True		ENSG00000106462	ENSG00000106462	HGNC:3527													
FAM149B1	gene	FAM149B1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert;Ciliopathy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30905400		False	3	100;0;0	2.156	True		ENSG00000138286	ENSG00000138286	HGNC:29162													
FAM177A1	gene	FAM177A1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with white matter abnormalities and gait disturbance, MIM# 621152			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38767059, 25558065		False	3	100;0;0	2.156	True		ENSG00000151327	ENSG00000151327	HGNC:19829													
FAM20C	gene	FAM20C	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	lethal osteosclerotic bone dysplasia MONDO:0009821			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34360805		False	3	100;0;0	2.156	True		ENSG00000177706	ENSG00000177706	HGNC:22140													
FAM50A	gene	FAM50A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mental retardation syndrome, X-linked, Armfield type (MIM #300261)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32703943		False	3	100;0;0	2.156	True		ENSG00000071859	ENSG00000071859	HGNC:18786													
FAR1	gene	FAR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#616154;Cataracts, spastic paraparesis, and speech delay, MIM#619338			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25439727;33239752		False	3	100;0;0	2.156	True		ENSG00000197601	ENSG00000197601	HGNC:26222													
FARS2	gene	FARS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 14, MIM#614946			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22499341;22833457		False	3	100;0;0	2.156	True		ENSG00000145982	ENSG00000145982	HGNC:21062													
FARSA	gene	FARSA	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Rajab interstitial lung disease with brain calcifications 2			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33598926		False	3	100;0;0	2.156	True		ENSG00000179115	ENSG00000179115	HGNC:3592													
FARSB	gene	FARSB	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Rajab syndrome, MIM#613658;interstitial lung disease;brain calcifications;microcephaly;intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29573043;19161147;29979980;30014610		False	3	100;0;0	2.156	True		ENSG00000116120	ENSG00000116120	HGNC:17800													
FASTKD2	gene	FASTKD2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, MIM#220110			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18771761;28499982;31944455;34234304		False	3	50;50;0	2.156	True		ENSG00000118246	ENSG00000118246	HGNC:29160													
FASTKD5	gene	FASTKD5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 24, MIM# 621431			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40499538		False	3	100;0;0	2.156	True		ENSG00000215251	ENSG00000215251	HGNC:25790													
FAT4	gene	FAT4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hennekam syndrome MONDO:0016256;van Maldergem syndrome MONDO:0017813			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29681106		False	3	100;0;0	2.156	True		ENSG00000196159	ENSG00000196159	HGNC:23109													
FBRSL1	gene	FBRSL1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Malformation and intellectual disability syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 32424618		False	3	100;0;0	2.156	True		ENSG00000112787	ENSG00000112787	HGNC:29308													
FBXL3	gene	FBXL3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with short stature, facial anomalies, and speech defects;OMIM #606220			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 30481285		False	3	0;100;0	2.156	True		ENSG00000005812	ENSG00000005812	HGNC:13599													
FBXL4	gene	FBXL4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome MONDO:0009723			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28383868		False	3	100;0;0	2.156	True		ENSG00000112234	ENSG00000112234	HGNC:13601													
FBXO11	gene	FBXO11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual Developmental Disorder with Dysmorphic Facies and Behavioural Abnormalities, MIM#618089			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30679813;30057029;29796876		False	3	100;0;0	2.156	True		ENSG00000138081	ENSG00000138081	HGNC:13590													
FBXO22	gene	FBXO22	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, FBXO22-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40215970		False	3	100;0;0	2.156	True		ENSG00000167196	ENSG00000167196	HGNC:13593													
FBXO28	gene	FBXO28	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 100, MIM# 619777			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33280099		False	3	100;0;0	2.156	True		ENSG00000143756	ENSG00000143756	HGNC:29046													
FBXO31	gene	FBXO31	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 45, MIM#615979;Spastic-dystonic cerebral palsy, de novo dominant			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24623383;32989326;33675180		False	3	50;50;0	2.156	True	Other	ENSG00000103264	ENSG00000103264	HGNC:16510													
FBXW11	gene	FBXW11	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental, eye, jaw, and digital syndrome (NDEJD), MIM#618914;Intellectual disability;developmental eye anomalies;digital anomalies			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31402090		False	3	100;0;0	2.156	True		ENSG00000072803	ENSG00000072803	HGNC:13607													
FBXW7	gene	FBXW7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay, hypotonia, and impaired language, MIM# 620012			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194		False	3	100;0;0	2.156	True		ENSG00000109670	ENSG00000109670	HGNC:16712													
FCSK	gene	FCSK	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation with defective fucosylation 2, MIM# 618324			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30503518;35718084;36426412		False	3	0;100;0	2.156	True		ENSG00000157353	ENSG00000157353	HGNC:29500													
FDFT1	gene	FDFT1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Squalene synthase deficiency, MIM#618156			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29909962		False	3	100;0;0	2.156	True		ENSG00000079459	ENSG00000079459	HGNC:3629													
FDXR	gene	FDXR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887;Auditory neuropathy and optic atrophy, MIM# 617717			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30250212;29040572;33348459;37046037;37481223		False	3	100;0;0	2.156	True		ENSG00000161513	ENSG00000161513	HGNC:3642													
FEM1B	gene	FEM1B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with behavioral, ear, and skeletal abnormalities, MIM# 621263			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31036916;38465576		False	3	100;0;0	2.156	True		ENSG00000169018	ENSG00000169018	HGNC:3649													
FERRY3	gene	FERRY3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 66 MIM#618221			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34967075;31334606;27311568;25558065;28097321		False	3	100;0;0	2.156	True		ENSG00000047621	ENSG00000047621	HGNC:1184													
FEZF2	gene	FEZF2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, FEZF2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38425142		False	3	100;0;0	2.156	True		ENSG00000153266	ENSG00000153266	HGNC:13506													
FGD1	gene	FGD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Aarskog-Scott syndrome, MIM # 305400;Mental retardation, X-linked syndromic 16, MIM# 305400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7954831;20082460		False	3	100;0;0	2.156	True		ENSG00000102302	ENSG00000102302	HGNC:3663													
FGF12	gene	FGF12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 47, MIM# 617166			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32645220;27164707;27830185;27872899		False	3	100;0;0	2.156	True		ENSG00000114279	ENSG00000114279	HGNC:3668													
FGF13	gene	FGF13	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 90, MIM# 301058;Intellectual developmental disorder, X-linked 110, MIM# 301095			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33245860;34184986		False	3	100;0;0	2.156	True	Other	ENSG00000129682	ENSG00000129682	HGNC:3670													
FGF14	gene	FGF14	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 27, MIM# 609307;Vestibulocerebellar disorder with predominant ocular signs, MIM# 193003			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000102466	ENSG00000102466	HGNC:3671													
FGFR1	gene	FGFR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hartsfield syndrome, MIM# 615465			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23812909		False	3	100;0;0	2.156	True		ENSG00000077782	ENSG00000077782	HGNC:3688													
FGFR3	gene	FGFR3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	CATSHL syndrome 610474;Hypochondroplasia 146000;SADDAN 616482;Muenke syndrome 602849;Thanatophoric dysplasia, type I 187600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000068078	ENSG00000068078	HGNC:3690													
FH	gene	FH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fumarase deficiency (MIM# 606812)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31746132;29052812;21560188		False	3	100;0;0	2.156	True		ENSG00000091483	ENSG00000091483	HGNC:3700													
FIBP	gene	FIBP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thauvin-Robinet-Faivre syndrome, MIM#617107			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40099975;37876348;36919607;27183861;26660953		False	3	100;0;0	2.156	True		ENSG00000172500	ENSG00000172500	HGNC:3705													
FIG4	gene	FIG4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease MONDO:0015626			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32385905;34122524;36529678		False	3	100;0;0	2.156	True		ENSG00000112367	ENSG00000112367	HGNC:16873													
FITM2	gene	FITM2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Siddiqi syndrome MIM#618635			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28067622;30214770;30288795		False	3	100;0;0	2.156	True		ENSG00000197296	ENSG00000197296	HGNC:16135													
FKRP	gene	FKRP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	myopathy caused by variation in FKRP MONDO:0700066			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33200426;11053680;12654965;14652796;15121789		False	3	100;0;0	2.156	True		ENSG00000181027	ENSG00000181027	HGNC:17997													
FKTN	gene	FKTN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy caused by variation in FKTN MONDO:0700067			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301385		False	3	100;0;0	2.156	True		ENSG00000106692	ENSG00000106692	HGNC:3622													
FLNA	gene	FLNA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Heterotopia, periventricular, 1, MIM#	300049"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:004863		False	3	100;0;0	2.156	True		ENSG00000196924	ENSG00000196924	HGNC:3754													
FLVCR1	gene	FLVCR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, FLVCR1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39306721		False	3	50;0;50	2.156	True		ENSG00000162769	ENSG00000162769	HGNC:24682													
FLVCR2	gene	FLVCR2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30712878;20206334;20518025;20690116;25677735		False	3	100;0;0	2.156	True		ENSG00000119686	ENSG00000119686	HGNC:20105													
FMN2	gene	FMN2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 47, MIM#616193			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25480035;32162566;24161494		False	3	100;0;0	2.156	True		ENSG00000155816	ENSG00000155816	HGNC:14074													
FMR1	gene	FMR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	fragile X syndrome MONDO:0010383			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:004870		False	3	100;0;0	2.156	True		ENSG00000102081	ENSG00000102081	HGNC:3775													
FOLR1	gene	FOLR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration due to cerebral folate transport deficiency, MIM# 613068			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19732866;30420205;27743887		False	3	100;0;0	2.156	True		ENSG00000110195	ENSG00000110195	HGNC:3791													
FOSL2	gene	FOSL2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Aplasia cutis-enamel dysplasia syndrome, MIM# 620789			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36197437		False	3	100;0;0	2.156	True		ENSG00000075426	ENSG00000075426	HGNC:3798													
FOXG1	gene	FOXG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	FOXG1 disorder MONDO:0100040			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18571142;19578037;19564653;28661489		False	3	100;0;0	2.156	True		ENSG00000176165	ENSG00000176165	HGNC:3811													
FOXP1	gene	FOXP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation with language impairment and with or without autistic features, MIM# 613670			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26633542;28741757;34109629		False	3	100;0;0	2.156	True		ENSG00000114861	ENSG00000114861	HGNC:3823													
FOXP2	gene	FOXP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Speech-language disorder-1, MIM# 602081			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15877281;15983371;27336128		False	3	100;0;0	2.156	True		ENSG00000128573	ENSG00000128573	HGNC:13875													
FOXP4	gene	FOXP4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092), FOXP4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33110267;36301021		False	3	0;100;0	2.156	True		ENSG00000137166	ENSG00000137166	HGNC:20842													
FOXRED1	gene	FOXRED1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease MONDO:0044970			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31434271;20818383;20858599		False	3	100;0;0	2.156	True		ENSG00000110074	ENSG00000110074	HGNC:26927													
FRA10AC1	gene	FRA10AC1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with growth retardation, dysmorphic facies, and corpus callosum abnormalities, MIM# 620113			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34694367		False	3	100;0;0	2.156	True		ENSG00000148690	ENSG00000148690	HGNC:1162													
FRAS1	gene	FRAS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fraser syndrome 1, MIM#219000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000138759	ENSG00000138759	HGNC:19185													
FRMD5	gene	FRMD5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36206744		False	3	100;0;0	2.156	True		ENSG00000171877	ENSG00000171877	HGNC:28214													
FRMPD4	gene	FRMPD4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked 104, MIM#300983			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25644381;29267967		False	3	100;0;0	2.156	True		ENSG00000169933	ENSG00000169933	HGNC:29007													
FRRS1L	gene	FRRS1L	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 37, MIM#616981			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27236917;27239025		False	3	100;0;0	2.156	True		ENSG00000260230	ENSG00000260230	HGNC:1362													
FSD1L	gene	FSD1L	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures, spastic tetraparesis, and vision impairment, MIM# 621643			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41720098		False	3	100;0;0	2.156	True		ENSG00000106701	ENSG00000106701	HGNC:13753													
FTO	gene	FTO	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Growth retardation, developmental delay, facial dysmorphism, MIM# 612938			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19559399;26378117;26697951;26378117;26740239		False	3	100;0;0	2.156	True		ENSG00000140718	ENSG00000140718	HGNC:24678													
FTSJ1	gene	FTSJ1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Intellectual developmental disorder, X-linked 9, MIM#	309549;X-linked complex neurodevelopmental disorder MONDO:0100148"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:004892		False	3	100;0;0	2.156	True		ENSG00000068438	ENSG00000068438	HGNC:13254													
FUCA1	gene	FUCA1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fucosidosis MONDO:0009254			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33266441		False	3	100;0;0	2.156	True		ENSG00000179163	ENSG00000179163	HGNC:4006													
FUT8	gene	FUT8	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation with defective fucosylation 1, MIM#618005			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29304374		False	3	100;0;0	2.156	True		ENSG00000033170	ENSG00000033170	HGNC:4019													
FZR1	gene	FZR1	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 109, MIM# 620145			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34788397		False	3	100;0;0	2.156	True		ENSG00000105325	ENSG00000105325	HGNC:24824													
GABBR1	gene	GABBR1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with language delay and variable cognitive abnormalities, MIM#620502			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36103875		False	3	100;0;0	2.156	True		ENSG00000204681	ENSG00000204681	HGNC:4070													
GABBR2	gene	GABBR2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with poor language and loss of hand skills, 617903			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29100083;28061363;28135719;28856709;29369404;29377213		False	3	100;0;0	2.156	True		ENSG00000136928	ENSG00000136928	HGNC:4507													
GABRA1	gene	GABRA1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 19 615744;Rett syndrome;Rett-like phenotypes;idiopathic generalized Epilepsy;Dravet syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11992121;21714819;24623842;30842224		False	3	100;0;0	2.156	True		ENSG00000022355	ENSG00000022355	HGNC:4075													
GABRA2	gene	GABRA2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 78, 618557			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29422393;29961870;31032849;31032848		False	3	100;0;0	2.156	True		ENSG00000151834	ENSG00000151834	HGNC:4076													
GABRA3	gene	GABRA3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Epilepsy, X-linked 2, with or without impaired intellectual development and dysmorphic features, MIM# 301091			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 29053855		False	3	100;0;0	2.156	True		ENSG00000011677	ENSG00000011677	HGNC:4077													
GABRA4	gene	GABRA4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, GABRA4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38565639		False	3	100;0;0	2.156	True		ENSG00000109158	ENSG00000109158	HGNC:4078													
GABRA5	gene	GABRA5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 79;OMIM #618559			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31056671;29961870		False	3	100;0;0	2.156	True		ENSG00000186297	ENSG00000186297	HGNC:4079													
GABRB2	gene	GABRB2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38996765		False	3	100;0;0	2.156	True		ENSG00000145864	ENSG00000145864	HGNC:4082													
GABRB3	gene	GABRB3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 43, MIM# 617113			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23934111;27476654		False	3	100;0;0	2.156	True		ENSG00000166206	ENSG00000166206	HGNC:4083													
GABRD	gene	GABRD	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Epilepsy;Susceptibility to epilepsy, MIM#613060			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15115768;34633442		False	3	100;0;0	2.156	True		ENSG00000187730	ENSG00000187730	HGNC:4084													
GABRG2	gene	GABRG2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 74 618396;Epilepsy, generalized, with febrile seizures plus, type 3 607681			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11326274;11326275;27864268		False	3	100;0;0	2.156	True		ENSG00000113327	ENSG00000113327	HGNC:4087													
GAD1	gene	GAD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 89, MIM# 619124			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15571623;32282878		False	3	100;0;0	2.156	True		ENSG00000128683	ENSG00000128683	HGNC:4092													
GALC	gene	GALC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Krabbe disease MONDO:000949			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301416		False	3	100;0;0	2.156	True		ENSG00000054983	ENSG00000054983	HGNC:4115													
GALE	gene	GALE	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	galactose epimerase deficiency MONDO:0009257			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21290786		False	3	100;0;0	2.156	True		ENSG00000117308	ENSG00000117308	HGNC:4116													
GALNT2	gene	GALNT2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32293671		False	3	100;0;0	2.156	True		ENSG00000143641	ENSG00000143641	HGNC:4124													
GALT	gene	GALT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galactosemia, MIM#230400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000213930	ENSG00000213930	HGNC:4135													
GAMT	gene	GAMT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	guanidinoacetate methyltransferase deficiency MONDO:0012999			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301745		False	3	100;0;0	2.156	True		ENSG00000130005	ENSG00000130005	HGNC:4136													
GATA6	gene	GATA6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Pancreatic agenesis and congenital heart defects, MIM#600001			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22158542		False	3	100;0;0	2.156	True		ENSG00000141448	ENSG00000141448	HGNC:4174													
GATAD2A	gene	GATAD2A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, GATAD2A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://doi.org/10.1016/j.xhgg.2023.100198;17565372		False	3	100;0;0	2.156	True		ENSG00000167491	ENSG00000167491	HGNC:29989													
GATAD2B	gene	GATAD2B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 18, OMIM # 615074			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31949314		False	3	100;0;0	2.156	True		ENSG00000143614	ENSG00000143614	HGNC:30778													
GATM	gene	GATM	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral creatine deficiency syndrome 3, MIM# 612718			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12468279;20682460;22386973		False	3	100;0;0	2.156	True		ENSG00000171766	ENSG00000171766	HGNC:4175													
GCDH	gene	GCDH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric aciduria, type I MIM#231670			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000105607	ENSG00000105607	HGNC:4189													
GCH1	gene	GCH1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GTP cyclohydrolase I deficiency with hyperphenylalaninemia MONDO:0100186			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22473768;7869202		False	3	100;0;0	2.156	True		ENSG00000131979	ENSG00000131979	HGNC:4193													
GCSH	gene	GCSH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multiple mitochondrial dysfunctions syndrome 7, MIM#	620423"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	1671321;36190515		False	3	50;0;50	2.156	True		ENSG00000140905	ENSG00000140905	HGNC:4208													
GDI1	gene	GDI1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked 41 MIM#300849			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28863211;22002931;9620768;9668174		False	3	100;0;0	2.156	True		ENSG00000203879	ENSG00000203879	HGNC:4226													
GEMIN4	gene	GEMIN4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, cataracts, and renal abnormalities, MIM# 617913			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25558065;30237576;27878435		False	3	50;50;0	2.156	True		ENSG00000179409	ENSG00000179409	HGNC:15717													
GEMIN5	gene	GEMIN5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, MIM#	619333"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33963192		False	3	100;0;0	2.156	True		ENSG00000082516	ENSG00000082516	HGNC:20043													
GFAP	gene	GFAP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alexander disease MONDO:0008752			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301351		False	3	100;0;0	2.156	True		ENSG00000131095	ENSG00000131095	HGNC:4235													
GFER	gene	GFER	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay (MIM #613076)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28155230		False	3	100;0;0	2.156	True		ENSG00000127554	ENSG00000127554	HGNC:4236													
GFM1	gene	GFM1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome MONDO:0009723			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25852744;31680380;21986555;32776492		False	3	100;0;0	2.156	True		ENSG00000168827	ENSG00000168827	HGNC:13780													
GFM2	gene	GFM2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 39, OMIM #618397			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 22700954;26016410;29075935		False	3	100;0;0	2.156	True		ENSG00000164347	ENSG00000164347	HGNC:29682													
GIGYF1	gene	GIGYF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism spectrum disorder (MONDO:0005258), GIGYF1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194;35917186		False	3	50;50;0	2.156	True		ENSG00000146830	ENSG00000146830	HGNC:9126													
GIGYF2	gene	GIGYF2	Expert Review Green;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, GIGYF2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42297935;18358451;33239198;25279164;20060621;19250854;26152800;19449032		False	3	100;0;0	2.156	True		ENSG00000204120	ENSG00000204120	HGNC:11960													
GIT1	gene	GIT1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, GIT1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42360756		False	3	100;0;0	2.156	True		ENSG00000108262	ENSG00000108262	HGNC:4272													
GJC2	gene	GJC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hypomyelinating leukodystrophy 2 MONDO:0012125;hereditary spastic paraplegia 44 MONDO:0013179			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29276893		False	3	100;0;0	2.156	True		ENSG00000198835	ENSG00000198835	HGNC:17494													
GK	gene	GK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	inborn glycerol kinase deficiency MONDO:0010613;X-linked adrenal hypoplasia congenita MONDO:0010264			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37091526;33212314		False	3	100;0;0	2.156	True		ENSG00000198814	ENSG00000198814	HGNC:4289													
GLB1	gene	GLB1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1 gangliosidosis MONDO:0018149;mucopolysaccharidosis type 4B MONDO:0009660			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24156116		False	3	100;0;0	2.156	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GLDC	gene	GLDC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	glycine encephalopathy MONDO:0011612			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301531		False	3	100;0;0	2.156	True		ENSG00000178445	ENSG00000178445	HGNC:4313													
GLI2	gene	GLI2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	postaxial polydactyly-anterior pituitary anomalies-facial dysmorphism syndrome MONDO:0014369			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24744436		False	3	100;0;0	2.156	True		ENSG00000074047	ENSG00000074047	HGNC:4318													
GLI3	gene	GLI3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Greig cephalopolysyndactyly syndrome MONDO:0008287			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301619;20301638		False	3	100;0;0	2.156	True		ENSG00000106571	ENSG00000106571	HGNC:4319													
GLIS3	gene	GLIS3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Diabetes mellitus, neonatal, with congenital hypothyroidism, MIM#610199			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21139041		False	3	100;0;0	2.156	True		ENSG00000107249	ENSG00000107249	HGNC:28510													
GLRA2	gene	GLRA2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, Pilorge type, MIM# 301076			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26370147;20479760;35294868		False	3	100;0;0	2.156	True		ENSG00000101958	ENSG00000101958	HGNC:4327													
GLS	gene	GLS	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 71, MIM# 618328;Global developmental delay, progressive ataxia, and elevated glutamine, MIM# 618412			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30970188;30239721;30575854		False	3	50;50;0	2.156	True	Other	ENSG00000115419	ENSG00000115419	HGNC:4331													
GLUL	gene	GLUL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Glutamine deficiency, congenital MIM#610015;Developmental and epileptic encephalopathy 116, MIM# 620806			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16267323;21353613;33150193		False	3	100;0;0	2.156	True		ENSG00000135821	ENSG00000135821	HGNC:4341													
GM2A	gene	GM2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Tay-Sachs disease AB variant MONDO:0010099			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33819415;20301397		False	3	100;0;0	2.156	True		ENSG00000196743	ENSG00000196743	HGNC:4367													
GMPPA	gene	GMPPA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	alacrima, achalasia, and intellectual disability syndrome MONDO:0014219			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31898852;35607266		False	3	100;0;0	2.156	True		ENSG00000144591	ENSG00000144591	HGNC:22923													
GMPPB	gene	GMPPB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	myopathy caused by variation in GMPPB MONDO:0700084			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23768512;26133662;27147698		False	3	100;0;0	2.156	True		ENSG00000173540	ENSG00000173540	HGNC:22932													
GNAI1	gene	GNAI1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, impaired speech, and behavioral abnormalities, MIM# 619854			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28135719;33473207		False	3	100;0;0	2.156	True		ENSG00000127955	ENSG00000127955	HGNC:4384													
GNAI2	gene	GNAI2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disease MONDO:0002254, GNAI2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31036916;40926810;39298586;27787898		False	3	50;50;0	2.156	True		ENSG00000114353	ENSG00000114353	HGNC:4385													
GNAO1	gene	GNAO1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 17;Neurodevelopmental disorder with involuntary movements			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28747448;30682224		False	3	100;0;0	2.156	True	Other	ENSG00000087258	ENSG00000087258	HGNC:4389													
GNAS	gene	GNAS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Pseudohypoparathyroidism Ia (103580);Pseudohypoparathyroidism Ib (603233);Pseudohypoparathyroidism Ic (612462);Pseudopseudohypoparathyroidism (612463)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000087460	ENSG00000087460	HGNC:4392													
GNB1	gene	GNB1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 42, MIM# 616973			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27108799;30194818;27668284;31034681		False	3	100;0;0	2.156	True		ENSG00000078369	ENSG00000078369	HGNC:4396													
GNB2	gene	GNB2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Neurodevelopmental disorder with hypotonia and dysmorphic facies, MIM#	619503"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31698099;33971351;34183358;33057194		False	3	67;33;0	2.156	True		ENSG00000172354	ENSG00000172354	HGNC:4398													
GNB5	gene	GNB5	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	gnb5-related intellectual disability-cardiac arrhythmia syndrome MONDO:0014953;Lodder-Merla syndrome, type 1, with impaired intellectual development and cardiac arrhythmia (MIM#617173);Lodder-Merla syndrome, type 2, with developmental delay and with or without cardiac arrhythmia (MIM#617182)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27523599;27677260;28697420;29368331		False	3	100;0;0	2.156	True		ENSG00000069966	ENSG00000069966	HGNC:4401													
GNE	gene	GNE	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Sialuria, MIM#269921			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000159921	ENSG00000159921	HGNC:23657													
GNPAT	gene	GNPAT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	glyceronephosphate O-acyltransferase deficiency MONDO:0100273			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9843043;19270340;21990100		False	3	100;0;0	2.156	True		ENSG00000116906	ENSG00000116906	HGNC:4416													
GNPTAB	gene	GNPTAB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GNPTAB-mucolipidosis MONDO:0100122			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301728		False	3	0;0;0	2.156	True		ENSG00000111670	ENSG00000111670	HGNC:29670													
GNPTG	gene	GNPTG	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucolipidosis III gamma, MIM# 252605;MONDO:0009652			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10712439;19370764;19659762;33507475;33023972;32651481		False	3	100;0;0	2.156	True		ENSG00000090581	ENSG00000090581	HGNC:23026													
GNS	gene	GNS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	mucopolysaccharidosis type 3D MONDO:0009658			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31536183;25851924;17998446;6450420		False	3	100;0;0	2.156	True		ENSG00000135677	ENSG00000135677	HGNC:4422													
GOLGA2	gene	GOLGA2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental delay with hypotonia, myopathy, and brain abnormalities, MIM 620240			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30237576;26742501;34424553		False	3	50;50;0	2.156	True		ENSG00000167110	ENSG00000167110	HGNC:4425													
GON4L	gene	GON4L	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Li-Takada-Miyake syndrome, MIM# 621212			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39500882;21937992		False	3	100;0;0	2.156	True		ENSG00000116580	ENSG00000116580	HGNC:25973													
GOT2	gene	GOT2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 82, MIM#	618721"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31422819		False	3	100;0;0	2.156	True		ENSG00000125166	ENSG00000125166	HGNC:4433													
GPAA1	gene	GPAA1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 15, MIM# 617810			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29100095		False	3	100;0;0	2.156	True		ENSG00000197858	ENSG00000197858	HGNC:4446													
GPATCH11	gene	GPATCH11	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, GPATCH11-related;Leber congenital amaurosis and developmental delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39572588		False	3	100;0;0	2.156	True		ENSG00000152133	ENSG00000152133	HGNC:26768													
GPC3	gene	GPC3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Simpson-Golabi-Behmel syndrome MONDO:0010731			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:004990		False	3	100;0;0	2.156	True		ENSG00000147257	ENSG00000147257	HGNC:4451													
GPC4	gene	GPC4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Keipert syndrome OMIM# 301026			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30982611		False	3	100;0;0	2.156	True		ENSG00000076716	ENSG00000076716	HGNC:4452													
GPHN	gene	GPHN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency C, MIM#615501			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11095995;22040219;26613940;24561070;23393157		False	3	50;50;0	2.156	True		ENSG00000171723	ENSG00000171723	HGNC:15465													
GPRC5B	gene	GPRC5B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephalic leukoencephalopathy with subcortical cysts 3 MIM#620447			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37143309		False	3	100;0;0	2.156	True		ENSG00000167191	ENSG00000167191	HGNC:13308													
GPT2	gene	GPT2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27601654;25758935		False	3	100;0;0	2.156	True		ENSG00000166123	ENSG00000166123	HGNC:18062													
GRIA1	gene	GRIA1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal dominant 67, MIM# 619927;Intellectual developmental disorder, autosomal recessive 76, MIM# 619931			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28628100;23033978;26350204;24896178		False	3	100;0;0	2.156	True		ENSG00000155511	ENSG00000155511	HGNC:4571													
GRIA2	gene	GRIA2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with language impairment and behavioral abnormalities, MIM# 618917			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31300657		False	3	100;0;0	2.156	True		ENSG00000120251	ENSG00000120251	HGNC:4572													
GRIA3	gene	GRIA3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, Wu type (MIM#300699)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32977175;17989220;38038360		False	3	100;0;0	2.156	True		ENSG00000125675	ENSG00000125675	HGNC:4573													
GRIA4	gene	GRIA4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35518358;29220673		False	3	100;0;0	2.156	True		ENSG00000152578	ENSG00000152578	HGNC:4574													
GRID2	gene	GRID2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 18 MIM#616204			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32622959;32170608		False	3	100;0;0	2.156	True		ENSG00000152208	ENSG00000152208	HGNC:4576													
GRIK2	gene	GRIK2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 6 MIM#611092;Neurodevelopmental disorder with impaired language and ataxia and with or without seizures MIM#619580			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34375587;17847003;25039795		False	3	100;0;0	2.156	True		ENSG00000164418	ENSG00000164418	HGNC:4580													
GRIN1	gene	GRIN1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 101 , MIM#619814;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29365063;27164704;27164704;28051072;34611970		False	3	100;0;0	2.156	True		ENSG00000176884	ENSG00000176884	HGNC:4584													
GRIN2A	gene	GRIN2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epilepsy, focal, with speech disorder and with or without mental retardation, MIM# 245570			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30544257;35983985		False	3	100;0;0	2.156	True	Other	ENSG00000183454	ENSG00000183454	HGNC:4585													
GRIN2B	gene	GRIN2B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	GRIN2B-related complex neurodevelopmental disorder MONDO:0700350;Developmental and epileptic encephalopathy 27 MIM#616139;Intellectual developmental disorder, autosomal dominant 6, with or without seizures MIM#613970			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28377535		False	3	100;0;0	2.156	True		ENSG00000273079	ENSG00000273079	HGNC:4586													
GRIN2D	gene	GRIN2D	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 46, MIM# 617162;intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27616483;30280376		False	3	100;0;0	2.156	True	Other	ENSG00000105464	ENSG00000105464	HGNC:4588													
GRM1	gene	GRM1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive spinocerebellar ataxia 13 MONDO:0013905			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26308914;22901947;31319223;36675067		False	3	50;50;0	2.156	True		ENSG00000152822	ENSG00000152822	HGNC:4593													
GRM7	gene	GRM7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, microcephaly, developmental delay;neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities (NEDSHBA), MIM#618922			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32286009;32248644		False	3	100;0;0	2.156	True		ENSG00000196277	ENSG00000196277	HGNC:4599													
GSK3B	gene	GSK3B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, GSK3B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39472663		False	3	100;0;0	2.156	True		ENSG00000082701	ENSG00000082701	HGNC:4617													
GSPT2	gene	GSPT2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder, MONDO:0700092, GSPT2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28414775;41420488		False	3	100;0;0	2.156	True		ENSG00000189369	ENSG00000189369	HGNC:4622													
GSS	gene	GSS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutathione synthetase deficiency, MIM# 266130			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000100983	ENSG00000100983	HGNC:4624													
GSX2	gene	GSX2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Diencephalic-mesencephalic junction dysplasia syndrome 2	618646;Intellectual disability;Dystonia;Spastic tetra paresis"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31412107;39119454		False	3	100;0;0	2.156	True		ENSG00000180613	ENSG00000180613	HGNC:24959													
GTF2E2	gene	GTF2E2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trichothiodystrophy 6, nonphotosensitive, MIM# 616943;MONDO:0014841			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28973399;37793898;31064989;28973399		False	3	50;50;0	2.156	True		ENSG00000197265	ENSG00000197265	HGNC:4651													
GTF2H5	gene	GTF2H5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trichothiodystrophy 3, photosensitive MIM#616395			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30359777;24986372		False	3	50;50;0	2.156	True		ENSG00000272047	ENSG00000272047	HGNC:21157													
GTF2I	gene	GTF2I	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, GTF2I-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40962490		False	3	100;0;0	2.156	True		-	ENSG00000263001	HGNC:4659													
GTF3C3	gene	GTF3C3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28940097;28097321;30552426		False	3	100;0;0	2.156	True		ENSG00000119041	ENSG00000119041	HGNC:4666													
GTF3C5	gene	GTF3C5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, GTF3C5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38520561;35503477		False	3	100;0;0	2.156	True		ENSG00000148308	ENSG00000148308	HGNC:4668													
GTPBP1	gene	GTPBP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with characteristic facial and ectodermal features and tetraparesis 1, MIM# 620888			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38118446		False	3	100;0;0	2.156	True		ENSG00000100226	ENSG00000100226	HGNC:4669													
GTPBP2	gene	GTPBP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Jaberi-Elahi syndrome, MIM#617988			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26675814;29449720;30790272		False	3	100;0;0	2.156	True		ENSG00000172432	ENSG00000172432	HGNC:4670													
GTPBP3	gene	GTPBP3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 23, MIM#616198			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34276756;25434004		False	3	100;0;0	2.156	True		ENSG00000130299	ENSG00000130299	HGNC:14880													
GUSB	gene	GUSB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis VII, MIM# 253220;MONDO:0009662			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000169919	ENSG00000169919	HGNC:4696													
H1-4	gene	H1-4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Rahman syndrome, MIM# 617537			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28475857;33270410;31910894;31400068		False	3	100;0;0	2.156	True		ENSG00000168298	ENSG00000168298	HGNC:4718													
H3-3A	gene	H3-3A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bryant-Li-Bhoj neurodevelopmental syndrome 1 MIM#619720			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33268356		False	3	100;0;0	2.156	True		ENSG00000163041	ENSG00000163041	HGNC:4764													
H3-3B	gene	H3-3B	Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bryant-Li-Bhoj neurodevelopmental syndrome 2 MIM#619721			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33268356		False	3	100;0;0	2.156	True		ENSG00000132475	ENSG00000132475	HGNC:4765													
H4C3	gene	H4C3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tessadori-van Haaften neurodevelopmental syndrome 1 MIM#619758			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28920961;35202563		False	3	67;33;0	2.156	True		ENSG00000197061	ENSG00000197061	HGNC:4787													
H4C5	gene	H4C5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tessadori-van Haaften neurodevelopmental syndrome 3, MIM# 619950			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35202563		False	3	100;0;0	2.156	True		-	ENSG00000276966	HGNC:4790													
H4C9	gene	H4C9	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental syndrome, MONDO:0700092, HIST1H4I-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35202563		False	3	100;0;0	2.156	True		-	ENSG00000276180	HGNC:4793													
HACE1	gene	HACE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia and psychomotor retardation with or without seizures, 616756;MONDO:0014764			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26424145;26437029;31321300		False	3	100;0;0	2.156	True		ENSG00000085382	ENSG00000085382	HGNC:21033													
HADHA	gene	HADHA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	long chain 3-hydroxyacyl-CoA dehydrogenase deficiency MONDO:0012173			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36063482		False	3	0;100;0	2.156	True		ENSG00000084754	ENSG00000084754	HGNC:4801													
HADHB	gene	HADHB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trifunctional protein deficiency, MIM#609015			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000138029	ENSG00000138029	HGNC:4803													
HCCS	gene	HCCS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	linear skin defects with multiple congenital anomalies 1 (MONDO:0024552)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18950397		False	3	50;50;0	2.156	True		ENSG00000004961	ENSG00000004961	HGNC:4837													
HCFC1	gene	HCFC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34164576;24011988		False	3	100;0;0	2.156	True		ENSG00000172534	ENSG00000172534	HGNC:4839													
HCN1	gene	HCN1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 24, MIM# 615871;Generalized epilepsy with febrile seizures plus, type 10, MIM# 618482			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24747641;30351409;30351409		False	3	100;0;0	2.156	True		ENSG00000164588	ENSG00000164588	HGNC:4845													
HCN2	gene	HCN2	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO#0700092), HCN2-related;Generalized epilepsy with febrile seizures plus, type 11, MIM# 602477			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	50;50;0	2.156	True		ENSG00000099822	ENSG00000099822	HGNC:4846													
HDAC2	gene	HDAC2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO:0700092), HDAC2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30806031;27620904;38753158		False	3	100;0;0	2.156	True		ENSG00000196591	ENSG00000196591	HGNC:4853													
HDAC3	gene	HDAC3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, HDAC3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39047730		False	3	100;0;0	2.156	True		ENSG00000171720	ENSG00000171720	HGNC:4854													
HDAC4	gene	HDAC4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with central hypotonia and dysmorphic facies MIM#619797;Brachydactyly mental retardation syndrome;Brachydactyly without intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24715439;20691407;31209962;33537682		False	3	50;50;0	2.156	True		ENSG00000068024	ENSG00000068024	HGNC:14063													
HDAC8	gene	HDAC8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Cornelia de Lange syndrome 5, MIM# 300882			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30614194;24403048		False	3	100;0;0	2.156	True		ENSG00000147099	ENSG00000147099	HGNC:13315													
HECTD1	gene	HECTD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 39879987		False	3	100;0;0	2.156	True		ENSG00000092148	ENSG00000092148	HGNC:20157													
HECTD4	gene	HECTD4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures, spasticity, and complete or partial agenesis of the corpus callosum, MIM# 620250			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36401616		False	3	100;0;0	2.156	True		ENSG00000173064	ENSG00000173064	HGNC:26611													
HECW2	gene	HECW2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, seizures, and absent language (MIM#617268)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29807643;29395664;27334371;27389779		False	3	100;0;0	2.156	True	Other	ENSG00000138411	ENSG00000138411	HGNC:29853													
HEPACAM	gene	HEPACAM	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Megalencephalic leukoencephalopathy with subcortical cysts 2A MONDO:0013490;Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without intellectual disability MONDO:0013491			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21419380;24202401;27389245;31372844;21419380;24202401;27322623		False	3	100;0;0	2.156	True		ENSG00000165478	ENSG00000165478	HGNC:26361													
HERC1	gene	HERC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Macrocephaly, dysmorphic facies, and psychomotor retardation, MIM# 617011			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28323226;27108999;26153217;26138117;20041218		False	3	100;0;0	2.156	True		ENSG00000103657	ENSG00000103657	HGNC:4867													
HERC2	gene	HERC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 38, MIM# 615516			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23065719;23243086;30902390;32571899;27848944;26077850;27759030		False	3	50;50;0	2.156	True		ENSG00000128731	ENSG00000128731	HGNC:4868													
HESX1	gene	HESX1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	septooptic dysplasia MONDO:0008428, Pituitary hormone deficiency, combined, 5 MONDO:0013099			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19623216;30888394		False	3	50;50;0	2.156	True		ENSG00000163666	ENSG00000163666	HGNC:4877													
HEXA	gene	HEXA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Tay-Sachs disease MONDO:0010100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301397		False	3	100;0;0	2.156	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
HEXB	gene	HEXB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sandhoff disease MONDO:0010006			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35420740		False	3	100;0;0	2.156	True		ENSG00000049860	ENSG00000049860	HGNC:4879													
HGSNAT	gene	HGSNAT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIIC (Sanfilippo C), MIM# 252930;MONDO:0009657			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19479962;31228227;20825431;20583299		False	3	100;0;0	2.156	True		ENSG00000165102	ENSG00000165102	HGNC:26527													
HIBCH	gene	HIBCH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-hydroxyisobutyryl-CoA hydrolase deficiency MONDO:0009603;Leigh syndrome MONDO:0009723			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24299452;30847210;17160907;26163321;26026795;31523596;32022391;24299452;32677093		False	3	100;0;0	2.156	True		ENSG00000198130	ENSG00000198130	HGNC:4908													
HID1	gene	HID1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 105 with hypopituitarism MIM#619983			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33999436		False	3	100;0;0	2.156	True		ENSG00000167861	ENSG00000167861	HGNC:15736													
HIKESHI	gene	HIKESHI	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 13, MIM# 616881			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34111619;26545878		False	3	100;0;0	2.156	True		ENSG00000149196	ENSG00000149196	HGNC:26938													
HIRA	gene	HIRA	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, HIRA-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33417013;28135719;25363760		False	3	100;0;0	2.156	True		ENSG00000100084	ENSG00000100084	HGNC:4916													
HIVEP2	gene	HIVEP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 43, MIM# 616977			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26153216;27003583;16836985;31602191;31207095		False	3	100;0;0	2.156	True		ENSG00000010818	ENSG00000010818	HGNC:4921													
HK1	gene	HK1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with visual defects and brain anomalies, MIM# 618547			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30778173		False	3	100;0;0	2.156	True	Other	ENSG00000156515	ENSG00000156515	HGNC:4922													
HLCS	gene	HLCS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	holocarboxylase synthetase deficiency MONDO:0009666			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18974016;18429047;12124727		False	3	100;0;0	2.156	True		ENSG00000159267	ENSG00000159267	HGNC:4976													
HMBS	gene	HMBS	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Encephalopathy, porphyria-related	MIM#620704;Leukoencephalopathy, porphyria-related, MIM#620711"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15534187;34089223		False	3	100;0;0	2.156	True		ENSG00000256269	ENSG00000256269	HGNC:4982													
HMGB1	gene	HMGB1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay and microcephaly, no OMIM #			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34164801		False	3	100;0;0	2.156	True		ENSG00000189403	ENSG00000189403	HGNC:4983													
HMGCL	gene	HMGCL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-hydroxy-3-methylglutaric aciduria MONDO:0009520			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36771238;35646072		False	3	0;100;0	2.156	True		ENSG00000117305	ENSG00000117305	HGNC:5005													
HNMT	gene	HNMT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 51, MIM#616739			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26206890;30744146;33310825;33739554		False	3	100;0;0	2.156	True		ENSG00000150540	ENSG00000150540	HGNC:5028													
HNRNPC	gene	HNRNPC	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	intellectual developmental disorder-74, MIM#620688			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37541189		False	3	100;0;0	2.156	True		ENSG00000092199	ENSG00000092199	HGNC:5035													
HNRNPD	gene	HNRNPD	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Complex neurodevelopmental disorder MONDO:0100038, HNRNPD-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194;33874999		False	3	50;50;0	2.156	True		ENSG00000138668	ENSG00000138668	HGNC:5036													
HNRNPH1	gene	HNRNPH1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with craniofacial dysmorphism and skeletal defects, MIM# 620083			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 32335897;29938792		False	3	100;0;0	2.156	True		ENSG00000169045	ENSG00000169045	HGNC:5041													
HNRNPH2	gene	HNRNPH2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, Bain type MIM#300986			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34907471;33728377;31670473;31236915;30887513		False	3	100;0;0	2.156	True		ENSG00000126945	ENSG00000126945	HGNC:5042													
HNRNPK	gene	HNRNPK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder-craniofacial dysmorphism-cardiac defect-hip dysplasia syndrome (Au-Kline syndrome) MONDO:0018681			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:005073		False	3	100;0;0	2.156	True		ENSG00000165119	ENSG00000165119	HGNC:5044													
HNRNPR	gene	HNRNPR	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dysmorphic facies and skeletal and brain abnormalities, MIM# 620073			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31079900		False	3	100;0;0	2.156	True		ENSG00000125944	ENSG00000125944	HGNC:5047													
HNRNPU	gene	HNRNPU	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 54 MIM# 617391			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28944577;28393272		False	3	100;0;0	2.156	True		ENSG00000153187	ENSG00000153187	HGNC:5048													
HOXA1	gene	HOXA1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bosley-Salih-Alorainy syndrome, MIM#601536 and Athabaskan brainstem dysgenesis syndrome, MIM#601536			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:005077		False	3	100;0;0	2.156	True		ENSG00000105991	ENSG00000105991	HGNC:5099													
HPD	gene	HPD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	tyrosinemia type III MONDO:0010162			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31537781		False	3	50;50;0	2.156	True		ENSG00000158104	ENSG00000158104	HGNC:5147													
HPDL	gene	HPDL	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32707086		False	3	100;0;0	2.156	True		ENSG00000186603	ENSG00000186603	HGNC:28242													
HPRT1	gene	HPRT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Lesch-Nyhan syndrome MONDO:0010298			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:005082		False	3	100;0;0	2.156	True		ENSG00000165704	ENSG00000165704	HGNC:5157													
HRAS	gene	HRAS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Costello syndrome, MIM# 218040			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16329078;16372351;16443854		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000174775	ENSG00000174775	HGNC:5173													
HS2ST1	gene	HS2ST1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194;Intellectual disability;dysmorphic features;congenital anomalies			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33159882		False	3	100;0;0	2.156	True		ENSG00000153936	ENSG00000153936	HGNC:5193													
HS6ST2	gene	HS6ST2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	X-linked syndromic intellectual disability MONDO:0020119			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40686562;30471091;36993824;38015989		False	3	100;0;0	2.156	True		ENSG00000171004	ENSG00000171004	HGNC:19133													
HSD17B10	gene	HSD17B10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	HSD10 mitochondrial disease MONDO:0010327			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22132097;17618155		False	3	100;0;0	2.156	True		ENSG00000072506	ENSG00000072506	HGNC:4800													
HSD17B4	gene	HSD17B4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-bifunctional protein deficiency, AR (MIM#261515);Perrault syndrome 1, AR (MIM#233400)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27790638		False	3	100;0;0	2.156	True		ENSG00000133835	ENSG00000133835	HGNC:5213													
HSPD1	gene	HSPD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 4, MIM# 612233			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18571143;27405012;32532876;28377887;27405012;11898127;17420924		False	3	50;50;0	2.156	True		ENSG00000144381	ENSG00000144381	HGNC:5261													
HSPG2	gene	HSPG2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Schwartz-Jampel syndrome, type 1, MIM#255800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000142798	ENSG00000142798	HGNC:5273													
HTRA2	gene	HTRA2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria type 8 MONDO:0044723			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27208207;27696117;30114719;32445293		False	3	100;0;0	2.156	True		ENSG00000115317	ENSG00000115317	HGNC:14348													
HUWE1	gene	HUWE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mental retardation, X-linked syndromic, Turner type			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000086758	ENSG00000086758	HGNC:30892													
HYCC1	gene	HYCC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hypomyelinating leukodystrophy 5 MONDO:0012514			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301737		False	3	100;0;0	2.156	True		ENSG00000122591	ENSG00000122591	HGNC:24587													
IARS1	gene	IARS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Growth retardation, impaired intellectual development, hypotonia, and hepatopathy, MIM#617093			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27426735		False	3	100;0;0	2.156	True		ENSG00000196305	ENSG00000196305	HGNC:5330													
IBA57	gene	IBA57	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 3, MIM#615330			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000181873	ENSG00000181873	HGNC:27302													
IDH2	gene	IDH2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	mitochondrial disease MONDO:0044970			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20847235;35359529		False	3	100;0;0	2.156	True		ENSG00000182054	ENSG00000182054	HGNC:5383													
IDS	gene	IDS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	mucopolysaccharidosis type 2 MONDO:0010674			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:005112		False	3	100;0;0	2.156	True		ENSG00000010404	ENSG00000010404	HGNC:5389													
IDUA	gene	IDUA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	mucopolysaccharidosis type 1 MONDO:0001586			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301341		False	3	100;0;0	2.156	True		ENSG00000127415	ENSG00000127415	HGNC:5391													
IER3IP1	gene	IER3IP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, epilepsy, and diabetes syndrome, MIM# 614231;Primary microcephaly-epilepsy-permanent neonatal diabetes syndrome, MONDO:0013647			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21835305;22991235;24138066;28711742		False	3	100;0;0	2.156	True		ENSG00000134049	ENSG00000134049	HGNC:18550													
IFIH1	gene	IFIH1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	IFIH1-related type 1 interferonopathy MONDO:0700262			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301648;25620204		False	3	100;0;0	2.156	True		ENSG00000115267	ENSG00000115267	HGNC:18873													
IFT172	gene	IFT172	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome MONDO:0015229			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24290075;26763875		False	3	0;100;0	2.156	True		ENSG00000138002	ENSG00000138002	HGNC:30391													
IFT27	gene	IFT27	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 19, MIM#615996			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24488770;30761183		False	3	100;0;0	2.156	True		ENSG00000100360	ENSG00000100360	HGNC:18626													
IFT74	gene	IFT74	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 20, MIM# 617119;Joubert syndrome 40, MIM# 619582;Spermatogenic failure 58, MIM# 619585			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27486776;32144365;33531668		False	3	100;0;0	2.156	True		ENSG00000096872	ENSG00000096872	HGNC:21424													
IGF1	gene	IGF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Growth retardation with deafness and mental retardation due to IGF1 deficiency, MIM # 608747			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8857020;15769976;14684690;31539878;28768959;34125705;22832530		False	3	100;0;0	2.156	True		ENSG00000017427	ENSG00000017427	HGNC:5464													
IGF1R	gene	IGF1R	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Insulin-like growth factor I, resistance to, MIM# 270450			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31586944		False	3	100;0;0	2.156	True		ENSG00000140443	ENSG00000140443	HGNC:5465													
IKBKG	gene	IKBKG	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Incontinentia pigmenti MONDO:0010631			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301645		False	3	100;0;0	2.156	True		-	ENSG00000269335	HGNC:5961													
IL1RAPL1	gene	IL1RAPL1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 21 MIM#300143			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34452636;27470653;21484992;18801879;18801879		False	3	100;0;0	2.156	True		ENSG00000169306	ENSG00000169306	HGNC:5996													
IMPDH2	gene	IMPDH2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dystonia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33098801		False	3	100;0;0	2.156	True		ENSG00000178035	ENSG00000178035	HGNC:6053													
INPP4A	gene	INPP4A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31978615;31938306;25338135;20011524;39315527		False	3	50;50;0	2.156	True		ENSG00000040933	ENSG00000040933	HGNC:6074													
INPP5E	gene	INPP5E	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 1, MIM# 213300;MONDO:0008944;Mental retardation, truncal obesity, retinal dystrophy, and micropenis, MIM# 610156;MONDO:0012423			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19668216;32139166;29230161;29052317;27998989;27401686;19668215		False	3	100;0;0	2.156	True		ENSG00000148384	ENSG00000148384	HGNC:21474													
INPP5K	gene	INPP5K	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	congenital muscular dystrophy with cataracts and intellectual disability MONDO:0024607			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28190456;28190459		False	3	100;0;0	2.156	True		ENSG00000132376	ENSG00000132376	HGNC:33882													
INTS1	gene	INTS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cataracts, poor growth, and dysmorphic facies, MIM# 618571			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28542170;30622326;31428919		False	3	100;0;0	2.156	True		ENSG00000164880	ENSG00000164880	HGNC:24555													
INTS11	gene	INTS11	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with motor and language delay, ocular defects, and brain abnormalities, MIM# 620428			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37054711		False	3	100;0;0	2.156	True		ENSG00000127054	ENSG00000127054	HGNC:26052													
INTS13	gene	INTS13	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Oral-facial-digital syndrome, MONDO:0015375, INTS13-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36229431		False	3	100;0;0	2.156	True		ENSG00000064102	ENSG00000064102	HGNC:20174													
INTS6	gene	INTS6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 78, MIM# 621627			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40966122		False	3	100;0;0	2.156	True		ENSG00000102786	ENSG00000102786	HGNC:14879													
IPO8	gene	IPO8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Vascular aneurysm, immune dysregulation, skeletal anomalies, and skin and joint laxity, MIM# 619472;Loeys-Dietz syndrome-like;cardiovascular, neurologic, skeletal and immunologic abnormalities			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34010604;33875846;34010605		False	3	100;0;0	2.156	True		ENSG00000133704	ENSG00000133704	HGNC:9853													
IQSEC1	gene	IQSEC1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder with short stature and behavioral abnormalities, MIM#	618687"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31607425		False	3	100;0;0	2.156	True		ENSG00000144711	ENSG00000144711	HGNC:29112													
IQSEC2	gene	IQSEC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked 1, MIM# 309530;Neurodevelopmental disorder, X-linked, with poor or absent speech and behavioral abnormalities, MIM# 301164			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31415821;20473311;30842726;33368194;23674175		False	3	100;0;0	2.156	True		ENSG00000124313	ENSG00000124313	HGNC:29059													
IREB2	gene	IREB2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, early-onset, with choreoathetoid movements and microcytic anemia, MIM#618451			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30915432;31243445;11175792;35602653		False	3	100;0;0	2.156	True		ENSG00000136381	ENSG00000136381	HGNC:6115													
IRF2BPL	gene	IRF2BPL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures, MIM#618088			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30057031		False	3	100;0;0	2.156	True		ENSG00000119669	ENSG00000119669	HGNC:14282													
IRX5	gene	IRX5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hamamy syndrome, MIM# 611174			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22581230;27453922;34899143		False	3	100;0;0	2.156	True		ENSG00000176842	ENSG00000176842	HGNC:14361													
ISCA1	gene	ISCA1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multiple mitochondrial dysfunctions syndrome 5, MIM#	617613"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28356563;32092383;31016283;30113620;30105122		False	3	100;0;0	2.156	True		ENSG00000135070	ENSG00000135070	HGNC:28660													
ISCA2	gene	ISCA2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 4, MIM# 616370			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25539947;29297947;29122497;29359243;31279336;31106229		False	3	100;0;0	2.156	True		ENSG00000165898	ENSG00000165898	HGNC:19857													
ITFG2	gene	ITFG2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental abnormality;Intellectual disability;Developmental regression;Ataxia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28397838;33083013		False	3	33;67;0	2.156	True		ENSG00000111203	ENSG00000111203	HGNC:30879													
ITGAV	gene	ITGAV	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with speech delay and behavioural abnormalities, MIM# 621372			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39526957		False	3	100;0;0	2.156	True		ENSG00000138448	ENSG00000138448	HGNC:6150													
ITPA	gene	ITPA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 35, MIM# 616647			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26224535;19498443;35234647;35098521		False	3	100;0;0	2.156	True		ENSG00000125877	ENSG00000125877	HGNC:6176													
ITPR1	gene	ITPR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	aniridia-cerebellar ataxia-intellectual disability syndrome MONDO:0008795;spinocerebellar ataxia type 29 MONDO:0007298			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27108797;27108798;15623688;22986007;28488678		False	3	100;0;0	2.156	True		ENSG00000150995	ENSG00000150995	HGNC:6180													
ITSN1	gene	ITSN1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092 ITSN1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34707297		False	3	0;0;0	2.156	True		ENSG00000205726	ENSG00000205726	HGNC:6183													
IVD	gene	IVD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	isovaleric acidaemia MONDO:0009475			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26018748		False	3	100;0;0	2.156	True		ENSG00000128928	ENSG00000128928	HGNC:6186													
JAM3	gene	JAM3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hemorrhagic destruction of the brain, subependymal calcification, and cataracts, MIM# 613730			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23255084;21109224		False	3	100;0;0	2.156	True		ENSG00000166086	ENSG00000166086	HGNC:15532													
JARID2	gene	JARID2	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay with variable intellectual disability and dysmorphic facies (DIDDF), MIM#620098			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23294540;33077894		False	3	100;0;0	2.156	True		ENSG00000008083	ENSG00000008083	HGNC:6196													
JKAMP	gene	JKAMP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM#	621533"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41643666		False	3	100;0;0	2.156	True		ENSG00000050130	ENSG00000050130	HGNC:20184													
JMJD1C	gene	JMJD1C	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability (MONDO#0001071), JMJD1C-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26181491;32996679		False	3	100;0;0	2.156	True		ENSG00000171988	ENSG00000171988	HGNC:12313													
KANSL1	gene	KANSL1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Koolen-De Vries syndrome (MIM#610443)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22544363		False	3	100;0;0	2.156	True		ENSG00000120071	ENSG00000120071	HGNC:24565													
KARS1	gene	KARS1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with or without deafness (LEPID), MIM#619147;Combined mitochondrial oxidative phosphorylation deficiency;epilepsy;intellectual disability;microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26741492;31618474;28887846;25330800;29615062;30252186;28496994		False	3	100;0;0	2.156	True		ENSG00000065427	ENSG00000065427	HGNC:6215													
KAT5	gene	KAT5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dysmorphic facies, sleep disturbance, and brain abnormalities (NEDFASB), MIM#619103;Severe global developmental delay;Intellectual disability;Seizures;Microcephaly;Behavioral abnormality;Sleep disturbance;Morphological abnormality of the central nervous system;Short stature;Oral cleft;Abnormality of the face			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32822602		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000172977	ENSG00000172977	HGNC:5275													
KAT6A	gene	KAT6A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	syndromic intellectual disability MONDO:0000508			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:005173		False	3	100;0;0	2.156	True		ENSG00000083168	ENSG00000083168	HGNC:13013													
KAT6B	gene	KAT6B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	KAT6B-related multiple congenital anomalies syndrome MONDO:0036042			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://search.clinicalgenome.org/CCID:005174		False	3	100;0;0	2.156	True		ENSG00000156650	ENSG00000156650	HGNC:17582													
KAT8	gene	KAT8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;seizures;autism;dysmorphic features;Li-Ghorbani-Weisz syndrome, MIM#618974			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31794431		False	3	100;0;0	2.156	True		ENSG00000103510	ENSG00000103510	HGNC:17933													
KATNB1	gene	KATNB1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lissencephaly 6, with microcephaly, MIM#	616212"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25521378;25521379;26640080		False	3	100;0;0	2.156	True		ENSG00000140854	ENSG00000140854	HGNC:6217													
KATNIP	gene	KATNIP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 26, MIM# 616784			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26714646;27245168		False	3	100;0;0	2.156	True		ENSG00000047578	ENSG00000047578	HGNC:29068													
KBTBD2	gene	KBTBD2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, KBTBD2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39313616		False	3	100;0;0	2.156	True		ENSG00000170852	ENSG00000170852	HGNC:21751													
KCNA2	gene	KCNA2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early infantile encephalopathy 32, MIM#616366			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29050392		False	3	100;0;0	2.156	True		ENSG00000177301	ENSG00000177301	HGNC:6220													
KCNA3	gene	KCNA3	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, KCNA3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37964487		False	3	100;0;0	2.156	True		ENSG00000177272	ENSG00000177272	HGNC:6221													
KCNA6	gene	KCNA6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36318112;40472070		False	3	100;0;0	2.156	True		ENSG00000151079	ENSG00000151079	HGNC:6225													
KCNB1	gene	KCNB1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 26, MIM# 616056			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31600826;31513310		False	3	100;0;0	2.156	True		ENSG00000158445	ENSG00000158445	HGNC:6231													
KCNB2	gene	KCNB2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, KCNB2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38503299		False	3	100;0;0	2.156	True		ENSG00000182674	ENSG00000182674	HGNC:6232													
KCNC1	gene	KCNC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Movement disorders;Epilepsy, progressive myoclonic 7 (MIM#616187)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28145425;31353862;25401298		False	3	100;0;0	2.156	True		ENSG00000129159	ENSG00000129159	HGNC:6233													
KCNC2	gene	KCNC2	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 103, MIM# 619913			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32392612;31972370;35314505		False	3	100;0;0	2.156	True		ENSG00000166006	ENSG00000166006	HGNC:6234													
KCND1	gene	KCND1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	neurodevelopmental disorder MONDO:0700092, KCND1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38772379		False	3	100;0;0	2.156	True		ENSG00000102057	ENSG00000102057	HGNC:6237													
KCND2	gene	KCND2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092;global developmental delay, HP:0001263;seizure, HP:0001250			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24501278;16934482;29581270;34245260		False	3	100;0;0	2.156	True		ENSG00000184408	ENSG00000184408	HGNC:6238													
KCND3	gene	KCND3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 19, MIM#607346			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35021282;32823520;34067185;34361012		False	3	100;0;0	2.156	True		ENSG00000171385	ENSG00000171385	HGNC:6239													
KCNH1	gene	KCNH1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Temple-Baraitser syndrome, OMIM:611816;Zimmermann-Laband syndrome 1, OMIM:135500;Intellectual disability;Encephalopathy without features of TBS/ZLS			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33811134		False	3	100;0;0	2.156	True		ENSG00000143473	ENSG00000143473	HGNC:6250													
KCNH5	gene	KCNH5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental and epileptic encephalopathy 112, MIM# 620537			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36307226		False	3	100;0;0	2.156	True	Other	ENSG00000140015	ENSG00000140015	HGNC:6254													
KCNJ10	gene	KCNJ10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	SESAME syndrome, MIM# 612780			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19289823;19420365;21849804;11466414		False	3	100;0;0	2.156	True		ENSG00000177807	ENSG00000177807	HGNC:6256													
KCNJ4	gene	KCNJ4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, KCNJ4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41830586		False	3	100;0;0	2.156	True	Other	ENSG00000168135	ENSG00000168135	HGNC:6265													
KCNJ6	gene	KCNJ6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Keppen-Lubinsky syndrome, MIM# 614098;MONDO:0013572			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25620207;29852244		False	3	100;0;0	2.156	True		ENSG00000157542	ENSG00000157542	HGNC:6267													
KCNK4	gene	KCNK4	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Facial dysmorphism, hypertrichosis, epilepsy, intellectual/developmental delay, and gingival overgrowth syndrome	618381"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30290154		False	3	100;0;0	2.156	True	Other	ENSG00000182450	ENSG00000182450	HGNC:6279													
KCNK9	gene	KCNK9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)	Birk-Barel syndrome, MIM# 612292;MONDO:0012856			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28333430;27151206;24980697;18678320;35698242		False	3	100;0;0	2.156	True		ENSG00000169427	ENSG00000169427	HGNC:6283													
KCNMA1	gene	KCNMA1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cerebellar atrophy, developmental delay, and seizures, MIM# 617643;Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM#609446			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27567911;29545233;26195193;31427379		False	3	100;0;0	2.156	True		ENSG00000156113	ENSG00000156113	HGNC:6284													
KCNN2	gene	KCNN2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33242881		False	3	100;0;0	2.156	True		ENSG00000080709	ENSG00000080709	HGNC:6291													
KCNN3	gene	KCNN3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Zimmermann-Laband syndrome 3 MIM#618658			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31155282		False	3	100;0;0	2.156	True		ENSG00000143603	ENSG00000143603	HGNC:6292													
KCNQ2	gene	KCNQ2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 7, MIM# 613720;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33659638;33754465		False	3	100;0;0	2.156	True		ENSG00000075043	ENSG00000075043	HGNC:6296													
KCNQ3	gene	KCNQ3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Seizures, benign neonatal, 2, MIM# 121201			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33337327;25524373;24851285		False	3	100;0;0	2.156	True		ENSG00000184156	ENSG00000184156	HGNC:6297													
KCNQ5	gene	KCNQ5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 46, MIM# 617601			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28669405;30359776		False	3	100;0;0	2.156	True		ENSG00000185760	ENSG00000185760	HGNC:6299													
KCNT1	gene	KCNT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy MIM#614959;childhood-onset epilepsy syndrome MONDO:0020072			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23086397;24029078		False	3	100;0;0	2.156	True		ENSG00000107147	ENSG00000107147	HGNC:18865													
KCNT2	gene	KCNT2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile 57, 617771			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29069600;29740868		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000162687	ENSG00000162687	HGNC:18866													
KCTD3	gene	KCTD3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092, KCTD3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29406573		False	3	100;0;0	2.156	True		ENSG00000136636	ENSG00000136636	HGNC:21305													
KCTD7	gene	KCTD7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	progressive myoclonus epilepsy MONDO:0020074;Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30295347;31197948		False	3	100;0;0	2.156	True		ENSG00000243335	ENSG00000243335	HGNC:21957													
KDM1A	gene	KDM1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cleft palate, psychomotor retardation, and distinctive facial features 616728			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26656649;24838796;27094131		False	3	100;0;0	2.156	True		ENSG00000004487	ENSG00000004487	HGNC:29079													
KDM2A	gene	KDM2A	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, KDM2A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41468891		False	3	100;0;0	2.156	True		ENSG00000173120	ENSG00000173120	HGNC:13606													
KDM2B	gene	KDM2B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with congenital cardiac defects and variable renal and ocular abnormalities, MIM# 621474			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36322151;40420380		False	3	100;0;0	2.156	True		ENSG00000089094	ENSG00000089094	HGNC:13610													
KDM3B	gene	KDM3B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Diets-Jongmans syndrome, MIM# 618846;Intellectual disability;dysmorphic features;short stature			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30929739		False	3	100;0;0	2.156	True		ENSG00000120733	ENSG00000120733	HGNC:1337													
KDM4B	gene	KDM4B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 65, MIM# 619320;Global developmental delay, intellectual disability and neuroanatomical defects			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33232677		False	3	100;0;0	2.156	True		ENSG00000127663	ENSG00000127663	HGNC:29136													
KDM5A	gene	KDM5A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092, KDM5A-related;El Hayek-Chahrour neurodevelopmental syndrome, MIM# 620820			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21937992;33350388		False	3	50;50;0	2.156	True		ENSG00000073614	ENSG00000073614	HGNC:9886													
KDM5B	gene	KDM5B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Mental retardation, autosomal recessive 65 MIM#618109;Neurodevelopmental disorder (MONDO#0700092), KDM5B-related, autosomal dominant			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29276005;30217758;30409806		False	3	100;0;0	2.156	True		ENSG00000117139	ENSG00000117139	HGNC:18039													
KDM5C	gene	KDM5C	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type MIM# 300534;MONDO:0010355			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15586325;32279304		False	3	100;0;0	2.156	True		ENSG00000126012	ENSG00000126012	HGNC:11114													
KDM6A	gene	KDM6A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Kabuki syndrome 2 MONDO:0010465			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33674768		False	3	100;0;0	2.156	True		ENSG00000147050	ENSG00000147050	HGNC:12637													
KDM6B	gene	KDM6B	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31124279		False	3	100;0;0	2.156	True		ENSG00000132510	ENSG00000132510	HGNC:29012													
KIAA0586	gene	KIAA0586	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 23 MIM#616490			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26096313		False	3	100;0;0	2.156	True		ENSG00000100578	ENSG00000100578	HGNC:19960													
KICS2	gene	KICS2	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 83, MIM# 621100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39824192		False	3	67;33;0	2.156	True		ENSG00000174206	ENSG00000174206	HGNC:26517													
KIDINS220	gene	KIDINS220	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296;MONDO:0015007			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27005418;29667355		False	3	100;0;0	2.156	True		ENSG00000134313	ENSG00000134313	HGNC:29508													
KIF11	gene	KIF11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microcephaly with or without chorioretinopathy, lymphoedema, or mental retardation, MIM# 152950;MONDO:0007918			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24281367;22284827;25115524;25124931;27212378;32730767;31993640;25996076		False	3	100;0;0	2.156	True		ENSG00000138160	ENSG00000138160	HGNC:6388													
KIF14	gene	KIF14	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 20, primary, autosomal recessive, MIM# 617914;Meckel syndrome 12, MIM# 616258			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28892560;29343805		False	3	100;0;0	2.156	True		ENSG00000118193	ENSG00000118193	HGNC:19181													
KIF1A	gene	KIF1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 9, MIM#614255			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28970574;22258533;31488895;31512412		False	3	100;0;0	2.156	True	Other	ENSG00000130294	ENSG00000130294	HGNC:888													
KIF21B	gene	KIF21B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder MONDO:0700092, KIF21B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32415109		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000116852	ENSG00000116852	HGNC:29442													
KIF26A	gene	KIF26A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia, complex, with other brain malformations 11, MIM# 620156			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36228617		False	3	100;0;0	2.156	True		ENSG00000066735	ENSG00000066735	HGNC:20226													
KIF2A	gene	KIF2A	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 3, 615411			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23603762;21594994;27747449;27896282		False	3	100;0;0	2.156	True		ENSG00000068796	ENSG00000068796	HGNC:6318													
KIF4A	gene	KIF4A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 100 MIM#300923			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24812067;34346154		False	3	100;0;0	2.156	True		ENSG00000090889	ENSG00000090889	HGNC:13339													
KIF5C	gene	KIF5C	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23603762;23033978;32562872		False	3	100;0;0	2.156	True		ENSG00000168280	ENSG00000168280	HGNC:6325													
KIF7	gene	KIF7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	acrocallosal syndrome MONDO:0008708;KIF7-related ciliopathy MONDO:0800463;Joubert syndrome 12 MIM#200990			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301500		False	3	100;0;0	2.156	True		ENSG00000166813	ENSG00000166813	HGNC:30497													
KIFBP	gene	KIFBP	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Goldberg-Shprintzen megacolon syndrome	609460"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000198954	ENSG00000198954	HGNC:23419													
KLC1	gene	KLC1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	KLC1-related neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42372486		False	3	100;0;0	2.156	True		ENSG00000126214	ENSG00000126214	HGNC:6387													
KLF7	gene	KLF7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), KLF7-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29251763		False	3	100;0;0	2.156	True		ENSG00000118263	ENSG00000118263	HGNC:6350													
KLHL13	gene	KLHL13	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder, MONDO:0700092, KLHL13-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 41159445		False	3	100;0;0	2.156	True		ENSG00000003096	ENSG00000003096	HGNC:22931													
KLHL15	gene	KLHL15	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked 103, MIM#300982			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25644381;24817631;37452054		False	3	100;0;0	2.156	True		ENSG00000174010	ENSG00000174010	HGNC:29347													
KLHL20	gene	KLHL20	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36214804		False	3	100;0;0	2.156	True		ENSG00000076321	ENSG00000076321	HGNC:25056													
KLHL7	gene	KLHL7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PERCHING syndrome MONDO:0014890;acrocallosal syndrome MONDO:0008708			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27392078;30142437;29074562		False	3	100;0;0	2.156	True		ENSG00000122550	ENSG00000122550	HGNC:15646													
KMT2A	gene	KMT2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Wiedemann-Steiner syndrome, MIM# 605130 AD			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000118058	ENSG00000118058	HGNC:7132													
KMT2B	gene	KMT2B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 28, childhood-onset 617284;MONDO:0015004;Intellectual developmental disorder, autosomal dominant 68, MIM# 619934			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33150406		False	3	100;0;0	2.156	True		ENSG00000272333	ENSG00000272333	HGNC:15840													
KMT2C	gene	KMT2C	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Kleefstra syndrome 2, MIM#617768;Neurodevelopmental disorder, MONDO:0700092, KMT2C-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39013459		False	3	100;0;0	2.156	True		ENSG00000055609	ENSG00000055609	HGNC:13726													
KMT2D	gene	KMT2D	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Kabuki syndrome 1, MIM# 147920;KMT2D-associated syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31949313		False	3	100;0;0	2.156	True		ENSG00000167548	ENSG00000167548	HGNC:7133													
KMT2E	gene	KMT2E	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	O'Donnell-Luria-Rodan syndrome, MIM# 618512;Intellectual disability;Autism;Seizures			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31079897		False	3	100;0;0	2.156	True		ENSG00000005483	ENSG00000005483	HGNC:18541													
KMT5B	gene	KMT5B	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 51 MIM# 617788			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25363768;28191889;29276005		False	3	100;0;0	2.156	True		ENSG00000110066	ENSG00000110066	HGNC:24283													
KNL1	gene	KNL1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 4, primary, autosomal recessive, MIM# 604321;MONDO:0011437			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22983954;26626498;27149178;30304678;27784895		False	3	100;0;0	2.156	True		ENSG00000137812	ENSG00000137812	HGNC:24054													
KPTN	gene	KPTN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 41 (MIM#615637)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24239382;32358097;32808430		False	3	100;0;0	2.156	True		ENSG00000118162	ENSG00000118162	HGNC:6404													
KRAS	gene	KRAS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Noonan syndrome 3, MIM# 609942;Cardiofaciocutaneous syndrome 2, MIM# 615278			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21797849;16474404;16474405;16773572;17056636		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000133703	ENSG00000133703	HGNC:6407													
L1CAM	gene	L1CAM	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	L1 syndrome MONDO:0017140			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000198910	ENSG00000198910	HGNC:6470													
L2HGDH	gene	L2HGDH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L-2-hydroxyglutaric aciduria, MIM#236792			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37113859		False	3	100;0;0	2.156	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
LAGE3	gene	LAGE3	Expert Review Green;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Galloway-Mowat syndrome 2, X-linked, MIM# 301006			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28805828		False	3	100;0;0	2.156	False		ENSG00000196976	ENSG00000196976	HGNC:26058													
LAMA1	gene	LAMA1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	ataxia - intellectual disability - oculomotor apraxia - cerebellar cysts syndrome MONDO:0014419			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24013853		False	3	100;0;0	2.156	True		ENSG00000101680	ENSG00000101680	HGNC:6481													
LAMA2	gene	LAMA2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, congenital, merosin deficient or partially deficient, 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM#618138;LAMA2-related muscular dystrophy (suggested by PMID: 30055037)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30055037		False	3	100;0;0	2.156	True		ENSG00000196569	ENSG00000196569	HGNC:6482													
LAMB1	gene	LAMB1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lissencephaly 5, MIM# 615191;Cystic leukoencephalopathy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23472759;25925986;29888467;25925986		False	3	100;0;0	2.156	True		ENSG00000091136	ENSG00000091136	HGNC:6486													
LAMB2	gene	LAMB2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pierson syndrome, MIM#609049			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000172037	ENSG00000172037	HGNC:6487													
LAMC3	gene	LAMC3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical malformations, occipital, MIM# 614115			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38758065;21572413		False	3	0;50;50	2.156	True		ENSG00000050555	ENSG00000050555	HGNC:6494													
LAMP2	gene	LAMP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Danon disease, MIM# 300257;MONDO:0010281			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10972294		False	3	100;0;0	2.156	True		ENSG00000005893	ENSG00000005893	HGNC:6501													
LARGE1	gene	LARGE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154;Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 6, MIM# 608840			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12966029;19067344;17436019;21248746;19299310		False	3	100;0;0	2.156	True		ENSG00000133424	ENSG00000133424	HGNC:6511													
LARP1	gene	LARP1	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder;MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39182167		False	3	100;0;0	2.156	True		ENSG00000155506	ENSG00000155506	HGNC:29531													
LARP7	gene	LARP7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alazami syndrome, MIM# 615071;Microcephalic primordial dwarfism, Alazami type MONDO:0014031			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22865833;21937992;30006060;33569879		False	3	100;0;0	2.156	True		ENSG00000174720	ENSG00000174720	HGNC:24912													
LARS1	gene	LARS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile liver failure syndrome 1, MIM# 615438;Seizures;Intellectual disability;Encephalopathy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32699352		False	3	100;0;0	2.156	True		ENSG00000133706	ENSG00000133706	HGNC:6512													
LARS2	gene	LARS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 4, MIM# 615300;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29205794;32423379;30737337;26537577;23541342		False	3	100;0;0	2.156	True		ENSG00000011376	ENSG00000011376	HGNC:17095													
LAS1L	gene	LAS1L	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Wilson-Turner syndrome, MIM# 309585			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25644381;26358559;34653234		False	3	0;100;0	2.156	True		ENSG00000001497	ENSG00000001497	HGNC:25726													
LEO1	gene	LEO1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, LEO-1 related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38965372		False	3	50;50;0	2.156	True		ENSG00000166477	ENSG00000166477	HGNC:30401													
LETM1	gene	LETM1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36055214		False	3	100;0;0	2.156	True		ENSG00000168924	ENSG00000168924	HGNC:6556													
LGI1	gene	LGI1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 121, MIM# 621475			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID:40455867		False	3	100;0;0	2.156	True		ENSG00000108231	ENSG00000108231	HGNC:6572													
LGI3	gene	LGI3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, LGI3-related;Global developmental delay;Intellectual disability;Distal deformities;Diminished reflexes;Facial myokymia;Hyporeflexia/areflexi			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35948005		False	3	100;0;0	2.156	True		ENSG00000168481	ENSG00000168481	HGNC:18711													
LHX2	gene	LHX2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO: 0700092)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37057675		False	3	100;0;0	2.156	True		ENSG00000106689	ENSG00000106689	HGNC:6594													
LIAS	gene	LIAS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperglycinemia, lactic acidosis, and seizures, MIM#614462			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24334290;22152680		False	3	100;0;0	2.156	True		ENSG00000121897	ENSG00000121897	HGNC:16429													
LIG4	gene	LIG4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	LIG4 syndrome, MIM# 606593			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16088910;9823897;10911993;15333585;9809069;12023982;11040211;15175260;19451691;17554302		False	3	100;0;0	2.156	True		ENSG00000174405	ENSG00000174405	HGNC:6601													
LINGO4	gene	LINGO4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental Delay, Intellectual disability, speech disorder			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33098801		False	3	100;0;0	2.156	True		ENSG00000213171	ENSG00000213171	HGNC:31814													
LINS1	gene	LINS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 27, MIM# 614340			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32802957;34450347;32499722;31922598;28181389		False	3	100;0;0	2.156	True		ENSG00000140471	ENSG00000140471	HGNC:30922													
LIPT1	gene	LIPT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lipoyltransferase 1 deficiency, MIM#616299			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24341803;24256811;29681092		False	3	100;0;0	2.156	True		ENSG00000144182	ENSG00000144182	HGNC:29569													
LMAN2L	gene	LMAN2L	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal dominant 69 MIM#617863;Intellectual developmental disorder, autosomal recessive 52 MIM#616887			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31020005;26566883;40221759;37667433		False	3	50;50;0	2.156	True		ENSG00000114988	ENSG00000114988	HGNC:19263													
LMBRD1	gene	LMBRD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria and homocystinuria, cblF type, MIM# 277380			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000168216	ENSG00000168216	HGNC:23038													
LMBRD2	gene	LMBRD2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental delay with variable neurologic and brain abnormalities, MIM# 619694;Global developmental delay;Intellectual disability;Microcephaly;Seizures;Abnormality of nervous system morphology;Abnormality of the eye			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32820033;https://doi.org/10.1101/797787		False	3	50;50;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000164187	ENSG00000164187	HGNC:25287													
LMNB1	gene	LMNB1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microcephaly 26, primary, autosomal dominant, MIM# 619179;Global developmental delay, Intellectual disability, Microcephaly, Short stature, Seizures, Abnormality of the corpus callosum, Cortical gyral simplification, Feeding difficulties, Scoliosis;Leukodystrophy, adult-onset, autosomal dominant, MIM#169500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32910914;33033404		False	3	50;0;50	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000113368	ENSG00000113368	HGNC:6637													
LMNB2	gene	LMNB2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Microcephaly 27, primary, autosomal dominant, MIM# 619180;Congenital microcephaly;Global developmental delay;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33033404		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000176619	ENSG00000176619	HGNC:6638													
LNPK	gene	LNPK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with epilepsy and hypoplasia of the corpus callosum, MIM# 618090			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30032983;35599435		False	3	50;50;0	2.156	True		ENSG00000144320	ENSG00000144320	HGNC:21610													
LONP1	gene	LONP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	CODAS syndrome, MIM#600373;mitochondrial disease (MONDO:0044970), LONP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31636596;36353900;31923470		False	3	100;0;0	2.156	True		ENSG00000196365	ENSG00000196365	HGNC:9479													
LRP2	gene	LRP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Donnai-Barrow syndrome, MIM#222448			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17632512		False	3	100;0;0	2.156	True		ENSG00000081479	ENSG00000081479	HGNC:6694													
LRPPRC	gene	LRPPRC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian), MIM#220111			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21266382;8392290;8392291;26510951		False	3	100;0;0	2.156	True		ENSG00000138095	ENSG00000138095	HGNC:15714													
LRRC7	gene	LRRC7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 77, MIM# 621415			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39256359		False	3	100;0;0	2.156	True		ENSG00000033122	ENSG00000033122	HGNC:18531													
LSM1	gene	LSM1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	FICUS syndrome, MIM# 621193			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31010896;36100156;40204357		False	3	67;0;33	2.156	True		ENSG00000175324	ENSG00000175324	HGNC:20472													
LSS	gene	LSS	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cataract 44, OMIM #616509;Hypotrichosis 14, OMIM #618275;intellectual disability and alopecia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30723320		False	3	100;0;0	2.156	True		ENSG00000160285	ENSG00000160285	HGNC:6708													
LTBP1	gene	LTBP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cutis laxa, autosomal recessive, type IIE MIM#619451			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33991472		False	3	100;0;0	2.156	True		ENSG00000049323	ENSG00000049323	HGNC:6714													
LYRM7	gene	LYRM7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 8, MIM#615838			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000186687	ENSG00000186687	HGNC:28072													
LYSET	gene	LYSET	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dysostosis multiplex, Ain-Naz type MIM@619345			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40171858;33252156		False	3	100;0;0	2.156	True		ENSG00000153485	ENSG00000153485	HGNC:20218													
LZTFL1	gene	LZTFL1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000163818	ENSG00000163818	HGNC:6741													
LZTR1	gene	LZTR1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Noonan syndrome 10, MIM#616564;Noonan syndrome 2, MIM#605275			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000099949	ENSG00000099949	HGNC:6742													
MAB21L1	gene	MAB21L1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebellar, ocular, craniofacial, and genital syndrome	MIM#618479"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30487245;27103078		False	3	100;0;0	2.156	True		ENSG00000180660	ENSG00000180660	HGNC:6757													
MAB21L2	gene	MAB21L2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microphthalmia/coloboma and skeletal dysplasia syndrome, MIM# 615877			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24906020;25719200;31037784;30375740;30073347;26116559		False	3	100;0;0	2.156	True		ENSG00000181541	ENSG00000181541	HGNC:6758													
MACF1	gene	MACF1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Lissencephaly 9 with complex brainstem malformation, MIM#618325;Neurodevelopmental disorder (MONDO:0700092), MACF1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30471716;30842214;37721175;40925378;33600046;24476948;32010038;29667327;297066461		False	3	100;0;0	2.156	True		ENSG00000127603	ENSG00000127603	HGNC:13664													
MADD	gene	MADD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	DEEAH syndrome, MIM#619004 (Developmental Delay With Endocrine, Exocrine, Autonomic, and Hematologic Abnormalities);Neurodevelopmental disorder with dysmorphic facies, impaired speech and hypotonia (NEDDISH), MIM# 619005			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28940097;29302074;32761064		False	3	100;0;0	2.156	True		ENSG00000110514	ENSG00000110514	HGNC:6766													
MAEA	gene	MAEA	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, MAEA-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40880485		False	3	50;50;0	2.156	True		ENSG00000090316	ENSG00000090316	HGNC:13731													
MAF	gene	MAF	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ayme-Gripp syndrome (MIM#601088)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30160832;34643041		False	3	100;0;0	2.156	True		ENSG00000178573	ENSG00000178573	HGNC:6776													
MAGEL2	gene	MAGEL2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	Schaaf-Yang syndrome, MIM# 615547			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24076603;31397880;29599419;30302899		False	3	100;0;0	2.156	True		ENSG00000254585	ENSG00000254585	HGNC:6814													
MAN1B1	gene	MAN1B1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 15, MIM#614202			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000177239	ENSG00000177239	HGNC:6823													
MAN2B1	gene	MAN2B1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mannosidosis, alpha-, types I and II, MIM# 248500;MONDO:0009561			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000104774	ENSG00000104774	HGNC:6826													
MAN2C1	gene	MAN2C1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of deglycosylation 2, MIM# 619775			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35045343		False	3	100;0;0	2.156	True		ENSG00000140400	ENSG00000140400	HGNC:6827													
MANBA	gene	MANBA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mannosidosis, beta, MIM# 248510;MONDO:0009562			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000109323	ENSG00000109323	HGNC:6831													
MAOA	gene	MAOA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Brunner syndrome, MIM# 300615			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25807999;24169519		False	3	100;0;0	2.156	True		ENSG00000189221	ENSG00000189221	HGNC:6833													
MAP1B	gene	MAP1B	Expert Review Green;Genetic Health Queensland;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;seizures;PVNH;dysmorphic features;Periventricular nodular heterotopia 9, MIM# 618918			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31317654;30150678;30214071		False	3	100;0;0	2.156	True		ENSG00000131711	ENSG00000131711	HGNC:6836													
MAP2K1	gene	MAP2K1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiofaciocutaneous syndrome 3, MIM# 615279			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16439621;17551924;18042262;20301365		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000169032	ENSG00000169032	HGNC:6840													
MAP2K2	gene	MAP2K2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiofaciocutaneous syndrome 3, MIM# 615279			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20358587;16439621;18042262		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000126934	ENSG00000126934	HGNC:6842													
MAP2K4	gene	MAP2K4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41480045		False	3	100;0;0	2.156	False	Other	ENSG00000065559	ENSG00000065559	HGNC:6844													
MAP4K4	gene	MAP4K4	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	RASopathy, MONDO:0021060, MAP4K4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37126546		False	3	50;0;50	2.156	True		ENSG00000071054	ENSG00000071054	HGNC:6866													
MAPK1	gene	MAPK1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Noonan syndrome 13, MIM#619087;Global developmental delay;Intellectual disability;Behavioral abnormality;Growth delay;Abnormality of the face;Abnormality of the neck;Abnormality of the cardiovascular system;Abnormality of the skin			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32721402		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000100030	ENSG00000100030	HGNC:6871													
MAPK8IP3	gene	MAPK8IP3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30612693;30945334		False	3	100;0;0	2.156	True		ENSG00000138834	ENSG00000138834	HGNC:6884													
MAPKAPK5	gene	MAPKAPK5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurocardiofaciodigital syndrome, MIM# 619869			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 3344202		False	3	100;0;0	2.156	True		ENSG00000089022	ENSG00000089022	HGNC:6889													
MAPRE2	gene	MAPRE2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Symmetric circumferential skin creases, congenital, 2, MIM# 616734			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26637975		False	3	100;0;0	2.156	True		ENSG00000166974	ENSG00000166974	HGNC:6891													
MARK2	gene	MARK2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 76, MIM# 621285			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 39419027, 39436150		False	3	100;0;0	2.156	True		ENSG00000072518	ENSG00000072518	HGNC:3332													
MASP1	gene	MASP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3MC syndrome 1, MIM# 257920;MONDO:0009770			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26789649;21258343;21035106		False	3	100;0;0	2.156	True		ENSG00000127241	ENSG00000127241	HGNC:6901													
MAST1	gene	MAST1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations;OMIM #618273			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31721002;30449657		False	3	100;0;0	2.156	True		ENSG00000105613	ENSG00000105613	HGNC:19034													
MAST3	gene	MAST3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 108, MIM#620115			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34185323;35095415		False	3	100;0;0	2.156	True		ENSG00000099308	ENSG00000099308	HGNC:19036													
MAST4	gene	MAST4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, MAST4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36910266;33057194		False	3	100;0;0	2.156	True		ENSG00000069020	ENSG00000069020	HGNC:19037													
MAT1A	gene	MAT1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850;Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850;Disorders of the metabolism of sulphur amino acids			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27604308;7560086		False	3	100;0;0	2.156	True		ENSG00000151224	ENSG00000151224	HGNC:6903													
MAU2	gene	MAU2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cornelia de Lange syndrome 7, MIM# 621570			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41332805;37962004;32433956		False	3	100;0;0	2.156	True		ENSG00000129933	ENSG00000129933	HGNC:29140													
MAX	gene	MAX	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Polydactyly-macrocephaly syndrome, MIM# 620712			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38141607		False	3	100;0;0	2.156	True		ENSG00000125952	ENSG00000125952	HGNC:6913													
MBD5	gene	MBD5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 1, MIM# 156200;MONDO:0007974			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18812405;21981781;23708187;22726846;33912662		False	3	100;0;0	2.156	True		ENSG00000204406	ENSG00000204406	HGNC:20444													
MBOAT7	gene	MBOAT7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability MIM#617188			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33335874;32645526;32744787;31852446;31282596;30701556		False	3	100;0;0	2.156	True		ENSG00000125505	ENSG00000125505	HGNC:15505													
MBTPS2	gene	MBTPS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	IFAP syndrome 1, with or without BRESHECK syndrome MONDO:0100213			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000012174	ENSG00000012174	HGNC:15455													
MCM3AP	gene	MCM3AP	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development, MIM#618124			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24123876;28633435;28969388;29982295;32202298		False	3	100;0;0	2.156	True		ENSG00000160294	ENSG00000160294	HGNC:6946													
MCM6	gene	MCM6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, MCM6-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37198333		False	3	100;0;0	2.156	True		ENSG00000076003	ENSG00000076003	HGNC:6949													
MCOLN1	gene	MCOLN1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucolipidosis IV, MIM# 252650;MONDO:0009653			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000090674	ENSG00000090674	HGNC:13356													
MCPH1	gene	MCPH1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 1, primary, autosomal recessive, MIM# 251200;MONDO:0009617			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12046007;15199523;16311745;20978018;32294449;30351297;29026105		False	3	100;0;0	2.156	True		ENSG00000147316	ENSG00000147316	HGNC:6954													
MDGA2	gene	MDGA2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 122, MIM# 621608			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://doi.org/10.1101/2025.08.28.25330873;40168357;27608760		False	3	100;0;0	2.156	True		ENSG00000139915	ENSG00000139915	HGNC:19835													
MDH2	gene	MDH2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 51 MIM#617339			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27989324;34766628		False	3	100;0;0	2.156	True		ENSG00000146701	ENSG00000146701	HGNC:6971													
MECP2	gene	MECP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Other	Encephalopathy, neonatal severe 300673 XLR;Mental retardation, X-linked, syndromic 13 300055 XLR;Rett syndrome 312750 XLD			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301670		False	3	100;0;0	2.156	True		ENSG00000169057	ENSG00000169057	HGNC:6990													
MED11	gene	MED11	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with developmental delay, early respiratory failure, myoclonic seizures, and brain abnormalities, MIM# 620327			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36001086		False	3	100;0;0	2.156	True		ENSG00000161920	ENSG00000161920	HGNC:32687													
MED12	gene	MED12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	MED12-related intellectual disability syndrome MONDO:0100000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000184634	ENSG00000184634	HGNC:11957													
MED12L	gene	MED12L	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, MED12L-related;Intellectual disability;Seizures;Autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31155615		False	3	100;0;0	2.156	True		ENSG00000144893	ENSG00000144893	HGNC:16050													
MED13	gene	MED13	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder 61, MIM# 618009			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29740699		False	3	100;0;0	2.156	True		ENSG00000108510	ENSG00000108510	HGNC:22474													
MED13L	gene	MED13L	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	syndromic intellectual disability MONDO:0000508			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28645799;29511999		False	3	100;0;0	2.156	True		ENSG00000123066	ENSG00000123066	HGNC:22962													
MED16	gene	MED16	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Guillouet-Gordon syndrome MIM#621220			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40081376		False	3	100;0;0	2.156	True		ENSG00000175221	ENSG00000175221	HGNC:17556													
MED17	gene	MED17	Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM#613668			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30345598		False	3	100;0;0	2.156	True		ENSG00000042429	ENSG00000042429	HGNC:2375													
MED23	gene	MED23	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	syndromic intellectual disability MONDO:0000508			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21868677;25845469;27311965;27457812;30847200;31164858		False	3	100;0;0	2.156	True		ENSG00000112282	ENSG00000112282	HGNC:2372													
MED25	gene	MED25	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basel-Vanagait-Smirin-Yosef syndrome, MIM# 616449;Congenital cataract-microcephaly-naevus flammeus syndrome MONDO:0014643			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25792360;32816121		False	3	100;0;0	2.156	True		ENSG00000104973	ENSG00000104973	HGNC:28845													
MED27	gene	MED27	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MIM# 619286			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33443317		False	3	100;0;0	2.156	True		ENSG00000160563	ENSG00000160563	HGNC:2377													
MEF2C	gene	MEF2C	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, MIM# 613443;MONDO:0013266			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19876902;19471318;19592390;19592390;20513142;34055696;34022131		False	3	100;0;0	2.156	True		ENSG00000081189	ENSG00000081189	HGNC:6996													
MEG3	gene	MEG3	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)	Kagami-Ogata syndrome, MIM# 608149			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33010492;33746039;33067531;38212313		False	3	100;0;0	2.156	True		ENSG00000214548	ENSG00000214548	HGNC:14575													
MEGF8	gene	MEGF8	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carpenter syndrome 2;OMIM #614976			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	3993675		False	3	100;0;0	2.156	True		ENSG00000105429	ENSG00000105429	HGNC:3233													
MEIS2	gene	MEIS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cleft palate, cardiac defects, and mental retardation (MIM#600987)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33427397;25712757		False	3	100;0;0	2.156	True		ENSG00000134138	ENSG00000134138	HGNC:7001													
METTL23	gene	METTL23	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 44;OMIM#615942			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 24501276;24626631		False	3	100;0;0	2.156	True		ENSG00000181038	ENSG00000181038	HGNC:26988													
METTL5	gene	METTL5	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder, autosomal recessive 72, MIM#	618665"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29302074;31564433		False	3	100;0;0	2.156	True		ENSG00000138382	ENSG00000138382	HGNC:25006													
MFF	gene	MFF	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22499341;26783368;32181496		False	3	100;0;0	2.156	True		ENSG00000168958	ENSG00000168958	HGNC:24858													
MFSD2A	gene	MFSD2A	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 15, primary, autosomal recessive, MIM# 616486			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26005865;26005868;24828044		False	3	100;0;0	2.156	True		ENSG00000168389	ENSG00000168389	HGNC:25897													
MFSD8	gene	MFSD8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 7, MIM# 610951;MONDO:0012588			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17564970;19201763		False	3	100;0;0	2.156	True		ENSG00000164073	ENSG00000164073	HGNC:28486													
MGAT2	gene	MGAT2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIa, MIM# 212066;MGAT2-CDG, MONDO:0008908			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8808595;11228641;22105986;33044030;31420886		False	3	100;0;0	2.156	True		ENSG00000168282	ENSG00000168282	HGNC:7045													
MICU1	gene	MICU1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy with extrapyramidal signs, MIM# 615673			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24336167;29721912;32395406		False	3	100;0;0	2.156	True		ENSG00000107745	ENSG00000107745	HGNC:1530													
MID1	gene	MID1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	X-linked Opitz G/BBB syndrome MONDO:0010222			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000101871	ENSG00000101871	HGNC:7095													
MKKS	gene	MKKS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	McKusick-Kaufman syndrome, MIM# 236700;Bardet-Biedl syndrome 6, MIM# 605231;Retinitis pigmentosa			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10973251;10802661;26900326		False	3	100;0;0	2.156	True		ENSG00000125863	ENSG00000125863	HGNC:7108													
MKS1	gene	MKS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 28, MIM# 617121;MONDO:0014928;Meckel syndrome 1, MIM# 249000;MONDO:0009571;Bardet-Biedl syndrome 13, MIM# 615990;MONDO:0014441			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17377820;24886560;19776033;33193692;27570071;27377014;18327255;24608809		False	3	100;0;0	2.156	True		ENSG00000011143	ENSG00000011143	HGNC:7121													
MLC1	gene	MLC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11254442;18757878;16652334		False	3	100;0;0	2.156	True		ENSG00000100427	ENSG00000100427	HGNC:17082													
MLYCD	gene	MLYCD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Malonyl-CoA decarboxylase deficiency, MIM# 248360			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12955715		False	3	100;0;0	2.156	True		ENSG00000103150	ENSG00000103150	HGNC:7150													
MMAA	gene	MMAA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria, vitamin B12-responsive, cblA type, MIM# 251100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301409;37420116		False	3	100;0;0	2.156	True		ENSG00000151611	ENSG00000151611	HGNC:18871													
MMAB	gene	MMAB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria, vitamin B12-responsive, cblB type, MIM# 251110			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301409;37420116		False	3	100;0;0	2.156	True		ENSG00000139428	ENSG00000139428	HGNC:19331													
MMACHC	gene	MMACHC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria and homocystinuria, cblC type, MIM#277400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000132763	ENSG00000132763	HGNC:24525													
MMADHC	gene	MMADHC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria, cblD type, variant 1 MIM#277410;Methylmalonic aciduria and homocystinuria, cblD type MIM#277410;Methylmalonic aciduria, cblD type, variant 2 MIM#277410;Disorders of cobalamin absorption, transport and metabolism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301409;37420116;27604308;18385497		False	3	100;0;0	2.156	True		ENSG00000168288	ENSG00000168288	HGNC:25221													
MMUT	gene	MMUT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria, mut(0) type, MIM# 251000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301409;37420116;1977311;11528502;12948746		False	3	100;0;0	2.156	True		ENSG00000146085	ENSG00000146085	HGNC:7526													
MN1	gene	MN1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CEBALID syndrome, MIM#618774;Intellectual disability;dysmophic features;rhombencephalosynapsis			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31834374;31839203		False	3	100;0;0	2.156	True	Other	ENSG00000169184	ENSG00000169184	HGNC:7180													
MOCS1	gene	MOCS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency A, MIM# 252150			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9921896;12754701;21031595		False	3	100;0;0	2.156	True		ENSG00000124615	ENSG00000124615	HGNC:7190													
MOCS2	gene	MOCS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency B MIM#252160;Disorders of molybdenum cofactor metabolism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27604308;10053004		False	3	100;0;0	2.156	True		ENSG00000164172	ENSG00000164172	HGNC:7193													
MOGS	gene	MOGS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIb, MIM# 606056			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31925597;30587846;33058492		False	3	100;0;0	2.156	True		ENSG00000115275	ENSG00000115275	HGNC:24862													
MORC2	gene	MORC2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM#	619090;Intellectual disability"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32693025		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000133422	ENSG00000133422	HGNC:23573													
MPDU1	gene	MPDU1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type If, MIM# 609180;MPDU1-CDG, MONDO:0012211			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11733564;11733556;31741824;29721919		False	3	100;0;0	2.156	True		ENSG00000129255	ENSG00000129255	HGNC:7207													
MPDZ	gene	MPDZ	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hydrocephalus, congenital, 2, with or without brain or eye anomalies;OMIM #615219			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 28556411;23240096		False	3	100;0;0	2.156	True		ENSG00000107186	ENSG00000107186	HGNC:7208													
MPLKIP	gene	MPLKIP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trichothiodystrophy 4, nonphotosensitive, MIM# 234050;MONDO:0021013			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15645389;16977596		False	3	100;0;0	2.156	True		ENSG00000168303	ENSG00000168303	HGNC:16002													
MPV17	gene	MPV17	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2EE, OMIM #618400;Mitochondrial DNA depletion syndrome 6 (hepatocerebral type), OMIM #256810			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 22593919		False	3	100;0;0	2.156	True		ENSG00000115204	ENSG00000115204	HGNC:7224													
MRAS	gene	MRAS	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Noonan syndrome 11 - MIM#618499			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000158186	ENSG00000158186	HGNC:7227													
MRPL49	gene	MRPL49	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 60, MIM# 621195			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39417135		False	3	100;0;0	2.156	True		ENSG00000149792	ENSG00000149792	HGNC:1176													
MRPS22	gene	MRPS22	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 5 MIM#611719			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29566152;17873122;25663021;28752220		False	3	100;0;0	2.156	True		ENSG00000175110	ENSG00000175110	HGNC:14508													
MRPS34	gene	MRPS34	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Combined oxidative phosphorylation deficiency 32, MIM#	617664"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28777931		False	3	100;0;0	2.156	True		ENSG00000074071	ENSG00000074071	HGNC:16618													
MSL2	gene	MSL2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Karayol-Borroto-Haghshenas neurodevelopmental syndrome, MIM# 620985			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31332282;33057194		False	3	50;50;0	2.156	True		ENSG00000174579	ENSG00000174579	HGNC:25544													
MSL3	gene	MSL3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Basilicata-Akhtar syndrome, OMIM # 301032			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33173220		False	3	100;0;0	2.156	True		ENSG00000005302	ENSG00000005302	HGNC:7370													
MSMO1	gene	MSMO1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, congenital cataract, and psoriasiform dermatitis, MIM# 616834;MONDO:0014793			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27604308;21285510;24144731;33161406;28673550;33161406		False	3	100;0;0	2.156	True		ENSG00000052802	ENSG00000052802	HGNC:10545													
MT-ATP6	gene	MT-ATP6	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40112238		False	3	100;0;0	2.156	True		ENSG00000198899	ENSG00000198899	HGNC:7414													
MT-CO2	gene	MT-CO2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519		False	3	100;0;0	2.156	True		ENSG00000198712	ENSG00000198712	HGNC:7421													
MTFMT	gene	MTFMT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 15, MIM# 614947;Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21907147;23499752;24461907;22499348		False	3	100;0;0	2.156	True		ENSG00000103707	ENSG00000103707	HGNC:29666													
MTHFR	gene	MTHFR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria due to MTHFR deficiency MIM#236250;Disorders of folate metabolism and transport			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27604308;7920641		False	3	100;0;0	2.156	True		ENSG00000177000	ENSG00000177000	HGNC:7436													
MTHFS	gene	MTHFS	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, epilepsy, and hypomyelination, 618367			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30031689;31844630;22303332		False	3	100;0;0	2.156	True		ENSG00000136371	ENSG00000136371	HGNC:7437													
MT-ND4	gene	MT-ND4	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231		False	3	100;0;0	2.156	True		ENSG00000198886	ENSG00000198886	HGNC:7459													
MTO1	gene	MTO1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 10;OMIM #614702			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 26061759;29331171;23929671		False	3	100;0;0	2.156	True		ENSG00000135297	ENSG00000135297	HGNC:19261													
MTOR	gene	MTOR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Smith-Kingsmore syndrome, MIM# 616638;Focal cortical dysplasia, type II, somatic, MIM# 607341;Overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes, MONDO:0100283			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28892148;25878179;26018084		False	3	100;0;0	2.156	True	Other	ENSG00000198793	ENSG00000198793	HGNC:3942													
MTR	gene	MTR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria-megaloblastic anaemia, cblG complementation type, MIM# 250940			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8968736;8968737;9683607;12068375		False	3	100;0;0	2.156	True		ENSG00000116984	ENSG00000116984	HGNC:7468													
MTRFR	gene	MTRFR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary spastic paraplegia 55 MONDO:0014020			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24284555;20598281;23188110;24080142;3479531		False	3	100;0;0	2.156	True		ENSG00000130921	ENSG00000130921	HGNC:26784													
MTRR	gene	MTRR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria-megaloblastic anaemia, cbl E type, MIM# 236270			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12555939;15714522		False	3	100;0;0	2.156	True		ENSG00000124275	ENSG00000124275	HGNC:7473													
MTSS2	gene	MTSS2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder with ocular anomalies and distinctive facial features	MIM#620086"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36067766;39890443;40698928		False	3	100;0;0	2.156	True		ENSG00000132613	ENSG00000132613	HGNC:25094													
MT-TE	gene	MT-TE	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TE-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256		False	3	100;0;0	2.156	True		ENSG00000210194	ENSG00000210194	HGNC:7479													
MT-TR	gene	MT-TR	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial disease (MONDO:0044970), MT-TR-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15286228;17588757;19809478;22781096		False	3	100;0;0	2.156	True		ENSG00000210174	ENSG00000210174	HGNC:7496													
MT-TS1	gene	MT-TS1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7669057;9778262;14605505;23696415;33279600;7581383		False	3	100;0;0	2.156	True		ENSG00000210151	ENSG00000210151	HGNC:7497													
MT-TS2	gene	MT-TS2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9792552;10090882;16950817;21257182;22369973;22378285		False	3	100;0;0	2.156	True		ENSG00000210184	ENSG00000210184	HGNC:7498													
MT-TV	gene	MT-TV	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	2.156	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TW	gene	MT-TW	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	2.156	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
MVK	gene	MVK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyper-IgD syndrome (MIM#260920);Mevalonic aciduria (MIM#610377)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29047407;26409462		False	3	100;0;0	2.156	True		ENSG00000110921	ENSG00000110921	HGNC:7530													
MYCN	gene	MYCN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Feingold syndrome 1 MIM#164280;Megalencephaly-polydactyly syndrome, MIM#	620748"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37710961		False	3	100;0;0	2.156	True		ENSG00000134323	ENSG00000134323	HGNC:7559													
MYH10	gene	MYH10	Expert list;Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	AD complex neurodevelopmental disorder  with or without congenital anomalies (MONDO:0100465)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24825879;24901346;25356899;22495309;25003005		False	3	100;0;0	2.156	True		ENSG00000133026	ENSG00000133026	HGNC:7568													
MYO5A	gene	MYO5A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Griscelli syndrome, type 1 MIM#214450			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32275080;22711375;25283056		False	3	100;0;0	2.156	True		ENSG00000197535	ENSG00000197535	HGNC:7602													
MYT1L	gene	MYT1L	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 39, MIM# 616521			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28859103;32065501		False	3	100;0;0	2.156	True		ENSG00000186487	ENSG00000186487	HGNC:7623													
NAA10	gene	NAA10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Microphthalmia, syndromic 1, MIM# 309800;Ogden syndrome MIM#300855			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30842225;34075687;21700266		False	3	100;0;0	2.156	True		ENSG00000102030	ENSG00000102030	HGNC:18704													
NAA15	gene	NAA15	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33103328;29656860;31127942;28191889;33557580;28990276		False	3	100;0;0	2.156	True		ENSG00000164134	ENSG00000164134	HGNC:30782													
NAA20	gene	NAA20	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 73, MIM# 619717			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34230638		False	3	100;0;0	2.156	True		ENSG00000173418	ENSG00000173418	HGNC:15908													
NACC1	gene	NACC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination - MIM#617393			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28132692		False	3	100;0;0	2.156	True		ENSG00000160877	ENSG00000160877	HGNC:20967													
NAE1	gene	NAE1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with dysmorphic facies and ischiopubic hypoplasia, MIM# 620210			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36608681		False	3	100;0;0	2.156	True		ENSG00000159593	ENSG00000159593	HGNC:621													
NAGA	gene	NAGA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kanzaki disease, MIM# 609242;Schindler disease, type I and type II 609241;alpha-N-acetylgalactosaminidase deficiency MONDO:0017779			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11313741;31468281;15619430;8782044		False	3	100;0;0	2.156	True		ENSG00000198951	ENSG00000198951	HGNC:7631													
NAGLU	gene	NAGLU	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8650226		False	3	100;0;0	2.156	True		ENSG00000108784	ENSG00000108784	HGNC:7632													
NALCN	gene	NALCN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Congenital contractures of the limbs and face, hypotonia, and developmental delay, MIM# 616266;Hypotonia, infantile, with psychomotor retardation and characteristic facies 1, MIM # 615419			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25683120;30167850;23749988;24075186		False	3	100;0;0	2.156	True		ENSG00000102452	ENSG00000102452	HGNC:19082													
NANS	gene	NANS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spondyloepimetaphyseal dysplasia, Camera-Genevieve type - MIM#610442			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8152878;15726110;8723082;27213289;7551156		False	3	100;0;0	2.156	True		ENSG00000095380	ENSG00000095380	HGNC:19237													
NAPB	gene	NAPB	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 107 MIM#620033			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26235277;28097321;33189936		False	3	100;0;0	2.156	True		ENSG00000125814	ENSG00000125814	HGNC:15751													
NARS1	gene	NARS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091;Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092;Abnormal muscle tone;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Ataxia;Abnormality of the face;Demyelinating peripheral neuropathy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32738225		False	3	100;0;0	2.156	True		ENSG00000134440	ENSG00000134440	HGNC:7643													
NAV3	gene	NAV3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with poor or absent speech, dysmorphic facies, and behavioral abnormalities, MIM# 621182			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39708122;38977784		False	3	100;0;0	2.156	True		ENSG00000067798	ENSG00000067798	HGNC:15998													
NBEA	gene	NBEA	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM#	619157;Intellectual disability;Seizures"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30269351;28554332;12746398;12826745;11450821;3377648;23277425;22109531;23153818		False	3	100;0;0	2.156	True		ENSG00000172915	ENSG00000172915	HGNC:7648													
NCAPD2	gene	NCAPD2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Microcephaly 21, primary, autosomal recessive;OMIM #617983			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31056748;27737959;28097321		False	3	0;100;0	2.156	True		ENSG00000010292	ENSG00000010292	HGNC:24305													
NCDN	gene	NCDN	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with infantile epileptic spasms (NEDIES), MIM#619373			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33711248		False	3	100;0;0	2.156	True		ENSG00000020129	ENSG00000020129	HGNC:17597													
NCKAP1	gene	NCKAP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092) , NCKAP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33157009		False	3	100;0;0	2.156	True		ENSG00000061676	ENSG00000061676	HGNC:7666													
NCOR1	gene	NCOR1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	complex neurodevelopmental disorder, MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32034166;31849593;30664766;30289594;29483668		False	3	100;0;0	2.156	False		ENSG00000141027	ENSG00000141027	HGNC:7672													
NDC1	gene	NDC1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39003500;19782045		False	3	100;0;0	2.156	True		ENSG00000058804	ENSG00000058804	HGNC:25525													
NDE1	gene	NDE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly with lissencephaly and/or hydranencephaly, MONDO:0700116			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21529752;21529751;30637988;15473967		False	3	100;0;0	2.156	True		ENSG00000072864	ENSG00000072864	HGNC:17619													
NDP	gene	NDP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Norrie disease MONDO:0010691			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000124479	ENSG00000124479	HGNC:7678													
NDST1	gene	NDST1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 46 - MIM#616116			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25125150;21937992;32878022;28211985		False	3	100;0;0	2.156	True		ENSG00000070614	ENSG00000070614	HGNC:7680													
NDUFA1	gene	NDUFA1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mitochondrial complex I deficiency, nuclear type 12 MIM#301020			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29506883;19185523;17262856;21596602		False	3	100;0;0	2.156	True		ENSG00000125356	ENSG00000125356	HGNC:7683													
NDUFA2	gene	NDUFA2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 13, MIM#618235			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18513682;28857146		False	3	100;0;0	2.156	True		ENSG00000131495	ENSG00000131495	HGNC:7685													
NDUFA3	gene	NDUFA3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970,NDUFA3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41038977;39661167		False	3	100;0;0	2.156	True		ENSG00000170906	ENSG00000170906	HGNC:7686													
NDUFA5	gene	NDUFA5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, NDUFA5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41916321		False	3	100;0;0	2.156	True		ENSG00000128609	ENSG00000128609	HGNC:7688													
NDUFAF1	gene	NDUFAF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 11, MIM#618234			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17557076;21931170;24963768		False	3	100;0;0	2.156	True		ENSG00000137806	ENSG00000137806	HGNC:18828													
NDUFB7	gene	NDUFB7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency nuclear type 39 (MC1DN39), MIM#620135			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33502047;27626371;40025060		False	3	50;50;0	2.156	True		ENSG00000099795	ENSG00000099795	HGNC:7702													
NDUFS1	gene	NDUFS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 5, MIM# 618226			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20382551		False	3	100;0;0	2.156	True		ENSG00000023228	ENSG00000023228	HGNC:7707													
NDUFS4	gene	NDUFS4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 1, 252010;Leigh syndrome, MIM#252010			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10944442;27079373;19107570;12616398		False	3	100;0;0	2.156	True		ENSG00000164258	ENSG00000164258	HGNC:7711													
NDUFS7	gene	NDUFS7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 3 (MIM# 618224)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22644603		False	3	100;0;0	2.156	True		ENSG00000115286	ENSG00000115286	HGNC:7714													
NDUFS8	gene	NDUFS8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 2 MIM#618222			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23430795;9837812;15159508;22499348;20818383;20819849		False	3	100;0;0	2.156	True		ENSG00000110717	ENSG00000110717	HGNC:7715													
NDUFV1	gene	NDUFV1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 4 MIM#618225			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34807224		False	3	100;0;0	2.156	True		ENSG00000167792	ENSG00000167792	HGNC:7716													
NEDD4L	gene	NEDD4L	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Periventricular nodular heterotopia 7, MIM#617201			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000049759	ENSG00000049759	HGNC:7728													
NEMF	gene	NEMF	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual developmental disorder with speech delay and axonal peripheral neuropathy, MIM# 619099;Intellectual disability;neuropathy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32934225		False	3	100;0;0	2.156	True		ENSG00000165525	ENSG00000165525	HGNC:10663													
NEU1	gene	NEU1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sialidosis, type I and type II, MIM# 256550;MONDO:0009738			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8985184;9054950;11063730		False	3	100;0;0	2.156	True		ENSG00000204386	ENSG00000204386	HGNC:7758													
NEUROD2	gene	NEUROD2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 72, MIM# 618374;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33438828;30323019		False	3	100;0;0	2.156	True		ENSG00000171532	ENSG00000171532	HGNC:7763													
NEUROG1	gene	NEUROG1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cranial dysinnervation disorder, congenital, with absent corneal reflex and developmental delay, OMIM:620469			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23419067;26077850;33439489;36647078		False	3	100;0;0	2.156	True		ENSG00000181965	ENSG00000181965	HGNC:7764													
NEXMIF	gene	NEXMIF	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mental retardation, X-linked 98, MIM# 300912			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27358180		False	3	100;0;0	2.156	True		ENSG00000050030	ENSG00000050030	HGNC:29433													
NF1	gene	NF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurofibromatosis, type 1 (MIM#162200)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23931823;10762507		False	3	100;0;0	2.156	True		ENSG00000196712	ENSG00000196712	HGNC:7765													
NFASC	gene	NFASC	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with central and peripheral motor dysfunction;OMIM #618356			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31501903;28940097;30124836;30850329;31608123		False	3	100;0;0	2.156	True		ENSG00000163531	ENSG00000163531	HGNC:29866													
NFIA	gene	NFIA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Brain malformations with or without urinary tract defects - MIM#613735			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35018717;33973697;32926563		False	3	100;0;0	2.156	True		ENSG00000162599	ENSG00000162599	HGNC:7784													
NFIB	gene	NFIB	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Macrocephaly, acquired, with impaired intellectual development, MIM#618286			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30388402		False	3	100;0;0	2.156	True		ENSG00000147862	ENSG00000147862	HGNC:7785													
NFIC	gene	NFIC	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, NFIC-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42498698		False	3	100;0;0	2.156	True		ENSG00000141905	ENSG00000141905	HGNC:7786													
NFIX	gene	NFIX	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Sotos syndrome 2 (MIM#614753);Marshall-Smith syndrome, MIM# 602535			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33034087;29897170;30548146;25118028		False	3	100;0;0	2.156	True		ENSG00000008441	ENSG00000008441	HGNC:7788													
NFU1	gene	NFU1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 1, MIM# 605711			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21944046;22077971;32747156;29441221		False	3	100;0;0	2.156	True		ENSG00000169599	ENSG00000169599	HGNC:16287													
NGLY1	gene	NGLY1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of deglycosylation (OMIM 615273)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24651605;27388694;32259258		False	3	100;0;0	2.156	True		ENSG00000151092	ENSG00000151092	HGNC:17646													
NHS	gene	NHS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Nance-Horan syndrome - MIM#302350;Cataract 40, X-linked - MIM#302200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31755796;25266737		False	3	100;0;0	2.156	True		ENSG00000188158	ENSG00000188158	HGNC:7820													
NIPBL	gene	NIPBL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cornelia de Lange syndrome 1, MIM # 122470			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16604071;20358602;16236812;17661813		False	3	100;0;0	2.156	True		ENSG00000164190	ENSG00000164190	HGNC:28862													
NKAP	gene	NKAP	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	intellectual developmental disorder, X-linked, syndromic, Hackmann-Di Donato type, MONDO:0026733, MIM#301039			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26358559;26350204;31587868		False	3	100;0;0	2.156	True		ENSG00000101882	ENSG00000101882	HGNC:29873													
NKX2-1	gene	NKX2-1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10931427;27066577;26839702;26103969;23911641;11854319;24714694		False	3	100;0;0	2.156	True		ENSG00000136352	ENSG00000136352	HGNC:11825													
NLGN3	gene	NLGN3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	X-linked complex neurodevelopmental disorder MONDO:0100148;{Autism susceptibility, X-linked 1} - MIM#300425			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28584888;12669065;25167861		False	3	100;0;0	2.156	True		ENSG00000196338	ENSG00000196338	HGNC:14289													
NLGN4X	gene	NLGN4X	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked, MIM# 300495			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16648374;28263302;12669065;18231125;10071191;29428674;26350204;14963808;23352163		False	3	50;0;50	2.156	True		ENSG00000146938	ENSG00000146938	HGNC:14287													
NONO	gene	NONO	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked syndromic 34 - MIM#300967			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26571461;27329731;27550220		False	3	100;0;0	2.156	True		ENSG00000147140	ENSG00000147140	HGNC:7871													
NOTCH1	gene	NOTCH1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35947102		False	3	100;0;0	2.156	True	Other	ENSG00000148400	ENSG00000148400	HGNC:7881													
NOTCH3	gene	NOTCH3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, NOTCH3-related;Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1, MIM#125310			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	50;0;50	2.156	True		ENSG00000074181	ENSG00000074181	HGNC:7883													
NOVA2	gene	NOVA2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;autism;hypotonia;spasticity;ataxia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32197073		False	3	100;0;0	2.156	True	Other	ENSG00000104967	ENSG00000104967	HGNC:7887													
NPC1	gene	NPC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C1 and type D, MIM# 257220;MONDO:0009757			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9211849;11333381		False	3	100;0;0	2.156	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC2	gene	NPC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-pick disease, type C2, MIM# 607625;MONDO:0011873			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11125141;17470133		False	3	100;0;0	2.156	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPHP1	gene	NPHP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 4, MIM# 609583;Nephronophthisis 1, juvenile, MIM# 256100;Senior-Loken syndrome-1, MIM# 266900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15138899;32139166;28347285;8852662;9856524		False	3	100;0;0	2.156	True		ENSG00000144061	ENSG00000144061	HGNC:7905													
NPHP3	gene	NPHP3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Meckel syndrome 7, MIM# 267010			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18371931		False	3	100;0;0	2.156	True		ENSG00000113971	ENSG00000113971	HGNC:7907													
NPRL2	gene	NPRL2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	epilepsy, familial focal, with variable foci 2 (MIM#617116)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26505888;34376795;40804712;30093711		False	3	100;0;0	2.156	True		ENSG00000114388	ENSG00000114388	HGNC:24969													
NPTN	gene	NPTN	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42387534		False	3	100;0;0	2.156	True		ENSG00000156642	ENSG00000156642	HGNC:17867													
NR2F1	gene	NR2F1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32275123		False	3	100;0;0	2.156	True		ENSG00000175745	ENSG00000175745	HGNC:7975													
NR2F2	gene	NR2F2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disease, MONDO:0002254, NR2F2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29478779;29663647;37500725		False	3	50;50;0	2.156	True		ENSG00000185551	ENSG00000185551	HGNC:7976													
NR4A2	gene	NR4A2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM#	619911"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31428396;30504930;29770430		False	3	50;50;0	2.156	True		ENSG00000153234	ENSG00000153234	HGNC:7981													
NRAS	gene	NRAS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Noonan syndrome 6, MIM# 613224			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19966803;26467218;28594414		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000213281	ENSG00000213281	HGNC:7989													
NRCAM	gene	NRCAM	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with neuromuscular and skeletal abnormalities, MIM# 619833			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35108495		False	3	100;0;0	2.156	True		ENSG00000091129	ENSG00000091129	HGNC:7994													
NRDC	gene	NRDC	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, NRDC-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41449824;28017472;34582790;19935654;41734767;41449824		False	3	50;50;0	2.156	True		ENSG00000078618	ENSG00000078618	HGNC:7995													
NRROS	gene	NRROS	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodegeneration;intracranial calcification;epilepsy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32197075;32100099		False	3	100;0;0	2.156	True		ENSG00000174004	ENSG00000174004	HGNC:24613													
NRXN1	gene	NRXN1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Pitt-Hopkins-like syndrome 2 - MIM#614325;Complex neurodevelopmental disorder, MONDO:0100038, NRXN1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25486015;19896112;21964664;30873608;35101781;22337556;22670139		False	3	100;0;0	2.156	True		ENSG00000179915	ENSG00000179915	HGNC:8008													
NSD1	gene	NSD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Sotos syndrome MONDO:0019349			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000165671	ENSG00000165671	HGNC:14234													
NSD2	gene	NSD2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Rauch-Steindl syndrome, MIM# 619695;Microcephaly;intellectual disability;Neurodevelopmental disorder, NSD2-associated, GoF, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30345613;31171569;36189577		False	3	100;0;0	2.156	True		ENSG00000109685	ENSG00000109685	HGNC:12766													
NSDHL	gene	NSDHL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	CK syndrome (MIM#300831)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21129721;15689440;25900314		False	3	100;0;0	2.156	True		ENSG00000147383	ENSG00000147383	HGNC:13398													
NSF	gene	NSF	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 96, MIM# 619340;Seizures;EEG with burst suppression;Global developmental delay;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31675180		False	3	100;0;0	2.156	True		ENSG00000073969	ENSG00000073969	HGNC:8016													
NSRP1	gene	NSRP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy;Cerebral palsy;microcephaly;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34385670		False	3	50;50;0	2.156	True		ENSG00000126653	ENSG00000126653	HGNC:25305													
NSUN2	gene	NSUN2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 5 - MIM#611091			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22541559;22541562;21063731;22577224;35126837		False	3	100;0;0	2.156	True		ENSG00000037474	ENSG00000037474	HGNC:25994													
NSUN3	gene	NSUN3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 48, MIM# 619012			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27356879;32488845;40465263		False	3	100;0;0	2.156	True		ENSG00000178694	ENSG00000178694	HGNC:26208													
NSUN6	gene	NSUN6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 82, MIM# 620779			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37226891		False	3	67;33;0	2.156	True		ENSG00000241058	ENSG00000241058	HGNC:23529													
NT5C2	gene	NT5C2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 45, autosomal recessive, MIM# 613162;MONDO:0013165			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24482476;32153630;29123918;28884889;28327087		False	3	100;0;0	2.156	True		ENSG00000076685	ENSG00000076685	HGNC:8022													
NTNG2	gene	NTNG2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual disability;autism;dysmorphic features;Neurodevelopmental disorder with behavioral abnormalities, absent speech, and hypotonia, MIM#	618718"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31668703;31692205		False	3	100;0;0	2.156	True		ENSG00000196358	ENSG00000196358	HGNC:14288													
NTRK1	gene	NTRK1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Insensitivity to pain, congenital, with anhidrosis - MIM#256800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10233776;19250380;10861667;10982191;20301726;20089052		False	3	100;0;0	2.156	True		ENSG00000198400	ENSG00000198400	HGNC:8031													
NTRK2	gene	NTRK2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Obesity, hyperphagia, and developmental delay, MIM# 613886			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15494731;27884935;29100083		False	3	100;0;0	2.156	True		ENSG00000148053	ENSG00000148053	HGNC:8032													
NUBPL	gene	NUBPL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 21 - MIM#618242			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20818383;32518176;23553477;31917109;32518176;31787496;30897263;22826544		False	3	100;0;0	2.156	True		ENSG00000151413	ENSG00000151413	HGNC:20278													
NUDT2	gene	NUDT2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with or without peripheral neuropathy MIM#619844			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27431290;30059600;33058507		False	3	100;0;0	2.156	True		ENSG00000164978	ENSG00000164978	HGNC:8049													
NUP188	gene	NUP188	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sandestig-Stefanova syndrome, 618804;microcephaly;ID;cataract;structural brain abnormalities;hypoventilation			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32021605;28726809;32275884		False	3	100;0;0	2.156	True		ENSG00000095319	ENSG00000095319	HGNC:17859													
NUP214	gene	NUP214	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"{Encephalopathy, acute, infection-induced, susceptibility to, 9}, MIM#	618426;epileptic encephalopathy;developmental regression;microcephaly"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31178128;30758658		False	3	100;0;0	2.156	True		ENSG00000126883	ENSG00000126883	HGNC:8064													
NUS1	gene	NUS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 55, with seizures, MIM# 617831			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31656175;29100083		False	3	100;0;0	2.156	True		ENSG00000153989	ENSG00000153989	HGNC:21042													
OCLN	gene	OCLN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pseudo-TORCH syndrome 1, MIM#251290			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20727516;32240828;29192239;28386946		False	3	100;0;0	2.156	True		ENSG00000197822	ENSG00000197822	HGNC:8104													
OCRL	gene	OCRL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	oculocerebrorenal syndrome MONDO:0010645			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000122126	ENSG00000122126	HGNC:8108													
ODC1	gene	ODC1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with alopecia and brain imaging abnormalities (NEDABIA), MIM#619075			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30475435;30239107		False	3	100;0;0	2.156	True	Other	ENSG00000115758	ENSG00000115758	HGNC:8109													
OFD1	gene	OFD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	ciliopathy MONDO:0005308			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24884629		False	3	100;0;0	2.156	True		ENSG00000046651	ENSG00000046651	HGNC:2567													
OGDH	gene	OGDH	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Oxoglutarate dehydrogenase deficiency, MIM# 203740			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36520152;32383294		False	3	100;0;0	2.156	True		ENSG00000105953	ENSG00000105953	HGNC:8124													
OGDHL	gene	OGDHL	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Yoon-Bellen neurodevelopmental syndrome, MIM# 619701;Neurodevelopmental disorder featuring epilepsy, hearing loss and visual impairment			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34800363		False	3	100;0;0	2.156	True		ENSG00000197444	ENSG00000197444	HGNC:25590													
OGT	gene	OGT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked 106, MIM# 300997			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28302723;28584052;31296563;31627256;29769320;29606577		False	3	100;0;0	2.156	True		ENSG00000147162	ENSG00000147162	HGNC:8127													
OLA1	gene	OLA1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, OLA1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41887223		False	3	100;0;0	2.156	True		ENSG00000138430	ENSG00000138430	HGNC:28833													
OPA3	gene	OPA3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR;Optic atrophy 3 with cataract (MIM#165300), AD			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25159689;31119193;31928268		False	3	100;0;0	2.156	True		ENSG00000125741	ENSG00000125741	HGNC:8142													
OPHN1	gene	OPHN1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, MIM#300486			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20528889;9582072;12807966;16221952		False	3	100;0;0	2.156	True		ENSG00000079482	ENSG00000079482	HGNC:8148													
OSGEP	gene	OSGEP	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Galloway-Mowat syndrome 3, MIM#	617729"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28805828;28272532		False	3	100;0;0	2.156	True		ENSG00000092094	ENSG00000092094	HGNC:18028													
OTC	gene	OTC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Ornithine transcarbamylase deficiency, MIM#311250			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000036473	ENSG00000036473	HGNC:8512													
OTUD5	gene	OTUD5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Multiple congenital anomalies-neurodevelopmental syndrome, X-linked, MIM# 301056			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33131077;33523931		False	3	50;0;50	2.156	True		ENSG00000068308	ENSG00000068308	HGNC:25402													
OTUD6B	gene	OTUD6B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, OMIM #617452			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28343629;32924626;31147255		False	3	100;0;0	2.156	True		ENSG00000155100	ENSG00000155100	HGNC:24281													
OTUD7A	gene	OTUD7A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia and seizures, MIM# 620790			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31997314;29395075;29395074;33381903;36180924;41028987		False	3	33;33;33	2.156	True		ENSG00000169918	ENSG00000169918	HGNC:20718													
OTX2	gene	OTX2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microphthalmia, syndromic 5, MIM# 610125;Pituitary hormone deficiency, combined, 6, MIM# 613986;Retinal dystrophy, early-onset, with or without pituitary dysfunction, MIM# 610125;Otocephaly-dysgnathia complex			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24167467;25589041;31969185		False	3	100;0;0	2.156	True		ENSG00000165588	ENSG00000165588	HGNC:8522													
OXR1	gene	OXR1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;seizures;cerebellar atrophy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31785787		False	3	100;0;0	2.156	True		ENSG00000164830	ENSG00000164830	HGNC:15822													
P4HTM	gene	P4HTM	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, hypoventilation, impaired intellectual development, dysautonomia, epilepsy, and eye abnormalities;OMIM #618493			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 25078763;30940925		False	3	100;0;0	2.156	True		ENSG00000178467	ENSG00000178467	HGNC:28858													
PABPC1	gene	PABPC1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, PABPC1-related (MONDO#0700092)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35511136		False	3	100;0;0	2.156	True		ENSG00000070756	ENSG00000070756	HGNC:8554													
PACS1	gene	PACS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Schuurs-Hoeijmakers syndrome (MIM# 615009)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26842493;23159249		False	3	100;0;0	2.156	True		ENSG00000175115	ENSG00000175115	HGNC:30032													
PACS2	gene	PACS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 66, MIM#618067			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29656858		False	3	100;0;0	2.156	True		ENSG00000179364	ENSG00000179364	HGNC:23794													
PAFAH1B1	gene	PAFAH1B1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lissencephaly 1, MIM# 607432;Subcortical laminar heterotopia, MIM# 607432;MONDO:0011830			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11754098;18285425		False	3	100;0;0	2.156	True		ENSG00000007168	ENSG00000007168	HGNC:8574													
PAH	gene	PAH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phenylketonuria, MIM#261600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000171759	ENSG00000171759	HGNC:8582													
PAK1	gene	PAK1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with macrocephaly, seizures, and speech delay;OMIM #618158			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31504246;30290153		False	3	100;0;0	2.156	True		ENSG00000149269	ENSG00000149269	HGNC:8590													
PAK2	gene	PAK2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Knobloch 2 syndrome MIM#618458			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33693784;38894571;38712026		False	3	100;0;0	2.156	True		ENSG00000180370	ENSG00000180370	HGNC:8591													
PAK3	gene	PAK3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked 30/47, MIM# 300558;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9731525;10946356;12884430;17853471;18523455;32050918;32005903;31943058;31843706;31678216		False	3	100;0;0	2.156	True		ENSG00000077264	ENSG00000077264	HGNC:8592													
PALS1	gene	PALS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Global developmental delay;Intellectual disability;Delayed speech and language development;Developmental regression;Behavioral abnormality			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33073849		False	3	100;0;0	2.156	True		ENSG00000072415	ENSG00000072415	HGNC:18669													
PAM16	gene	PAM16	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spondylometaphyseal dysplasia, Megarbane-Dagher-Melike type, MIM#613320			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24786642;27354339		False	3	100;0;0	2.156	True		ENSG00000217930	ENSG00000217930	HGNC:29679													
PAN2	gene	PAN2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental delay with variable cardiac and renal congenital anomalies and dysmoprhic facies, MIM# 621384			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID:35304602;29620724		False	3	100;0;0	2.156	True		ENSG00000135473	ENSG00000135473	HGNC:20074													
PARN	gene	PARN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dyskeratosis congenita, autosomal recessive 6, MIM# 616353			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25893599;26342108		False	3	100;0;0	2.156	True		ENSG00000140694	ENSG00000140694	HGNC:8609													
PARP6	gene	PARP6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Epilepsy;Microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34067418		False	3	100;0;0	2.156	True		ENSG00000137817	ENSG00000137817	HGNC:26921													
PAX1	gene	PAX1	Expert Review Green;Literature;Radboud University Medical Center, Nijmegen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Otofaciocervical syndrome 2 with T-cell deficiency, MIM #615560			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29681087, 37924468, 37689091, 32111619, 29681087, 28657137, 23851939		False	3	50;50;0	2.156	True		ENSG00000125813	ENSG00000125813	HGNC:8615													
PAX5	gene	PAX5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092, PAX5-related;Hypogammaglobulinaemia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35094443;31452935;28263302;25418537;8001127;27626380;35947077		False	3	50;50;0	2.156	True		ENSG00000196092	ENSG00000196092	HGNC:8619													
PAX6	gene	PAX6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microphthalmia/coloboma 12, OMIM #120200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26130484;31700164		False	3	100;0;0	2.156	True		ENSG00000007372	ENSG00000007372	HGNC:8620													
PAX8	gene	PAX8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypothyroidism, congenital, due to thyroid dysgenesis or hypoplasia, MIM# 218700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33272083;9590296;11232006;15356023;15718293		False	3	100;0;0	2.156	True		ENSG00000125618	ENSG00000125618	HGNC:8622													
PBX1	gene	PBX1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital anomalies of kidney and urinary tract syndrome with or without hearing loss, abnormal ears, or developmental delay, OMIM #617641			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000185630	ENSG00000185630	HGNC:8632													
PC	gene	PC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate carboxylase deficiency - MIM#266150			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9585612;12112657		False	3	100;0;0	2.156	True		ENSG00000173599	ENSG00000173599	HGNC:8636													
PCBP1	gene	PCBP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, PCBP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41415500		False	3	100;0;0	2.156	True		ENSG00000169564	ENSG00000169564	HGNC:8647													
PCBP2	gene	PCBP2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, PCBP2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38965372		False	3	100;0;0	2.156	True		ENSG00000197111	ENSG00000197111	HGNC:8648													
PCCA	gene	PCCA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Propionicacidemia MIM#606054			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22593918		False	3	100;0;0	2.156	True		ENSG00000175198	ENSG00000175198	HGNC:8653													
PCCB	gene	PCCB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Propionicacidemia MIM#606054			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22593918		False	3	100;0;0	2.156	True		ENSG00000114054	ENSG00000114054	HGNC:8654													
PCDH12	gene	PCDH12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM#251280			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27164683;30178464		False	3	100;0;0	2.156	True		ENSG00000113555	ENSG00000113555	HGNC:8657													
PCDH19	gene	PCDH19	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Other	Developmental and epileptic encephalopathy 9 MIM#300088			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28669061		False	3	100;0;0	2.156	True		ENSG00000165194	ENSG00000165194	HGNC:14270													
PCDHGC4	gene	PCDHGC4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with poor growth and skeletal anomalies, MIM# 619880			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34244665		False	3	100;0;0	2.156	True		ENSG00000242419	ENSG00000242419	HGNC:8717													
PCGF2	gene	PCGF2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Turnpenny-Fry syndrome, MIM# 618371			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30343942		False	3	100;0;0	2.156	True		-	ENSG00000277258	HGNC:12929													
PCLO	gene	PCLO	Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 3, MIM#608027			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25832664;40661989;32122952;30287594		False	3	100;0;0	2.156	True		ENSG00000186472	ENSG00000186472	HGNC:13406													
PCYT2	gene	PCYT2	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Global developmental delay with regression;spastic para- or tetra paresis;epilepsy;progressive cerebral and cerebellar atrophy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31637422		False	3	100;0;0	2.156	True		ENSG00000185813	ENSG00000185813	HGNC:8756													
PDCD6IP	gene	PDCD6IP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 29, primary, autosomal recessive, MIM# 620047			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 32286682		False	3	50;0;50	2.156	True		ENSG00000170248	ENSG00000170248	HGNC:8766													
PDE10A	gene	PDE10A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dyskinesia, limb and orofacial, infantile-onset, MIM#616921			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27058446		False	3	100;0;0	2.156	True		ENSG00000112541	ENSG00000112541	HGNC:8772													
PDE1B	gene	PDE1B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40492975		False	3	100;0;0	2.156	True		ENSG00000123360	ENSG00000123360	HGNC:8775													
PDE4D	gene	PDE4D	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Acrodysostosis 2, with or without hormone resistance, MIM# 614613			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22464250;22464252;23033274;24203977		False	3	100;0;0	2.156	True		ENSG00000113448	ENSG00000113448	HGNC:8783													
PDE6D	gene	PDE6D	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 22, MIM#615665			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24166846;30423442		False	3	100;0;0	2.156	True		ENSG00000156973	ENSG00000156973	HGNC:8788													
PDGFRB	gene	PDGFRB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Kosaki overgrowth syndrome MIM#616592			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31710779;35221873		False	3	100;0;0	2.156	True		ENSG00000113721	ENSG00000113721	HGNC:8804													
PDHA1	gene	PDHA1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Pyruvate dehydrogenase E1-alpha deficiency MIM#312170			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23021068		False	3	100;0;0	2.156	True		ENSG00000131828	ENSG00000131828	HGNC:8806													
PDHB	gene	PDHB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase E1-beta deficiency, MIM#614111			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15138885;26014431		False	3	100;0;0	2.156	True		ENSG00000168291	ENSG00000168291	HGNC:8808													
PDHX	gene	PDHX	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lacticacidemia due to PDX1 deficiency MIM#245349			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34138529		False	3	100;0;0	2.156	True		ENSG00000110435	ENSG00000110435	HGNC:21350													
PDP1	gene	PDP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase phosphatase deficiency, MIM#608782			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19184109;15855260;31392110		False	3	100;0;0	2.156	True		ENSG00000164951	ENSG00000164951	HGNC:9279													
PDS5A	gene	PDS5A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder, MONDO:0100038, PDS5A -related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30158690;41810376;42431198		False	3	100;0;0	2.156	True		ENSG00000121892	ENSG00000121892	HGNC:29088													
PDS5B	gene	PDS5B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, PDS5B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41810376;42431198		False	3	100;0;0	2.156	True		ENSG00000083642	ENSG00000083642	HGNC:20418													
PDSS1	gene	PDSS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 2 MIM#614651			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17332895;22494076;33285023		False	3	100;0;0	2.156	True		ENSG00000148459	ENSG00000148459	HGNC:17759													
PDZD8	gene	PDZD8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder with autism and dysmorphic facies, MIM#	620021"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35227461		False	3	100;0;0	2.156	True		ENSG00000165650	ENSG00000165650	HGNC:26974													
PEPD	gene	PEPD	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Prolidase deficiency MIM#170100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26110198;32455636		False	3	100;0;0	2.156	True		ENSG00000124299	ENSG00000124299	HGNC:8840													
PET100	gene	PET100	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24462369;25293719;31406627		False	3	100;0;0	2.156	True		ENSG00000229833	ENSG00000229833	HGNC:40038													
PEX1	gene	PEX1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Heimler syndrome 1 MIM#234580;Peroxisome biogenesis disorder 1A (Zellweger) MIM#214100;Peroxisome biogenesis disorder 1B (NALD/IRD) MIM#601539			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301621		False	3	100;0;0	2.156	True		ENSG00000127980	ENSG00000127980	HGNC:8850													
PEX10	gene	PEX10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870;Peroxisome biogenesis disorder 6B MIM#614871			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301621		False	3	100;0;0	2.156	True		ENSG00000157911	ENSG00000157911	HGNC:8851													
PEX11B	gene	PEX11B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 14B MIM#614920			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28129423;22581968		False	3	100;0;0	2.156	True		ENSG00000131779	ENSG00000131779	HGNC:8853													
PEX12	gene	PEX12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 3A (Zellweger) MIM#614859;Peroxisome biogenesis disorder 3B MIM#266510			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301621		False	3	100;0;0	2.156	True		ENSG00000108733	ENSG00000108733	HGNC:8854													
PEX13	gene	PEX13	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 11A (Zellweger) MIM#614883;Peroxisome biogenesis disorder 11B MIM#614885			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301621		False	3	100;0;0	2.156	True		ENSG00000162928	ENSG00000162928	HGNC:8855													
PEX14	gene	PEX14	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Peroxisome biogenesis disorder 13A (Zellweger) MIM#614887;peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37493040;20301621		False	3	100;0;0	2.156	True		ENSG00000142655	ENSG00000142655	HGNC:8856													
PEX16	gene	PEX16	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876;Peroxisome biogenesis disorder 8B MIM#614877			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301621		False	3	100;0;0	2.156	True		ENSG00000121680	ENSG00000121680	HGNC:8857													
PEX19	gene	PEX19	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10051604;20683989;11883941;28391327		False	3	100;0;0	2.156	True		ENSG00000162735	ENSG00000162735	HGNC:9713													
PEX2	gene	PEX2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 5A (Zellweger) MIM#614866;Peroxisome biogenesis disorder 5B MIM#614867			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301621		False	3	100;0;0	2.156	True		ENSG00000164751	ENSG00000164751	HGNC:9717													
PEX26	gene	PEX26	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872;Peroxisome biogenesis disorder 7B MIM614873			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301621		False	3	100;0;0	2.156	True		ENSG00000215193	ENSG00000215193	HGNC:22965													
PEX3	gene	PEX3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882;Peroxisome biogenesis disorder 10B , MIM# 617370			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10942428;10958759;10968777;27557811;33101983;20301621		False	3	100;0;0	2.156	True		ENSG00000034693	ENSG00000034693	HGNC:8858													
PEX5	gene	PEX5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 2A (Zellweger) MIM#214110;Peroxisome biogenesis disorder 2B MIM#202370			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301621		False	3	100;0;0	2.156	True		ENSG00000139197	ENSG00000139197	HGNC:9719													
PEX6	gene	PEX6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 4A (Zellweger) MIM#614862;Peroxisome biogenesis disorder 4B MIM#614863			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29220678;20301621		False	3	100;0;0	2.156	True		ENSG00000124587	ENSG00000124587	HGNC:8859													
PEX7	gene	PEX7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 9B MIM#614879;Rhizomelic chondrodysplasia punctata, type 1 MIM#215100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301447		False	3	100;0;0	2.156	True		ENSG00000112357	ENSG00000112357	HGNC:8860													
PGAP1	gene	PGAP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with dysmorphic features, spasticity, and brain abnormalities, MIM# 615802			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24482476;24784135;25823418;25804403;26050939		False	3	100;0;0	2.156	True		ENSG00000197121	ENSG00000197121	HGNC:25712													
PGAP2	gene	PGAP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 3, MIM# 614207, MONDO:0013628			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23561846;23561847;31805394;29119105;27871432		False	3	100;0;0	2.156	True		ENSG00000148985	ENSG00000148985	HGNC:17893													
PGAP3	gene	PGAP3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 4, MIM# 615716, MONDO:0014318			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24439110;29620724;30345601;30217754		False	3	100;0;0	2.156	True		ENSG00000161395	ENSG00000161395	HGNC:23719													
PGBD5	gene	PGBD5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM#	621482"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41533792		False	3	100;0;0	2.156	True		ENSG00000177614	ENSG00000177614	HGNC:19405													
PGK1	gene	PGK1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Phosphoglycerate kinase 1 deficiency, MIM# 300653;MONDO:0010392			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000102144	ENSG00000102144	HGNC:8896													
PGM2L1	gene	PGM2L1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33979636		False	3	100;0;0	2.156	True		ENSG00000165434	ENSG00000165434	HGNC:20898													
PGM3	gene	PGM3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 23, MIM# 615816;PGM3-CDG, MONDO:0014353			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30578875;31231132;33098103;30157810;28704707		False	3	100;0;0	2.156	True		ENSG00000013375	ENSG00000013375	HGNC:8907													
PHACTR1	gene	PHACTR1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 70, MIM# 618298;PHACTR1-associated neurodevelopment disorder			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30256902;28135719;23033978;27457812		False	3	100;0;0	2.156	True	Other	ENSG00000112137	ENSG00000112137	HGNC:20990													
PHF21A	gene	PHF21A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with behavioral abnormalities and craniofacial dysmorphism with or without seizures, MIM# 618725			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31649809;30487643;22770980		False	3	100;0;0	2.156	True		ENSG00000135365	ENSG00000135365	HGNC:24156													
PHF5A	gene	PHF5A	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092), PHF5A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37422718		False	3	100;0;0	2.156	True		ENSG00000100410	ENSG00000100410	HGNC:18000													
PHF6	gene	PHF6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Borjeson-Forssman-Lehmann syndrome, MIM# 301900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16912705		False	3	100;0;0	2.156	True		ENSG00000156531	ENSG00000156531	HGNC:18145													
PHF8	gene	PHF8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation syndrome, X-linked, Siderius type, MIM#300263			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17661819;17594395;16199551		False	3	100;0;0	2.156	True		ENSG00000172943	ENSG00000172943	HGNC:20672													
PHGDH	gene	PHGDH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neu-Laxova syndrome 1 MIM#256520;Phosphoglycerate dehydrogenase deficiency MIM#601815			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37347880		False	3	100;0;0	2.156	True		ENSG00000092621	ENSG00000092621	HGNC:8923													
PHIP	gene	PHIP	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chung-Jansen syndrome, MIM#617991			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29209020;27900362;23033978		False	3	100;0;0	2.156	True		ENSG00000146247	ENSG00000146247	HGNC:15673													
PI4K2A	gene	PI4K2A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hyperkinetic movements, seizures and structural brain abnormalities, MIM# 620732			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30564627;35880319;19581584		False	3	100;0;0	2.156	True		ENSG00000155252	ENSG00000155252	HGNC:30031													
PI4KA	gene	PI4KA	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental syndrome with hypomyelinating leukodystrophy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34415322		False	3	100;0;0	2.156	True		ENSG00000241973	ENSG00000241973	HGNC:8983													
PIBF1	gene	PIBF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 33, OMIM #617767			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26167768;30858804;29695797;33004012		False	3	100;0;0	2.156	True		ENSG00000083535	ENSG00000083535	HGNC:23352													
PIDD1	gene	PIDD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 75, with neuropsychiatric features and variant lissencephaly, MIM# 619827			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28397838;29302074;33414379;34163010		False	3	100;0;0	2.156	True		ENSG00000177595	ENSG00000177595	HGNC:16491													
PIGA	gene	PIGA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466;Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22305531;24357517;24706016;26545172;33333793;32694024;34875027		False	3	100;0;0	2.156	True		ENSG00000165195	ENSG00000165195	HGNC:8957													
PIGB	gene	PIGB	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 80, MIM# 618580;Acrofrontofacionasal dysplasia 1, MIM# 201180			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31256876;34400385		False	3	100;0;0	2.156	True		ENSG00000069943	ENSG00000069943	HGNC:8959													
PIGC	gene	PIGC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 16, MIM# 617816			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27694521;32707268		False	3	100;0;0	2.156	True		ENSG00000135845	ENSG00000135845	HGNC:8960													
PIGG	gene	PIGG	Expert Review;Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with or without hypotonia, seizures, and cerebellar atrophy	MIM#616917"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26996948		False	3	100;0;0	2.156	True		ENSG00000174227	ENSG00000174227	HGNC:25985													
PIGH	gene	PIGH	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 17, MIM#618010			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29573052;29603516		False	3	100;0;0	2.156	True		ENSG00000100564	ENSG00000100564	HGNC:8964													
PIGK	gene	PIGK	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures, MIM# 618879			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32220290		False	3	100;0;0	2.156	True		ENSG00000142892	ENSG00000142892	HGNC:8965													
PIGL	gene	PIGL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	CHIME syndrome, MIM# 280000, MONDO:0010221			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22444671;31535386;30023290;29473937;28371479;25706356		False	3	100;0;0	2.156	True		ENSG00000108474	ENSG00000108474	HGNC:8966													
PIGN	gene	PIGN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple congenital anomalies-hypotonia-seizures syndrome 1, MIM# 614080, MONDO:0013563			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21493957;24253414;26364997;26394714;33193741;32585529;29330547		False	3	100;0;0	2.156	True		ENSG00000197563	ENSG00000197563	HGNC:8967													
PIGO	gene	PIGO	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 2, MIM# 614749, MONDO:0013882			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22683086;31698102;28900819;28545593;28337824		False	3	100;0;0	2.156	True		ENSG00000165282	ENSG00000165282	HGNC:23215													
PIGP	gene	PIGP	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 55, 617599			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28334793;31139695;32042915		False	3	50;50;0	2.156	True		ENSG00000185808	ENSG00000185808	HGNC:3046													
PIGQ	gene	PIGQ	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 77 (MIM #618548)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32588908;24463883;25558065;31148362		False	3	100;0;0	2.156	True		ENSG00000007541	ENSG00000007541	HGNC:14135													
PIGS	gene	PIGS	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Glycosylphosphatidylinositol biosynthesis defect 18, MIM#	618143"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30269814		False	3	100;0;0	2.156	True		ENSG00000087111	ENSG00000087111	HGNC:14937													
PIGT	gene	PIGT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30976099;25943031;24906948;24906948;24906948;28728837;28728837;28728837		False	3	100;0;0	2.156	True		ENSG00000124155	ENSG00000124155	HGNC:14938													
PIGV	gene	PIGV	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 1, MIM# 239300, MONDO:0009398			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20802478;22315194;28817240;24129430		False	3	100;0;0	2.156	True		ENSG00000060642	ENSG00000060642	HGNC:26031													
PIGW	gene	PIGW	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 11, MIM# 616025			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24367057;27626616;30813920;32198969		False	3	100;0;0	2.156	True		-	ENSG00000277161	HGNC:23213													
PIK3C2A	gene	PIK3C2A	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Oculoskeletodental syndrome, 618440			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31034465		False	3	100;0;0	2.156	True		ENSG00000011405	ENSG00000011405	HGNC:8971													
PIK3CA	gene	PIK3CA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	PIK3CA-related overgrowth spectrum MONDO:1040002			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23946963		False	3	100;0;0	2.156	True		ENSG00000121879	ENSG00000121879	HGNC:8975													
PIK3R2	gene	PIK3R2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 1, MIM# 603387			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22729224;23745724;33604570		False	3	100;0;0	2.156	True		ENSG00000105647	ENSG00000105647	HGNC:8980													
PIP5K1C	gene	PIP5K1C	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with intellectual, visual, and language impairment MIM#621635			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37451268		False	3	100;0;0	2.156	True		ENSG00000186111	ENSG00000186111	HGNC:8996													
PISD	gene	PISD	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;cataracts;retinal degeneration;microcephaly;deafness;short stature;white matter abnormalities;no OMIM number yet.			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31263216;30858161		False	3	100;0;0	2.156	True		ENSG00000241878	ENSG00000241878	HGNC:8999													
PITRM1	gene	PITRM1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26697887;29764912;29383861		False	3	100;0;0	2.156	True		ENSG00000107959	ENSG00000107959	HGNC:17663													
PLA2G6	gene	PLA2G6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile neuroaxonal dystrophy 1 MIM#256600;Neurodegeneration with brain iron accumulation 2B MIM#610217			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301718		False	3	100;0;0	2.156	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLAA	gene	PLAA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, MIM# 617527			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28007986;28413018;31322726		False	3	100;0;0	2.156	True		ENSG00000137055	ENSG00000137055	HGNC:9043													
PLAAT3	gene	PLAAT3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lipodystrophy, familial partial, type 9, MIM# 620683			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37919452		False	3	100;0;0	2.156	True		ENSG00000176485	ENSG00000176485	HGNC:17825													
PLAT	gene	PLAT	ClinGen;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO:0002254, PLAT-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39574431;37808270;27417437		False	3	100;0;0	2.156	True		ENSG00000104368	ENSG00000104368	HGNC:9051													
PLCB1	gene	PLCB1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 12 (MIM#613722)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24684524;20833646;22690784;26818157		False	3	100;0;0	2.156	True		ENSG00000182621	ENSG00000182621	HGNC:15917													
PLK1	gene	PLK1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, PLK1-related, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33875846		False	3	100;0;0	2.156	True		ENSG00000166851	ENSG00000166851	HGNC:9077													
PLK4	gene	PLK4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly and chorioretinopathy, autosomal recessive, 2, MIM# 616171			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25344692;25320347;27650967		False	3	100;0;0	2.156	True		ENSG00000142731	ENSG00000142731	HGNC:11397													
PLP1	gene	PLP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Pelizeaus-Merzbacher spectrum disorder MONDO:0010714			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000123560	ENSG00000123560	HGNC:9086													
PLPBP	gene	PLPBP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, early-onset, vitamin B6-dependent, MIM# 617290			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27912044;31741821;30668673		False	3	100;0;0	2.156	True		ENSG00000147471	ENSG00000147471	HGNC:9457													
PLXNA1	gene	PLXNA1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dworschak-Punetha neurodevelopmental syndrome, MIM# 619955			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34054129		False	3	100;0;0	2.156	True		ENSG00000114554	ENSG00000114554	HGNC:9099													
PLXNB2	gene	PLXNB2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease MONDO:0002254, PLXNB2 -related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38458752		False	3	100;0;0	2.156	True		ENSG00000196576	ENSG00000196576	HGNC:9104													
PMM2	gene	PMM2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ia MIM#212065			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301289		False	3	100;0;0	2.156	True		ENSG00000140650	ENSG00000140650	HGNC:9115													
PMPCA	gene	PMPCA	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 2, MIM#	213200"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25808372;26657514;27148589;30617178		False	3	100;0;0	2.156	True		ENSG00000165688	ENSG00000165688	HGNC:18667													
PMPCB	gene	PMPCB	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multiple mitochondrial dysfunctions syndrome 6, MIM#	617954"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29576218		False	3	100;0;0	2.156	True		ENSG00000105819	ENSG00000105819	HGNC:9119													
PNKP	gene	PNKP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, seizures, and developmental delay, MIM#613402			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23224214;20118933		False	3	100;0;0	2.156	True		ENSG00000039650	ENSG00000039650	HGNC:9154													
PNPLA6	gene	PNPLA6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	retinal dystrophy-ataxia-pituitary hormone abnormality-hypogonadism syndrome MONDO:0100155			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25299038		False	3	100;0;0	2.156	True		ENSG00000032444	ENSG00000032444	HGNC:16268													
PNPLA8	gene	PNPLA8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 39082157		False	3	100;0;0	2.156	True		ENSG00000135241	ENSG00000135241	HGNC:28900													
PNPT1	gene	PNPT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 13, MIM#614932			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000138035	ENSG00000138035	HGNC:23166													
POC1A	gene	POC1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short stature-onychodysplasia-facial dysmorphism-hypotrichosis syndrome, MONDO:0013894			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22840364;22840363;26374189;26162852;26791357;39662966		False	3	50;0;50	2.156	True		ENSG00000164087	ENSG00000164087	HGNC:24488													
POGZ	gene	POGZ	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	White-Sutton syndrome, MIM# 616364;MONDO:0014606			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33098347;31782611;26942287		False	3	100;0;0	2.156	True		ENSG00000143442	ENSG00000143442	HGNC:18801													
POLA1	gene	POLA1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Van Esch-O'Driscoll syndrome OMIM# 301030			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31006512		False	3	100;0;0	2.156	True		ENSG00000101868	ENSG00000101868	HGNC:9173													
POLG	gene	POLG	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450;Progressive external ophthalmoplegia, autosomal dominant 1, MIM# 157640			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301791		False	3	100;0;0	2.156	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLR1A	gene	POLR1A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Acrofacial dysostosis, Cincinnati type MIM#616462;Leukodystrophy, hypomyelinating, 27, MIM# 620675			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37075751		False	3	50;50;0	2.156	True		ENSG00000068654	ENSG00000068654	HGNC:17264													
POLR1C	gene	POLR1C	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 11, MIM#	616494"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26151409		False	3	100;0;0	2.156	True		ENSG00000171453	ENSG00000171453	HGNC:20194													
POLR2A	gene	POLR2A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Neurodevelopmental disorder with hypotonia and variable intellectual and behavioral abnormalities, MIM#	618603"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31353023		False	3	100;0;0	2.156	True	Other	ENSG00000181222	ENSG00000181222	HGNC:9187													
POLR3A	gene	POLR3A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3B	gene	POLR3B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	POLR3B-related disorder MONDO:0700277;Charcot-Marie-Tooth disease, demyelinating, type 1I MIM#619742;Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism MIM#614381			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33417887		False	3	100;0;0	2.156	True		ENSG00000013503	ENSG00000013503	HGNC:30348													
POLR3K	gene	POLR3K	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3-related leukodystrophy MONDO:0700282			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://doi.org/10.1155/2024/8807171;30584594		False	3	100;0;0	2.156	True		ENSG00000161980	ENSG00000161980	HGNC:14121													
POLRMT	gene	POLRMT	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 55, MIM# 619743;intellectual disability;hypotonia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33602924		False	3	100;0;0	2.156	True		ENSG00000099821	ENSG00000099821	HGNC:9200													
POMGNT1	gene	POMGNT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	myopathy caused by variation in POMGNT1 MONDO:0700068			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000085998	ENSG00000085998	HGNC:19139													
POMGNT2	gene	POMGNT2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	myopathy caused by variation in POMGNT2 MONDO:0700069			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000144647	ENSG00000144647	HGNC:25902													
POMK	gene	POMK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12, MIM#615249			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000185900	ENSG00000185900	HGNC:26267													
POMT1	gene	POMT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	myopathy caused by variation in POMT1 MONDO:0700070			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000130714	ENSG00000130714	HGNC:9202													
POMT2	gene	POMT2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	myopathy caused by variation in POMT2 MONDO:0700071			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000009830	ENSG00000009830	HGNC:19743													
PORCN	gene	PORCN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	focal dermal hypoplasia MONDO:0010592			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301712		False	3	100;0;0	2.156	True		ENSG00000102312	ENSG00000102312	HGNC:17652													
POU3F2	gene	POU3F2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism spectrum disorder, NDD, and adolescent-onset obesity;neurodevelopmental disorder MONDO:0700092, POU3F2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37207645		False	3	100;0;0	2.156	True	Other	ENSG00000184486	ENSG00000184486	HGNC:9215													
POU3F3	gene	POU3F3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Snijders Blok-Fisher syndrome MIM#618604			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 24550763;31303265		False	3	100;0;0	2.156	True		ENSG00000198914	ENSG00000198914	HGNC:9216													
PPFIA2	gene	PPFIA2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, PPFIA2 related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41044885		False	3	100;0;0	2.156	True		ENSG00000139220	ENSG00000139220	HGNC:9246													
PPFIA3	gene	PPFIA3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paul-Chao neurodevelopmental syndrome, MIM# 621122			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38723631		False	3	100;0;0	2.156	True		ENSG00000177380	ENSG00000177380	HGNC:9247													
PPFIBP1	gene	PPFIBP1	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures, microcephaly, and brain abnormalities, MIM# 620024			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35830857		False	3	100;0;0	2.156	True		ENSG00000110841	ENSG00000110841	HGNC:9249													
PPIL1	gene	PPIL1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 14, MIM# 619301;microcephaly;seizures			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33220177		False	3	100;0;0	2.156	True		ENSG00000137168	ENSG00000137168	HGNC:9260													
PPM1D	gene	PPM1D	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Jansen de Vries syndrome (MIM #617450)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28343630;31916397;30795918;29758292		False	3	100;0;0	2.156	True		ENSG00000170836	ENSG00000170836	HGNC:9277													
PPP1CB	gene	PPP1CB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Noonan syndrome-like disorder with loose anlagen hair 2, OMIM # 617506			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32476286;28211982;27264673;27681385;27868344		False	3	100;0;0	2.156	True		ENSG00000213639	ENSG00000213639	HGNC:9282													
PPP1R12A	gene	PPP1R12A	Expert Review Green;Research	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Genitourinary and/or/brain malformation syndrome MIM#618820			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31883643		False	3	100;0;0	2.156	True		ENSG00000058272	ENSG00000058272	HGNC:7618													
PPP1R15B	gene	PPP1R15B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, short stature, and impaired glucose metabolism 2, MIM# 616817			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38159565;26159176;26307080;27640355;40568171		False	3	50;50;0	2.156	True		ENSG00000158615	ENSG00000158615	HGNC:14951													
PPP1R21	gene	PPP1R21	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia;intellectual disability;white matter abnormalities			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30520571		False	3	100;0;0	2.156	True		ENSG00000162869	ENSG00000162869	HGNC:30595													
PPP2CA	gene	PPP2CA	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder and language delay with or without structural brain abnormalities;OMIM #618354			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30595372		False	3	100;0;0	2.156	True		ENSG00000113575	ENSG00000113575	HGNC:9299													
PPP2R1A	gene	PPP2R1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 36, MIM#616362;Microcephaly-corpus callosum hypoplasia-intellectual disability-facial dysmorphism syndrome, MONDO:0014605			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26168268;33106617		False	3	100;0;0	2.156	True		ENSG00000105568	ENSG00000105568	HGNC:9302													
PPP2R5C	gene	PPP2R5C	Expert Review Green;Research	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Houge-Janssens syndrome 4, MIM# 621185			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25972378		False	3	67;33;0	2.156	True		ENSG00000078304	ENSG00000078304	HGNC:9311													
PPP2R5D	gene	PPP2R5D	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Houge-Janssens syndrome 1, MIM#616355			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32074998;26168268		False	3	100;0;0	2.156	True	Other	ENSG00000112640	ENSG00000112640	HGNC:9312													
PPP3CA	gene	PPP3CA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development MIM#618265;Developmental and epileptic encephalopathy 91 MIM617711			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29432562;32593294		False	3	100;0;0	2.156	True		ENSG00000138814	ENSG00000138814	HGNC:9314													
PPT1	gene	PPT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 1 MIM#256730			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7637805;9425237;9664077		False	3	100;0;0	2.156	True		ENSG00000131238	ENSG00000131238	HGNC:9325													
PQBP1	gene	PQBP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Renpenning syndrome, MIM#309500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31840929;14634649;20410308		False	3	100;0;0	2.156	True		ENSG00000102103	ENSG00000102103	HGNC:9330													
PRDM13	gene	PRDM13	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 17, MIM# 619909;Cerebellar dysfunction, impaired intellectual development, and hypogonadotropic hypogonadism, MIM# 619761			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34730112;35390279		False	3	67;33;0	2.156	True		ENSG00000112238	ENSG00000112238	HGNC:13998													
PRKACB	gene	PRKACB	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cardioacrofacial dysplasia 2, MONDO:0030877			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33058759;39095811		False	3	67;33;0	2.156	True		ENSG00000142875	ENSG00000142875	HGNC:9381													
PRKAR1A	gene	PRKAR1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Acrodysostosis 1, with or without hormone resistance, MIM#101800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000108946	ENSG00000108946	HGNC:9388													
PRKAR1B	gene	PRKAR1B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Marbach-Schaaf neurodevelopmental syndrome MIM#619680;Global developmental delay;Intellectual disability;Autism;Attention deficit hyperactivity disorder;Aggressive behavior;Abnormality of movement;Upslanted palpebral fissure			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25414040;33057194;33833410		False	3	50;50;0	2.156	True		ENSG00000188191	ENSG00000188191	HGNC:9390													
PRMT1	gene	PRMT1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, PRMT1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39937650		False	3	100;0;0	2.156	True		ENSG00000126457	ENSG00000126457	HGNC:5187													
PRMT7	gene	PRMT7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short stature, brachydactyly, intellectual developmental disability, and seizures, MIM# 617157			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26437029;27718516;30513135		False	3	100;0;0	2.156	True		ENSG00000132600	ENSG00000132600	HGNC:25557													
PRMT9	gene	PRMT9	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, PRMT9-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38561334;41260215		False	3	50;0;50	2.156	True		ENSG00000164169	ENSG00000164169	HGNC:25099													
PRPF19	gene	PRPF19	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), PRPF19-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37962958		False	3	100;0;0	2.156	True		ENSG00000110107	ENSG00000110107	HGNC:17896													
PRPF8	gene	PRPF8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, PRPF8-related;Retinitis pigmentosa 13 - MIM#600059			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35543142		False	3	100;0;0	2.156	True		ENSG00000174231	ENSG00000174231	HGNC:17340													
PRPS1	gene	PRPS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	PRPS1 deficiency disorder MONDO:0100061			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24961627		False	3	100;0;0	2.156	True		ENSG00000147224	ENSG00000147224	HGNC:9462													
PRR12	gene	PRR12	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuroocular syndrome, MIM#619539;Intellectual disability;Iris abnormalities;Complex microphthalmia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29556724;33824499		False	3	100;0;0	2.156	True		ENSG00000126464	ENSG00000126464	HGNC:29217													
PRUNE1	gene	PRUNE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies , MIM#617481			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26539891;28334956;33105479		False	3	100;0;0	2.156	True		ENSG00000143363	ENSG00000143363	HGNC:13420													
PSAP	gene	PSAP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy due to SAP-b deficiency, MIM#249900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000197746	ENSG00000197746	HGNC:9498													
PSMC3	gene	PSMC3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Ebstein-Bezieau neurodevelopmental syndrome, MIM# 621539;Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32500975;37256937		False	3	50;50;0	2.156	True		ENSG00000165916	ENSG00000165916	HGNC:9549													
PSMC5	gene	PSMC5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Yu-Kury neurodevelopmental syndrome, MIM# 621565			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194		False	3	100;0;0	2.156	True		ENSG00000087191	ENSG00000087191	HGNC:9552													
PSMD11	gene	PSMD11	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, PSMD11-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38866022;30733659		False	3	100;0;0	2.156	True		ENSG00000108671	ENSG00000108671	HGNC:9556													
PSMD12	gene	PSMD12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Stankiewicz-Isidor syndrome, MIM# 617516			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28132691;34906456		False	3	100;0;0	2.156	True		ENSG00000197170	ENSG00000197170	HGNC:9557													
PSMF1	gene	PSMF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, with movement disorders, cognitive decline, and brain abnormalities, MIM# 621694			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41986367		False	3	100;0;0	2.156	True		ENSG00000125818	ENSG00000125818	HGNC:9571													
PSPH	gene	PSPH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phosphoserine phosphatase deficiency MIM#614023			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37347880		False	3	100;0;0	2.156	True		ENSG00000146733	ENSG00000146733	HGNC:9577													
PTBP1	gene	PTBP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	STAD syndrome, MIM# 621495			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40965981		False	3	100;0;0	2.156	True		ENSG00000011304	ENSG00000011304	HGNC:9583													
PTCD3	gene	PTCD3	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-51, MIM#619057;Intellectual disability;optic atrophy;Leigh-like syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30607703;19427859;36450274		False	3	100;0;0	2.156	True		ENSG00000132300	ENSG00000132300	HGNC:24717													
PTCH1	gene	PTCH1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Holoprosencephaly 7, MIM# 610828			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000185920	ENSG00000185920	HGNC:9585													
PTCHD1	gene	PTCHD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	non-syndromic X-linked intellectual disability MONDO:0019181			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000165186	ENSG00000165186	HGNC:26392													
PTDSS1	gene	PTDSS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lenz-Majewski hyperostotic dwarfism MIM#151050			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24241535;29341480;31403251		False	3	100;0;0	2.156	True		ENSG00000156471	ENSG00000156471	HGNC:9587													
PTEN	gene	PTEN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cowden syndrome 1 MIM#158350;Macrocephaly/autism syndrome MIM#605309;PTEN hamartoma tumor syndrome MONDO:0017623			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000171862	ENSG00000171862	HGNC:9588													
PTF1A	gene	PTF1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pancreatic and cerebellar agenesis, MIM# 609069			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21749365;10507728;15543146;19650412		False	3	100;0;0	2.156	True		ENSG00000168267	ENSG00000168267	HGNC:23734													
PTPMT1	gene	PTPMT1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39279645;37672386		False	3	100;0;0	2.156	True		ENSG00000110536	ENSG00000110536	HGNC:26965													
PTPN1	gene	PTPN1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Type 1 interferonopathy of childhood, MONDO:0957408, PTPN1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39986310		False	3	100;0;0	2.156	True		ENSG00000196396	ENSG00000196396	HGNC:9642													
PTPN11	gene	PTPN11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Noonan syndrome 1, MIM#163950 AD;LEOPARD syndrome 1, 151100 AD (for reporting use Noonan syndrome with multiple lentigines)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11992261;21533187;24935154		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000179295	ENSG00000179295	HGNC:9644													
PTPN23	gene	PTPN23	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;brain abnormalities;seizures;optic atrophy;microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31395947		False	3	100;0;0	2.156	True		ENSG00000076201	ENSG00000076201	HGNC:14406													
PTPN4	gene	PTPN4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, PTPN4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17953619;25424712;30238967;34527963		False	3	100;0;0	2.156	True		ENSG00000088179	ENSG00000088179	HGNC:9656													
PTRH2	gene	PTRH2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Infantile-onset multisystem neurologic, endocrine, and pancreatic disease, MIM#	616263"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25574476;28175314;28328138;25558065;27129381;33092935;37239392		False	3	50;50;0	2.156	True		ENSG00000141378	ENSG00000141378	HGNC:24265													
PTRHD1	gene	PTRHD1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30398675;27134041;27753167;29143421		False	3	100;0;0	2.156	True		ENSG00000184924	ENSG00000184924	HGNC:33782													
PTS	gene	PTS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninaemia, BH4-deficient, A, MIM# 261640			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000150787	ENSG00000150787	HGNC:9689													
PUF60	gene	PUF60	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Verheij syndrome, MIM# 615583			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28327570		False	3	100;0;0	2.156	True		ENSG00000179950	ENSG00000179950	HGNC:17042													
PUM1	gene	PUM1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29474920;25768905;30903679;31859446		False	3	100;0;0	2.156	True		ENSG00000134644	ENSG00000134644	HGNC:14957													
PURA	gene	PURA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25439098;25342064;12972605		False	3	100;0;0	2.156	True		ENSG00000185129	ENSG00000185129	HGNC:9701													
PUS1	gene	PUS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25227147;17056637;15108122;32287105;31641589;28832011		False	3	100;0;0	2.156	True		ENSG00000177192	ENSG00000177192	HGNC:15508													
PUS3	gene	PUS3	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly and gray sclerae, MIM# 617051			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30308082;28454995;27055666;30697592;31444731		False	3	100;0;0	2.156	True		ENSG00000110060	ENSG00000110060	HGNC:25461													
PUS7	gene	PUS7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with abnormal behavior, microcephaly, and short stature;OMIM #618342			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30526862;30778726;31583274		False	3	100;0;0	2.156	True		ENSG00000091127	ENSG00000091127	HGNC:26033													
PYCR1	gene	PYCR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cutis laxa, autosomal recessive, type IIB, MIM# 612940;Cutis laxa, autosomal recessive, type IIIB, MIM# 614438			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19648921;4076251;22052856;19576563;19648921;9648921;22052856;28294978;27756598		False	3	100;0;0	2.156	True		ENSG00000183010	ENSG00000183010	HGNC:9721													
PYCR2	gene	PYCR2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 10, MIM# 616420			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25865492;27130255		False	3	100;0;0	2.156	True		ENSG00000143811	ENSG00000143811	HGNC:30262													
QARS1	gene	QARS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, progressive, seizures, and cerebral and cerebellar atrophy, MIM# 615760			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28620870;25471517;25432320;25041233;24656866;32042906		False	3	100;0;0	2.156	True		ENSG00000172053	ENSG00000172053	HGNC:9751													
QDPR	gene	QDPR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11153907		False	3	100;0;0	2.156	True		ENSG00000151552	ENSG00000151552	HGNC:9752													
QRICH1	gene	QRICH1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ververi-Brady syndrome, MIM#617982			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28692176;30281152;33009816		False	3	100;0;0	2.156	True		ENSG00000198218	ENSG00000198218	HGNC:24713													
RAB11A	gene	RAB11A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, RAB11A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29100083;33875846		False	3	100;0;0	2.156	True		ENSG00000103769	ENSG00000103769	HGNC:9760													
RAB11B	gene	RAB11B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29106825		False	3	100;0;0	2.156	True		ENSG00000185236	ENSG00000185236	HGNC:9761													
RAB18	gene	RAB18	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Warburg micro syndrome 3, MIM# 614222			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11237903;23420520		False	3	100;0;0	2.156	True		ENSG00000099246	ENSG00000099246	HGNC:14244													
RAB1A	gene	RAB1A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, RAB1A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37924809;38091987		False	3	50;50;0	2.156	True		ENSG00000138069	ENSG00000138069	HGNC:9758													
RAB23	gene	RAB23	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carpenter syndrome (MIM#201000)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17503333;21412941;23599695;25168863		False	3	100;0;0	2.156	True		ENSG00000112210	ENSG00000112210	HGNC:14263													
RAB39B	gene	RAB39B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 72, OMIM:300271;Waisman syndrome, OMIM:311510			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20159109;25434005;11050621;29152164;32873259;34761259		False	3	100;0;0	2.156	True		ENSG00000155961	ENSG00000155961	HGNC:16499													
RAB3A	gene	RAB3A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40166812		False	3	100;0;0	2.156	True		ENSG00000105649	ENSG00000105649	HGNC:9777													
RAB3GAP1	gene	RAB3GAP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Warburg micro syndrome 1, MIM# 600118;Martsolf syndrome 2, MIM# 619420			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15696165;20512159;23420520;23420520;30730599		False	3	100;0;0	2.156	True		ENSG00000115839	ENSG00000115839	HGNC:17063													
RAB3GAP2	gene	RAB3GAP2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Martsolf syndrome (MIM212720);Warburg micro syndrome 2 (MIM#614225)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23420520;32376645		False	3	100;0;0	2.156	True		ENSG00000118873	ENSG00000118873	HGNC:17168													
RAB5C	gene	RAB5C	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, RAB5C-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37552066		False	3	100;0;0	2.156	True		ENSG00000108774	ENSG00000108774	HGNC:9785													
RABGAP1	gene	RABGAP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, RABGAP1-related,MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36083289		False	3	100;0;0	2.156	True		ENSG00000011454	ENSG00000011454	HGNC:17155													
RAC1	gene	RAC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 48 MIM#617751			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30042656;29276006;30293988		False	3	100;0;0	2.156	True	Other	ENSG00000136238	ENSG00000136238	HGNC:9801													
RAC3	gene	RAC3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with structural brain anomalies and dysmorphic facies, MIM#618577			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30293988;29276006		False	3	0;0;0	2.156	True		ENSG00000169750	ENSG00000169750	HGNC:9803													
RAD21	gene	RAD21	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cornelia de Lange syndrome 4, MIM # 614701			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22633399;32193685;27882533;30716475;30125677;24378232		False	3	100;0;0	2.156	True		ENSG00000164754	ENSG00000164754	HGNC:9811													
RAF1	gene	RAF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Noonan syndrome 5, MIM# 611553			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17603483;17603482;31145547;31030682;29271604		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000132155	ENSG00000132155	HGNC:9829													
RAI1	gene	RAI1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Smith-Magenis syndrome (MIM#182290)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11404004;12652298;15788730		False	3	100;0;0	2.156	True		ENSG00000108557	ENSG00000108557	HGNC:9834													
RALA	gene	RALA	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hiatt-Neu-Cooper neurodevelopmental syndrome, MIM# 619311;Intellectual disability;short stature;dysmorphism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30500825		False	3	100;0;0	2.156	True		ENSG00000006451	ENSG00000006451	HGNC:9839													
RALGAPA1	gene	RALGAPA1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, neonatal respiratory insufficiency, and thermodysregulation MIM#618797			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32004447		False	3	100;0;0	2.156	True		ENSG00000174373	ENSG00000174373	HGNC:17770													
RAP1B	gene	RAP1B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Thrombocytopenia 1 with multiple congenital anomalies and dysmorphic facies, MIM# 620654			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32627184;26280580		False	3	50;0;50	2.156	True		ENSG00000127314	ENSG00000127314	HGNC:9857													
RAP1GDS1	gene	RAP1GDS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alfadhel syndrome, MIM# 620655			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32431071;33875846		False	3	100;0;0	2.156	True		ENSG00000138698	ENSG00000138698	HGNC:9859													
RAPGEF2	gene	RAPGEF2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092;amyotrophic lateral sclerosis MONDO:0004976			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41556274;30636905		False	3	100;0;0	2.156	False		ENSG00000109756	ENSG00000109756	HGNC:16854													
RARB	gene	RARB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Microphthalmia, syndromic 12, MIM# 615524			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30880327;30281527;24075189;27120018;25457163;17506106		False	3	100;0;0	2.156	True		ENSG00000077092	ENSG00000077092	HGNC:9865													
RARS1	gene	RARS1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 9 MIM# 616140			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31814314		False	3	100;0;0	2.156	True		ENSG00000113643	ENSG00000113643	HGNC:9870													
RARS2	gene	RARS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 6, MIM# 611523			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17847012;20635367;25809939		False	3	100;0;0	2.156	True		ENSG00000146282	ENSG00000146282	HGNC:21406													
RBBP5	gene	RBBP5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, RBBP5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39036895		False	3	100;0;0	2.156	True		ENSG00000117222	ENSG00000117222	HGNC:9888													
RBBP8	gene	RBBP8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Jawad syndrome, MIM#251255;Seckel syndrome 2, MIM#606744			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30561437;34270086;32379725		False	3	100;0;0	2.156	True		ENSG00000101773	ENSG00000101773	HGNC:9891													
RBFOX1	gene	RBFOX1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), RBFOX1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24664471;37962958		False	3	50;0;50	2.156	True		ENSG00000078328	ENSG00000078328	HGNC:18222													
RBL2	gene	RBL2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;Brunet-Wagner neurodevelopmental syndrome MIM#619690			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32105419;9806916		False	3	50;0;50	2.156	True		ENSG00000103479	ENSG00000103479	HGNC:9894													
RBM10	gene	RBM10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	TARP syndrome, 311900 (3), X-linked recessive			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24259342;24000153;30462380		False	3	100;0;0	2.156	True		ENSG00000182872	ENSG00000182872	HGNC:9896													
RBMX	gene	RBMX	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, syndromic 11, Shashi type, MIM#300238;Gustavson syndrome, MIM# 309555			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25256757;34260915;37277488		False	3	50;50;0	2.156	True		ENSG00000147274	ENSG00000147274	HGNC:9910													
RBSN	gene	RBSN	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kariminejad-Reversade neurodevelopmental syndrome, MIM# 620937			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25233840;29784638;35652444		False	3	100;0;0	2.156	True		ENSG00000131381	ENSG00000131381	HGNC:20759													
RDH11	gene	RDH11	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Retinal dystrophy, juvenile cataracts, and short stature syndrome, MIM# 616108			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24916380;15634683;30731079;18326732		False	3	100;0;0	2.156	False		ENSG00000072042	ENSG00000072042	HGNC:17964													
RELN	gene	RELN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Lissencephaly 2 (Norman-Roberts type), MIM# 257320			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35769015;29671837		False	3	100;0;0	2.156	True		ENSG00000189056	ENSG00000189056	HGNC:9957													
RERE	gene	RERE	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart, MIM# 616975			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27087320;23451234;30896913;30061196		False	3	100;0;0	2.156	True		ENSG00000142599	ENSG00000142599	HGNC:9965													
RFC4	gene	RFC4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, RFC4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 39106866		False	3	100;0;0	2.156	True		ENSG00000163918	ENSG00000163918	HGNC:9972													
RFT1	gene	RFT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type In, MIM# 612015;RFT1-CDG, MONDO:0012783			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18313027;19701946;19856127;23111317;30071302;29923091;27927990;26892341		False	3	100;0;0	2.156	True		ENSG00000163933	ENSG00000163933	HGNC:30220													
RFX3	gene	RFX3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	RFX3-related neurodevelopmental disorder MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33658631		False	3	100;0;0	2.156	True		ENSG00000080298	ENSG00000080298	HGNC:9984													
RFX4	gene	RFX4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	RFX4-related neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33658631		False	3	100;0;0	2.156	True		ENSG00000111783	ENSG00000111783	HGNC:9985													
RFX7	gene	RFX7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 71, with behavioral abnormalities, MIM# 620330			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33658631		False	3	100;0;0	2.156	True		ENSG00000181827	ENSG00000181827	HGNC:25777													
RHEB	gene	RHEB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Other	Neurodevelopmental disorder MONDO:0700092, RHEB-related;Intellectual disability;Macrocephaly;Focal cortical dysplasia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31337748;29051493		False	3	100;0;0	2.156	True		ENSG00000106615	ENSG00000106615	HGNC:10011													
RHOBTB2	gene	RHOBTB2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 64, MIM#618004			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29768694;29276004;37165955		False	3	100;0;0	2.156	True		ENSG00000008853	ENSG00000008853	HGNC:18756													
RICTOR	gene	RICTOR	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, RICTOR-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39738822		False	3	100;0;0	2.156	True		ENSG00000164327	ENSG00000164327	HGNC:28611													
RING1	gene	RING1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder, MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29386386;41653922		False	3	50;0;50	2.156	True		ENSG00000204227	ENSG00000204227	HGNC:10018													
RIT1	gene	RIT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Noonan syndrome 8, MIM# 615355			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23791108;25124994;24939608;27101134		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000143622	ENSG00000143622	HGNC:10023													
RLIM	gene	RLIM	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Tonne-Kalscheuer syndrome, MIM# 300978			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29728705;25735484;25644381;33159883		False	3	100;0;0	2.156	True	Other	ENSG00000131263	ENSG00000131263	HGNC:13429													
RMND1	gene	RMND1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 11 MIM#614922			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26395190		False	3	100;0;0	2.156	True		ENSG00000155906	ENSG00000155906	HGNC:21176													
RNASEH2A	gene	RNASEH2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 4, MIM# 610333			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000104889	ENSG00000104889	HGNC:18518													
RNASEH2B	gene	RNASEH2B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 2, MIM# 610181			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2C	gene	RNASEH2C	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 3, MIM# 610329			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000172922	ENSG00000172922	HGNC:24116													
RNASET2	gene	RNASET2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31349848;19525954;27091087;29336640;18545798;15851732		False	3	100;0;0	2.156	True		ENSG00000026297	ENSG00000026297	HGNC:21686													
RNF113A	gene	RNF113A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	?Trichothiodystrophy 5, nonphotosensitive;OMIM #300953			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 25612912;31793730;31880405		False	3	50;50;0	2.156	True		ENSG00000125352	ENSG00000125352	HGNC:12974													
RNF125	gene	RNF125	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tenorio syndrome - MIM# 616260			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25196541		False	3	100;0;0	2.156	True		ENSG00000101695	ENSG00000101695	HGNC:21150													
RNF13	gene	RNF13	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 73	618379"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30595371		False	3	100;0;0	2.156	True	Other	ENSG00000082996	ENSG00000082996	HGNC:10057													
RNF2	gene	RNF2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lou-Schoch-Yamamoto syndrome , MIM#619460;epilepsy;intellectual disability;intrauterine growth retardation			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33864376		False	3	100;0;0	2.156	True		ENSG00000121481	ENSG00000121481	HGNC:10061													
RNF220	gene	RNF220	Expert Review Green;Literature;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33964137;10881263		False	3	100;0;0	2.156	True		ENSG00000187147	ENSG00000187147	HGNC:25552													
RNPC3	gene	RNPC3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Growth hormone deficiency;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29866761;32462814;33650182;37463572;35792517;34906446		False	3	50;50;0	2.156	True		ENSG00000185946	ENSG00000185946	HGNC:18666													
RNU2-2	gene	RNU2-2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 119, MIM# 621304			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40210679;40442284;40950445		False	3	100;0;0	2.156	True		ENSG00000222328	ENSG00000222328	HGNC:10152													
RNU4-2	gene	RNU4-2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38991538;40297424		False	3	100;0;0	2.156	True		ENSG00000202538	ENSG00000202538	HGNC:10193													
RNU4ATAC	gene	RNU4ATAC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephalic osteodysplastic primordial dwarfism, type I, MIM#210710;Roifman syndrome, MIM#616651			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000264229	ENSG00000264229	HGNC:34016													
RNU5B-1	gene	RNU5B-1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with seizures and joint laxity, MIM# 621302			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40442284		False	3	100;0;0	2.156	True		ENSG00000200156	ENSG00000200156	HGNC:10212													
RNU6ATAC	gene	RNU6ATAC	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mendez-Johnson immunoneurologic syndrome, MIM# 621585			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41808409;40975062;41864208		False	3	33;33;33	2.156	True		ENSG00000221676	ENSG00000221676	HGNC:34017													
RNU7-1	gene	RNU7-1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 9, MIM# 619487			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33230297		False	3	100;0;0	2.156	True		ENSG00000238923	ENSG00000238923	HGNC:34033													
ROBO1	gene	ROBO1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurooculorenal syndrome, MIM# 620305			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28286008;30692597;35227688;35348658		False	3	100;0;0	2.156	True		ENSG00000169855	ENSG00000169855	HGNC:10249													
ROGDI	gene	ROGDI	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kohlschutter-Tonz syndrome, MIM# 226750			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22424600;23086778;33866847		False	3	100;0;0	2.156	True		ENSG00000067836	ENSG00000067836	HGNC:29478													
ROR2	gene	ROR2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Robinow syndrome, autosomal recessive, MIM#268310			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33937263;32954672;32172608		False	3	50;0;50	2.156	True		ENSG00000169071	ENSG00000169071	HGNC:10257													
RORA	gene	RORA	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, MIM#618060			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29656859		False	3	100;0;0	2.156	True	Other	ENSG00000069667	ENSG00000069667	HGNC:10258													
RPGRIP1L	gene	RPGRIP1L	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 7, MIM# 611560;Meckel syndrome 5, MIM# 611561			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000103494	ENSG00000103494	HGNC:29168													
RPH3A	gene	RPH3A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092), RPH3A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37403762;29441694		False	3	100;0;0	2.156	True		ENSG00000089169	ENSG00000089169	HGNC:17056													
RPIA	gene	RPIA	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ribose 5-phosphate isomerase deficiency, MIM 608611			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	14988808;10589548;20499043;28801340;30088433		False	3	100;0;0	2.156	True		ENSG00000153574	ENSG00000153574	HGNC:10297													
RPL10	gene	RPL10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked, syndromic, 35 (MIM#300998)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25316788;26290468;25846674;29066376		False	3	100;0;0	2.156	True		ENSG00000147403	ENSG00000147403	HGNC:10298													
RPS4X	gene	RPS4X	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder, MONDO:0700092, RPS4X-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42031741		False	3	100;0;0	2.156	True		ENSG00000198034	ENSG00000198034	HGNC:10424													
RPS6KA3	gene	RPS6KA3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Coffin-Lowry syndrome MIM# 303600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000177189	ENSG00000177189	HGNC:10432													
RPS6KC1	gene	RPS6KC1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41130203		False	3	100;0;0	2.156	True		ENSG00000136643	ENSG00000136643	HGNC:10439													
RRAS2	gene	RRAS2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Noonan syndrome 12 MIM#618624			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31130282;31130285		False	3	50;50;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000133818	ENSG00000133818	HGNC:17271													
RREB1	gene	RREB1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Rasopathy, MONDO:0021060, RREB1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32938917;38332451;40418122		False	3	50;50;0	2.156	True		ENSG00000124782	ENSG00000124782	HGNC:10449													
RRM2B	gene	RRM2B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000048392	ENSG00000048392	HGNC:17296													
RSF1	gene	RSF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, RSF1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41606215		False	3	100;0;0	2.156	True		ENSG00000048649	ENSG00000048649	HGNC:18118													
RSPRY1	gene	RSPRY1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spondyloepimetaphyseal dysplasia, Faden-Alkuraya type, MIM# 616723			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26365341;30063090;38562122;39940902		False	3	100;0;0	2.156	True		ENSG00000159579	ENSG00000159579	HGNC:29420													
RSRC1	gene	RSRC1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder, autosomal recessive 70, MIM#	618402"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28640246;29522154		False	3	100;0;0	2.156	True		ENSG00000174891	ENSG00000174891	HGNC:24152													
RTEL1	gene	RTEL1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dyskeratosis congenita, autosomal recessive 5, MIM#615190			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000258366	ENSG00000258366	HGNC:15888													
RTF1	gene	RTF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, RTF1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40770811;33057194;35982160;31038196		False	3	100;0;0	2.156	True		ENSG00000137815	ENSG00000137815	HGNC:28996													
RTN4IP1	gene	RTN4IP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Optic atrophy 10 with or without ataxia, mental retardation, and seizures, MIM#616732			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26593267		False	3	100;0;0	2.156	True		ENSG00000130347	ENSG00000130347	HGNC:18647													
RTTN	gene	RTTN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, short stature, and polymicrogyria with seizures, MIM# 614833;Microcephalic primordial dwarfism due to RTTN deficiency MONDO:0018764			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22939636;26608784;26940245;30121372;29967526;30927481;30121372		False	3	100;0;0	2.156	True		ENSG00000176225	ENSG00000176225	HGNC:18654													
RUNX1T1	gene	RUNX1T1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, RUNX1T1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39568205;19172993;22644616;31223340		False	3	100;0;0	2.156	True		ENSG00000079102	ENSG00000079102	HGNC:1535													
RXYLT1	gene	RXYLT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23217329;23519211		False	3	100;0;0	2.156	True		ENSG00000118600	ENSG00000118600	HGNC:13530													
RYBP	gene	RYBP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, RYBP-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39891528		False	3	100;0;0	2.156	True		ENSG00000163602	ENSG00000163602	HGNC:10480													
SAMD9	gene	SAMD9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	MIRAGE Syndrome, MIM#617053			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27182967;34659124;32194975;29175836;37195360;30900330;37745698		False	3	50;0;50	2.156	True		ENSG00000205413	ENSG00000205413	HGNC:1348													
SAMHD1	gene	SAMHD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 5, MIM# 612952			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301648;29239743;25246298;19525956;21102625;33307271;35418820		False	3	100;0;0	2.156	True		ENSG00000101347	ENSG00000101347	HGNC:15925													
SARS1	gene	SARS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO#070009, SARS1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28236339;34570399;35790048		False	3	33;33;33	2.156	True		ENSG00000031698	ENSG00000031698	HGNC:10537													
SARS2	gene	SARS2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis, MIM#613845			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21255763;24034276		False	3	100;0;0	2.156	True		ENSG00000104835	ENSG00000104835	HGNC:17697													
SART3	gene	SART3	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO#0700092), SART3-related, with 46,XY gonadal dysgenesis			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37296101		False	3	100;0;0	2.156	True		ENSG00000075856	ENSG00000075856	HGNC:16860													
SASS6	gene	SASS6	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 14, primary, autosomal recessive, MIM# 616402			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24951542;30639237		False	3	100;0;0	2.156	True		ENSG00000156876	ENSG00000156876	HGNC:25403													
SATB1	gene	SATB1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Kohlschutter-Tonz syndrome-like, MIM# 619229;Developmental delay with dysmorphic facies and dental anomalies, MIM# 619228;Neurodevelopmental disorder;intellectual disability;epilepsy;microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194;33513338		False	3	100;0;0	2.156	True		ENSG00000182568	ENSG00000182568	HGNC:10541													
SATB2	gene	SATB2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Glass syndrome, MIM# 612313;MONDO:0100147			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29023086;28151491;32446642		False	3	100;0;0	2.156	True		ENSG00000119042	ENSG00000119042	HGNC:21637													
SBF1	gene	SBF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4B3, MIM# 615284;MONDO:0014117			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24799518;23749797;30039846;28902413		False	3	100;0;0	2.156	True		ENSG00000100241	ENSG00000100241	HGNC:10542													
SC5D	gene	SC5D	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lathosterolosis, MIM#607330			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17853487;12189593;12812989;24142275		False	3	100;0;0	2.156	True		ENSG00000109929	ENSG00000109929	HGNC:10547													
SCAF4	gene	SCAF4	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Fliedner-Zweier syndrome, MIM#620511			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32730804		False	3	100;0;0	2.156	True		ENSG00000156304	ENSG00000156304	HGNC:19304													
SCAMP5	gene	SCAMP5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SCAMP5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31439720;33390987		False	3	50;50;0	2.156	True	Other	ENSG00000198794	ENSG00000198794	HGNC:30386													
SCAPER	gene	SCAPER	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder and retinitis pigmentosa;OMIM #618195			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 28794130;31069901;31192531;30723319		False	3	100;0;0	2.156	True		ENSG00000140386	ENSG00000140386	HGNC:13081													
SCN1A	gene	SCN1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Epileptic encephalopathy, early infantile, 6 (Dravet syndrome) 607208 Developmental and epileptic encephalopathy 6B, non-Dravet, MIM# 619317			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN1B	gene	SCN1B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 52, MIM#617350			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000105711	ENSG00000105711	HGNC:10586													
SCN2A	gene	SCN2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Developmental and epileptic encephalopathy 11, MIM#	613721"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31230762;31904126;28256214;31904120;31924505;31205438;1325650;17021166		False	3	100;0;0	2.156	True		ENSG00000136531	ENSG00000136531	HGNC:10588													
SCN3A	gene	SCN3A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial focal, with variable foci 4, MIM# 617935;Epileptic encephalopathy, early infantile, 62, MIM# 617938;Intellectual disability;Malformations of cortical development			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32515017		False	3	100;0;0	2.156	True	Other	ENSG00000153253	ENSG00000153253	HGNC:10590													
SCN8A	gene	SCN8A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Developmental and epileptic encephalopathy 13, MIM#	614558"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34353676;38233770;30171078		False	3	100;0;0	2.156	True		ENSG00000196876	ENSG00000196876	HGNC:10596													
SCO2	gene	SCO2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10545952;10749987;18924171		False	3	100;0;0	2.156	True		-	ENSG00000284194	HGNC:10604													
SCYL2	gene	SCYL2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Arthrogryposis multiplex congenita 4, neurogenic, with agenesis of the corpus callosum, MIM# 618766			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31960134;26203146;40243816;39169672		False	3	100;0;0	2.156	True		ENSG00000136021	ENSG00000136021	HGNC:19286													
SDCCAG8	gene	SDCCAG8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 16, MIM# 615993;MONDO:0014444;Senior-Loken syndrome 7, MIM# 613615;MONDO:0013326;Nephronophthisis			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20835237;22626039;22626039;32432520;31534065;26968886		False	3	100;0;0	2.156	True		ENSG00000054282	ENSG00000054282	HGNC:10671													
SDHA	gene	SDHA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex II deficiency, nuclear type 1 MIM#252011			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	1492653;23322652		False	3	100;0;0	2.156	True		ENSG00000073578	ENSG00000073578	HGNC:10680													
SDHAF1	gene	SDHAF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex II deficiency, nuclear type 2, MIM# 619166			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19465911;26749241;22995659		False	3	100;0;0	2.156	True		ENSG00000205138	ENSG00000205138	HGNC:33867													
SEC31A	gene	SEC31A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Halperin-Birk syndrome, MIM# 618651			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30464055;40508110;39725565		False	3	50;50;0	2.156	True		ENSG00000138674	ENSG00000138674	HGNC:17052													
SECISBP2	gene	SECISBP2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thyroid hormone metabolism, abnormal, 1, MIM# 609698			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16228000;19602558;21084748;22247018;39315526		False	3	50;0;50	2.156	True		ENSG00000187742	ENSG00000187742	HGNC:30972													
SEL1L	gene	SEL1L	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, poor growth, dysmorphic facies, and agammaglobulinaemia, MIM# 621068;Neurodevelopmental disorder with poor growth, absent speech, progressive ataxia, and dysmorphic facies, MIM# 621067			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37943610;PMID: 37943617		False	3	100;0;0	2.156	True		ENSG00000071537	ENSG00000071537	HGNC:10717													
SELENOI	gene	SELENOI	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 81, autosomal recessive, MIM# 618768			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28052917;39806532;29500230;33454747		False	3	100;0;0	2.156	True		ENSG00000138018	ENSG00000138018	HGNC:29361													
SEMA6A	gene	SEMA6A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092;SEMA6A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38062045,22132072		False	3	100;0;0	2.156	True		ENSG00000092421	ENSG00000092421	HGNC:10738													
SEMA6B	gene	SEMA6B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability, MONDO:0001071, SEMA6B related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35604360		False	3	100;0;0	2.156	True		ENSG00000167680	ENSG00000167680	HGNC:10739													
SEPHS1	gene	SEPHS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ververi-Brady syndrome 2, MIM# 621325			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38531365		False	3	100;0;0	2.156	True		ENSG00000086475	ENSG00000086475	HGNC:19685													
SEPSECS	gene	SEPSECS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2D, MIM#613811			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12920088;25044680		False	3	100;0;0	2.156	True		ENSG00000109618	ENSG00000109618	HGNC:30605													
SEPTIN2	gene	SEPTIN2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, SEPTIN2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41408595		False	3	100;0;0	2.156	True		ENSG00000168385	ENSG00000168385	HGNC:7729													
SERAC1	gene	SERAC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL), MIM#614739			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24741715;37711114;37090937;28916646;32684373		False	3	100;0;0	2.156	True		ENSG00000122335	ENSG00000122335	HGNC:21061													
SET	gene	SET	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 58, MIM#618106;intellectual disability, autosomal dominant 58, MONDO:0020847			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29688601;29907757;25356899		False	3	100;0;0	2.156	True		ENSG00000119335	ENSG00000119335	HGNC:10760													
SETBP1	gene	SETBP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Schinzel-Giedion syndrome MONDO:0010010;complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28346496;21037274		False	3	100;0;0	2.156	True		ENSG00000152217	ENSG00000152217	HGNC:15573													
SETD1A	gene	SETD1A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, early-onset, with or without developmental delay, MIM# 618832;Neurodevelopmental disorder with speech impairment and dysmorphic facies, MIM# 619056			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31197650;32346159		False	3	100;0;0	2.156	True		ENSG00000099381	ENSG00000099381	HGNC:29010													
SETD1B	gene	SETD1B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32546566;29322246;31440728;31685013		False	3	100;0;0	2.156	True		ENSG00000139718	ENSG00000139718	HGNC:29187													
SETD2	gene	SETD2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Luscan-Lumish syndrome, MIM#616831;Rabin-Pappas syndrome,MIM# 620155;Intellectual developmental disorder, autosomal dominant 70, MIM# 620157			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29681085;32710489		False	3	100;0;0	2.156	True		ENSG00000181555	ENSG00000181555	HGNC:18420													
SETD5	gene	SETD5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability, autosomal dominant 23 (MIM # 615761)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29484850		False	3	100;0;0	2.156	True		ENSG00000168137	ENSG00000168137	HGNC:25566													
SF1	gene	SF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SF1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40987292		False	3	100;0;0	2.156	True		ENSG00000168066	ENSG00000168066	HGNC:12950													
SF3B1	gene	SF3B1	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder MONDO:0100038, SF3B1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41577671		False	3	50;50;0	2.156	True		ENSG00000115524	ENSG00000115524	HGNC:10768													
SF3B3	gene	SF3B3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SF3B3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41709284		False	3	100;0;0	2.156	True		ENSG00000189091	ENSG00000189091	HGNC:10770													
SFXN4	gene	SFXN4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 18, MIM#615578			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31059822;24119684		False	3	100;0;0	2.156	True		ENSG00000183605	ENSG00000183605	HGNC:16088													
SGPL1	gene	SGPL1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sphingosine Phosphate Lyase Insufficiency Syndrome;RENI syndrome (MIM#617575)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33074640		False	3	100;0;0	2.156	True		ENSG00000166224	ENSG00000166224	HGNC:10817													
SGSH	gene	SGSH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIIA (Sanfilippo A), MIM# 252900;MONDO:0009655			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7493035;9158154;9401012;9554748		False	3	100;0;0	2.156	True		ENSG00000181523	ENSG00000181523	HGNC:10818													
SGSM3	gene	SGSM3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder, autosomal recessive 84, MIM#	620401"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37833060;39390489		False	3	100;0;0	2.156	True		ENSG00000100359	ENSG00000100359	HGNC:25228													
SHANK1	gene	SHANK1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SHANK1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22503632;25188300;34113010		False	3	67;0;33	2.156	True		ENSG00000161681	ENSG00000161681	HGNC:15474													
SHANK2	gene	SHANK2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism, susceptibility to, 17, MIM#613436;complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20473310;22346768;20531469;35456494;32987185;25188300;22699619;22699620		False	3	100;0;0	2.156	True		ENSG00000162105	ENSG00000162105	HGNC:14295													
SHANK3	gene	SHANK3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Phelan-McDermid syndrome, MIM# 606232;MONDO:0011652			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16284256;17173049;20186804;22892527		False	3	100;0;0	2.156	True		ENSG00000251322	ENSG00000251322	HGNC:14294													
SHH	gene	SHH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Holoprosencephaly 3 (MIM#142945)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22791840;19057928		False	3	100;0;0	2.156	True		ENSG00000164690	ENSG00000164690	HGNC:10848													
SHMT2	gene	SHMT2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121;Congenital microcephaly;Infantile axial hypotonia;Spastic paraparesis;Global developmental delay;Intellectual disability;Abnormality of the corpus callosum;Abnormal cortical gyration;Hypertrophic cardiomyopathy;Abnormality of the face;Proximal placement of thumb;2-3 toe syndactyly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33015733		False	3	100;0;0	2.156	True		ENSG00000182199	ENSG00000182199	HGNC:10852													
SHOC2	gene	SHOC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Noonan syndrome-like with loose anagen hair 1, MIM# 607721			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19684605;23918763;20882035		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000108061	ENSG00000108061	HGNC:15454													
SIAH1	gene	SIAH1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Buratti-Harel syndrome, MIM# 619314;Developmental delay;Infantile hypotonia;Dysmorphic features;Laryngomalacia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32430360		False	3	100;0;0	2.156	True		ENSG00000196470	ENSG00000196470	HGNC:10857													
SIK1	gene	SIK1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 30, MIM#616341;developmental and epileptic encephalopathy, MONDO#0100062			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25839329;27966542;35267137		False	3	100;0;0	2.156	True		ENSG00000142178	ENSG00000142178	HGNC:11142													
SIL1	gene	SIL1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Marinesco-Sjogren syndrome (MIM#248800)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24176978;16282977		False	3	100;0;0	2.156	True		ENSG00000120725	ENSG00000120725	HGNC:24624													
SIN3A	gene	SIN3A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Witteveen-Kolk syndrome, OMIM # 613406			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27399968		False	3	100;0;0	2.156	True		ENSG00000169375	ENSG00000169375	HGNC:19353													
SIN3B	gene	SIN3B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SIN3B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33811806		False	3	100;0;0	2.156	True		ENSG00000127511	ENSG00000127511	HGNC:19354													
SIX3	gene	SIX3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Holoprosencephaly 2, autosomal dominant, MIM#157170			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20531442;19346217;20157829;15635066		False	3	100;0;0	2.156	True		ENSG00000138083	ENSG00000138083	HGNC:10889													
SKI	gene	SKI	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Shprintzen-Goldberg syndrome, MIM# 182212;Neurodevelopmental disorder, MONDO:0700092, SKI-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23023332;23103230;24736733;30071989		False	3	100;0;0	2.156	True		ENSG00000157933	ENSG00000157933	HGNC:10896													
SKIC3	gene	SKIC3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	trichohepatoenteric syndrome 1 MONDO:0024541			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29334452		False	3	100;0;0	2.156	True		ENSG00000198677	ENSG00000198677	HGNC:23639													
SKOR2	gene	SKOR2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Valence-Farazi cerebellar ataxia syndrome, MIM# 621386			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40890458;29997391;21937600		False	3	100;0;0	2.156	True		ENSG00000215474	ENSG00000215474	HGNC:32695													
SLC12A2	gene	SLC12A2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Delpire-McNeill syndrome, MIM#	619083;Kilquist syndrome, MIM#619080;deafness;intellectual disability;dysmorphic features;absent salivation;ectodermal dysplasia;constipation;intestinal malrotation;multiple congenital anomalies"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28135719;32658972;27900370;32294086;29288388;30740830;32754646		False	3	67;33;0	2.156	True		ENSG00000064651	ENSG00000064651	HGNC:10911													
SLC12A5	gene	SLC12A5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 34, MIM# 616645			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26333769;27436767;31618474;12000122;38660387		False	3	100;0;0	2.156	True		ENSG00000124140	ENSG00000124140	HGNC:13818													
SLC12A6	gene	SLC12A6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Agenesis of the corpus callosum with peripheral neuropathy, MIM# 218000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31439721;27485015;16606917;21628467;12368912;17893295		False	3	100;0;0	2.156	True		ENSG00000140199	ENSG00000140199	HGNC:10914													
SLC12A9	gene	SLC12A9	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SLC12A9-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38334070		False	3	100;0;0	2.156	True		ENSG00000146828	ENSG00000146828	HGNC:17435													
SLC13A5	gene	SLC13A5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 25, with amelogenesis imperfecta MIM#615905;MONDO:0014392			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24995870;26384929		False	3	100;0;0	2.156	True		ENSG00000141485	ENSG00000141485	HGNC:23089													
SLC16A2	gene	SLC16A2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Allan-Herndon-Dudley syndrome, MIM# 300523			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15980113;31410843;20301789		False	3	100;0;0	2.156	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC17A5	gene	SLC17A5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sialic acid storage disorder, infantile, MIM# 269920			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10581036;10947946		False	3	100;0;0	2.156	True		ENSG00000119899	ENSG00000119899	HGNC:10933													
SLC18A2	gene	SLC18A2	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Parkinsonism-dystonia, infantile, 2, MIM#	618049"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23363473;31240161;26497564		False	3	100;0;0	2.156	True		ENSG00000165646	ENSG00000165646	HGNC:10935													
SLC19A3	gene	SLC19A3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15871139;34276785;23482991;20065143		False	3	100;0;0	2.156	True		ENSG00000135917	ENSG00000135917	HGNC:16266													
SLC1A2	gene	SLC1A2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 41, MIM#617105;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27476654;28777935		False	3	100;0;0	2.156	True		ENSG00000110436	ENSG00000110436	HGNC:10940													
SLC1A4	gene	SLC1A4	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM#	616657;MONDO:0014725"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29989513;27193218;26138499;26041762;25930971		False	3	100;0;0	2.156	True		ENSG00000115902	ENSG00000115902	HGNC:10942													
SLC25A1	gene	SLC25A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072;Myasthenic syndrome, congenital, 23, presynaptic, MIM#618197, MONDO:0032596			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31527857;26870663		False	3	100;0;0	2.156	True		ENSG00000100075	ENSG00000100075	HGNC:10979													
SLC25A12	gene	SLC25A12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 39, MIM# 612949			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19641205;24515575;35008954;32700846;31766059;31514314		False	3	100;0;0	2.156	True		ENSG00000115840	ENSG00000115840	HGNC:10982													
SLC25A15	gene	SLC25A15	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome, MIM#238970			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18978333;25874378		False	3	100;0;0	2.156	True		ENSG00000102743	ENSG00000102743	HGNC:10985													
SLC25A22	gene	SLC25A22	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 3, MIM# 609304			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15592994;19780765;24596948;33821742;33342683;31285529		False	3	100;0;0	2.156	True		ENSG00000177542	ENSG00000177542	HGNC:19954													
SLC2A1	gene	SLC2A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	GLUT1-deficiency syndrome, MONDO:0000188;Dystonia 9 601042;GLUT1 deficiency syndrome 1, infantile onset, severe 606777;GLUT1 deficiency syndrome 2, childhood onset 612126;Stomatin-deficient cryohydrocytosis with neurologic defects 608885			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32913944		False	3	100;0;0	2.156	True		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC30A9	gene	SLC30A9	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Birk-Landau-Perez syndrome	(MIM#617595)"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37041080		False	3	100;0;0	2.156	True		ENSG00000014824	ENSG00000014824	HGNC:1329													
SLC31A1	gene	SLC31A1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration and seizures due to copper transport defect, MIM# 620306			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35913762;36562171;41040850		False	3	33;0;67	2.156	True		ENSG00000136868	ENSG00000136868	HGNC:11016													
SLC32A1	gene	SLC32A1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Generalized epilepsy with febrile seizures plus, type 12, MIM# 620755;Developmental and epileptic encephalopathy 114, MIM# 620774			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36073542		False	3	100;0;0	2.156	True		ENSG00000101438	ENSG00000101438	HGNC:11018													
SLC33A1	gene	SLC33A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital cataracts, hearing loss, and neurodegeneration, MIM# 614482			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31194315		False	3	100;0;0	2.156	True		ENSG00000169359	ENSG00000169359	HGNC:95													
SLC35A2	gene	SLC35A2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854;Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23561849;24115232;27743886;25778940;33407896		False	3	100;0;0	2.156	True		ENSG00000102100	ENSG00000102100	HGNC:11022													
SLC35C1	gene	SLC35C1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIc, MIM# 266265, MONDO:0009953			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33836758;32313197;34389986		False	3	100;0;0	2.156	True		ENSG00000181830	ENSG00000181830	HGNC:20197													
SLC38A3	gene	SLC38A3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 102, MIM# 619881			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34605855		False	3	100;0;0	2.156	True		ENSG00000188338	ENSG00000188338	HGNC:18044													
SLC39A14	gene	SLC39A14	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermanganesemia with dystonia 2 (MIM# 617013)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27231142;29685658		False	3	100;0;0	2.156	True		ENSG00000104635	ENSG00000104635	HGNC:20858													
SLC39A8	gene	SLC39A8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIn , MIM#616721			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26637978;26637979		False	3	100;0;0	2.156	True		ENSG00000138821	ENSG00000138821	HGNC:20862													
SLC45A1	gene	SLC45A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with neuropsychiatric features, MIM# 617532			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28434495;39003656		False	3	100;0;0	2.156	True		ENSG00000162426	ENSG00000162426	HGNC:17939													
SLC46A1	gene	SLC46A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Folate malabsorption, hereditary, MIM# 229050			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17446347;17129779;21333572		False	3	100;0;0	2.156	True		ENSG00000076351	ENSG00000076351	HGNC:30521													
SLC4A10	gene	SLC4A10	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia and characteristic brain abnormalities, MIM# 620746			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37459438		False	3	100;0;0	2.156	True		ENSG00000144290	ENSG00000144290	HGNC:13811													
SLC4A4	gene	SLC4A4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Renal tubular acidosis, proximal, with ocular abnormalities MIM#604278			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29914390;11274232;15930088		False	3	100;0;0	2.156	True		ENSG00000080493	ENSG00000080493	HGNC:11030													
SLC5A6	gene	SLC5A6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Developmental delay;epilepsy;neurodegeneration;Neurodegeneration, infantile-onset, biotin-responsive, MIM#	618973"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31754459;27904971;31392107		False	3	100;0;0	2.156	True		ENSG00000138074	ENSG00000138074	HGNC:11041													
SLC6A1	gene	SLC6A1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myoclonic-atonic epilepsy, MIM#616421			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29315614;38781976		False	3	100;0;0	2.156	True		ENSG00000157103	ENSG00000157103	HGNC:11042													
SLC6A17	gene	SLC6A17	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 48, MIM# 616269			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25704603;23672601;40897375		False	3	50;50;0	2.156	True		ENSG00000197106	ENSG00000197106	HGNC:31399													
SLC6A19	gene	SLC6A19	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hartnup disorder, MIM# 234500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000174358	ENSG00000174358	HGNC:27960													
SLC6A3	gene	SLC6A3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia, infantile, 1, MIM# 613135			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21112253		False	3	100;0;0	2.156	True		ENSG00000142319	ENSG00000142319	HGNC:11049													
SLC6A8	gene	SLC6A8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Cerebral creatine deficiency syndrome 1, MIM# 300352			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27604308;16738945		False	3	100;0;0	2.156	True		ENSG00000130821	ENSG00000130821	HGNC:11055													
SLC6A9	gene	SLC6A9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycine encephalopathy with normal serum glycine 617301			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27481395;27773429		False	3	100;0;0	2.156	True		ENSG00000196517	ENSG00000196517	HGNC:11056													
SLC9A6	gene	SLC9A6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked syndromic, Christianson type, MIM# 300243;MONDO:0010278			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18342287;19377476;25044251;33278113;32569089;31879735		False	3	100;0;0	2.156	True		ENSG00000198689	ENSG00000198689	HGNC:11079													
SLF2	gene	SLF2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Atelis syndrome 1, MIM# 620184			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36333305		False	3	100;0;0	2.156	True		ENSG00000119906	ENSG00000119906	HGNC:17814													
SLITRK2	gene	SLITRK2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked 111, MIM# 301107			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35840571		False	3	100;0;0	2.156	True		ENSG00000185985	ENSG00000185985	HGNC:13449													
SLK	gene	SLK	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SLK-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40347834		False	3	100;0;0	2.156	True		ENSG00000065613	ENSG00000065613	HGNC:11088													
SMAD4	gene	SMAD4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myhre syndrome MIM#139210			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9843046;22243968;7296942;8261650		False	3	100;0;0	2.156	True		ENSG00000141646	ENSG00000141646	HGNC:6770													
SMAD6	gene	SMAD6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 32499606		False	3	100;0;0	2.156	True		ENSG00000137834	ENSG00000137834	HGNC:6772													
SMARCA1	gene	SMARCA1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder, MONDO:0700092, SMARCA1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37841849;41213919		False	3	100;0;0	2.156	True		ENSG00000102038	ENSG00000102038	HGNC:11097													
SMARCA2	gene	SMARCA2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Nicolaides-Baraitser syndrome, MIM #601358;Blepharophimosis-intellectual disability syndrome,  MIM#619293			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26468571;32694869		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000080503	ENSG00000080503	HGNC:11098													
SMARCA4	gene	SMARCA4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 4 (MIM# 614609)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22426308;23929686;23637025		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000127616	ENSG00000127616	HGNC:11100													
SMARCA5	gene	SMARCA5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, SMARCA5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33980485		False	3	100;0;0	2.156	True		ENSG00000153147	ENSG00000153147	HGNC:11101													
SMARCB1	gene	SMARCB1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 3 (MIM# 614608);MONDO:0015452			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22426308;29907796;3175698;23556151		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000099956	ENSG00000099956	HGNC:11103													
SMARCC1	gene	SMARCC1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	SMARCC1-associated developmental dysgenesis syndrome (MONDO:0700123)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29983323;37285932		False	3	100;0;0	2.156	True		ENSG00000173473	ENSG00000173473	HGNC:11104													
SMARCC2	gene	SMARCC2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 8;OMIM #618362			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30580808		False	3	100;0;0	2.156	True		ENSG00000139613	ENSG00000139613	HGNC:11105													
SMARCD1	gene	SMARCD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, SMARCD1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30879640		False	3	100;0;0	2.156	True		ENSG00000066117	ENSG00000066117	HGNC:11106													
SMARCE1	gene	SMARCE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 5, MIM# 616938			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22426308;23906836;23929686;32732226;32436246;32410215;34205270		False	3	100;0;0	2.156	True		ENSG00000073584	ENSG00000073584	HGNC:11109													
SMC1A	gene	SMC1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Cornelia de Lange syndrome 2 MONDO:0010370			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301283		False	3	100;0;0	2.156	True		ENSG00000072501	ENSG00000072501	HGNC:11111													
SMC3	gene	SMC3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cornelia de Lange syndrome 3 MONDO:0012555			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301283		False	3	100;0;0	2.156	True		ENSG00000108055	ENSG00000108055	HGNC:2468													
SMC5	gene	SMC5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Atelis syndrome 2, MIM# 620185			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36333305		False	3	100;0;0	2.156	True		ENSG00000198887	ENSG00000198887	HGNC:20465													
SMG8	gene	SMG8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Alzahrani-Kuwahara syndrome, MIM#	619268;Intellectual disability"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31130284;33242396		False	3	50;50;0	2.156	True		ENSG00000167447	ENSG00000167447	HGNC:25551													
SMG9	gene	SMG9	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Heart and brain malformation syndrome, MIM#	616920;Neurodevelopmental disorder with intention tremor, pyramidal signs, dyspraxia, and ocular anomalies, MIM# 619995"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27018474;31390136;35087184		False	3	100;0;0	2.156	True		ENSG00000105771	ENSG00000105771	HGNC:25763													
SMOC1	gene	SMOC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microphthalmia with limb anomalies, MIM# 206920			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21194678;21194680;30445150		False	3	100;0;0	2.156	True		ENSG00000198732	ENSG00000198732	HGNC:20318													
SMPD1	gene	SMPD1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type A, MIM# 257200;MONDO:0009756			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32292456;32280632;28164782		False	3	100;0;0	2.156	True		ENSG00000166311	ENSG00000166311	HGNC:11120													
SMPD4	gene	SMPD4	Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Severe neurodevelopmental delay, microcephaly, arthrogryposis			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31495489		False	3	100;0;0	2.156	True		ENSG00000136699	ENSG00000136699	HGNC:32949													
SMS	gene	SMS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked syndromic, Snyder-Robinson type, MIM# 309583;Syndromic X-linked intellectual disability Snyder type, MONDO:0010664			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30237987;34177437;32838743;23805436		False	3	100;0;0	2.156	True		ENSG00000102172	ENSG00000102172	HGNC:11123													
SNAP25	gene	SNAP25	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	?Myasthenic syndrome, congenital, 18;OMIM #616330			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 25003006;29100083;28135719		False	3	100;0;0	2.156	True		ENSG00000132639	ENSG00000132639	HGNC:11132													
SNAP29	gene	SNAP29	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (MIM#609528)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33977139;30793783;29051910		False	3	100;0;0	2.156	True		ENSG00000099940	ENSG00000099940	HGNC:11133													
SNAPC4	gene	SNAPC4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with motor regression, progressive spastic paraplegia, and oromotor dysfunction, MIM# 620515			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36965478		False	3	100;0;0	2.156	True		ENSG00000165684	ENSG00000165684	HGNC:11137													
SNAPIN	gene	SNAPIN	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with structural brain abnormalities and craniofacial abnormalities, MIM# 621393			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40930097;26539891		False	3	100;0;0	2.156	True		ENSG00000143553	ENSG00000143553	HGNC:17145													
SNF8	gene	SNF8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 115, MIM#620783;Neurodevelopmental disorder plus optic atrophy, MIM# 620784			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38423010		False	3	100;0;0	2.156	True		ENSG00000159210	ENSG00000159210	HGNC:17028													
SNRPB	gene	SNRPB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebrocostomandibular syndrome, MIM# 117650			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25047197;25504470;26971886		False	3	100;0;0	2.156	True		ENSG00000125835	ENSG00000125835	HGNC:11153													
SNW1	gene	SNW1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), SNW1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40608414		False	3	100;0;0	2.156	True		ENSG00000100603	ENSG00000100603	HGNC:16696													
SNX14	gene	SNX14	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 20 (MIM#616354)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25439728;25848753;27913285		False	3	100;0;0	2.156	True		ENSG00000135317	ENSG00000135317	HGNC:14977													
SNX27	gene	SNX27	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Damseh-Danson neurodevelopmental disorder, MIM# 621591			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25894286;31721175;21300787;23524343		False	3	100;0;0	2.156	True		ENSG00000143376	ENSG00000143376	HGNC:20073													
SOD1	gene	SOD1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic tetraplegia and axial hypotonia, progressive, MIM#618598			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31314961;31332433;34788402		False	3	100;0;0	2.156	True		ENSG00000142168	ENSG00000142168	HGNC:11179													
SON	gene	SON	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ZTTK syndrome, MIM# 617140			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27545680;27545676;31005274		False	3	100;0;0	2.156	True		ENSG00000159140	ENSG00000159140	HGNC:11183													
SOS1	gene	SOS1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Noonan syndrome 4, MIM# 610733			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17143285;17143282;28884940;17586837		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000115904	ENSG00000115904	HGNC:11187													
SOS2	gene	SOS2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Noonan syndrome 9, MIM#	616559"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000100485	ENSG00000100485	HGNC:11188													
SOX10	gene	SOX10	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Peripheral demyelinating neuropathy Central demyelination, Waardenburg and Hirschsprung disease, OMIM #609136;Waardenburg syndrome, type 2E, with or without neurologic involvement (OMIM #611584)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10762540;34667088;38132479		False	3	100;0;0	2.156	True		ENSG00000100146	ENSG00000100146	HGNC:11190													
SOX11	gene	SOX11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with microcephaly and with or without ocular malformations or hypogonadotropic hypogonadism, MIM# 615866			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24886874;33785884;33430815;33086258;31530938;35642566;35341651		False	3	100;0;0	2.156	True		ENSG00000176887	ENSG00000176887	HGNC:11191													
SOX2	gene	SOX2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microphthalmia, syndromic 3, MIM# 206900;Optic nerve hypoplasia and abnormalities of the central nervous system, MIM# 206900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30450772;28121235;25542770;24498598;24211324;24033328;21326281		False	3	100;0;0	2.156	True		ENSG00000181449	ENSG00000181449	HGNC:11195													
SOX4	gene	SOX4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 10;OMIM #618506			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30661772		False	3	100;0;0	2.156	True		ENSG00000124766	ENSG00000124766	HGNC:11200													
SOX5	gene	SOX5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lamb-Shaffer syndrome, MIM#616803			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31578471		False	3	100;0;0	2.156	True		ENSG00000134532	ENSG00000134532	HGNC:11201													
SOX6	gene	SOX6	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ADHD;Craniosynostosis;Osteochondromas;Tolchin-Le Caignec syndrome, MIM#618971			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32442410		False	3	100;0;0	2.156	True		ENSG00000110693	ENSG00000110693	HGNC:16421													
SP9	gene	SP9	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38288683		False	3	100;0;0	2.156	True		ENSG00000217236	ENSG00000217236	HGNC:30690													
SPART	gene	SPART	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Troyer syndrome, MIM# 275900;SPG20;MONDO:0010156			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31535723;31535723;26003402;28679690;27112432;20437587;12134148;18413476;31314595;28875386		False	3	100;0;0	2.156	True		ENSG00000133104	ENSG00000133104	HGNC:18514													
SPECC1L	gene	SPECC1L	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Teebi hypertelorism syndrome 1, MIM# 145420			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31953237;30472488		False	3	50;0;50	2.156	True		ENSG00000100014	ENSG00000100014	HGNC:29022													
SPEN	gene	SPEN	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Radio-Tartaglia syndrome, MIM# 619312			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194;33596411		False	3	50;50;0	2.156	True		ENSG00000065526	ENSG00000065526	HGNC:17575													
SPG11	gene	SPG11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 11, autosomal recessive 604360			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33581793		False	3	100;0;0	2.156	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPNS1	gene	SPNS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysosomal disorder, SPNS1-related, MONDO:0002561			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40608416;38451736		False	3	50;50;0	2.156	True		ENSG00000169682	ENSG00000169682	HGNC:30621													
SPOP	gene	SPOP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Nabais Sa-de Vries syndrome, type 1 MIM#618828;Nabais Sa-de Vries syndrome, type 2, MIM#618829			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32109420		False	3	100;0;0	2.156	True	Other	ENSG00000121067	ENSG00000121067	HGNC:11254													
SPOUT1	gene	SPOUT1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39962046		False	3	100;0;0	2.156	True		ENSG00000198917	ENSG00000198917	HGNC:26933													
SPR	gene	SPR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29302074;16049044;17188538		False	3	50;50;0	2.156	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPRED1	gene	SPRED1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Legius syndrome, MIM# 611431			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17704776;19366998;21548021		False	3	100;0;0	2.156	True		ENSG00000166068	ENSG00000166068	HGNC:20249													
SPRED2	gene	SPRED2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Noonan syndrome 14, MIM# 619745			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34626534		False	3	100;0;0	2.156	True		ENSG00000198369	ENSG00000198369	HGNC:17722													
SPTAN1	gene	SPTAN1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 5, MIM# 613477			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20493457;22258530;32811770;36331550		False	3	100;0;0	2.156	True		ENSG00000197694	ENSG00000197694	HGNC:11273													
SPTBN1	gene	SPTBN1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34211179 PMID: 33847457		False	3	100;0;0	2.156	True		ENSG00000115306	ENSG00000115306	HGNC:11275													
SPTBN2	gene	SPTBN2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386;Spinocerebellar ataxia 5, MIM# 600224			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23236289;23838597;22781464;31617442;31066025		False	3	100;0;0	2.156	True		ENSG00000173898	ENSG00000173898	HGNC:11276													
SPTBN4	gene	SPTBN4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, neuropathy, and deafness MIM#617519			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28540413;29861105		False	3	100;0;0	2.156	True		ENSG00000160460	ENSG00000160460	HGNC:14896													
SRCAP	gene	SRCAP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Floating-Harbor syndrome MIM#136140;Developmental delay, hypotonia, musculoskeletal defects, and behavioral abnormalities, MIM#	619595"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33909990		False	3	100;0;0	2.156	True		ENSG00000080603	ENSG00000080603	HGNC:16974													
SRD5A3	gene	SRD5A3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Iq, MIM#612379;Kahrizi syndrome, MIM# 612713			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32424323		False	3	100;0;0	2.156	True		ENSG00000128039	ENSG00000128039	HGNC:25812													
SRPK3	gene	SRPK3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked, 114, MIM#301134			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39073169		False	3	100;0;0	2.156	True		ENSG00000184343	ENSG00000184343	HGNC:11402													
SRRM1	gene	SRRM1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SRRM1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41145827		False	3	100;0;0	2.156	True		ENSG00000133226	ENSG00000133226	HGNC:16638													
SRRM2	gene	SRRM2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 72, MIM# 620439			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194;35567594		False	3	50;50;0	2.156	True		ENSG00000167978	ENSG00000167978	HGNC:16639													
SRRM4	gene	SRRM4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SRRM4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41958152		False	3	100;0;0	2.156	True	Other	ENSG00000139767	ENSG00000139767	HGNC:29389													
SRSF1	gene	SRSF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dysmorphic facies and behavioral abnormalities, MIM# 620489			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37071997		False	3	100;0;0	2.156	True		ENSG00000136450	ENSG00000136450	HGNC:10780													
SSPOP	gene	SSPOP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SSPOP-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 41077560		False	3	100;0;0	2.156	True		ENSG00000197558	ENSG00000197558	HGNC:21998													
SSR4	gene	SSR4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Congenital disorder of glycosylation, type Iy, MIM# 300934			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24218363;26264460		False	3	100;0;0	2.156	True		ENSG00000180879	ENSG00000180879	HGNC:11326													
ST3GAL3	gene	ST3GAL3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability, autosomal recessive 12 MIM# 611090			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23252400;21907012;31584066;37938134		False	3	100;0;0	2.156	True		ENSG00000126091	ENSG00000126091	HGNC:10866													
ST3GAL5	gene	ST3GAL5	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Salt and pepper developmental regression syndrome 609056;GM3 synthase deficiency, MONDO:0018274;Lactosylceramide alpha-2,3-sialyltransferase deficiency (Disorders of glycosphingolipid and glycosylphosphatidylinositol anchor glycosylation)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15502825;22990144;30185102;24026681;23436467;22990144;15502825;27232954;30691927;30688114;30576498		False	3	100;0;0	2.156	True		ENSG00000115525	ENSG00000115525	HGNC:10872													
STAG1	gene	STAG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 47, MIM# 617635			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28119487;34440290		False	3	100;0;0	2.156	True		ENSG00000118007	ENSG00000118007	HGNC:11354													
STAG2	gene	STAG2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mullegama-Klein-Martinez syndrome, MIM#301022			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30765867;28296084;30447054;29263825;30158690		False	3	0;0;0	2.156	True		ENSG00000101972	ENSG00000101972	HGNC:11355													
STAMBP	gene	STAMBP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly-capillary malformation syndrome, MIM# 614261;MONDO:0013659			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23542699;31638258;29907875;27531570;25692795;25266620		False	3	100;0;0	2.156	True		ENSG00000124356	ENSG00000124356	HGNC:16950													
STEEP1	gene	STEEP1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 107, MIM# 301013			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29374277		False	3	100;0;0	2.156	True		ENSG00000018610	ENSG00000018610	HGNC:26239													
STIL	gene	STIL	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 7, primary, autosomal recessive, MIM# 612703;MONDO:0012989			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19215732;22989186;25218063;33132204;32677750;29230157		False	3	100;0;0	2.156	True		ENSG00000123473	ENSG00000123473	HGNC:10879													
STRA6	gene	STRA6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Matthew-Wood syndrome MONDO:0011010			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17273977		False	3	100;0;0	2.156	True		ENSG00000137868	ENSG00000137868	HGNC:30650													
STRADA	gene	STRADA	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Polyhydramnios, megalencephaly, and symptomatic epilepsy, MIM#	611087"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17522105;27170158;28688840		False	3	100;0;0	2.156	True		ENSG00000266173	ENSG00000266173	HGNC:30172													
STT3A	gene	STT3A	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Iw, AR, OMIM #615596;Congenital disorder of glycosylation, type Iw, autosomal dominant, MIM# 619714			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23842455;30701557;28424003;34653363		False	3	67;0;33	2.156	True		ENSG00000134910	ENSG00000134910	HGNC:6172													
STX1A	gene	STX1A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO#0700092, STX1A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000106089	ENSG00000106089	HGNC:11433													
STX1B	gene	STX1B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Generalized epilepsy with febrile seizures plus, type 9, MIM# 616172			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25362483;33677401		False	3	100;0;0	2.156	True		ENSG00000099365	ENSG00000099365	HGNC:18539													
STXBP1	gene	STXBP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	developmental and epileptic encephalopathy, 4 MONDO:0012812			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27905812		False	3	100;0;0	2.156	True		ENSG00000136854	ENSG00000136854	HGNC:11444													
SUCLA2	gene	SUCLA2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria);OMIM #612073			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 27913098;15877282;23759946;17287286;17301081		False	3	100;0;0	2.156	True		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUCLG1	gene	SUCLG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33230783;28358460		False	3	100;0;0	2.156	True		ENSG00000163541	ENSG00000163541	HGNC:11449													
SUCO	gene	SUCO	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease (MONDO:0002254), SUCO-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29620724;20440000;41282771		False	3	100;0;0	2.156	True		ENSG00000094975	ENSG00000094975	HGNC:1240													
SUFU	gene	SUFU	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Joubert syndrome 32, MIM#617757;Neurodevelopmental disorder, MONDO:0700092, SUFU-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28965847;33024317		False	3	100;0;0	2.156	True		ENSG00000107882	ENSG00000107882	HGNC:16466													
SUMF1	gene	SUMF1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple sulfatase deficiency;OMIM #272200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000144455	ENSG00000144455	HGNC:20376													
SUOX	gene	SUOX	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	isolated sulfite oxidase deficiency MONDO:0010089			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28933809		False	3	100;0;0	2.156	True		ENSG00000139531	ENSG00000139531	HGNC:11460													
SUPT16H	gene	SUPT16H	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dysmorphic facies and thin corpus callosum, MIM# 619480;Intellectual disability;Abnormality of the corpus callosum			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31924697		False	3	100;0;0	2.156	True		ENSG00000092201	ENSG00000092201	HGNC:11465													
SUPT4H1	gene	SUPT4H1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO:0002254, SUPT4H1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41842694		False	3	100;0;0	2.156	True		ENSG00000213246	ENSG00000213246	HGNC:11467													
SURF1	gene	SURF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 1, MIM# 220110			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9843204;9837813		False	3	100;0;0	2.156	True		ENSG00000148290	ENSG00000148290	HGNC:11474													
SUZ12	gene	SUZ12	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Imagawa-Matsumoto syndrome, MIM# 618786;Intellectual disability;Overgrowth			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31736240;30019515;28229514		False	3	100;0;0	2.156	True		ENSG00000178691	ENSG00000178691	HGNC:17101													
SVBP	gene	SVBP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, MIM #618569;Spastic paraplegia 94, autosomal recessive, MIM# 621150			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31363758;30607023;39412222		False	3	100;0;0	2.156	True		ENSG00000177868	ENSG00000177868	HGNC:29204													
SYN1	gene	SYN1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	X-linked complex neurodevelopmental disorder MONDO:0100148;epilepsy, X-linked 1, with variable learning disabilities and behavior disorders MONDO:0010339			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000008056	ENSG00000008056	HGNC:11494													
SYNCRIP	gene	SYNCRIP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Global developmental delay;Intellectual disability;Autism;Myoclonic atonic seizures;Abnormality of nervous system morphology			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34157790;30504930;27479843;23020937		False	3	0;100;0	2.156	True		ENSG00000135316	ENSG00000135316	HGNC:16918													
SYNGAP1	gene	SYNGAP1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability, autosomal dominant 5 (MIM # 612621)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26079862		False	3	100;0;0	2.156	True		ENSG00000197283	ENSG00000197283	HGNC:11497													
SYNJ1	gene	SYNJ1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 53, MIM# 617389			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32435303;27435091		False	3	100;0;0	2.156	True		ENSG00000159082	ENSG00000159082	HGNC:11503													
SYP	gene	SYP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 96, MIM# 300802			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23966691;19377476		False	3	100;0;0	2.156	True		ENSG00000102003	ENSG00000102003	HGNC:11506													
SYT1	gene	SYT1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Baker-Gordon syndrome, MIM# 618218;MONDO:0033864			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 30107533		False	3	100;0;0	2.156	True		ENSG00000067715	ENSG00000067715	HGNC:11509													
SZT2	gene	SZT2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23932106;30560016;30359774;28556953;32402703		False	3	100;0;0	2.156	True		ENSG00000198198	ENSG00000198198	HGNC:29040													
TAB2	gene	TAB2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital heart defects, multiple types, 2 MONDO:0014000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35971781		False	3	100;0;0	2.156	True		ENSG00000055208	ENSG00000055208	HGNC:17075													
TAF1	gene	TAF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked, syndromic 33, MIM# 300966			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31646703		False	3	100;0;0	2.156	True		ENSG00000147133	ENSG00000147133	HGNC:11535													
TAF1C	gene	TAF1C	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO#0700092), TAF1C-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32779182;40371665		False	3	50;50;0	2.156	True		ENSG00000103168	ENSG00000103168	HGNC:11534													
TAF2	gene	TAF2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual development disorder, autosomal recessive 40, MIM# 615599			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21937992;22633631;26350204;34474177		False	3	50;50;0	2.156	True		ENSG00000064313	ENSG00000064313	HGNC:11536													
TAF4	gene	TAF4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 73, MIM# 620450			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33875846;28191890;35904126		False	3	67;33;0	2.156	True		ENSG00000130699	ENSG00000130699	HGNC:11537													
TAF6	gene	TAF6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alazami-Yuan syndrome, MIM# 617126			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25558065;25574841;32030742		False	3	100;0;0	2.156	True		ENSG00000106290	ENSG00000106290	HGNC:11540													
TAF8	gene	TAF8	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with severe motor impairment, absent language, cerebral hypomyelination, and brain atrophy, MIM# 619972			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 29648665;35759269		False	3	50;0;50	2.156	True		ENSG00000137413	ENSG00000137413	HGNC:17300													
TAFAZZIN	gene	TAFAZZIN	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Barth syndrome MONDO:0010543			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25299040		False	3	100;0;0	2.156	True		ENSG00000102125	ENSG00000102125	HGNC:11577													
TANC2	gene	TANC2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual disability;autism;epilepsy;dysmorphism;Intellectual developmental disorder with autistic features and language delay, with or without seizures, MIM#	618906"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31616000		False	3	100;0;0	2.156	True		ENSG00000170921	ENSG00000170921	HGNC:30212													
TANGO2	gene	TANGO2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, MIM#	616878;metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration MONDO:0014812"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29369572		False	3	100;0;0	2.156	True		ENSG00000183597	ENSG00000183597	HGNC:25439													
TAOK1	gene	TAOK1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay with or without intellectual impairment or behavioural abnormalities, MIM#619575;Intellectual disability;hypotonia;macrocephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31230721		False	3	100;0;0	2.156	True		ENSG00000160551	ENSG00000160551	HGNC:29259													
TAOK2	gene	TAOK2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, MONDO:0700092, TAOK2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39737487		False	3	100;0;0	2.156	True		ENSG00000149930	ENSG00000149930	HGNC:16835													
TARS2	gene	TARS2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 21, MIM# 615918;Epilepsy;Developmental Delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33153448;24827421;34508595		False	3	100;0;0	2.156	True		ENSG00000143374	ENSG00000143374	HGNC:30740													
TASP1	gene	TASP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental delay;microcephaly;dysmorphic features;congenital abnormalities;Suleiman-El-Hattab syndrome, MIM#618950			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31209944;31350873		False	3	100;0;0	2.156	True		ENSG00000089123	ENSG00000089123	HGNC:15859													
TAT	gene	TAT	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	tyrosinemia type II MONDO:0010160			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28255985		False	3	100;0;0	2.156	True		ENSG00000198650	ENSG00000198650	HGNC:11573													
TBC1D20	gene	TBC1D20	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Warburg micro syndrome 4;OMIM #615663			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 24239381		False	3	100;0;0	2.156	True		ENSG00000125875	ENSG00000125875	HGNC:16133													
TBC1D23	gene	TBC1D23	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 11, MIM# 617695			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28823707;28823706		False	3	100;0;0	2.156	True		ENSG00000036054	ENSG00000036054	HGNC:25622													
TBC1D24	gene	TBC1D24	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Developmental and epileptic encephalopathy 16, MIM#	615338;DOORS syndrome, MIM#	220500"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25719194		False	3	100;0;0	2.156	True		ENSG00000162065	ENSG00000162065	HGNC:29203													
TBC1D2B	gene	TBC1D2B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures and gingival overgrowth (NEDSGO), MIM#619323;Global developmental delay;Intellectual disability;Seizures;Gingival overgrowth;Behavioral abnormality;Abnormality of the mandible;Abnormality of brain morphology;Abnormality of the eye;Hearing abnormality			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32623794		False	3	33;67;0	2.156	True		ENSG00000167202	ENSG00000167202	HGNC:29183													
TBC1D32	gene	TBC1D32	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Orofacial digital syndrome type IX, MIM#258865			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24285566;32573025;32060556;31130284;36826837;40319332		False	3	100;0;0	2.156	True		ENSG00000146350	ENSG00000146350	HGNC:21485													
TBC1D7	gene	TBC1D7	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Macrocephaly/megalencephaly syndrome, autosomal recessive, MIM# 248000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24515783;23687350;36669495		False	3	100;0;0	2.156	True		ENSG00000145979	ENSG00000145979	HGNC:21066													
TBCD	gene	TBCD	Expert Review;Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27666370;27666374		False	3	100;0;0	2.156	True		ENSG00000141556	ENSG00000141556	HGNC:11581													
TBCE	gene	TBCE	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, with amyotrophy and optic atrophy MIM:617207;Hypoparathyroidism-retardation-dysmorphism syndrome MIM:241410			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27666369;17699660;34356170;34134906		False	3	100;0;0	2.156	True		-	ENSG00000284770	HGNC:11582													
TBCK	gene	TBCK	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, MIM# 616900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27040692;30103036;27040691		False	3	100;0;0	2.156	True		ENSG00000145348	ENSG00000145348	HGNC:28261													
TBL1XR1	gene	TBL1XR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 41, MIM# 616944;Pierpont syndrome, MIM# 602342			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26769062;30365874;25425123;9450851;23160955;28687524;23176139;16007632		False	3	100;0;0	2.156	True		ENSG00000177565	ENSG00000177565	HGNC:29529													
TBR1	gene	TBR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with autism and speech delay, MIM# 606053			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25232744;30250039		False	3	100;0;0	2.156	True		ENSG00000136535	ENSG00000136535	HGNC:11590													
TBX1	gene	TBX1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	DiGeorge syndrome, MIM# 188400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000184058	ENSG00000184058	HGNC:11592													
TCEAL1	gene	TCEAL1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder with gait disturbance, dysmorphic facies and behavioral abnormalities, X-linked, MIM# 301094			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36368327		False	3	100;0;0	2.156	True		ENSG00000172465	ENSG00000172465	HGNC:11616													
TCF20	gene	TCF20	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay with variable intellectual impairment and behavioral abnormalities, AD, MIM#618430			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30739909;30819258;25228304		False	3	100;0;0	2.156	True		ENSG00000100207	ENSG00000100207	HGNC:11631													
TCF4	gene	TCF4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Pitt-Hopkins syndrome MONDO:0012589			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22934316		False	3	100;0;0	2.156	True		ENSG00000196628	ENSG00000196628	HGNC:11634													
TCF7L2	gene	TCF7L2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, TCF7L2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194;34003604		False	3	33;67;0	2.156	True		ENSG00000148737	ENSG00000148737	HGNC:11641													
TCN2	gene	TCN2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Transcobalamin II deficiency, 275350			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19373259;32841161;33023511;30124850		False	3	100;0;0	2.156	True		ENSG00000185339	ENSG00000185339	HGNC:11653													
TCP1	gene	TCP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39480921		False	3	100;0;0	2.156	True		ENSG00000120438	ENSG00000120438	HGNC:11655													
TCTN1	gene	TCTN1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 13, MIM# 614173;MONDO:0013608			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31302911;28631893;21725307;26477546;34980503		False	3	100;0;0	2.156	True		ENSG00000204852	ENSG00000204852	HGNC:26113													
TCTN2	gene	TCTN2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 24, MIM# 616654 MONDO:0014724			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21565611;25118024		False	3	100;0;0	2.156	True		ENSG00000168778	ENSG00000168778	HGNC:25774													
TCTN3	gene	TCTN3	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 18, OMIM #614815;Orofaciodigital syndrome IV, OMIM #258860			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 22883145;25118024;26092869		False	3	0;100;0	2.156	True		ENSG00000119977	ENSG00000119977	HGNC:24519													
TDP2	gene	TDP2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 23;OMIM #616949			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31410782;30109272;24658003		False	3	100;0;0	2.156	True		ENSG00000111802	ENSG00000111802	HGNC:17768													
TECPR2	gene	TECPR2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 49, autosomal recessive, 615031;Autonomic-sensory neuropathy;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23176824;26542466		False	3	100;0;0	2.156	True		ENSG00000196663	ENSG00000196663	HGNC:19957													
TEDC1	gene	TEDC1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Primary microcephaly, MONDO:0016660			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39979680;38252227		False	3	100;0;0	2.156	True		ENSG00000185347	ENSG00000185347	HGNC:20127													
TEFM	gene	TEFM	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 58, MIM# 620451			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36823193		False	3	100;0;0	2.156	True		ENSG00000172171	ENSG00000172171	HGNC:26223													
TELO2	gene	TELO2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	You-Hoover-Fong syndrome, MIM#616954;Syndromic intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27132593;28944240		False	3	100;0;0	2.156	True		ENSG00000100726	ENSG00000100726	HGNC:29099													
TENM3	gene	TENM3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microphthalmia, syndromic 15, MIM#615145;coloboma			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30513139;22766609;27103084;29753094		False	3	100;0;0	2.156	True		ENSG00000218336	ENSG00000218336	HGNC:29944													
TERT	gene	TERT	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dyskeratosis congenita, autosomal dominant 2, OMIM #613989;Dyskeratosis congenita, autosomal recessive 4, OMIM #613989;Pulmonary fibrosis and/or bone marrow failure, telomere-related, 1, OMIM #614742			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000164362	ENSG00000164362	HGNC:11730													
TET3	gene	TET3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Beck-Fahrner syndrome MIM#618798			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31928709		False	3	100;0;0	2.156	True		ENSG00000187605	ENSG00000187605	HGNC:28313													
TFE3	gene	TFE3	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, with pigmentary mosaicism and coarse facies, MIM# 301066;Intellectual disability;Epilepsy;Coarse facial features			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30595499;31833172;32409512		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000068323	ENSG00000068323	HGNC:11752													
TGIF1	gene	TGIF1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Holoprosencephaly 4, MIM# 142946;MONDO:0007734			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10835638;16323008		False	3	100;0;0	2.156	True		ENSG00000177426	ENSG00000177426	HGNC:11776													
TH	gene	TH	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Segawa syndrome, recessive MIM#605407			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22815559;11196107;10585338		False	3	100;0;0	2.156	True		ENSG00000180176	ENSG00000180176	HGNC:11782													
THOC2	gene	THOC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked 12/35 MIM#300957			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26166480;32116545;29851191;32960281		False	3	100;0;0	2.156	True		ENSG00000125676	ENSG00000125676	HGNC:19073													
THOC6	gene	THOC6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Beaulieu-Boycott-Innes syndrome, MIM# 613680			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23621916;26739162;27102954;30238602;30476144		False	3	100;0;0	2.156	True		ENSG00000131652	ENSG00000131652	HGNC:28369													
THRA	gene	THRA	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypothyroidism congenital nongoitrous 6 (MIM 614450)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22494134;23940126;24847461;25670821;26037512;25621899;27144938;28856816;30842990;37469961		False	3	100;0;0	2.156	True		ENSG00000126351	ENSG00000126351	HGNC:11796													
THUMPD1	gene	THUMPD1	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO:0002254, THUMPD1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000066654	ENSG00000066654	HGNC:23807													
TIAM1	gene	TIAM1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with language delay and seizures, MIM# 619908			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000156299	ENSG00000156299	HGNC:11805													
TIMM50	gene	TIMM50	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type IX, MIM#617698			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27573165;30190335;31058414		False	3	100;0;0	2.156	True		ENSG00000105197	ENSG00000105197	HGNC:23656													
TINF2	gene	TINF2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Revesz syndrome, MIM# 268130			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	1404302;18252230;21477109		False	3	100;0;0	2.156	True		ENSG00000092330	ENSG00000092330	HGNC:11824													
TLK2	gene	TLK2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Intellectual disability, MIM 618050;Neurodevelopmental disease			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29861108;29942082;27479843;23911319;30559488;29942082;31558842		False	3	100;0;0	2.156	True		ENSG00000146872	ENSG00000146872	HGNC:11842													
TM2D3	gene	TM2D3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurocardiorenal malformation syndrome, MIM# 621379			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40449487		False	3	100;0;0	2.156	True		ENSG00000184277	ENSG00000184277	HGNC:24128													
TMCO1	gene	TMCO1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Craniofacial dysmorphism, skeletal anomalies, and impaired intellectual development 1, MIM#	213980;cerebrofaciothoracic dysplasia MONDO:0008952"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	1204988;1640432;15326640;20018682		False	3	100;0;0	2.156	True		ENSG00000143183	ENSG00000143183	HGNC:18188													
TMEM106B	gene	TMEM106B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukodystrophy, hypomyelinating, 16 (MIM #617964)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29186371;29444210;32595021		False	3	100;0;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000106460	ENSG00000106460	HGNC:22407													
TMEM147	gene	TMEM147	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with facial dysmorphism, absent language, and pseudo-Pelger-Huet anomaly, MIM# 620075			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36044892		False	3	100;0;0	2.156	True		ENSG00000105677	ENSG00000105677	HGNC:30414													
TMEM161B	gene	TMEM161B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, TMEM161B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37486637;36669109;36669111		False	3	100;0;0	2.156	False		ENSG00000164180	ENSG00000164180	HGNC:28483													
TMEM163	gene	TMEM163	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hypomyelinating leukodystrophy, MONDO:0019046			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35953447		False	3	100;0;0	2.156	True		ENSG00000152128	ENSG00000152128	HGNC:25380													
TMEM165	gene	TMEM165	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIk, MIM# 614727;TMEM165-CDG, MONDO:0013870			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22683087;28323990;27401145;27008884;26238249;25609749		False	3	100;0;0	2.156	True		ENSG00000134851	ENSG00000134851	HGNC:30760													
TMEM167A	gene	TMEM167A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40924476		False	3	100;0;0	2.156	True		ENSG00000174695	ENSG00000174695	HGNC:28330													
TMEM184B	gene	TMEM184B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO:0700092), TMEM184B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39006436		False	3	100;0;0	2.156	True		ENSG00000198792	ENSG00000198792	HGNC:1310													
TMEM216	gene	TMEM216	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 2 MONDO:0011963			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20036350		False	3	100;0;0	2.156	True		ENSG00000187049	ENSG00000187049	HGNC:25018													
TMEM218	gene	TMEM218	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 39, MIM#619562			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33791682;25161209		False	3	100;0;0	2.156	True		ENSG00000150433	ENSG00000150433	HGNC:27344													
TMEM222	gene	TMEM222	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470;Motor delay;Delayed speech and language development;Intellectual disability;Generalized hypotonia;Broad-based gait;Abnormality of nervous system morphology;Seizures;Microcephaly;Behavioral abnormality			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33824500		False	3	100;0;0	2.156	True		ENSG00000186501	ENSG00000186501	HGNC:25363													
TMEM237	gene	TMEM237	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 14, MIM# 614424			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22152675		False	3	100;0;0	2.156	True		ENSG00000155755	ENSG00000155755	HGNC:14432													
TMEM240	gene	TMEM240	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 21, MIM#	607454;spinocerebellar ataxia type 21 MONDO:0011833"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25070513		False	3	100;0;0	2.156	True		ENSG00000205090	ENSG00000205090	HGNC:25186													
TMEM63B	gene	TMEM63B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 118, MIM# 621250;Lung-brain developmental disorder, MIM# 621645			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37421948;42259295		False	3	100;0;0	2.156	True		ENSG00000137216	ENSG00000137216	HGNC:17735													
TMEM63C	gene	TMEM63C	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 87, autosomal recessive, MIM# 619966			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35718349		False	3	100;0;0	2.156	True		ENSG00000165548	ENSG00000165548	HGNC:23787													
TMEM67	gene	TMEM67	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 6, MIM# 610688;Meckel syndrome 3, MIM# 607361;COACH syndrome 1, MIM# 216360			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16415887;17377820;17160906;19508969		False	3	100;0;0	2.156	True		ENSG00000164953	ENSG00000164953	HGNC:28396													
TMEM70	gene	TMEM70	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2, MIM# 614052			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18953340		False	3	100;0;0	2.156	True		ENSG00000175606	ENSG00000175606	HGNC:26050													
TMEM94	gene	TMEM94	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with cardiac defects and dysmorphic facies, MIM#618316			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30526868		False	3	100;0;0	2.156	True		ENSG00000177728	ENSG00000177728	HGNC:28983													
TMTC3	gene	TMTC3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lissencephaly 8 (MIM#617255)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27773428;28973161		False	3	100;0;0	2.156	True		ENSG00000139324	ENSG00000139324	HGNC:26899													
TMX2	gene	TMX2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly;ID;brain malformations			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31735293;31586943		False	3	100;0;0	2.156	True		ENSG00000213593	ENSG00000213593	HGNC:30739													
TNPO2	gene	TNPO2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM# 619556			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34314705		False	3	100;0;0	2.156	True	Other	ENSG00000105576	ENSG00000105576	HGNC:19998													
TNR	gene	TNR	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, nonprogressive, with spasticity and transient opisthotonus, MIM# 619653;Spastic para- or tetraparesis;Axial muscular hypotonia;Intellectual disability;Transient opisthotonus			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32099069		False	3	100;0;0	2.156	True		ENSG00000116147	ENSG00000116147	HGNC:11953													
TNRC6B	gene	TNRC6B	Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Global developmental delay with speech and behavioural abnormalities, MIM# 619243			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32152250;28135719;25363768;27479843;28959963;25228304		False	3	100;0;0	2.156	True		ENSG00000100354	ENSG00000100354	HGNC:29190													
TOE1	gene	TOE1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 7, MIM# 614969			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28092684		False	3	100;0;0	2.156	True		ENSG00000132773	ENSG00000132773	HGNC:15954													
TOGARAM1	gene	TOGARAM1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 37, MIM# 619185			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32747439;32453716		False	3	100;0;0	2.156	True		ENSG00000198718	ENSG00000198718	HGNC:19959													
TOP2B	gene	TOP2B	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual disability (MONDO:0001071), TOP2B-related;B-cell immunodeficiency, distal limb anomalies, and urogenital malformations	MIM#609296"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31953910;28343847;12773624		False	3	50;50;0	2.156	True		ENSG00000077097	ENSG00000077097	HGNC:11990													
TP73	gene	TP73	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ciliary dyskinesia, primary, 47, and lissencephaly, MIM#619466;Intellectual disability;lissencephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31130284;34077761		False	3	100;0;0	2.156	True		ENSG00000078900	ENSG00000078900	HGNC:12003													
TPP1	gene	TPP1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 2, OMIM #204500;Spinocerebellar ataxia, autosomal recessive 7, OMIM #609270			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000166340	ENSG00000166340	HGNC:2073													
TPP2	gene	TPP2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25525876;25414442;33586135;18362329		False	3	100;0;0	2.156	True		ENSG00000134900	ENSG00000134900	HGNC:12016													
TRA2B	gene	TRA2B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Ramond-Elliott neurodevelopmental syndrome, MIM# 621421			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36549593		False	3	100;0;0	2.156	True		ENSG00000136527	ENSG00000136527	HGNC:10781													
TRAF7	gene	TRAF7	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiac, facial, and digital anomalies with developmental delay;OMIM #618164			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 29961569		False	3	100;0;0	2.156	True		ENSG00000131653	ENSG00000131653	HGNC:20456													
TRAIP	gene	TRAIP	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seckel syndrome 9, MIM#616777			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26595769		False	3	100;0;0	2.156	True		ENSG00000183763	ENSG00000183763	HGNC:30764													
TRAK1	gene	TRAK1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 68, MIM# 618201			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28940097;28364549;29846532		False	3	100;0;0	2.156	True		ENSG00000182606	ENSG00000182606	HGNC:29947													
TRAPPC10	gene	TRAPPC10	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, short stature, and speech delay, MIM# 620027			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35298461;30167849		False	3	100;0;0	2.156	True		ENSG00000160218	ENSG00000160218	HGNC:11868													
TRAPPC11	gene	TRAPPC11	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, autosomal recessive 18;OMIM #615356			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 23830518;27707803		False	3	100;0;0	2.156	True		ENSG00000168538	ENSG00000168538	HGNC:25751													
TRAPPC12	gene	TRAPPC12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM#617669			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28777934		False	3	0;100;0	2.156	True		ENSG00000171853	ENSG00000171853	HGNC:24284													
TRAPPC2L	gene	TRAPPC2L	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder - MONDO:0700092, TRAPPC2L-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36849228;32843486;30120216		False	3	50;50;0	2.156	True		ENSG00000167515	ENSG00000167515	HGNC:30887													
TRAPPC4	gene	TRAPPC4	Expert Review;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with epilepsy, spasticity, and brain atrophy, MIM# 618741			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31794024		False	3	100;0;0	2.156	True		ENSG00000196655	ENSG00000196655	HGNC:19943													
TRAPPC6B	gene	TRAPPC6B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28626029;28397838;31687267		False	3	100;0;0	2.156	True		ENSG00000182400	ENSG00000182400	HGNC:23066													
TRAPPC9	gene	TRAPPC9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability, autosomal recessive 13 (MIM# 613192)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22549410;20004765;20004763;30853973;29187737		False	3	100;0;0	2.156	True		ENSG00000167632	ENSG00000167632	HGNC:30832													
TREX1	gene	TREX1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome MONDO:0018866			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25604658;16845398;17357087;31559893		False	3	100;0;0	2.156	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TRIM71	gene	TRIM71	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Congenital hydrocephalus 4 (MIM#618667)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29983323;32168371;30975633;40892928;38833623		False	3	100;0;0	2.156	True		ENSG00000206557	ENSG00000206557	HGNC:32669													
TRIM8	gene	TRIM8	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Focal segmental glomerulosclerosis and neurodevelopmental syndrome, MIM# 619428;Intellectual disability;Seizures;FSGS			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30244534;27346735;23934111;33508234		False	3	100;0;0	2.156	True		ENSG00000171206	ENSG00000171206	HGNC:15579													
TRIO	gene	TRIO	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 44, MIM# 617061			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26721934;32109419		False	3	100;0;0	2.156	True		ENSG00000038382	ENSG00000038382	HGNC:12303													
TRIP12	gene	TRIP12	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation autosomal dominant 49, Clark-Baraitser Syndrome, MIM#617752			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27848077;28251352		False	3	100;0;0	2.156	True		ENSG00000153827	ENSG00000153827	HGNC:12306													
TRIT1	gene	TRIT1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 35, MIM#617873			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32088416;24901367;28185376;30977854		False	3	100;0;0	2.156	True		ENSG00000043514	ENSG00000043514	HGNC:20286													
TRMT1	gene	TRMT1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder, autosomal recessive 68	MIM#618302"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30289604;26308914;21937992		False	3	100;0;0	2.156	True		ENSG00000104907	ENSG00000104907	HGNC:25980													
TRMT10A	gene	TRMT10A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, short stature, and impaired glucose metabolism 1, MIM# 616033;MONDO:0000208			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24204302;25053765;33448213;33067246;26535115;26526202;26297882		False	3	100;0;0	2.156	True		ENSG00000145331	ENSG00000145331	HGNC:28403													
TRNT1	gene	TRNT1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Retinitis pigmentosa and erythrocytic microcytosis, OMIM #616959;Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay, OMIM #616084			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 25193871;23553769;29170023;27389523		False	3	100;0;0	2.156	True		ENSG00000072756	ENSG00000072756	HGNC:17341													
TRPM3	gene	TRPM3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31278393		False	3	100;0;0	2.156	True		ENSG00000083067	ENSG00000083067	HGNC:17992													
TRPM7	gene	TRPM7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Familial primary hypomagnesaemia, MONDO:0018100, TRPM7-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35561741;35712613;39099563		False	3	100;0;0	2.156	True		ENSG00000092439	ENSG00000092439	HGNC:17994													
TRRAP	gene	TRRAP	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay with or without dysmorphic facies and autism;OMIM #618454			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 30827496		False	3	100;0;0	2.156	True		ENSG00000196367	ENSG00000196367	HGNC:12347													
TSC1	gene	TSC1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tuberous sclerosis MIM#191100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10533067;18830229;15798777;17304050		False	3	100;0;0	2.156	True		ENSG00000165699	ENSG00000165699	HGNC:12362													
TSC2	gene	TSC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tuberous sclerosis MIM#613254			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	14985384;10533067;10205261;17304050		False	3	100;0;0	2.156	True		ENSG00000103197	ENSG00000103197	HGNC:12363													
TSEN15	gene	TSEN15	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 2F, 617026			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27392077;30914295;25558065		False	3	100;0;0	2.156	True		ENSG00000198860	ENSG00000198860	HGNC:16791													
TSEN2	gene	TSEN2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2B, MIM# 612389			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23562994;20952379		False	3	100;0;0	2.156	True		ENSG00000154743	ENSG00000154743	HGNC:28422													
TSEN54	gene	TSEN54	Expert list;Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2A 277470;Pontocerebellar hypoplasia type 4 225753			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301773;41825724;39634246;39400946;39034883;38622473;38347586;35962274;34085948;32697043;32214227;29410950;27570394;27430971		False	3	100;0;0	2.156	True		ENSG00000182173	ENSG00000182173	HGNC:27561													
TSFM	gene	TSFM	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 3, MIM#610505			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25037205;33816677;31451716;22499341		False	3	100;0;0	2.156	True		ENSG00000123297	ENSG00000123297	HGNC:12367													
TSHB	gene	TSHB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Central congenital hypothyroidism Orphanet:226298			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15292359;27362444		False	3	100;0;0	2.156	True		ENSG00000134200	ENSG00000134200	HGNC:12372													
TSPOAP1	gene	TSPOAP1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 22, MIM# 620453			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33539324		False	3	100;0;0	2.156	True		ENSG00000005379	ENSG00000005379	HGNC:16831													
TTC19	gene	TTC19	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 2, MIM#615157			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21278747;23532514;24368687;24397319		False	3	100;0;0	2.156	True		ENSG00000011295	ENSG00000011295	HGNC:26006													
TTC5	gene	TTC5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebral atrophy and variable facial dysmorphism , MIM#619244;Central hypotonia;Global developmental delay;Intellectual disability;Abnormality of nervous system morphology;Microcephaly;Abnormality of the face;Behavioral abnormality;Abnormality of the genitourinary system			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29302074;32439809		False	3	100;0;0	2.156	True		ENSG00000136319	ENSG00000136319	HGNC:19274													
TTC8	gene	TTC8	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 8, MIM# 615985			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	14520415;19797195		False	3	100;0;0	2.156	True		ENSG00000165533	ENSG00000165533	HGNC:20087													
TTI1	gene	TTI1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM#	620445"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26539891;30315573;36724785		False	3	33;67;0	2.156	True		ENSG00000101407	ENSG00000101407	HGNC:29029													
TTI2	gene	TTI2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 39 (MIM#615541) AR			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32061250;23956177;31737043		False	3	100;0;0	2.156	True		ENSG00000129696	ENSG00000129696	HGNC:26262													
TUBA1A	gene	TUBA1A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lissencephaly 3, MIM# 611603			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000167552	ENSG00000167552	HGNC:20766													
TUBB	gene	TUBB	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 6, MIM#615771			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23246003		False	3	100;0;0	2.156	True		ENSG00000196230	ENSG00000196230	HGNC:20778													
TUBB2A	gene	TUBB2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 5, MIM# 615763			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32571897		False	3	100;0;0	2.156	True		ENSG00000137267	ENSG00000137267	HGNC:12412													
TUBB2B	gene	TUBB2B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 7 MIM#610031			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11425694;23001566;19465910;22333901		False	3	100;0;0	2.156	True		ENSG00000137285	ENSG00000137285	HGNC:30829													
TUBB3	gene	TUBB3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex cortical dysplasia with other brain malformations 1 MONDO:0013541;Congenital fibrosis of extraocular muscles 3A, syndromic 1, with anosmia and developmental delay;MIM#621655 Congenital fibrosis of extraocular muscles 3A2, syndromic, with joint contractures, developmental delay, and peripheral neuropathy, MIM#621666			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20829227		False	3	100;0;0	2.156	True		ENSG00000258947	ENSG00000258947	HGNC:20772													
TUBB4A	gene	TUBB4A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	hypomyelinating leukodystrophy 6 MONDO:0012905			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37529938;35661708;27538619;24526230		False	3	100;0;0	2.156	True		ENSG00000104833	ENSG00000104833	HGNC:20774													
TUBG1	gene	TUBG1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex cortical dysplasia with other brain malformations 4 MONDO:0014171			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29706637;23603762		False	3	100;0;0	2.156	True		ENSG00000131462	ENSG00000131462	HGNC:12417													
TUBGCP2	gene	TUBGCP2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lissencephaly;pachygyria;subcortical band heterotopia;microcephaly;intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31630790		False	3	100;0;0	2.156	True		ENSG00000130640	ENSG00000130640	HGNC:18599													
TUBGCP6	gene	TUBGCP6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly and chorioretinopathy, autosomal recessive, 1, MIM#251270			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25344692;22279524		False	3	100;0;0	2.156	True		ENSG00000128159	ENSG00000128159	HGNC:18127													
TUSC3	gene	TUSC3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 7, MIM# 611093, MONDO:0012615;TUSC3-CDG (Disorders of protein N-glycosylation)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18452889;18455129;21739581;27148795;31606977		False	3	100;0;0	2.156	True		ENSG00000104723	ENSG00000104723	HGNC:30242													
TWIST1	gene	TWIST1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Saethre-Chotzen syndrome MONDO:0007042			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301368		False	3	100;0;0	2.156	True		ENSG00000122691	ENSG00000122691	HGNC:12428													
U2AF2	gene	U2AF2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay, dysmorphic facies, and brain anomalies, MIM# 620535			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34112922;37092751;36747105;37134193		False	3	50;50;0	2.156	True		ENSG00000063244	ENSG00000063244	HGNC:23156													
UBA5	gene	UBA5	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 44 (MIM#617132)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33811063		False	3	100;0;0	2.156	True		ENSG00000081307	ENSG00000081307	HGNC:23230													
UBAP2L	gene	UBAP2L	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with impaired language, behavioral abnormalities, and dysmorphic facies, MIM# 620494;Delayed speech and language development;Motor delay;Intellectual disability;Autistic behavior;Seizures;Microcephaly;Abnormality of head or neck;Short stature;Abnormality of the skeletal system			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35977029		False	3	100;0;0	2.156	True		ENSG00000143569	ENSG00000143569	HGNC:29877													
UBE2A	gene	UBE2A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked syndromic, Nascimento-type (MIM#300860)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24053514;16909393		False	3	100;0;0	2.156	True		ENSG00000077721	ENSG00000077721	HGNC:12472													
UBE3A	gene	UBE3A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)	Angelman syndrome MONDO:0007113			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301323		False	3	100;0;0	2.156	True		ENSG00000114062	ENSG00000114062	HGNC:12496													
UBE3B	gene	UBE3B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kaufman oculocerebrofacial syndrome, MIM# 244450;MONDO:0009485			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23200864;23200864;34012380;32949109		False	3	100;0;0	2.156	True		ENSG00000151148	ENSG00000151148	HGNC:13478													
UBE3C	gene	UBE3C	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with absent speech and movement and behavioral abnormalities, MIM# 620270			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36401616		False	3	100;0;0	2.156	True		ENSG00000009335	ENSG00000009335	HGNC:16803													
UBE4A	gene	UBE4A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia and gross motor and seech delay, MIM# 619639			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33420346		False	3	100;0;0	2.156	True		ENSG00000110344	ENSG00000110344	HGNC:12499													
UBR1	gene	UBR1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Johanson-Blizzard syndrome (MIM#243800)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24599544		False	3	100;0;0	2.156	True		ENSG00000159459	ENSG00000159459	HGNC:16808													
UBR5	gene	UBR5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with speech delay and behavioral abnormalities, MIM# 621372			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39721588		False	3	100;0;0	2.156	True		ENSG00000104517	ENSG00000104517	HGNC:16806													
UBR7	gene	UBR7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Li-Campeau syndrome, MIM# 619189;Intellectual disability;epilepsy;hypothyroidism;congenital anomalies;dysmorphic features			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33340455		False	3	100;0;0	2.156	True		ENSG00000012963	ENSG00000012963	HGNC:20344													
UBTF	gene	UBTF	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701;Neurodevelopmental disorder, MONDO:0700092, UBTF-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28777933;29300972;39366741		False	3	50;50;0	2.156	True		ENSG00000108312	ENSG00000108312	HGNC:12511													
UFC1	gene	UFC1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with spasticity and poor growth;OMIM #618076			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 29868776		False	3	100;0;0	2.156	True		ENSG00000143222	ENSG00000143222	HGNC:26941													
UFM1	gene	UFM1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 14;OMIM #617899			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 27545674;27545681;28931644		False	3	100;0;0	2.156	True		ENSG00000120686	ENSG00000120686	HGNC:20597													
UFSP2	gene	UFSP2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 106, MIM# 620028;Abnormal muscle tone;Seizures;Global developmental delay;Delayed speech and language development;Intellectual disability;Strabismus			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33473208		False	3	50;50;0	2.156	True		ENSG00000109775	ENSG00000109775	HGNC:25640													
UGDH	gene	UGDH	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 84 - MIM #618792			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32001716		False	3	100;0;0	2.156	True		ENSG00000109814	ENSG00000109814	HGNC:12525													
UGGT1	gene	UGGT1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IICC, MIM# 621381			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40267907		False	3	100;0;0	2.156	True		ENSG00000136731	ENSG00000136731	HGNC:15663													
UGP2	gene	UGP2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy;intellectual disability;microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31820119		False	3	100;0;0	2.156	True		ENSG00000169764	ENSG00000169764	HGNC:12527													
UMPS	gene	UMPS	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Orotic aciduria MIM# 258900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9042911;33489760		False	3	100;0;0	2.156	True		ENSG00000114491	ENSG00000114491	HGNC:12563													
UNC13A	gene	UNC13A	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456;Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27648472;28192369;41125872		False	3	100;0;0	2.156	True		ENSG00000130477	ENSG00000130477	HGNC:23150													
UNC79	gene	UNC79	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), UNC79-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID:37183800		False	3	0;100;0	2.156	True		ENSG00000133958	ENSG00000133958	HGNC:19966													
UNC80	gene	UNC80	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, infantile, with psychomotor retardation and characteristic facies 2, MIM# 616801;MONDO:0014777			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26708751;26708753;26545877;32620897;30167850;30167850		False	3	100;0;0	2.156	True		ENSG00000144406	ENSG00000144406	HGNC:26582													
UPB1	gene	UPB1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Beta-ureidopropionase deficiency, OMIM #613161			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27604308;24526388;25638458;22525402;15385443;17964839		False	3	50;50;0	2.156	True		ENSG00000100024	ENSG00000100024	HGNC:16297													
UPF1	gene	UPF1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, MONDO:0700092, UPF1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194		False	3	100;0;0	2.156	True		ENSG00000005007	ENSG00000005007	HGNC:9962													
UPF3B	gene	UPF3B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked, syndromic 14, MIM# 300676			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19377476;17704778;31737052;28948974;32667670		False	3	100;0;0	2.156	True		ENSG00000125351	ENSG00000125351	HGNC:20439													
USP18	gene	USP18	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pseudo-TORCH syndrome 2;OMIM #617397			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31940699;12833411;27325888		False	3	100;0;0	2.156	True		ENSG00000184979	ENSG00000184979	HGNC:12616													
USP27X	gene	USP27X	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual disability, X-linked 105, MIM#300984			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25644381;38182161		False	3	100;0;0	2.156	True		-	ENSG00000273820	HGNC:13486													
USP34	gene	USP34	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092-USP34 related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42315110;39117575		False	3	100;0;0	2.156	True		ENSG00000115464	ENSG00000115464	HGNC:20066													
USP7	gene	USP7	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hao-Fountain syndrome, MIM# 616863;MONDO:0014805;Intellectual disability;Autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30679821;26365382		False	3	100;0;0	2.156	True		ENSG00000187555	ENSG00000187555	HGNC:12630													
USP9X	gene	USP9X	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder 99 MIM#300919;syndromic, female-restricted Intellectual developmental disorder 99 MIM#300968			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31443933;26833328		False	3	100;0;0	2.156	True		ENSG00000124486	ENSG00000124486	HGNC:12632													
VAMP2	gene	VAMP2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760;Cortical visual impairment;Seizures;Stereotypic behaviour;Generalized hypotonia;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30929742		False	3	100;0;0	2.156	True		ENSG00000220205	ENSG00000220205	HGNC:12643													
VARS1	gene	VARS1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy;OMIM #617802			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 30755616;30755602;26539891;29691655;30275004		False	3	100;0;0	2.156	True		ENSG00000204394	ENSG00000204394	HGNC:12651													
VARS2	gene	VARS2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 20;OMIM #615917			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 24827421;25058219;29137650;29314548;31064326		False	3	100;0;0	2.156	True		ENSG00000137411	ENSG00000137411	HGNC:21642													
VCP	gene	VCP	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO: 0700092), VCP-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37883978		False	3	100;0;0	2.156	True		ENSG00000165280	ENSG00000165280	HGNC:12666													
VIPAS39	gene	VIPAS39	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Arthrogryposis, renal dysfunction, and cholestasis 2;OMIM #613404			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 20190753		False	3	100;0;0	2.156	True		ENSG00000151445	ENSG00000151445	HGNC:20347													
VLDLR	gene	VLDLR	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	cerebellar ataxia, intellectual disability, and dysequilibrium syndrome 1 MONDO:0024542			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301729		False	3	100;0;0	2.156	True		ENSG00000147852	ENSG00000147852	HGNC:12698													
VMA22	gene	VMA22	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIo MIM# 616828			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000136710	ENSG00000136710	HGNC:28178													
VPS11	gene	VPS11	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 12, MIM#616683			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27120463;26307567;27473128		False	3	100;0;0	2.156	True		ENSG00000160695	ENSG00000160695	HGNC:14583													
VPS13B	gene	VPS13B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cohen syndrome MONDO:0008999			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301655		False	3	100;0;0	2.156	True		ENSG00000132549	ENSG00000132549	HGNC:2183													
VPS16	gene	VPS16	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	mucopolysaccharidosis-like disorder, VPS16-related MONDO#0100365			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33938619;34013567;34901436		False	3	100;0;0	2.156	True		ENSG00000215305	ENSG00000215305	HGNC:14584													
VPS33B	gene	VPS33B	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Arthrogryposis, renal dysfunction, and cholestasis 1;OMIM #208085			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31240160;30561130		False	3	100;0;0	2.156	True		ENSG00000184056	ENSG00000184056	HGNC:12712													
VPS35L	gene	VPS35L	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ritscher-Schinzel syndrome-3 (RTSC3), MIM#619135			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25434475;31712251		False	3	50;50;0	2.156	True		ENSG00000103544	ENSG00000103544	HGNC:24641													
VPS41	gene	VPS41	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32808683;33764426		False	3	100;0;0	2.156	True		ENSG00000006715	ENSG00000006715	HGNC:12713													
VPS4A	gene	VPS4A	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CIMDAG syndrome MIM# 619273			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33186543;33186545		False	3	100;0;0	2.156	True	Other	ENSG00000132612	ENSG00000132612	HGNC:13488													
VPS50	gene	VPS50	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis , MIM#619685;Neonatal cholestatic liver disease;Failure to thrive;Profound global developmental delay;Postnatal microcephaly;Seizures;Abnormality of the corpus callosum			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34037727;38876772		False	3	33;67;0	2.156	True		ENSG00000004766	ENSG00000004766	HGNC:25956													
VPS51	gene	VPS51	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Pontocerebellar hypoplasia, type 13, MIM#	618606"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30624672;31207318;40176246;40565173		False	3	100;0;0	2.156	True		ENSG00000149823	ENSG00000149823	HGNC:1172													
VPS53	gene	VPS53	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 2E, OMIM #615851			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24577744;12920088		False	3	100;0;0	2.156	True		ENSG00000141252	ENSG00000141252	HGNC:25608													
VRK1	gene	VRK1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	pontocerebellar hypoplasia type 1A MONDO:0011866			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19646678		False	3	100;0;0	2.156	True		ENSG00000100749	ENSG00000100749	HGNC:12718													
VWA3B	gene	VWA3B	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 22 MIM#616948			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26157035;41673450;37772257		False	3	50;0;50	2.156	True		ENSG00000168658	ENSG00000168658	HGNC:28385													
WAC	gene	WAC	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Desanto-Shinawi syndrome 616708			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26264232;26757981		False	3	100;0;0	2.156	True		ENSG00000095787	ENSG00000095787	HGNC:17327													
WAPL	gene	WAPL	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder, MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42431198;30158690		False	3	100;0;0	2.156	True		ENSG00000062650	ENSG00000062650	HGNC:23293													
WARS1	gene	WARS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities,MIM# 620317			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35815345;35790048		False	3	100;0;0	2.156	True		ENSG00000140105	ENSG00000140105	HGNC:12729													
WARS2	gene	WARS2	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM#617710			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29783990;28236339;29120065;28650581;28905505		False	3	100;0;0	2.156	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WASF1	gene	WASF1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with absent language and variable seizures , MIM#618707			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29961568;34845217;34478686;34356165		False	3	100;0;0	2.156	True		ENSG00000112290	ENSG00000112290	HGNC:12732													
WASHC4	gene	WASHC4	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder, autosomal recessive 43	MIM#615817"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 21498477		False	3	67;33;0	2.156	True		ENSG00000136051	ENSG00000136051	HGNC:29174													
WBP4	gene	WBP4	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, WBP4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37963460		False	3	100;0;0	2.156	True		ENSG00000120688	ENSG00000120688	HGNC:12739													
WDFY3	gene	WDFY3	Expert Review Green;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microcephaly 18, primary, autosomal dominant, MIM#617520			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31327001;27008544		False	3	100;0;0	2.156	True		ENSG00000163625	ENSG00000163625	HGNC:20751													
WDPCP	gene	WDPCP	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 15, MIM# 615992;OFD;Congenital heart defects, hamartomas of tongue, and polysyndactyly, 217085			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20671153;25427950;32055034;29588463;28289185		False	3	100;0;0	2.156	True		ENSG00000143951	ENSG00000143951	HGNC:28027													
WDR11	gene	WDR11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, WDR11-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34413497;20887964;29263200		False	3	50;25;25	2.156	True		ENSG00000120008	ENSG00000120008	HGNC:13831													
WDR26	gene	WDR26	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Skraban-Deardorff syndrome, MIM#617616			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28686853;33506510;33675273		False	3	100;0;0	2.156	True		ENSG00000162923	ENSG00000162923	HGNC:21208													
WDR37	gene	WDR37	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurooculocardiogenitourinary syndrome;OMIM #618652			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 31327508;31327510		False	3	100;0;0	2.156	True		ENSG00000047056	ENSG00000047056	HGNC:31406													
WDR4	gene	WDR4	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway-Mowat syndrome 6, OMIM #618347;Microcephaly, growth deficiency, seizures, and brain malformations, OMIM #618346			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26416026;30079490;29597095;28617965		False	3	100;0;0	2.156	True		ENSG00000160193	ENSG00000160193	HGNC:12756													
WDR44	gene	WDR44	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Ciliopathy, MONDO:0005308, WDR44-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38191484		False	3	100;0;0	2.156	True		ENSG00000131725	ENSG00000131725	HGNC:30512													
WDR45	gene	WDR45	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	X-linked complex neurodevelopmental disorder MONDO:0100148;neurodegeneration with brain iron accumulation 5 MONDO:0010476			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28211668		False	3	100;0;0	2.156	True		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR45B	gene	WDR45B	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM# 617977			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21937992;28503735;27431290		False	3	100;0;0	2.156	True		ENSG00000141580	ENSG00000141580	HGNC:25072													
WDR47	gene	WDR47	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder MONDO:0100038, WDR47-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39609633		False	3	100;0;0	2.156	True		ENSG00000085433	ENSG00000085433	HGNC:29141													
WDR5	gene	WDR5	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, WDR5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36408368		False	3	100;0;0	2.156	True	Other	ENSG00000196363	ENSG00000196363	HGNC:12757													
WDR62	gene	WDR62	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 2, primary, autosomal recessive, with or without cortical malformations, MIM# 604317;MONDO:0011435			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20890279;20729831;20890278;21496009;21834044;22775483;32677750;31788460		False	3	100;0;0	2.156	True		ENSG00000075702	ENSG00000075702	HGNC:24502													
WDR73	gene	WDR73	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway-Mowat syndrome 1 MONDO:0033005			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26123727		False	3	100;0;0	2.156	True		ENSG00000177082	ENSG00000177082	HGNC:25928													
WDR81	gene	WDR81	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Hydrocephalus, congenital, 3, with brain anomalies, 617967			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21885617;28556411;28969387		False	3	100;0;0	2.156	True		ENSG00000167716	ENSG00000167716	HGNC:26600													
WDR83OS	gene	WDR83OS	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with variable familial hypercholanemia, MIM# 621016			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39471804;30250217		False	3	100;0;0	2.156	True		ENSG00000105583	ENSG00000105583	HGNC:30203													
WDR91	gene	WDR91	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32732226;38041506;34791078;40550703;28860274;34028500;ClinVar: SCV000965687.1		False	3	100;0;0	2.156	True		ENSG00000105875	ENSG00000105875	HGNC:24997													
WIPI2	gene	WIPI2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with short stature and variable skeletal anomalies 618453;global developmental delay;intellectual disability;refractory infantile/childhood-onset epilepsy;progressive tetraplegia with joint contractures;dyskinesia;speech and visual impairment;autistic features;ataxic gait			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30968111;34557665		False	3	50;0;50	2.156	True		ENSG00000157954	ENSG00000157954	HGNC:32225													
WNK3	gene	WNK3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Prieto syndrome, MIM# 309610			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35678782		False	3	100;0;0	2.156	True		ENSG00000196632	ENSG00000196632	HGNC:14543													
WNT1	gene	WNT1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Osteogenesis imperfecta, type XV;OMIM# 615220			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000125084	ENSG00000125084	HGNC:12774													
WNT5A	gene	WNT5A	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Robinow syndrome, autosomal dominant 1;OMIM# 180700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000114251	ENSG00000114251	HGNC:12784													
WSB2	gene	WSB2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Luo-Agrawal neurodevelopmental syndrome, MIM# 621552			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID:40374945		False	3	100;0;0	2.156	True		ENSG00000176871	ENSG00000176871	HGNC:19222													
WWOX	gene	WWOX	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	developmental and epileptic encephalopathy, 28 MONDO:0014533;autosomal recessive spinocerebellar ataxia 12 MONDO:0013687			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25411445;24369382		False	3	100;0;0	2.156	True		ENSG00000186153	ENSG00000186153	HGNC:12799													
XPA	gene	XPA	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Xeroderma pigmentosum, group A;OMIM# 278700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26302748;25566891;24135642		False	3	100;0;0	2.156	True		ENSG00000136936	ENSG00000136936	HGNC:12814													
XPO1	gene	XPO1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, XPO1-related, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40819229		False	3	100;0;0	2.156	True		ENSG00000082898	ENSG00000082898	HGNC:12825													
XPOT	gene	XPOT	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO:0002254			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10.64898/2026.01.28.26344748		False	3	100;0;0	2.156	True		ENSG00000184575	ENSG00000184575	HGNC:12826													
XRCC4	gene	XRCC4	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short stature, microcephaly, and endocrine dysfunction MIM#616541, MONDO:0014686			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25728776;25872942;25839420;18695064		False	3	100;0;0	2.156	True		ENSG00000152422	ENSG00000152422	HGNC:12831													
XYLT1	gene	XYLT1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Desbuquois dysplasia 2, MIM# 615777;Baratela-Scott syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 24581741;22711505;23982343		False	3	100;0;0	2.156	True		ENSG00000103489	ENSG00000103489	HGNC:15516													
YARS1	gene	YARS1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile-onset multisystem neurologic, endocrine, and pancreatic disease 2, MIM# 619418			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30304524;29232904;27633801		False	3	100;0;0	2.156	True		ENSG00000134684	ENSG00000134684	HGNC:12840													
YIF1B	gene	YIF1B	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32006098		False	3	100;0;0	2.156	True		ENSG00000167645	ENSG00000167645	HGNC:30511													
YWHAE	gene	YWHAE	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36999555		False	3	100;0;0	2.156	True		ENSG00000108953	ENSG00000108953	HGNC:12851													
YWHAG	gene	YWHAG	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 56, (MIMI#617665)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33393734;33590706;31926053;33767733		False	3	100;0;0	2.156	True		ENSG00000170027	ENSG00000170027	HGNC:12852													
YY1	gene	YY1	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Gabriele-de Vries syndrome, OMIM #617557			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28575647		False	3	100;0;0	2.156	True		ENSG00000100811	ENSG00000100811	HGNC:12856													
ZBTB11	gene	ZBTB11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 69;OMIM #618383			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29893856		False	3	50;50;0	2.156	True		ENSG00000066422	ENSG00000066422	HGNC:16740													
ZBTB18	gene	ZBTB18	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 22, MIM# 612337;Intellectual disability;microcephaly;corpus callosum abnormalities			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29573576		False	3	100;0;0	2.156	True		ENSG00000179456	ENSG00000179456	HGNC:13030													
ZBTB20	gene	ZBTB20	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Primrose syndrome, MIM# 259050			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25017102;27061120;30256248		False	3	100;0;0	2.156	True		ENSG00000181722	ENSG00000181722	HGNC:13503													
ZBTB24	gene	ZBTB24	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency-centromeric instability-facial anomalies syndrome 2;OMIM # 614069			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21906047;21596365;23486536		False	3	100;0;0	2.156	True		ENSG00000112365	ENSG00000112365	HGNC:21143													
ZBTB47	gene	ZBTB47	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO#0700092), ZBTB47-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37743782		False	3	100;0;0	2.156	True		ENSG00000114853	ENSG00000114853	HGNC:26955													
ZBTB7A	gene	ZBTB7A	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Macrocephaly, neurodevelopmental delay, lymphoid hyperplasia, and persistent fetal hemoglobin (MIM#619769)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34515416;31645653		False	3	100;0;0	2.156	True		ENSG00000178951	ENSG00000178951	HGNC:18078													
ZC4H2	gene	ZC4H2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Wieacker-Wolff syndrome, MIM# 314580			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23623388;34322088;33949289;31885220;31206972		False	3	100;0;0	2.156	True		ENSG00000126970	ENSG00000126970	HGNC:24931													
ZDHHC9	gene	ZDHHC9	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Syndromic X-linked intellectual disability Raymond type MONDO:0010427			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17436253		False	3	100;0;0	2.156	True		ENSG00000188706	ENSG00000188706	HGNC:18475													
ZEB2	gene	ZEB2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mowat-Wilson syndrome, MIM# 235730;MONDO:0009341			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29300384		False	3	100;0;0	2.156	True		ENSG00000169554	ENSG00000169554	HGNC:14881													
ZFHX3	gene	ZFHX3	Expert Review Green;Research	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ZFHX3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37292950;38412861		False	3	100;0;0	2.156	True		ENSG00000140836	ENSG00000140836	HGNC:777													
ZFHX4	gene	ZFHX4	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, ZFHX4-related (MONDO:0700092)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194;24038936;21802062		False	3	100;0;0	2.156	True		ENSG00000091656	ENSG00000091656	HGNC:30939													
ZFTRAF1	gene	ZFTRAF1	Expert Review Green;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder and microcephaly, MONDO:0700092, CYHR1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	50;50;0	2.156	True		ENSG00000187954	ENSG00000187954	HGNC:17806													
ZFX	gene	ZFX	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked syndromic 37, MIM# 301118			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26350204;26740508;38325380		False	3	100;0;0	2.156	True		ENSG00000005889	ENSG00000005889	HGNC:12869													
ZFYVE26	gene	ZFYVE26	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 15, autosomal recessive, MIM#	270700;hereditary spastic paraplegia 15, MONDO:0010044"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301682		False	3	100;0;0	2.156	True		ENSG00000072121	ENSG00000072121	HGNC:20761													
ZIC1	gene	ZIC1	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Structural brain anomalies with impaired intellectual development and craniosynostosis;OMIM #618736    			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 26340333, 30391508		False	3	100;0;0	2.156	True		ENSG00000152977	ENSG00000152977	HGNC:12872													
ZIC2	gene	ZIC2	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Holoprosencephaly 5 MONDO:0012322			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21940735		False	3	100;0;0	2.156	True		ENSG00000043355	ENSG00000043355	HGNC:12873													
ZMIZ1	gene	ZMIZ1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dysmorphic facies and distal skeletal anomalies;OMIM #618659			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 30639322		False	3	100;0;0	2.156	True		ENSG00000108175	ENSG00000108175	HGNC:16493													
ZMYM2	gene	ZMYM2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Neurodevelopmental-craniofacial syndrome with variable renal and cardiac abnormalities, MIM#	619522"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32891193		False	3	50;50;0	2.156	True		ENSG00000121741	ENSG00000121741	HGNC:12989													
ZMYM3	gene	ZMYM3	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 112, MIM# 301111			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24721225;36586412		False	3	67;0;33	2.156	True		ENSG00000147130	ENSG00000147130	HGNC:13054													
ZMYND11	gene	ZMYND11	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 30, MIM# 616083			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32097528		False	3	100;0;0	2.156	True		ENSG00000015171	ENSG00000015171	HGNC:16966													
ZMYND8	gene	ZMYND8	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ZMYND8-related;Delayed speech and language development;Motor delay;Intellectual disability;Abnormality of cardiovascular system morphology;Hearing abnormality;Abnormality of vision;Abnormality of the face;Seizures			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35916866;32530565		False	3	100;0;0	2.156	True		ENSG00000101040	ENSG00000101040	HGNC:9397													
ZNF142	gene	ZNF142	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with impaired speech and hyperkinetic movements, MIM#618425			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31036918		False	3	100;0;0	2.156	True		ENSG00000115568	ENSG00000115568	HGNC:12927													
ZNF148	gene	ZNF148	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Global developmental delay, absent or hypoplastic corpus callosum, and dysmorphic facies;OMIM #617260			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 27964749		False	3	100;0;0	2.156	True		ENSG00000163848	ENSG00000163848	HGNC:12933													
ZNF292	gene	ZNF292	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder, autosomal dominant 64	MIM#619188"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31723249		False	3	100;0;0	2.156	True		ENSG00000188994	ENSG00000188994	HGNC:18410													
ZNF335	gene	ZNF335	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 10, primary, autosomal recessive;OMIM #615095			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 23178126;27540107;29652087		False	3	100;0;0	2.156	True		ENSG00000198026	ENSG00000198026	HGNC:15807													
ZNF462	gene	ZNF462	Expert list;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Weiss-Kruszka syndrome, OMIM# 618619			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31361404;28513610		False	3	100;0;0	2.156	True		ENSG00000148143	ENSG00000148143	HGNC:21684													
ZNF526	gene	ZNF526	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dentici-Novelli neurodevelopmental syndrome, MIM# 619877			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21937992;25558065;33397746		False	3	100;0;0	2.156	True		ENSG00000167625	ENSG00000167625	HGNC:29415													
ZNF536	gene	ZNF536	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ZNF536-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42697193		False	3	100;0;0	2.156	True		ENSG00000198597	ENSG00000198597	HGNC:29025													
ZNF699	gene	ZNF699	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"DEGCAGS syndrome, MIM#	619488"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33875846		False	3	100;0;0	2.156	True		ENSG00000196110	ENSG00000196110	HGNC:24750													
ZNF711	gene	ZNF711	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 97, MIM# 300803			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27993705;19377476		False	3	100;0;0	2.156	True		ENSG00000147180	ENSG00000147180	HGNC:13128													
ZNHIT3	gene	ZNHIT3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PEHO syndrome, MIM# 260565			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28335020;28335020;31048081		False	3	100;0;0	2.156	True		-	ENSG00000273611	HGNC:12309													
ZNRF3	gene	ZNRF3	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39168120		False	3	100;0;0	2.156	True		ENSG00000183579	ENSG00000183579	HGNC:18126													
ZRSR2	gene	ZRSR2	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Orofaciodigital syndrome XXI, MIM# 301132			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38158857		False	3	100;0;0	2.156	True		ENSG00000169249	ENSG00000169249	HGNC:23019													
ZSCAN10	gene	ZSCAN10	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease MONDO:0002254			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38386308		False	3	100;0;0	2.156	True		ENSG00000130182	ENSG00000130182	HGNC:12997													
ZSWIM6	gene	ZSWIM6	Expert Review Green;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features, MIM#617865			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29198722		False	3	100;0;0	2.156	True		ENSG00000130449	ENSG00000130449	HGNC:29316													
AASS	gene	AASS	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperlysinemia, MIM# 238700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23570448		False	2	0;100;0	2.156	True		ENSG00000008311	ENSG00000008311	HGNC:17366													
ABCB7	gene	ABCB7	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Anaemia, sideroblastic, with ataxia, MIM# 301310			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11050011;26242992		False	2	0;100;0	2.156	False		ENSG00000131269	ENSG00000131269	HGNC:48													
ABI2	gene	ABI2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ABI2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40475134		False	2	0;100;0	2.156	True		ENSG00000138443	ENSG00000138443	HGNC:24011													
ACACA	gene	ACACA	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acetyl-CoA carboxylase deficiency, MIM# 613933			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34552920;10677481;16717184;36709796		False	2	0;100;0	2.156	True		-	ENSG00000278540	HGNC:84													
ACADS	gene	ACADS	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acyl-CoA dehydrogenase, short-chain, deficiency of, MIM# 201470			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000122971	ENSG00000122971	HGNC:90													
ACADSB	gene	ACADSB	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	2-methylbutyrylglycinuria, MIM# 610006			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000196177	ENSG00000196177	HGNC:91													
ACAT1	gene	ACAT1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alpha-methylacetoacetic aciduria, MIM# 203750			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000075239	ENSG00000075239	HGNC:93													
ADAM23	gene	ADAM23	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neonatal-onset developmental and epileptic encephalopathy, MONDO:0100455, ADAM23-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40455867		False	2	0;100;0	2.156	True		ENSG00000114948	ENSG00000114948	HGNC:202													
ADCY5	gene	ADCY5	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617		False	2	0;100;0	2.156	True		ENSG00000173175	ENSG00000173175	HGNC:236													
ADD1	gene	ADD1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092, ADD1-related;Intellectual disability, corpus callosum dysgenesis, and ventriculomegaly;no OMIM #			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34906466		False	2	50;50;0	2.156	True		ENSG00000087274	ENSG00000087274	HGNC:243													
AGPAT3	gene	AGPAT3	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO#0700092), AGPAT3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37821758		False	2	100;0;0	2.156	True		ENSG00000160216	ENSG00000160216	HGNC:326													
AKAP6	gene	AKAP6	Expert Review Amber;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, AKAP6-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28600779		False	2	0;100;0	2.156	True		ENSG00000151320	ENSG00000151320	HGNC:376													
ALDOA	gene	ALDOA	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease XII, MIM#611881			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000149925	ENSG00000149925	HGNC:414													
ALX1	gene	ALX1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Frontonasal dysplasia 3, MIM#613456			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27324866;20451171;23059813		False	2	0;100;0	2.156	True		ENSG00000180318	ENSG00000180318	HGNC:1494													
ALX3	gene	ALX3	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Frontonasal dysplasia 1, MIM#136760			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19409524		False	2	0;100;0	2.156	True		ENSG00000156150	ENSG00000156150	HGNC:449													
ALX4	gene	ALX4	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Frontonasal dysplasia 2, MIM# 613451			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19409524		False	2	0;100;0	2.156	True		ENSG00000052850	ENSG00000052850	HGNC:450													
ANAPC7	gene	ANAPC7	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ferguson-Bonni neurodevelopmental syndrome, MIM#	619699"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34942119		False	2	0;100;0	2.156	True		ENSG00000196510	ENSG00000196510	HGNC:17380													
AQP4	gene	AQP4	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Megalencephalic leukoencephalopathy with subcortical cysts 4, remitting MIM#620448			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37143309		False	2	0;100;0	2.156	True		ENSG00000171885	ENSG00000171885	HGNC:637													
ARHGAP31	gene	ARHGAP31	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Adams-Oliver syndrome 1, MIM#100300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000031081	ENSG00000031081	HGNC:29216													
ARHGEF40	gene	ARHGEF40	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 39838643		False	2	0;50;50	2.156	True		ENSG00000165801	ENSG00000165801	HGNC:25516													
ARNT2	gene	ARNT2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Webb-Dattani syndrome 615926			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24022475		False	2	0;100;0	2.156	True		ENSG00000172379	ENSG00000172379	HGNC:16876													
ASAP2	gene	ASAP2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, ASAP2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40770811;28191890;33057194;35982160		False	2	0;100;0	2.156	True		ENSG00000151693	ENSG00000151693	HGNC:2721													
ASTN2	gene	ASTN2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, ASTN2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28940097;34412080;27138430		False	2	0;100;0	2.156	True		ENSG00000148219	ENSG00000148219	HGNC:17021													
ATAD2B	gene	ATAD2B	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, ATAD2B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39313616		False	2	0;100;0	2.156	True		ENSG00000119778	ENSG00000119778	HGNC:29230													
ATM	gene	ATM	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Ataxia-telangiectasia, MIM#208900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000149311	ENSG00000149311	HGNC:795													
ATP11A	gene	ATP11A	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukodystrophy, hypomyelinating, 24 , MIM# 619851			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34403372		False	2	0;100;0	2.156	True	Other	ENSG00000068650	ENSG00000068650	HGNC:13552													
ATP13A2	gene	ATP13A2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome, MIM# 606693			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP5F1E	gene	ATP5F1E	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 3 MIM#614053			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34954817;20566710;27626380;20026007		False	2	0;100;0	2.156	True		ENSG00000124172	ENSG00000124172	HGNC:838													
ATP5MK	gene	ATP5MK	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 6 MIM#618683			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29917077;30240627;40014158		False	2	0;100;0	2.156	True		ENSG00000173915	ENSG00000173915	HGNC:30889													
ATP8B2	gene	ATP8B2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, ATP8B2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39219493		False	2	0;100;0	2.156	True		ENSG00000143515	ENSG00000143515	HGNC:13534													
ATXN2L	gene	ATXN2L	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	macrocephaly;intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33283965;33057194		False	2	0;100;0	2.156	True		ENSG00000168488	ENSG00000168488	HGNC:31326													
B3GALT6	gene	B3GALT6	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ehlers-Danlos syndrome, spondylodysplastic type, 2, MIM#615349;Spondyloepimetaphyseal dysplasia with joint laxity, type 1, with or without fractures, MIM#271640			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000176022	ENSG00000176022	HGNC:17978													
BAZ2B	gene	BAZ2B	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, BAZ2B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31999386;37872713		False	2	0;100;0	2.156	True		ENSG00000123636	ENSG00000123636	HGNC:963													
BBOX1	gene	BBOX1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carnitine deficiency, MONDO:0017716, BBOX1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41022783		False	2	0;100;0	2.156	True		ENSG00000129151	ENSG00000129151	HGNC:964													
BCORL1	gene	BCORL1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Shukla-Vernon syndrome, MIM#301029			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24123876;30941876		False	2	100;0;0	2.156	True		ENSG00000085185	ENSG00000085185	HGNC:25657													
BRIP1	gene	BRIP1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fanconi anaemia, complementation group J, MIM# 609054			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000136492	ENSG00000136492	HGNC:20473													
BUB1	gene	BUB1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Primary microcephaly-30 (MCPH30), MIM#620183			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35044816;19772675;19117986;23209306		False	2	50;50;0	2.156	True		ENSG00000169679	ENSG00000169679	HGNC:1148													
CACNA2D1	gene	CACNA2D1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 110, MIM# 620149			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35293990		False	2	67;33;0	2.156	True		ENSG00000153956	ENSG00000153956	HGNC:1399													
CACNB4	gene	CACNB4	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	intellectual disability;psychomotor retardation;blindness;epilepsy;movement disorder;cerebellar atrophy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32176688		False	2	0;100;0	2.156	True		ENSG00000182389	ENSG00000182389	HGNC:1404													
CAMK2G	gene	CAMK2G	Expert Review;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder, autosomal dominant 59 MIM#	618522"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30184290;23033978		False	2	0;100;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000148660	ENSG00000148660	HGNC:1463													
CCDC174	gene	CCDC174	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, infantile, with psychomotor retardation - IHPMR, 616816			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26358778		False	2	0;100;0	2.156	True	Other	ENSG00000154781	ENSG00000154781	HGNC:28033													
CCDC78	gene	CCDC78	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Centronuclear myopathy 4, MIM#614807			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22818856		False	2	0;100;0	2.156	True		ENSG00000162004	ENSG00000162004	HGNC:14153													
CD96	gene	CD96	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	C syndrome, MIM#211750			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17847009		False	2	0;100;0	2.156	True		ENSG00000153283	ENSG00000153283	HGNC:16892													
CDK9	gene	CDK9	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	multiple congenital anomalies/dysmorphic syndrome-variable intellectual disability syndrome MONDO:0015160;CHARGE-like syndrome with retinal dystrophy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33640901;30237576;26633546		False	2	0;100;0	2.156	True		ENSG00000136807	ENSG00000136807	HGNC:1780													
CDKL2	gene	CDKL2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CDKL2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40088891		False	2	0;100;0	2.156	True	Other	ENSG00000138769	ENSG00000138769	HGNC:1782													
CDKN1C	gene	CDKN1C	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	IMAGE syndrome, MIM# 614732			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000129757	ENSG00000129757	HGNC:1786													
CDO1	gene	CDO1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disease, MONDO:0002254, CDO1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39949058		False	2	0;100;0	2.156	True		ENSG00000129596	ENSG00000129596	HGNC:1795													
CENATAC	gene	CENATAC	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mosaic variegated aneuploidy syndrome 4 (MIM#620153)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34009673		False	2	0;100;0	2.156	True		ENSG00000186166	ENSG00000186166	HGNC:30460													
CEP63	gene	CEP63	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seckel syndrome 6, MIM#614728			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21983783;26158450		False	2	0;100;0	2.156	True		ENSG00000182923	ENSG00000182923	HGNC:25815													
CEP89	gene	CEP89	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23575228		False	2	0;100;0	2.156	True		ENSG00000121289	ENSG00000121289	HGNC:25907													
CFAP418	gene	CFAP418	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 21, MIM#617406			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26854863;27008867		False	2	0;100;0	2.156	True		ENSG00000156172	ENSG00000156172	HGNC:27232													
CHMP3	gene	CHMP3	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary spastic paraplegia (MONDO:0019064), CHMP3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35710109		False	2	0;100;0	2.156	True		ENSG00000115561	ENSG00000115561	HGNC:29865													
CHRM1	gene	CHRM1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental delay;intellectual disability;autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34212451;31981491;12483218		False	2	0;100;0	2.156	True		ENSG00000168539	ENSG00000168539	HGNC:1950													
CHST14	gene	CHST14	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ehlers-Danlos syndrome, musculocontractural type 1, MIM#601776			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25703627		False	2	0;100;0	2.156	True		ENSG00000169105	ENSG00000169105	HGNC:24464													
CLCN2	gene	CLCN2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with ataxia, MIM#615651			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23707145		False	2	0;100;0	2.156	True		ENSG00000114859	ENSG00000114859	HGNC:2020													
CLCN7	gene	CLCN7	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypopigmentation, organomegaly, and delayed myelination and development, MIM# 618541			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31155284		False	2	0;100;0	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000103249	ENSG00000103249	HGNC:2025													
CNKSR1	gene	CNKSR1	Expert Review;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, CNKSR1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30450701;30237576;21937992		False	2	0;100;0	2.156	True		ENSG00000142675	ENSG00000142675	HGNC:19700													
COG3	gene	COG3	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIbb, MIM# 620546			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37711075		False	2	0;100;0	2.156	True		ENSG00000136152	ENSG00000136152	HGNC:18619													
COQ2	gene	COQ2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 1, MIM#607426			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000173085	ENSG00000173085	HGNC:25223													
COQ9	gene	COQ9	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 5, MIM#614654			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000088682	ENSG00000088682	HGNC:25302													
COX14	gene	COX14	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 10, MIM#619053			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22243966		False	2	0;100;0	2.156	True		ENSG00000178449	ENSG00000178449	HGNC:28216													
COX20	gene	COX20	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, MIM#220110			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31079202;30656193;24202787		False	2	0;0;100	2.156	True		ENSG00000203667	ENSG00000203667	HGNC:26970													
COX7B	gene	COX7B	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Linear skin defects with multiple congenital anomalies 2, MIM#300887			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23122588		False	2	0;100;0	2.156	True		ENSG00000131174	ENSG00000131174	HGNC:2291													
CRBN	gene	CRBN	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 2, MIM# 607417			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15557513;28143899		False	2	0;100;0	2.156	True		ENSG00000113851	ENSG00000113851	HGNC:30185													
CSF1R	gene	CSF1R	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain abnormalities, neurodegeneration, and dysosteosclerosis, MIM# 618476;BANDDOS			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30982609;33749994;34135456		False	2	0;100;0	2.156	True		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSMD2	gene	CSMD2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, CSMD2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40632521;31068362;38649688		False	2	0;50;50	2.156	True		ENSG00000121904	ENSG00000121904	HGNC:19290													
CSNK1G1	gene	CSNK1G1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, CSNK1G-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33009664		False	2	0;100;0	2.156	True		ENSG00000169118	ENSG00000169118	HGNC:2454													
CSTF2	gene	CSTF2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 113, MIM# 301116			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32816001		False	2	0;100;0	2.156	True		ENSG00000101811	ENSG00000101811	HGNC:2484													
CTC1	gene	CTC1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000178971	ENSG00000178971	HGNC:26169													
CTNND1	gene	CTNND1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Blepharocheilodontic syndrome 2, MIM# 617681			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28301459;32196547		False	2	0;100;0	2.156	True		ENSG00000198561	ENSG00000198561	HGNC:2515													
DCAF15	gene	DCAF15	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cornelia de Lange syndrome, MONDO:0016033, DCAF15-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000132017	ENSG00000132017	HGNC:25095													
DCTN4	gene	DCTN4	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, DCTN4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42378292		False	2	0;100;0	2.156	True		ENSG00000132912	ENSG00000132912	HGNC:15518													
DDX1	gene	DDX1	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, DDX1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000079785	ENSG00000079785	HGNC:2734													
DENR	gene	DENR	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, DENR-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27239039		False	2	0;100;0	2.156	True		ENSG00000139726	ENSG00000139726	HGNC:2769													
DHTKD1	gene	DHTKD1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	2-aminoadipic 2-oxoadipic aciduria MIM#204750;Disorders of histidine, tryptophan or lysine metabolism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23141293;37499576;1112064;6434826;4442872;4430147		False	2	0;100;0	2.156	True		ENSG00000181192	ENSG00000181192	HGNC:23537													
DHX32	gene	DHX32	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, DHX32-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 32989326		False	2	0;100;0	2.156	True		ENSG00000089876	ENSG00000089876	HGNC:16717													
DHX36	gene	DHX36	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, DHX36-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True	Other	ENSG00000174953	ENSG00000174953	HGNC:14410													
DLG2	gene	DLG2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual disability (MONDO#0001071), DLG2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37860969		False	2	0;100;0	2.156	True		ENSG00000150672	ENSG00000150672	HGNC:2901													
DLGAP1	gene	DLGAP1	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, DLGAP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000170579	ENSG00000170579	HGNC:2905													
DMRTA2	gene	DMRTA2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, MONDO:0001149, DMRTA2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40541527;26757254		False	2	0;100;0	2.156	True		ENSG00000142700	ENSG00000142700	HGNC:13908													
DNAJA3	gene	DNAJA3	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, DNAJA3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34750646;30770860		False	2	0;100;0	2.156	True		ENSG00000103423	ENSG00000103423	HGNC:11808													
DPYD	gene	DPYD	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dihydropyrimidine dehydrogenase deficiency (MIM#274270)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10071185;25565930;30349988;28275972;17065071;21114665;22003227;28123791		False	2	0;100;0	2.156	True		ENSG00000188641	ENSG00000188641	HGNC:3012													
DPYSL2	gene	DPYSL2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	intellectual disability, MONDO:0001071, DPYSL2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27249678;35861646		False	2	0;100;0	2.156	True		ENSG00000092964	ENSG00000092964	HGNC:3014													
DROSHA	gene	DROSHA	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO#0700092), DROSHA-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35405010		False	2	0;100;0	2.156	True		ENSG00000113360	ENSG00000113360	HGNC:17904													
EIF2A	gene	EIF2A	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability, epilepsy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31130284		False	2	0;100;0	2.156	True		ENSG00000144895	ENSG00000144895	HGNC:3254													
EIF3I	gene	EIF3I	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000084623	ENSG00000084623	HGNC:3272													
EIF3K	gene	EIF3K	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	EIF3K-related neurodevelopmental disorder,  MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40219605		False	2	0;100;0	2.156	True		ENSG00000178982	ENSG00000178982	HGNC:24656													
EMG1	gene	EMG1	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bowen-Conradi syndrome, MIM#211180			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19463982;27798105;26676230;25708872		False	2	0;100;0	2.156	True		ENSG00000126749	ENSG00000126749	HGNC:16912													
EMX2	gene	EMX2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder - MONDO:0100038, EMX2-related;Hypogonadotropic hypogonadism, MONDO:0015770, EMX2-related;DSD, EMX2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41765865;34829455;33434492;25577462		False	2	50;0;50	2.156	True		ENSG00000170370	ENSG00000170370	HGNC:3341													
EPHA7	gene	EPHA7	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092,EPHA7-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34176129		False	2	0;100;0	2.156	True		ENSG00000135333	ENSG00000135333	HGNC:3390													
ERBB4	gene	ERBB4	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33603162		False	2	100;0;0	2.156	True		ENSG00000178568	ENSG00000178568	HGNC:3432													
ERGIC3	gene	ERGIC3	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33710394;31585110		False	2	0;100;0	2.156	True		ENSG00000125991	ENSG00000125991	HGNC:15927													
EXOC2	gene	EXOC2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with dysmorphic facies and cerebellar hypoplasia, MIM# 619306;Global developmental delay;Intellectual disability;Abnormality of the face;Abnormality of brain morphology			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32639540		False	2	0;100;0	2.156	True		ENSG00000112685	ENSG00000112685	HGNC:24968													
EXOSC10	gene	EXOSC10	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microcephaly, MONDO:0001149,  EXOSC10-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41132091		False	2	0;100;0	2.156	True		ENSG00000171824	ENSG00000171824	HGNC:9138													
EXOSC2	gene	EXOSC2	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short stature, hearing loss, retinitis pigmentosa, and distinctive facies, MIM# 617763			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26843489;31628467;36344539;36069504		False	2	0;100;0	2.156	True		ENSG00000130713	ENSG00000130713	HGNC:17097													
EXOSC4	gene	EXOSC4	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39009343;37961665;36344539		False	2	0;100;0	2.156	True		ENSG00000178896	ENSG00000178896	HGNC:18189													
FANCB	gene	FANCB	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fanconi anemia, complementation group B, MIM# 300514			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000181544	ENSG00000181544	HGNC:3583													
FANCD2	gene	FANCD2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Fanconi anemia, complementation group D2, MIM#	227646"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000144554	ENSG00000144554	HGNC:3585													
FANCG	gene	FANCG	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fanconi anemia, complementation group G, MIM# 614082			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000221829	ENSG00000221829	HGNC:3588													
FEM1C	gene	FEM1C	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, FEM1C-related MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36336956;28135719;33398170;33398168		False	2	50;50;0	2.156	True		ENSG00000145780	ENSG00000145780	HGNC:16933													
FGFR2	gene	FGFR2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, MIM# 207410;Apert syndrome, MIM# 101200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000066468	ENSG00000066468	HGNC:3689													
FIBCD1	gene	FIBCD1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, FIBCD1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35916241		False	2	0;100;0	2.156	True		ENSG00000130720	ENSG00000130720	HGNC:25922													
FICD	gene	FICD	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, FICD-related (MONDO#0700092)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36704923		False	2	0;100;0	2.156	True		ENSG00000198855	ENSG00000198855	HGNC:18416													
FKBP4	gene	FKBP4	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000004478	ENSG00000004478	HGNC:3720													
FOXR1	gene	FOXR1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Postnatal microcephaly, progressive brain atrophy and global developmental delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34723967		False	2	0;100;0	2.156	True		ENSG00000176302	ENSG00000176302	HGNC:29980													
FRMD4A	gene	FRMD4A	Expert Review;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;microcephaly;Corpus callosum, agenesis of, with facial anomalies and cerebellar ataxia, MIM# 616819			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25388005;30214071;34869127		False	2	50;50;0	2.156	True		ENSG00000151474	ENSG00000151474	HGNC:25491													
FRY	gene	FRY	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sensorineural hearing loss disorder, MONDO:0020678;Neurodevelopmental disorder, MONDO:0700092, FRY-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31487712, 27457812, 21937992, 33098347		False	2	0;100;0	2.156	True		ENSG00000073910	ENSG00000073910	HGNC:20367													
FRYL	gene	FRYL	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Pan-Chung-Bellen syndrome, MIM# 621049			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38479391		False	2	50;50;0	2.156	True		ENSG00000075539	ENSG00000075539	HGNC:29127													
FTCD	gene	FTCD	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutamate formiminotransferase deficiency MIM#229100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	http://iembase.com/disorder/47;29178637;30740726		False	2	0;100;0	2.156	True		ENSG00000160282	ENSG00000160282	HGNC:3974													
GBA1	gene	GBA1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Gaucher disease, type II 230900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GLYCTK	gene	GLYCTK	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-glyceric aciduria MONDO:0009070			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31837836;3588091;30637540;28462797;20949620;28190537		False	2	0;100;0	2.156	True		ENSG00000168237	ENSG00000168237	HGNC:24247													
GMNN	gene	GMNN	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Meier-Gorlin syndrome 6, MIM#	616835"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26637980		False	2	0;100;0	2.156	True		ENSG00000112312	ENSG00000112312	HGNC:17493													
GNAQ	gene	GNAQ	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Sturge-Weber syndrome, somatic, mosaic, MIM#185300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000156052	ENSG00000156052	HGNC:4390													
GORAB	gene	GORAB	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Geroderma osteodysplasticum, MIM#231070			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000120370	ENSG00000120370	HGNC:25676													
GPN2	gene	GPN2	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038;Perrault syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000142751	ENSG00000142751	HGNC:25513													
GTF3C1	gene	GTF3C1	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, GTF3C1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000077235	ENSG00000077235	HGNC:4664													
H4C11	gene	H4C11	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tessadori-van Haaften neurodevelopmental syndrome 2 , MIM# 619759			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31804630;35202563		False	2	0;100;0	2.156	True		ENSG00000197238	ENSG00000197238	HGNC:4785													
H4C4	gene	H4C4	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, HIST1H4D-related MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35202563		False	2	0;100;0	2.156	True		-	ENSG00000277157	HGNC:4782													
H4C6	gene	H4C6	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, HIST1H4F-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35202563		False	2	0;100;0	2.156	True		-	ENSG00000274618	HGNC:4783													
HARS1	gene	HARS1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	multisystem ataxic syndrome;mild-severe intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32333447		False	2	0;100;0	2.156	True		ENSG00000170445	ENSG00000170445	HGNC:4816													
HAX1	gene	HAX1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neutropenia, severe congenital 3, autosomal recessive, MIM# 610738			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000143575	ENSG00000143575	HGNC:16915													
HEATR3	gene	HEATR3	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bone marrow failure, short stature, facial and acromelic dysmorphic features, and mild intellectual disability;Diamond-Blackfan anaemia 21, MIM# 620072			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35213692		False	2	0;100;0	2.156	True		ENSG00000155393	ENSG00000155393	HGNC:26087													
HEATR5B	gene	HEATR5B	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia MONDO:0020135, HEATR5B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33824466		False	2	0;100;0	2.156	True		ENSG00000008869	ENSG00000008869	HGNC:29273													
HSPA9	gene	HSPA9	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Even-plus syndrome, MONDO:0014801			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32869452;26598328		False	2	0;100;0	2.156	True		ENSG00000113013	ENSG00000113013	HGNC:5244													
HTT	gene	HTT	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lopes-Maciel-Rodan syndrome, 617435;LOMARS;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26740508;27329733;33432339		False	2	0;100;0	2.156	True		ENSG00000197386	ENSG00000197386	HGNC:4851													
HYLS1	gene	HYLS1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hydrolethalus syndrome, MIM#236680			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000198331	ENSG00000198331	HGNC:26558													
ICE1	gene	ICE1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability, cerebral atrophy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31130284		False	2	0;100;0	2.156	True		ENSG00000164151	ENSG00000164151	HGNC:29154													
IKZF2	gene	IKZF2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Immunodysregulation, craniofacial anomalies, hearing impairment, athelia, and developmental delay, MIM# 621234			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37316189		False	2	0;100;0	2.156	True		ENSG00000030419	ENSG00000030419	HGNC:13177													
IMPA1	gene	IMPA1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 59, MIM#617323			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26416544;30616629		False	2	0;100;0	2.156	True		ENSG00000133731	ENSG00000133731	HGNC:6050													
IQSEC3	gene	IQSEC3	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;Fetal akinesia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32049026;31130284;31680123		False	2	0;100;0	2.156	True		ENSG00000120645	ENSG00000120645	HGNC:29193													
IRF2BP1	gene	IRF2BP1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, IRF2BP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38091987;37501076		False	2	0;100;0	2.156	True		ENSG00000170604	ENSG00000170604	HGNC:21728													
IRS1	gene	IRS1	Expert Review Amber;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO: 0002254, IRS1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;50;50	2.156	True		ENSG00000169047	ENSG00000169047	HGNC:6125													
ITCH	gene	ITCH	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autoimmune disease, multisystem, with facial dysmorphism, MIM#613385			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20170897;31091003		False	2	0;100;0	2.156	True		ENSG00000078747	ENSG00000078747	HGNC:13890													
ITGA7	gene	ITGA7	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, congenital, due to ITGA7 deficiency, MIM# 613204			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9590299		False	2	0;100;0	2.156	True		ENSG00000135424	ENSG00000135424	HGNC:6143													
JAKMIP1	gene	JAKMIP1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO#0700092), JAKMIP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29158550;26627310;27799067		False	2	0;100;0	2.156	True		ENSG00000152969	ENSG00000152969	HGNC:26460													
JPH3	gene	JPH3	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, JPH3-related;Intellectual disability;dystonia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33824468;36273396		False	2	0;50;50	2.156	True		ENSG00000154118	ENSG00000154118	HGNC:14203													
KCNJ1	gene	KCNJ1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bartter syndrome, type 2, MIM#241200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000151704	ENSG00000151704	HGNC:6255													
KCNK3	gene	KCNK3	Expert Review;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, KCNK3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194		False	2	50;50;0	2.156	True		ENSG00000171303	ENSG00000171303	HGNC:6278													
KDM8	gene	KDM8	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36795492		False	2	0;100;0	2.156	False		ENSG00000155666	ENSG00000155666	HGNC:25840													
KGD4	gene	KGD4	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 41018056;38685873		False	2	0;100;0	2.156	True		ENSG00000134056	ENSG00000134056	HGNC:16631													
KIF21A	gene	KIF21A	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Fibrosis of extraocular muscles, congenital, 1/3B, MIM#135700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37921537;39643435;41282472;32141982;24715754;36494820;22699964		False	2	0;50;50	2.156	True		ENSG00000139116	ENSG00000139116	HGNC:19349													
KIF5A	gene	KIF5A	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 10, autosomal dominant, MIM# 604187;inherited neurodegenerative disorder MONDO:0024237			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18853458		False	2	0;100;0	2.156	True		ENSG00000155980	ENSG00000155980	HGNC:6323													
LDB1	gene	LDB1	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, LDB1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000198728	ENSG00000198728	HGNC:6532													
LGALS3BP	gene	LGALS3BP	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37205765;34728600		False	2	0;100;0	2.156	False		ENSG00000108679	ENSG00000108679	HGNC:6564													
LINGO1	gene	LINGO1	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 64, MIM#618103			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28837161		False	2	0;100;0	2.156	True		ENSG00000169783	ENSG00000169783	HGNC:21205													
LIPT2	gene	LIPT2	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM#617668			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28757203		False	2	0;100;0	2.156	True		ENSG00000175536	ENSG00000175536	HGNC:37216													
LRP1	gene	LRP1	Expert Review Amber;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092;Syndromic disease, MONDO:0002254;developmental dysplasia of the hip 3, MONDO:0958037;keratosis pilaris atrophicans, MONDO:0018855;?Keratosis pilaris atrophicans, MIM#604093;Developmental dysplasia of the hip 3, MIM#620690			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42649465;40374006;36307211;36067312;33776059;26142438		False	2	0;100;0	2.156	True		ENSG00000123384	ENSG00000123384	HGNC:6692													
LRRC32	gene	LRRC32	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cleft palate, proliferative retinopathy, and developmental delay (CPPRDD) syndrome, MIM# 619074			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30976112;41041957		False	2	0;100;0	2.156	True		ENSG00000137507	ENSG00000137507	HGNC:4161													
LRRC45	gene	LRRC45	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092, LRRC45-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39638757		False	2	0;100;0	2.156	True		ENSG00000169683	ENSG00000169683	HGNC:28302													
LRRC8C	gene	LRRC8C	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	TIMES syndrome MIM#621056			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39623139		False	2	0;100;0	2.156	True	Other	ENSG00000171488	ENSG00000171488	HGNC:25075													
LYST	gene	LYST	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chediak-Higashi syndrome, MIM#214500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000143669	ENSG00000143669	HGNC:1968													
MACROH2A1	gene	MACROH2A1	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, MACROH2A1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000113648	ENSG00000113648	HGNC:4740													
MAGED1	gene	MAGED1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder, MONDO:0700092, MAGED1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42162770		False	2	0;100;0	2.156	False		ENSG00000179222	ENSG00000179222	HGNC:6813													
MAL	gene	MAL	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 28, MIM#  620978			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35217805		False	2	0;100;0	2.156	True		ENSG00000172005	ENSG00000172005	HGNC:6817													
MAN2A2	gene	MAN2A2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, MONDO:0015286, MAN2A2-reated			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36357165;40628855		False	2	0;100;0	2.156	True		ENSG00000196547	ENSG00000196547	HGNC:6825													
MANF	gene	MANF	Expert Review;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Diabetes, deafness, developmental delay, and short stature syndrome, MIM# 620651			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26077850;33500254;34815294		False	2	0;100;0	2.156	True		ENSG00000145050	ENSG00000145050	HGNC:15461													
MCCC1	gene	MCCC1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-Methylcrotonyl-CoA carboxylase 1 deficiency MIM#210200;Organic acidurias			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36822454;31730530		False	2	0;100;0	2.156	True		ENSG00000078070	ENSG00000078070	HGNC:6936													
MCCC2	gene	MCCC2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-Methylcrotonyl-CoA carboxylase 2 deficiency (MIM#210210)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34899149		False	2	0;100;0	2.156	True		ENSG00000131844	ENSG00000131844	HGNC:6937													
MDGA1	gene	MDGA1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, MDGA1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41862769;40585099		False	2	0;100;0	2.156	True		ENSG00000112139	ENSG00000112139	HGNC:19267													
MED20	gene	MED20	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, MED20-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25446406;10.21203/rs.3.rs-9516499/v1		False	2	0;100;0	2.156	True		ENSG00000124641	ENSG00000124641	HGNC:16840													
MED22	gene	MED22	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000148297	ENSG00000148297	HGNC:11477													
MED29	gene	MED29	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, MONDO:0020135, MED29-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40745490		False	2	0;100;0	2.156	True		ENSG00000063322	ENSG00000063322	HGNC:23074													
MGA	gene	MGA	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disease, MONDO:0002254, MGA-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39600096;20044811		False	2	0;100;0	2.156	True		ENSG00000174197	ENSG00000174197	HGNC:14010													
MIDEAS	gene	MIDEAS	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ELMSAN1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000156030	ENSG00000156030	HGNC:19853													
MIR17HG	gene	MIR17HG	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Feingold syndrome 2;OMIM #614326			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 25391829;21892160;29636449		False	2	50;50;0	2.156	True		ENSG00000215417	ENSG00000215417	HGNC:23564													
MMGT1	gene	MMGT1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, MMGT1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194		False	2	0;100;0	2.156	True		ENSG00000169446	ENSG00000169446	HGNC:28100													
MOCS3	gene	MOCS3	Expert Review;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency, type B2, MIM# 621373			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33897766;28544736		False	2	0;100;0	2.156	True		ENSG00000124217	ENSG00000124217	HGNC:15765													
MRPL3	gene	MRPL3	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 9;OMIM #614582			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 27815843;21786366		False	2	0;100;0	2.156	True		ENSG00000114686	ENSG00000114686	HGNC:10379													
MRTFB	gene	MRTFB	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), MKL2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37013900		False	2	0;100;0	2.156	True	Other	ENSG00000186260	ENSG00000186260	HGNC:29819													
MTERF3	gene	MTERF3	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease (MONDO:0044970), MTERF3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40543543		False	2	0;100;0	2.156	True		ENSG00000156469	ENSG00000156469	HGNC:24258													
MTNAP1	gene	MTNAP1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41720819		False	2	0;100;0	2.156	True		ENSG00000141219	ENSG00000141219	HGNC:29601													
NAV2	gene	NAV2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, NAV2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID:35218524		False	2	0;100;0	2.156	True		ENSG00000166833	ENSG00000166833	HGNC:15997													
NBN	gene	NBN	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Nijmegen breakage syndrome, MIM# 251260			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000104320	ENSG00000104320	HGNC:7652													
NCAPG2	gene	NCAPG2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Khan-Khan-Katsanis syndrome, MIM# 618460			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30609410		False	2	50;50;0	2.156	True		ENSG00000146918	ENSG00000146918	HGNC:21904													
NDUFA10	gene	NDUFA10	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 22, MIM#618243			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21150889;26741492		False	2	0;100;0	2.156	True		ENSG00000130414	ENSG00000130414	HGNC:7684													
NDUFA11	gene	NDUFA11	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 14, MIM#618236			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18306244;31074871		False	2	0;100;0	2.156	True		ENSG00000174886	ENSG00000174886	HGNC:20371													
NDUFA8	gene	NDUFA8	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 37- 619272;Epilepsy;Microcephaly;Developmental Delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32385911;33153867		False	2	0;100;0	2.156	True		ENSG00000119421	ENSG00000119421	HGNC:7692													
NDUFA9	gene	NDUFA9	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 26, MIM#618247			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28671271;22114105		False	2	0;100;0	2.156	True		ENSG00000139180	ENSG00000139180	HGNC:7693													
NDUFAF2	gene	NDUFAF2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 10, MIM#618233			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18180188;20571988;19384974;16200211		False	2	0;100;0	2.156	True		ENSG00000164182	ENSG00000164182	HGNC:28086													
NDUFAF3	gene	NDUFAF3	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 18, MIM#618240			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19463981		False	2	0;100;0	2.156	True		ENSG00000178057	ENSG00000178057	HGNC:29918													
NDUFAF4	gene	NDUFAF4	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 15, MIM#618237			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18179882;28853723		False	2	0;100;0	2.156	True		ENSG00000123545	ENSG00000123545	HGNC:21034													
NDUFAF5	gene	NDUFAF5	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 16, MIM# 618238			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19542079;21607760;18940309		False	2	0;100;0	2.156	True		ENSG00000101247	ENSG00000101247	HGNC:15899													
NDUFAF6	gene	NDUFAF6	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 17, MIM#618239			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26741492;18614015		False	2	0;100;0	2.156	True		ENSG00000156170	ENSG00000156170	HGNC:28625													
NDUFB3	gene	NDUFB3	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 25, MIM#618246			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22277967;22499348;27091925		False	2	0;100;0	2.156	True		ENSG00000119013	ENSG00000119013	HGNC:7698													
NDUFB9	gene	NDUFB9	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 24, MIM#618245			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22200994;38129218		False	2	0;100;0	2.156	True		ENSG00000147684	ENSG00000147684	HGNC:7704													
NDUFS2	gene	NDUFS2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 6, MIM#618228			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11220739;31411514;29272804		False	2	0;100;0	2.156	True		ENSG00000158864	ENSG00000158864	HGNC:7708													
NDUFS3	gene	NDUFS3	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 8, MIM#618230			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	14729820;22499348;30140060		False	2	0;100;0	2.156	True		ENSG00000213619	ENSG00000213619	HGNC:7710													
NDUFS6	gene	NDUFS6	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 9, MIM#618232			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15372108;19259137;30948790;22474353		False	2	0;100;0	2.156	True		ENSG00000145494	ENSG00000145494	HGNC:7713													
NDUFV2	gene	NDUFV2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 7, MIM#618229			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12754703;26008862;29554876		False	2	0;100;0	2.156	True		ENSG00000178127	ENSG00000178127	HGNC:7717													
NECAP1	gene	NECAP1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 21, MIM#615833			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24399846;30626896;30525121		False	2	100;0;0	2.156	True		ENSG00000089818	ENSG00000089818	HGNC:24539													
NFXL1	gene	NFXL1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease (MONDO:0002254), NFXL1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40430072;41024252		False	2	0;100;0	2.156	True		ENSG00000170448	ENSG00000170448	HGNC:18726													
NHP2	gene	NHP2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dyskeratosis congenita, autosomal recessive 2, MIM# 613987;H yeraal-Hreidarsson syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18523010;31985013		False	2	0;100;0	2.156	True		ENSG00000145912	ENSG00000145912	HGNC:14377													
NLGN1	gene	NLGN1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092;autism, susceptibility to, 20, MONDO:0030004			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30460678;38739110;28841651		False	2	0;50;50	2.156	True		ENSG00000169760	ENSG00000169760	HGNC:14291													
NLGN2	gene	NLGN2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, NLGN2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37506563;32405903;27865048;22820233		False	2	0;100;0	2.156	True		ENSG00000169992	ENSG00000169992	HGNC:14290													
NMNAT1	gene	NMNAT1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spondyloepiphyseal dysplasia, sensorineural hearing loss, intellectual disability, and Leber congenital amaurosis (SHILCA), MIM#619260			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32533184;33668384		False	2	0;100;0	2.156	True		ENSG00000173614	ENSG00000173614	HGNC:17877													
NUAK1	gene	NUAK1	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO: 0002254			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000074590	ENSG00000074590	HGNC:14311													
NUBP2	gene	NUBP2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39867373		False	2	0;100;0	2.156	False		ENSG00000095906	ENSG00000095906	HGNC:8042													
NUP85	gene	NUP85	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34170319;30179222		False	2	0;100;0	2.156	True		ENSG00000125450	ENSG00000125450	HGNC:8734													
PAICS	gene	PAICS	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PAICS deficiency, MONDO:0859003;Phosphoribosylaminoimidazole carboxylase deficiency, MIM:619859;Disorders of purine metabolism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31600779;42569864;39726239;39604553		False	2	0;100;0	2.156	True		ENSG00000128050	ENSG00000128050	HGNC:8587													
PCNA	gene	PCNA	ClinGen;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary ataxia MONDO:0100309			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24911150, 33426167, 36990216		False	2	0;100;0	2.156	True		ENSG00000132646	ENSG00000132646	HGNC:8729													
PCNT	gene	PCNT	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephalic osteodysplastic primordial dwarfism, type II MIM#210720			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34978779		False	2	0;100;0	2.156	True		ENSG00000160299	ENSG00000160299	HGNC:16068													
PDE2A	gene	PDE2A	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Paroxysmal dyskinesia;Intellectual developmental disorder with paroxysmal dyskinesia or seizures, MIM# 619150			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32467598;32196122;29392776		False	2	50;50;0	2.156	True		ENSG00000186642	ENSG00000186642	HGNC:8777													
PEDS1	gene	PEDS1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, PEDS1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41491239		False	2	0;100;0	2.156	True		ENSG00000240849	ENSG00000240849	HGNC:16735													
PFAS	gene	PFAS	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Inborn error of metabolism, MONDO:0019052, PFAS-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40421664		False	2	0;100;0	2.156	True		ENSG00000178921	ENSG00000178921	HGNC:8863													
PHACTR4	gene	PHACTR4	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disease, MONDO:0002254, PHACTR4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40012205		False	2	0;100;0	2.156	True		ENSG00000204138	ENSG00000204138	HGNC:25793													
PHC1	gene	PHC1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 11, primary, autosomal recessive, MIM#615414			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23418308		False	2	0;100;0	2.156	True		ENSG00000111752	ENSG00000111752	HGNC:3182													
PIEZO2	gene	PIEZO2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Marden-Walker syndrome, MIM# 248700;Arthrogryposis, distal, type 3, MIM# 114300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24726473		False	2	0;100;0	2.156	True		ENSG00000154864	ENSG00000154864	HGNC:26270													
PIGU	gene	PIGU	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 21;OMIM #618590			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31353022		False	2	50;50;0	2.156	True		ENSG00000101464	ENSG00000101464	HGNC:15791													
PIGY	gene	PIGY	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 6, MIM# 616809			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26293662		False	2	0;100;0	2.156	True		ENSG00000255072	ENSG00000255072	HGNC:28213													
PJA1	gene	PJA1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	X-linked complex neurodevelopmental disorder, PJA1-related, MONDO:0100148			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32530565		False	2	0;100;0	2.156	True		ENSG00000181191	ENSG00000181191	HGNC:16648													
PLCH1	gene	PLCH1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Holoprosencephaly 14, MIM# 619895			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33820834		False	2	0;100;0	2.156	True		ENSG00000114805	ENSG00000114805	HGNC:29185													
PLEKHG2	gene	PLEKHG2	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy and acquired microcephaly with or without dystonia, 616763			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26539891;24001768;26573021		False	2	0;100;0	2.156	True		ENSG00000090924	ENSG00000090924	HGNC:29515													
PLOD3	gene	PLOD3	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysyl hydroxylase 3 deficiency, MIM#612394			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18834968;31129566;30237576;30463024		False	2	0;100;0	2.156	True		ENSG00000106397	ENSG00000106397	HGNC:9083													
PLXNA2	gene	PLXNA2	Expert Review Amber;Literature;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder, PLXNA2-related, MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34327814		False	2	0;100;0	2.156	True		ENSG00000076356	ENSG00000076356	HGNC:9100													
PPM1K	gene	PPM1K	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Maple syrup urine disease, mild variant, MIM#615135			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23086801;36706222		False	2	0;100;0	2.156	True		ENSG00000163644	ENSG00000163644	HGNC:25415													
PPP1R3F	gene	PPP1R3F	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37531237		False	2	50;50;0	2.156	True		ENSG00000049769	ENSG00000049769	HGNC:14944													
PPP2R2B	gene	PPP2R2B	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, PPP2R2B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25356899;39565297		False	2	0;100;0	2.156	True		ENSG00000156475	ENSG00000156475	HGNC:9305													
PPP5C	gene	PPP5C	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, PPP5C-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35361529;25363768;33057194;40172746		False	2	0;100;0	2.156	True		ENSG00000011485	ENSG00000011485	HGNC:9322													
PREP	gene	PREP	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), PREP-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42362369		False	2	0;100;0	2.156	True		ENSG00000085377	ENSG00000085377	HGNC:9358													
PRICKLE2	gene	PRICKLE2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, PRICKLE2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34092786;21276947;26942291;26942292		False	2	50;50;0	2.156	True		ENSG00000163637	ENSG00000163637	HGNC:20340													
PRKD1	gene	PRKD1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital heart defects and ectodermal dysplasia, 617364			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32817298;27479907		False	2	50;50;0	2.156	True		ENSG00000184304	ENSG00000184304	HGNC:9407													
PRODH	gene	PRODH	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperprolinemia, type I MIM#239500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17412540;12217952		False	2	50;50;0	2.156	True		ENSG00000100033	ENSG00000100033	HGNC:9453													
PRORP	gene	PRORP	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 54, MIM# 619737			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 34715011		False	2	0;50;50	2.156	True		ENSG00000100890	ENSG00000100890	HGNC:19958													
PRRT2	gene	PRRT2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Convulsions, familial infantile, with paroxysmal choreoathetosis, MIM# 602066;Episodic kinesigenic dyskinesia 1, MIM# 128200;Seizures, benign familial infantile, 2, MIM# 605751;intellectual disability, autosomal recessive			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23352743;25595153;23398397		False	2	0;100;0	2.156	True		ENSG00000167371	ENSG00000167371	HGNC:30500													
PRSS12	gene	PRSS12	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability, PRSS12 related MIM#249500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12459588;22090715;23344636		False	2	0;50;50	2.156	True		ENSG00000164099	ENSG00000164099	HGNC:9477													
PSAT1	gene	PSAT1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phosphoserine aminotransferase deficiency, MIM# 610992;Neu-Laxova syndrome 2, MIM# 616038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26960553;17436247;25152457		False	2	0;100;0	2.156	True		ENSG00000135069	ENSG00000135069	HGNC:19129													
PSMB1	gene	PSMB1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092, PSMB1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32129449		False	2	0;100;0	2.156	True		ENSG00000008018	ENSG00000008018	HGNC:9537													
PTBP2	gene	PTBP2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), PTBP2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40965981		False	2	0;100;0	2.156	True		ENSG00000117569	ENSG00000117569	HGNC:17662													
PTPA	gene	PTPA	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;Parkinsonism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36073231		False	2	0;100;0	2.156	True		ENSG00000119383	ENSG00000119383	HGNC:9308													
PTPRD	gene	PTPRD	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, PTPRD related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37056996;31088393;38890753		False	2	0;100;0	2.156	False		ENSG00000153707	ENSG00000153707	HGNC:9668													
PTPRG	gene	PTPRG	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37056996		False	2	0;100;0	2.156	False		ENSG00000144724	ENSG00000144724	HGNC:9671													
RAB14	gene	RAB14	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, RAB14-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33057194		False	2	0;100;0	2.156	True		ENSG00000119396	ENSG00000119396	HGNC:16524													
RBM28	gene	RBM28	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alopecia, neurologic defects, and endocrinopathy syndrome, MIM#612079			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18439547;33941690		False	2	0;100;0	2.156	True		ENSG00000106344	ENSG00000106344	HGNC:21863													
REPS2	gene	REPS2	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	complex neurodevelopmental disorder MONDO:0100038;Cerebral palsy HP:0100021			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000169891	ENSG00000169891	HGNC:9963													
RIC1	gene	RIC1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cleft lip;cataract;tooth abnormality;intellectual disability;facial dysmorphism;ADHD			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31932796		False	2	0;100;0	2.156	True		ENSG00000107036	ENSG00000107036	HGNC:17686													
RLF	gene	RLF	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, RLF-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000117000	ENSG00000117000	HGNC:10025													
RMRP	gene	RMRP	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Anauxetic dysplasia 1, MIM#607095			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		-	ENSG00000277027	HGNC:10031													
RNU5A-1	gene	RNU5A-1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), RNU5A-1 related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40379786		False	2	0;100;0	2.156	True		ENSG00000199568	ENSG00000199568	HGNC:10211													
RPS23	gene	RPS23	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Brachycephaly, trichomegaly, and developmental delay, MIM# 617412			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28257692		False	2	0;100;0	2.156	True		ENSG00000186468	ENSG00000186468	HGNC:10410													
RUSC2	gene	RUSC2	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mental retardation, autosomal recessive 61, MIM#	617773"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27612186		False	2	0;100;0	2.156	True		ENSG00000198853	ENSG00000198853	HGNC:23625													
SACS	gene	SACS	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia, Charlevoix-Saguenay type, MIM# 270550			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28843771;20876471;28658676;27871429		False	2	0;100;0	2.156	True		ENSG00000151835	ENSG00000151835	HGNC:10519													
SCN3B	gene	SCN3B	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SCN3B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40879121		False	2	0;100;0	2.156	True		ENSG00000166257	ENSG00000166257	HGNC:20665													
SEMA3E	gene	SEMA3E	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CHARGE syndrome, MIM#214800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15235037;31691538;31464029		False	2	0;100;0	2.156	True		ENSG00000170381	ENSG00000170381	HGNC:10727													
SEMA5A	gene	SEMA5A	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	no OMIM number yet			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 26395558		False	2	0;100;0	2.156	True		ENSG00000112902	ENSG00000112902	HGNC:10736													
SLC1A1	gene	SLC1A1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dicarboxylic aminoaciduria, MIM#222730			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000106688	ENSG00000106688	HGNC:10939													
SLC20A2	gene	SLC20A2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 1, MIM#213600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41458256;35881308		False	2	0;100;0	2.156	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC2A2	gene	SLC2A2	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fanconi-Bickel syndrome, MIM# 227810			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000163581	ENSG00000163581	HGNC:11006													
SLC35A1	gene	SLC35A1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIf, MIM# 603585			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28856833;23873973;11157507		False	2	0;100;0	2.156	True		ENSG00000164414	ENSG00000164414	HGNC:11021													
SLC35A3	gene	SLC35A3	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Arthrogryposis, mental retardation, and seizures OMIM #615553;Skeletal dysplasia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28328131;24031089;28777481		False	2	0;100;0	2.156	True		ENSG00000117620	ENSG00000117620	HGNC:11023													
SLC35B2	gene	SLC35B2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 26, with chondrodysplasia, MIM# 620269			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35325049		False	2	0;100;0	2.156	True		ENSG00000157593	ENSG00000157593	HGNC:16872													
SLC35F1	gene	SLC35F1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SLC35F1-associated;Rett-like syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33821533		False	2	0;100;0	2.156	True		ENSG00000196376	ENSG00000196376	HGNC:21483													
SLC5A5	gene	SLC5A5	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thyroid dyshormonogenesis 1, MIM# 274400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000105641	ENSG00000105641	HGNC:11040													
SLC9A7	gene	SLC9A7	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 108;OMIM #301024			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 30335141		False	2	0;100;0	2.156	True		ENSG00000065923	ENSG00000065923	HGNC:17123													
SMARCD2	gene	SMARCD2	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Specific granule deficiency 2, 617475 (includes global developmental delay in some patients)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26350204;28369036		False	2	0;100;0	2.156	True		ENSG00000108604	ENSG00000108604	HGNC:11107													
SMC6	gene	SMC6	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SMC6-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000163029	ENSG00000163029	HGNC:20466													
SNIP1	gene	SNIP1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Psychomotor retardation, epilepsy, and craniofacial dysmorphism, MIM# 614501			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22279524;34570759		False	2	0;100;0	2.156	True		ENSG00000163877	ENSG00000163877	HGNC:30587													
SNORD118	gene	SNORD118	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, brain calcifications, and cysts, MIM#614561			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27571260		False	2	0;100;0	2.156	True		ENSG00000200463	ENSG00000200463	HGNC:32952													
SNRPN	gene	SNRPN	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	Prader-Willi syndrome;OMIM #176270			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000128739	ENSG00000128739	HGNC:11164													
SOX3	gene	SOX3	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked, with isolated growth hormone deficiency, MIM#300123;Panhypopituitarism, X-linked, MIM#312000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29175558;30125608;12428212;15800844		False	2	0;100;0	2.156	True	Other	ENSG00000134595	ENSG00000134595	HGNC:11199													
SOX9	gene	SOX9	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	campomelic dysplasia MONDO:0007251			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301724;26663529;21373255		False	2	0;50;50	2.156	True		ENSG00000125398	ENSG00000125398	HGNC:11204													
SREBF2	gene	SREBF2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurocutaneous syndrome, MONDO:0042983, SREBF2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38847193		False	2	0;100;0	2.156	True		ENSG00000198911	ENSG00000198911	HGNC:11290													
SREK1	gene	SREK1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Prader-Willi-like syndrome, SREK1-related MONDO:0008300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40549565		False	2	0;100;0	2.156	True		ENSG00000153914	ENSG00000153914	HGNC:17882													
STN1	gene	STN1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebroretinal microangiopathy with calcification and cysts 2, MIM#617341			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32627942;27432940		False	2	0;0;0	2.156	True		ENSG00000107960	ENSG00000107960	HGNC:26200													
SUPT6H	gene	SUPT6H	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SUPT6H-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41864309		False	2	0;100;0	2.156	True		ENSG00000109111	ENSG00000109111	HGNC:11470													
SV2A	gene	SV2A	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SV2A-related;Developmental and epileptic encephalopathy 113, MIM# 620772			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37985816;36350923;37861890		False	2	0;100;0	2.156	True		ENSG00000159164	ENSG00000159164	HGNC:20566													
SYTL4	gene	SYTL4	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder, MONDO:0700092, SYTL4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42531028		False	2	0;100;0	2.156	True		ENSG00000102362	ENSG00000102362	HGNC:15588													
TACO1	gene	TACO1	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency;OMIM #220110			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 19503089;20727754;25044680		False	2	0;100;0	2.156	True		ENSG00000136463	ENSG00000136463	HGNC:24316													
TAF13	gene	TAF13	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 60, MIM# 617432			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28257693;40679298		False	2	0;100;0	2.156	True		ENSG00000197780	ENSG00000197780	HGNC:11546													
TARS1	gene	TARS1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trichothiodystrophy 7, nonphotosensitive;OMIM #618546			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31374204		False	2	0;100;0	2.156	True		ENSG00000113407	ENSG00000113407	HGNC:11572													
TBCB	gene	TBCB	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40856104		False	2	0;100;0	2.156	True		ENSG00000105254	ENSG00000105254	HGNC:1989													
TBX2	gene	TBX2	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Vertebral anomalies and variable endocrine and T-cell dysfunction - MIM#618223			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36733940		False	2	0;100;0	2.156	True		ENSG00000121068	ENSG00000121068	HGNC:11597													
TGFB1	gene	TGFB1	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Inflammatory bowel disease, immunodeficiency, and encephalopathy, MIM# 618213			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29483653		False	2	0;100;0	2.156	True		ENSG00000105329	ENSG00000105329	HGNC:11766													
THG1L	gene	THG1L	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 28 - 618800;Epilepsy;Intellectual Disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33682303		False	2	0;100;0	2.156	True		ENSG00000113272	ENSG00000113272	HGNC:26053													
THRB	gene	THRB	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Thyroid hormone resistance, autosomal recessive, MIM# 274300;Thyroid hormone resistance, autosomal dominant, MIM# 188570			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22319036;1682340		False	2	0;100;0	2.156	True		ENSG00000151090	ENSG00000151090	HGNC:11799													
TKFC	gene	TKFC	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Triokinase and FMN cyclase deficiency syndrome, MIM#618805;Developmental delay;cataracts;liver dysfunction			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32004446		False	2	0;100;0	2.156	True		ENSG00000149476	ENSG00000149476	HGNC:24552													
TKT	gene	TKT	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short stature, developmental delay, and congenital heart defects;OMIM #617044			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 27259054		False	2	50;50;0	2.156	True		ENSG00000163931	ENSG00000163931	HGNC:11834													
TMEM231	gene	TMEM231	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 20, OMIM #614970;Meckel syndrome 11, OMIM #615397			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 23012439		False	2	0;100;0	2.156	True		ENSG00000205084	ENSG00000205084	HGNC:37234													
TNIK	gene	TNIK	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 54, MIM# 617028			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27106596;23035106		False	2	0;100;0	2.156	True		ENSG00000154310	ENSG00000154310	HGNC:30765													
TNK2	gene	TNK2	Expert Review Amber;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	late onset infantile epilepsy;Mayer-Rokitansky-K ster-Hauser syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27977884;23686771;31517310		False	2	0;100;0	2.156	False		ENSG00000061938	ENSG00000061938	HGNC:19297													
TRIP13	gene	TRIP13	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mosaic variegated aneuploidy syndrome 3, MIM# 617598			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28553959		False	2	0;100;0	2.156	True		ENSG00000071539	ENSG00000071539	HGNC:12307													
TRPC5	gene	TRPC5	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder, MONDO:0700092, TRPC5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36323681;24817631;23033978;33504798;28191890;40907672		False	2	0;100;0	2.156	True		ENSG00000072315	ENSG00000072315	HGNC:12337													
TSHZ3	gene	TSHZ3	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	congenital anomaly of kidney and urinary tract MONDO:0019719			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27668656;34919690;36553458;39420202		False	2	0;100;0	2.156	True		ENSG00000121297	ENSG00000121297	HGNC:30700													
TSPAN7	gene	TSPAN7	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 58, MIM #300210, MONDO:0010266			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	10449641;12070254;10655063;25081361		False	2	0;100;0	2.156	True		ENSG00000156298	ENSG00000156298	HGNC:11854													
TTL	gene	TTL	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000114999	ENSG00000114999	HGNC:21586													
TUBGCP4	gene	TUBGCP4	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly and chorioretinopathy, autosomal recessive, 3, 616335			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25817018		False	2	0;100;0	2.156	True		ENSG00000137822	ENSG00000137822	HGNC:16691													
TUFM	gene	TUFM	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 4;OMIM #610678			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 26741492;17160893		False	2	0;100;0	2.156	True		ENSG00000178952	ENSG00000178952	HGNC:12420													
TXNIP	gene	TXNIP	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metabolic disease MONDO:0005066, TXNIP-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41116060;30755400;42448226		False	2	0;100;0	2.156	True		-	ENSG00000265972	HGNC:16952													
UBA7	gene	UBA7	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42023152;33710394;28397838		False	2	0;100;0	2.156	False		ENSG00000182179	ENSG00000182179	HGNC:12471													
UBE2I	gene	UBE2I	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, UBE2I-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000103275	ENSG00000103275	HGNC:12485													
UNC13C	gene	UNC13C	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41399760		False	2	0;100;0	2.156	True		ENSG00000137766	ENSG00000137766	HGNC:23149													
UQCC2	gene	UQCC2	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 7;OMIM #615824			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 28804536;24385928		False	2	0;100;0	2.156	True		ENSG00000137288	ENSG00000137288	HGNC:21237													
USP14	gene	USP14	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease MONDO:0002254, USP14-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38469793;35066879		False	2	0;100;0	2.156	True		ENSG00000101557	ENSG00000101557	HGNC:12612													
VPS37A	gene	VPS37A	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 53, autosomal recessive;OMIM #614898			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 22717650		False	2	0;100;0	2.156	True		ENSG00000155975	ENSG00000155975	HGNC:24928													
WDR59	gene	WDR59	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO:0002254			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41715954		False	2	0;100;0	2.156	True		ENSG00000103091	ENSG00000103091	HGNC:25706													
WDTC1	gene	WDTC1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, WDTC1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41793087		False	2	0;100;0	2.156	True		ENSG00000142784	ENSG00000142784	HGNC:29175													
WFS1	gene	WFS1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Wolfram syndrome 1, MIM# 222300;Wolfram-like syndrome, autosomal dominant, MIM# 614296			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	50;50;0	2.156	True		ENSG00000109501	ENSG00000109501	HGNC:12762													
XPO7	gene	XPO7	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, XPO7-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	2	0;100;0	2.156	True		ENSG00000130227	ENSG00000130227	HGNC:14108													
YAP1	gene	YAP1	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coloboma, ocular, with or without hearing impairment, cleft lip/palate, and/or mental retardation OMIM #120433			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24462371		False	2	0;100;0	2.156	True		ENSG00000137693	ENSG00000137693	HGNC:16262													
YKT6	gene	YKT6	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO:0002254, YKT6-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38522068		False	2	0;100;0	2.156	True		ENSG00000106636	ENSG00000106636	HGNC:16959													
YWHAZ	gene	YWHAZ	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, YWHAZ-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36001342;31024343;35143101;35501409;22124272;26207352;40692796		False	2	0;50;50	2.156	True		ENSG00000164924	ENSG00000164924	HGNC:12855													
ZBTB16	gene	ZBTB16	Expert Review Amber;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Skeletal defects, genital hypoplasia, and mental retardation, OMIM #612447			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18611983		False	2	0;100;0	2.156	True		ENSG00000109906	ENSG00000109906	HGNC:12930													
ZBTB7B	gene	ZBTB7B	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inborn error of immunity, MONDO:0003778, ZBTB7B-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40392549		False	2	0;100;0	2.156	True		ENSG00000160685	ENSG00000160685	HGNC:18668													
ZC3H14	gene	ZC3H14	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 56;OMIM# 617125			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21734151;33710394;28666327		False	2	0;100;0	2.156	True		ENSG00000100722	ENSG00000100722	HGNC:20509													
ZDHHC16	gene	ZDHHC16	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, ZDHHC16-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39313616		False	2	0;100;0	2.156	True		ENSG00000171307	ENSG00000171307	HGNC:20714													
ZNF407	gene	ZNF407	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	SIMHA syndrome, MIM# 619557;Global developmental delay;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24907849;32737394;23195952		False	2	0;100;0	2.156	True		ENSG00000215421	ENSG00000215421	HGNC:19904													
ZNF423	gene	ZNF423	Expert list;Expert Review Amber	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Joubert syndrome 19, OMIM# 614844			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 22863007		False	2	0;100;0	2.156	True		ENSG00000102935	ENSG00000102935	HGNC:16762													
ZNF668	gene	ZNF668	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with poor growth, large ears, and dysmorphic facies, MIM# 620194			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34313816;26633546		False	2	0;100;0	2.156	True		ENSG00000167394	ENSG00000167394	HGNC:25821													
ZNF865	gene	ZNF865	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ZNF865 associated neurodevelopmental disorder MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40936200		False	2	0;100;0	2.156	True		ENSG00000261221	ENSG00000261221	HGNC:38705													
ZRANB1	gene	ZRANB1	Expert Review Amber;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ZRANB1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38099646		False	2	0;100;0	2.156	True		ENSG00000019995	ENSG00000019995	HGNC:18224													
ABCC6	gene	ABCC6	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000091262	ENSG00000091262	HGNC:57													
ABCG5	gene	ABCG5	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sitosterolemia 2, MIM#618666			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000138075	ENSG00000138075	HGNC:13886													
ACOX2	gene	ACOX2	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bile acid synthesis defect, congenital, 6 - 617308			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27647924;27884763;29287774		False	1	0;0;100	2.156	True		ENSG00000168306	ENSG00000168306	HGNC:120													
ACTA1	gene	ACTA1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Myopathy, actin, congenital, with excess of thin myofilaments, MIM#161800;Nemaline myopathy 3, MIM#161800;Myopathy, actin, congenital, with cores, MIM#161800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21514153		False	1	0;0;100	2.156	True		ENSG00000143632	ENSG00000143632	HGNC:129													
ADA2	gene	ADA2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Vasculitis, autoinflammation, immunodeficiency, and hematologic defects syndrome, MIM#615688			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000093072	ENSG00000093072	HGNC:1839													
ADAMTSL2	gene	ADAMTSL2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Geleophysic dysplasia 1, MIM#231050			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000197859	ENSG00000197859	HGNC:14631													
ADGRB3	gene	ADGRB3	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30659260;18628273		False	1	0;0;100	2.156	True		ENSG00000135298	ENSG00000135298	HGNC:945													
ADGRG6	gene	ADGRG6	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lethal congenital contracture syndrome 9;OMIM #616503			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 30549416		False	1	0;0;100	2.156	True		ENSG00000112414	ENSG00000112414	HGNC:13841													
ADRA2B	gene	ADRA2B	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cortical myoclonus and epilepsy;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24114805;21937992		False	1	0;0;100	2.156	True		-	ENSG00000274286	HGNC:282													
AFG3L2	gene	AFG3L2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 5, autosomal recessive, MIM#614487			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000141385	ENSG00000141385	HGNC:315													
AGGF1	gene	AGGF1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000164252	ENSG00000164252	HGNC:24684													
AGK	gene	AGK	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sengers syndrome, MIM#212350			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000006530	ENSG00000006530	HGNC:21869													
AGL	gene	AGL	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease IIIa, MIM# 232400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000162688	ENSG00000162688	HGNC:321													
AGO3	gene	AGO3	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25271087		False	1	0;0;100	2.156	True		ENSG00000126070	ENSG00000126070	HGNC:18421													
AGPS	gene	AGPS	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Rhizomelic chondrodysplasia punctata, type 3, MIM#600121			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000018510	ENSG00000018510	HGNC:327													
AGT	gene	AGT	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Renal tubular dysgenesis, MIM#267430			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000135744	ENSG00000135744	HGNC:333													
AGTR2	gene	AGTR2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	X-linked complex neurodevelopmental disorder MONDO:0100148			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000180772	ENSG00000180772	HGNC:338													
AHSG	gene	AHSG	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Alopecia-intellectual disability syndrome 1 MIM#203650;infantile cortical hyperostosis			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 28054173;9395485;31288248;17389622		False	1	0;0;100	2.156	True		ENSG00000145192	ENSG00000145192	HGNC:349													
AKR1C2	gene	AKR1C2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	46XY sex reversal 8, MIM#614279			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000151632	ENSG00000151632	HGNC:385													
ALDOB	gene	ALDOB	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fructose intolerance, hereditary, MIM#229600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000136872	ENSG00000136872	HGNC:417													
ALS2	gene	ALS2	ClinGen;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	ALS2-related motor neuron disease, MONDO:0100227			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000003393	ENSG00000003393	HGNC:443													
ANKH	gene	ANKH	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Craniometaphyseal dysplasia, MIM#123000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000154122	ENSG00000154122	HGNC:15492													
ANKRD31	gene	ANKRD31	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ANKRD31-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27541642		False	1	0;0;100	2.156	True		ENSG00000145700	ENSG00000145700	HGNC:26853													
APTX	gene	APTX	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia, MIM#208920			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000137074	ENSG00000137074	HGNC:15984													
AR	gene	AR	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Spinal and bulbar muscular atrophy of Kennedy, MIM# 313200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000169083	ENSG00000169083	HGNC:644													
ARHGEF2	gene	ARHGEF2	Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder with midbrain and hindbrain malformations MONDO:0056797			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28453519		False	1	0;0;100	2.156	False		ENSG00000116584	ENSG00000116584	HGNC:682													
ARHGEF6	gene	ARHGEF6	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	MENTAL RETARDATION X-LINKED TYPE 46			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11017088		False	1	0;0;100	2.156	True		ENSG00000129675	ENSG00000129675	HGNC:685													
ARID3A	gene	ARID3A	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cornelia de Lange syndrome - MONDO:0016033			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40677927		False	1	0;0;100	2.156	True		ENSG00000116017	ENSG00000116017	HGNC:3031													
ASAH2	gene	ASAH2	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41808410		False	1	0;0;100	2.156	True		ENSG00000188611	ENSG00000188611	HGNC:18860													
ASMT	gene	ASMT	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21251267		False	1	0;0;100	2.156	True		ENSG00000196433	ENSG00000196433	HGNC:750													
ATL1	gene	ATL1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuropathy, hereditary sensory, type ID, MIM# 613708;Spastic paraplegia 3A, autosomal dominant, MIM# 182600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21336785;28736820;29180453;29691679;31236401		False	1	0;0;100	2.156	True		ENSG00000198513	ENSG00000198513	HGNC:11231													
ATP10A	gene	ATP10A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31696658		False	1	0;0;100	2.156	True		ENSG00000206190	ENSG00000206190	HGNC:13542													
ATP2A2	gene	ATP2A2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Darier disease, MIM#124200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000174437	ENSG00000174437	HGNC:812													
ATP2C2	gene	ATP2C2	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	language impairment, HP:0002463			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33864365;28440294		False	1	0;0;100	2.156	True		ENSG00000064270	ENSG00000064270	HGNC:29103													
ATP6V1C1	gene	ATP6V1C1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, ATP6V1C1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39210597		False	1	0;0;100	2.156	True		ENSG00000155097	ENSG00000155097	HGNC:856													
ATXN10	gene	ATXN10	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 10, MIM#603516			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000130638	ENSG00000130638	HGNC:10549													
AVP	gene	AVP	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Diabetes insipidus, neurohypophyseal, MIM#125700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000101200	ENSG00000101200	HGNC:894													
AVPR1A	gene	AVPR1A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	autism spectrum disorder MONDO:0005258			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000166148	ENSG00000166148	HGNC:895													
AVPR2	gene	AVPR2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Diabetes insipidus, nephrogenic, MIM#304800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000126895	ENSG00000126895	HGNC:897													
B3GAT3	gene	B3GAT3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects, MIM#245600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000149541	ENSG00000149541	HGNC:923													
BANF1	gene	BANF1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, BANF1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35982159		False	1	0;0;100	2.156	True		ENSG00000175334	ENSG00000175334	HGNC:17397													
BCAT1	gene	BCAT1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), BCAT1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41029903		False	1	0;0;100	2.156	True		ENSG00000060982	ENSG00000060982	HGNC:976													
BDNF	gene	BDNF	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Central hypoventilation syndrome, congenital, MIM#209880			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000176697	ENSG00000176697	HGNC:1033													
BICD2	gene	BICD2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM#615290			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	50;0;50	2.156	True		ENSG00000185963	ENSG00000185963	HGNC:17208													
BIN1	gene	BIN1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Centronuclear myopathy 2, MIM# 255200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000136717	ENSG00000136717	HGNC:1052													
BLM	gene	BLM	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bloom syndrome, MIM# 210900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000197299	ENSG00000197299	HGNC:1058													
BMPER	gene	BMPER	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Diaphanospondylodysostosis, MIM#608022			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000164619	ENSG00000164619	HGNC:24154													
C18orf32	gene	C18orf32	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), C18orf32-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID:35107634		False	1	0;0;100	2.156	True		ENSG00000177576	ENSG00000177576	HGNC:31690													
C19orf12	gene	C19orf12	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 4, MIM#614298			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
CA5A	gene	CA5A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperammonemia due to carbonic anhydrase VA deficiency, MIM# 615751			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26913920		False	1	0;0;100	2.156	True		ENSG00000174990	ENSG00000174990	HGNC:1377													
CACNG2	gene	CACNG2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 10, MIM#614256			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21376300		False	1	0;0;100	2.156	True		ENSG00000166862	ENSG00000166862	HGNC:1406													
CANT1	gene	CANT1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Desbuquois dysplasia 1, MIM# 251450			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000171302	ENSG00000171302	HGNC:19721													
CCDC149	gene	CCDC149	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease, MONDO:0002254, CCDC149-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40459248;42554577		False	1	0;0;100	2.156	True		ENSG00000181982	ENSG00000181982	HGNC:25405													
CCDC8	gene	CCDC8	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-M syndrome 3, MIM#614205			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21737058		False	1	0;0;100	2.156	True		ENSG00000169515	ENSG00000169515	HGNC:25367													
CCDC93	gene	CCDC93	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ritscher-Schinzel syndrome, MONDO:0019078, CCDC93-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40601774		False	1	0;50;50	2.156	True		ENSG00000125633	ENSG00000125633	HGNC:25611													
CDC6	gene	CDC6	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Meier-Gorlin syndrome 5 (MIM#613805)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21358632		False	1	0;0;100	2.156	True		ENSG00000094804	ENSG00000094804	HGNC:1744													
CDH15	gene	CDH15	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 3 MIM#612580			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19012874;12052883;28422132;26506440		False	1	0;0;100	2.156	True		ENSG00000129910	ENSG00000129910	HGNC:1754													
CDK5R1	gene	CDK5R1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30733659		False	1	0;0;100	2.156	True		ENSG00000176749	ENSG00000176749	HGNC:1775													
CDKL1	gene	CDKL1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CDKL1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40088891		False	1	0;50;50	2.156	True		ENSG00000100490	ENSG00000100490	HGNC:1781													
CDT1	gene	CDT1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Meier-Gorlin syndrome 4, MIM#613804			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000167513	ENSG00000167513	HGNC:24576													
CFH	gene	CFH	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Complement factor H deficiency, MIM#609814			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000000971	ENSG00000000971	HGNC:4883													
CFHR1	gene	CFHR1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hemolytic uremic syndrome, atypical, susceptibility to, MIM#235400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000244414	ENSG00000244414	HGNC:4888													
CFHR3	gene	CFHR3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hemolytic uremic syndrome, atypical, susceptibility to, MIM#235400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000116785	ENSG00000116785	HGNC:16980													
CHD9	gene	CHD9	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CHD9-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42640505;35183220		False	1	0;0;100	2.156	True		ENSG00000177200	ENSG00000177200	HGNC:25701													
CHRNA4	gene	CHRNA4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, nocturnal frontal lobe, 1, MIM# 600513			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	14623738		False	1	0;0;100	2.156	True		ENSG00000101204	ENSG00000101204	HGNC:1958													
CISD2	gene	CISD2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wolfram syndrome 2, MIM#604928			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000145354	ENSG00000145354	HGNC:24212													
CLASP1	gene	CLASP1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, CLASP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39040917		False	1	0;0;100	2.156	True		ENSG00000074054	ENSG00000074054	HGNC:17088													
CLCNKA	gene	CLCNKA	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Other	Bartter syndrome, type 4b, digenic, MIM#613090			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18310267;29254190		False	1	0;0;100	2.156	True		ENSG00000186510	ENSG00000186510	HGNC:2026													
CLIC2	gene	CLIC2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual disability, X-linked, syndromic 32, 300886			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22814392;25927380		False	1	0;0;100	2.156	True		ENSG00000155962	ENSG00000155962	HGNC:2063													
CLIP2	gene	CLIP2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22608712		False	1	0;0;100	2.156	True		ENSG00000106665	ENSG00000106665	HGNC:2586													
CLPP	gene	CLPP	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 3, MIM# 614129			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23541340		False	1	0;0;100	2.156	True		ENSG00000125656	ENSG00000125656	HGNC:2084													
CLUAP1	gene	CLUAP1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leber congenital amaurosis, MONDO:0018998, CLUAP1-related;Ciliopathy, MONDO:0005308, CLUAP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34209753;28679688;26820066		False	1	0;100;0	2.156	False		ENSG00000103351	ENSG00000103351	HGNC:19009													
CMAS	gene	CMAS	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, CMAS-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31495922		False	1	0;0;100	2.156	True		ENSG00000111726	ENSG00000111726	HGNC:18290													
CNTN3	gene	CNTN3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, CNTN3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28600779		False	1	0;0;100	2.156	True		ENSG00000113805	ENSG00000113805	HGNC:2173													
CNTN4	gene	CNTN4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder, MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15106122;18349135;17932120		False	1	0;0;100	2.156	True		ENSG00000144619	ENSG00000144619	HGNC:2174													
CNTN6	gene	CNTN6	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CNTN6-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30836150;28641109;29983269		False	1	0;0;100	2.156	True		ENSG00000134115	ENSG00000134115	HGNC:2176													
CNTNAP5	gene	CNTNAP5	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20346443		False	1	0;0;100	2.156	True		ENSG00000155052	ENSG00000155052	HGNC:18748													
COA3	gene	COA3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 14, MIM# 619058			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25604084		False	1	0;0;100	2.156	True		ENSG00000183978	ENSG00000183978	HGNC:24990													
COL18A1	gene	COL18A1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Knobloch syndrome, type 1, MIM#267750			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000182871	ENSG00000182871	HGNC:2195													
COL1A2	gene	COL1A2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Ehlers-Danlos syndrome, arthrochalasia type, 2, MIM# 617821;Ehlers-Danlos syndrome, cardiac valvular type, MIM# 225320;Osteogenesis imperfecta, type II, MIM# 166210;Osteogenesis imperfecta, type III, MIM# 259420;Osteogenesis imperfecta, type IV, MIM# 166220			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000164692	ENSG00000164692	HGNC:2198													
COLEC10	gene	COLEC10	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3MC syndrome 3, MIM# 248340			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28301481		False	1	0;0;100	2.156	True		ENSG00000184374	ENSG00000184374	HGNC:2220													
COMMD4	gene	COMMD4	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ritscher-Schinzel syndrome, MONDO:0019078, COMMD4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40601774		False	1	0;0;100	2.156	True		ENSG00000140365	ENSG00000140365	HGNC:26027													
COMMD9	gene	COMMD9	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, COMMD9-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40601774		False	1	0;0;100	2.156	True		ENSG00000110442	ENSG00000110442	HGNC:25014													
CORO1A	gene	CORO1A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 8, MIM#615401			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000102879	ENSG00000102879	HGNC:2252													
COX4I2	gene	COX4I2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Exocrine pancreatic insufficiency, dyserythropoietic anemia, and calvarial hyperostosis, MIM#612714			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19268275;22730437		False	1	0;0;100	2.156	True		ENSG00000131055	ENSG00000131055	HGNC:16232													
COX6B1	gene	COX6B1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 7, MIM# 619051			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18499082;24781756		False	1	0;0;100	2.156	True		ENSG00000126267	ENSG00000126267	HGNC:2280													
CP	gene	CP	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminaemia, MIM#604290			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000047457	ENSG00000047457	HGNC:2295													
CPA6	gene	CPA6	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epilepsy, familial temporal lobe, 5, MIM#614417;Febrile seizures, familial, 11, MIM#614418			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25875328;21922598;23105115		False	1	0;0;100	2.156	True		ENSG00000165078	ENSG00000165078	HGNC:17245													
CRIPTO	gene	CRIPTO	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital nervous system disorder, MONDO:0002320, TDGF1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 12073012		False	1	0;0;100	2.156	True		ENSG00000241186	ENSG00000241186	HGNC:11701													
CRKL	gene	CRKL	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28121514;25565927		False	1	0;0;100	2.156	True		ENSG00000099942	ENSG00000099942	HGNC:2363													
CRLF1	gene	CRLF1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cold-induced sweating syndrome 1, MIM#272430			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000006016	ENSG00000006016	HGNC:2364													
CRTAP	gene	CRTAP	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Osteogenesis imperfecta, type VII, MIM#610682			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000170275	ENSG00000170275	HGNC:2379													
CSTB	gene	CSTB	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM# 254800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	9012407;9054946		False	1	0;0;100	2.156	True		ENSG00000160213	ENSG00000160213	HGNC:2482													
CTSF	gene	CTSF	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 13, Kufs type, MIM#615362			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000174080	ENSG00000174080	HGNC:2531													
CUBN	gene	CUBN	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Megaloblastic anemia-1, Finnish type, MIM#261100;Proteinuria			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000107611	ENSG00000107611	HGNC:2548													
CYC1	gene	CYC1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 6 MIM#615453			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23910460;34252606		False	1	0;0;100	2.156	True		ENSG00000179091	ENSG00000179091	HGNC:2579													
CYFIP1	gene	CYFIP1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		-	ENSG00000273749	HGNC:13759													
CYP27A1	gene	CYP27A1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, MIM# 213700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP2U1	gene	CYP2U1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 56, autosomal recessive, MIM#615030			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000155016	ENSG00000155016	HGNC:20582													
DBX1	gene	DBX1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	central hypoventilation syndrome, congenital MONDO:0800031			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40995053		False	1	0;0;100	2.156	True		ENSG00000109851	ENSG00000109851	HGNC:33185													
DDR2	gene	DDR2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Warburg-Cinotti syndrome, MIM#618175, AD;Spondylometaepiphyseal dysplasia, short limb-hand type, MIM#271665, AR			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000162733	ENSG00000162733	HGNC:2731													
DDX39A	gene	DDX39A	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DDX39A-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40726340		False	1	0;0;100	2.156	True		ENSG00000123136	ENSG00000123136	HGNC:17821													
DIP2B	gene	DIP2B	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, FRA12A type, MIM# 136630			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17236128;33688487		False	1	0;50;50	2.156	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000066084	ENSG00000066084	HGNC:29284													
DIPK2A	gene	DIPK2A	Expert Review Red;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000181744	ENSG00000181744	HGNC:28490													
DLGAP2	gene	DLGAP2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000198010	ENSG00000198010	HGNC:2906													
DLK1	gene	DLK1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	central precocious puberty			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 28324015;30462238		False	1	50;0;50	2.156	True		ENSG00000185559	ENSG00000185559	HGNC:2907													
DNAH14	gene	DNAH14	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO#0700092), DNAH14-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35438214		False	1	50;0;50	2.156	True		ENSG00000185842	ENSG00000185842	HGNC:2945													
DNAJA1	gene	DNAJA1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DNAJA1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30972502		False	1	0;0;100	2.156	True		ENSG00000086061	ENSG00000086061	HGNC:5229													
DNAJC3	gene	DNAJC3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, combined cerebellar and peripheral, with hearing loss and diabetes mellitus, MIM# 616192			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25466870;28940199		False	1	0;0;100	2.156	True		ENSG00000102580	ENSG00000102580	HGNC:9439													
DNAJC6	gene	DNAJC6	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 19a, juvenile-onset, MIM#615528			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000116675	ENSG00000116675	HGNC:15469													
DOCK8	gene	DOCK8	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	intellectual developmental disorder, autosomal dominant 2, MIM#614113			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18060736;29930340;29191242;33455084;32978894;25435912		False	1	0;0;100	2.156	True		ENSG00000107099	ENSG00000107099	HGNC:19191													
DOK7	gene	DOK7	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenic syndrome, congenital, 10, MIM#254300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000175920	ENSG00000175920	HGNC:26594													
DPM3	gene	DPM3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 612937			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19576565;28803818;30931530;31469168		False	1	0;0;100	2.156	True		ENSG00000179085	ENSG00000179085	HGNC:3007													
DPP10	gene	DPP10	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28670437		False	1	0;0;100	2.156	True		ENSG00000175497	ENSG00000175497	HGNC:20823													
DPP6	gene	DPP6	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability, autosomal dominant 33 (MIM#616311)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23832105		False	1	0;67;33	2.156	True		ENSG00000130226	ENSG00000130226	HGNC:3010													
DSE	gene	DSE	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ehlers-Danlos syndrome, musculocontractural type 2, MIM#615539			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000111817	ENSG00000111817	HGNC:21144													
DUOXA2	gene	DUOXA2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thyroid dyshormonogenesis 5, MIM#274900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000140274	ENSG00000140274	HGNC:32698													
DYNC2H1	gene	DYNC2H1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short-rib thoracic dysplasia 3 with or without polydactyly, MIM#613091			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000187240	ENSG00000187240	HGNC:2962													
DYNC2I2	gene	DYNC2I2	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short-rib thoracic dysplasia 11 with or without polydactyly;OMIM #615633			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000119333	ENSG00000119333	HGNC:28296													
EDC3	gene	EDC3	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mental retardation, autosomal recessive 50, MIM#	616460"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29685133;25701870		False	1	0;0;100	2.156	True		ENSG00000179151	ENSG00000179151	HGNC:26114													
EDNRB	gene	EDNRB	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Waardenburg syndrome, type 4A, MIM#277580			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000136160	ENSG00000136160	HGNC:3180													
EFNB1	gene	EFNB1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Other	Craniofrontonasal dysplasia, MIM# 304110			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000090776	ENSG00000090776	HGNC:3226													
EFNB2	gene	EFNB2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability and congenital abnormalities			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29508392		False	1	0;0;100	2.156	True		ENSG00000125266	ENSG00000125266	HGNC:3227													
EIF2AK1	gene	EIF2AK1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;white matter abnormalities			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32197074		False	1	0;0;100	2.156	True		ENSG00000086232	ENSG00000086232	HGNC:24921													
EIF2B1	gene	EIF2B1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, MIM#603896			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000111361	ENSG00000111361	HGNC:3257													
EIF2B2	gene	EIF2B2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, MIM#603896			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000119718	ENSG00000119718	HGNC:3258													
EIF2B3	gene	EIF2B3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, MIM#603896			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000070785	ENSG00000070785	HGNC:3259													
EIF2B4	gene	EIF2B4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, MIM#603896			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000115211	ENSG00000115211	HGNC:3260													
EIF2B5	gene	EIF2B5	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, MIM#603896			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000145191	ENSG00000145191	HGNC:3261													
ELMOD1	gene	ELMOD1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092,ELMOD1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31327155		False	1	0;0;100	2.156	True		ENSG00000110675	ENSG00000110675	HGNC:25334													
ELP1	gene	ELP1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, ELP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36864284		False	1	0;0;100	2.156	True		ENSG00000070061	ENSG00000070061	HGNC:5959													
EN2	gene	EN2	ClinGen;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Complex neurodevelopmental disorder,  MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000164778	ENSG00000164778	HGNC:3343													
EOGT	gene	EOGT	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adams-Oliver syndrome 4, MIM#615297			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31368252		False	1	0;0;100	2.156	True		ENSG00000163378	ENSG00000163378	HGNC:28526													
EOMES	gene	EOMES	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17353897		False	1	0;0;100	2.156	True		ENSG00000163508	ENSG00000163508	HGNC:3372													
EPB41L1	gene	EPB41L1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 11, MIM# 614257			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21376300;26539891;25961944		False	1	0;0;100	2.156	True		ENSG00000088367	ENSG00000088367	HGNC:3378													
EPM2A	gene	EPM2A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2A (Lafora), MIM#254780			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000112425	ENSG00000112425	HGNC:3413													
ERCC4	gene	ERCC4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Xeroderma pigmentosum, group F, MIM#278760;XFE progeroid syndrome, MIM# 610965			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000175595	ENSG00000175595	HGNC:3436													
ERMARD	gene	ERMARD	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Periventricular nodular heterotopia 6, MIM#615544			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24056535;27087860		False	1	0;0;100	2.156	True		ENSG00000130023	ENSG00000130023	HGNC:21056													
ETS1	gene	ETS1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ETS1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31160359		False	1	0;0;100	2.156	True		ENSG00000134954	ENSG00000134954	HGNC:3488													
EVC	gene	EVC	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ellis-van Creveld syndrome, MIM#225500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000072840	ENSG00000072840	HGNC:3497													
EVC2	gene	EVC2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ellis-van Creveld syndrome, MIM#225500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000173040	ENSG00000173040	HGNC:19747													
FA2H	gene	FA2H	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 35, autosomal recessive, MIM#612319			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FAAH2	gene	FAAH2	Expert Review Red;Genetic Health Queensland;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder, MONDO:0700092, FAAH2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25885783;40744325		False	1	0;0;100	2.156	True		ENSG00000165591	ENSG00000165591	HGNC:26440													
FAM111A	gene	FAM111A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Kenny-Caffey syndrome, type 2, MIM# 127000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000166801	ENSG00000166801	HGNC:24725													
FBLN5	gene	FBLN5	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cutis laxa, autosomal recessive, type IA, MIM#219100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000140092	ENSG00000140092	HGNC:3602													
FBN1	gene	FBN1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Marfan syndrome, MIM#154700;Geleophysic dysplasia 2, MIM#614185;Weill-Marchesani syndrome 2, dominant, MIM#608328			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000166147	ENSG00000166147	HGNC:3603													
FGF3	gene	FGF3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Deafness, congenital with inner ear agenesis, microtia, and microdontia, MIM#610706			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000186895	ENSG00000186895	HGNC:3681													
FHIP2A	gene	FHIP2A	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	no OMIM number yet			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31353455;27431290		False	1	0;0;100	2.156	True		ENSG00000151553	ENSG00000151553	HGNC:29320													
FLNB	gene	FLNB	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Larsen syndrome, MIM#150250			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000136068	ENSG00000136068	HGNC:3755													
FMO4	gene	FMO4	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092;FMO4 related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41714691, 28940097		False	1	0;0;100	2.156	True		ENSG00000076258	ENSG00000076258	HGNC:3772													
FSCN1	gene	FSCN1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, FSCN1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40874942		False	1	0;0;100	2.156	True		ENSG00000075618	ENSG00000075618	HGNC:11148													
FTL	gene	FTL	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 3, MIM#606159;Hyperferritinemia-cataract syndrome, MIM#600886;L-ferritin deficiency, dominant and recessive, MIM#615604			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000087086	ENSG00000087086	HGNC:3999													
FZD3	gene	FZD3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000104290	ENSG00000104290	HGNC:4041													
G6PC3	gene	G6PC3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neutropenia, severe congenital 4, autosomal recessive, MIM# 612541			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20717171		False	1	0;0;100	2.156	True		ENSG00000141349	ENSG00000141349	HGNC:24861													
GABRG1	gene	GABRG1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy MONDO:0100062			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	36121006		False	1	0;0;100	2.156	True		ENSG00000163285	ENSG00000163285	HGNC:4086													
GAK	gene	GAK	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, GAK-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37056996		False	1	0;50;50	2.156	True		ENSG00000178950	ENSG00000178950	HGNC:4113													
GAN	gene	GAN	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Giant axonal neuropathy-1, MIM# 256850			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000261609	ENSG00000261609	HGNC:4137													
GAP43	gene	GAP43	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, MONDO:0700092, GAP43-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39738362		False	1	0;0;100	2.156	True		ENSG00000172020	ENSG00000172020	HGNC:4140													
GATA1	gene	GATA1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000102145	ENSG00000102145	HGNC:4170													
GBA2	gene	GBA2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 46, autosomal recessive, MIM#614409			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000070610	ENSG00000070610	HGNC:18986													
GBE1	gene	GBE1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease IV, MIM#232500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000114480	ENSG00000114480	HGNC:4180													
GBX1	gene	GBX1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, GBX1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40519143		False	1	0;0;100	2.156	True		ENSG00000164900	ENSG00000164900	HGNC:4185													
GCK	gene	GCK	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Diabetes mellitus, permanent neonatal	606176"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000106633	ENSG00000106633	HGNC:4195													
GHR	gene	GHR	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Growth hormone insensitivity, partial, MIM#604271;Laron dwarfism, MIM#262500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000112964	ENSG00000112964	HGNC:4263													
GJA1	gene	GJA1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Atrioventricular septal defect 3, MIM#600309;Craniometaphyseal dysplasia, autosomal recessive, MIM#218400;Erythrokeratodermia variabilis et progressiva 3, MIM#617525;Hypoplastic left heart syndrome 1, MIM#241550;Oculodentodigital dysplasia, MIM#164200;Oculodentodigital dysplasia, autosomal recessive, MIM#257850;Palmoplantar keratoderma with congenital alopecia, MIM#104100;Syndactyly, type III, MIM# 186100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000152661	ENSG00000152661	HGNC:4274													
GJB1	gene	GJB1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM#302800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000169562	ENSG00000169562	HGNC:4283													
GLRA1	gene	GLRA1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperekplexia 1, MIM# 149400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000145888	ENSG00000145888	HGNC:4326													
GLUD1	gene	GLUD1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hyperinsulinism-hyperammonemia syndrome, MIM#606762			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000148672	ENSG00000148672	HGNC:4335													
GLYAT	gene	GLYAT	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, GLYAT-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40747359		False	1	0;0;100	2.156	True		ENSG00000149124	ENSG00000149124	HGNC:13734													
GNA14	gene	GNA14	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000156049	ENSG00000156049	HGNC:4382													
GOSR2	gene	GOSR2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 6, MIM#614018			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000108433	ENSG00000108433	HGNC:4431													
GPSM2	gene	GPSM2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chudley-McCullough syndrome, MIM#604213			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20602914;22578326;28387217;27180139;27064331		False	1	0;0;100	2.156	True		ENSG00000121957	ENSG00000121957	HGNC:29501													
GRIPAP1	gene	GRIPAP1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	GRIPAP1-related neurodevelopmental disorder MONDO:0001071			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28285821		False	1	0;50;50	2.156	True		ENSG00000068400	ENSG00000068400	HGNC:18706													
GRPR	gene	GRPR	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000126010	ENSG00000126010	HGNC:4609													
GTF2H4	gene	GTF2H4	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Xeroderma pigmentosum, complementation group J, MIM# 621435			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40924495;40924475		False	1	0;0;100	2.156	True		ENSG00000213780	ENSG00000213780	HGNC:4658													
GTF2IRD1	gene	GTF2IRD1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31418010		False	1	0;0;100	2.156	True		ENSG00000006704	ENSG00000006704	HGNC:4661													
GYS2	gene	GYS2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease 0, liver, MIM#240600			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000111713	ENSG00000111713	HGNC:4707													
H19	gene	H19	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Beckwith-Wiedemann syndrome, MIM#130650;Silver-Russell syndrome, MIM#180860			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000130600	ENSG00000130600	HGNC:4713													
HADH	gene	HADH	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-hydroxyacyl-CoA dehydrogenase deficiency, MIM#231530;Hyperinsulinemic hypoglycemia, familial, 4, MIM#609975			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000138796	ENSG00000138796	HGNC:4799													
HAL	gene	HAL	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	[Histidinemia], MIM#235800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	4421298;7119955		False	1	0;0;100	2.156	True		ENSG00000084110	ENSG00000084110	HGNC:4806													
HARS2	gene	HARS2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 2, MIM# 614926			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21464306;27650058;31827252;31486067		False	1	0;0;100	2.156	True		ENSG00000112855	ENSG00000112855	HGNC:4817													
HOXD10	gene	HOXD10	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Vertical talus, congenital, MIM#192950			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000128710	ENSG00000128710	HGNC:5133													
HYPK	gene	HYPK	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, HYPK-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40986405		False	1	0;0;100	2.156	True		ENSG00000242028	ENSG00000242028	HGNC:18418													
IFT140	gene	IFT140	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Short-rib thoracic dysplasia 9 with or without polydactyly, MIM#266920			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000187535	ENSG00000187535	HGNC:29077													
IGBP1	gene	IGBP1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Corpus callosum, agenesis of, with mental retardation, ocular coloboma and micrognathia, MIM# 300472			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	14556245		False	1	0;0;100	2.156	True		ENSG00000089289	ENSG00000089289	HGNC:5461													
IGF2	gene	IGF2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Growth restriction, severe, with distinctive facies, MIM#616489			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31544945;26154720		False	1	0;0;100	2.156	True		ENSG00000167244	ENSG00000167244	HGNC:5466													
IMMP2L	gene	IMMP2L	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29788020;29152845		False	1	0;0;100	2.156	True		ENSG00000184903	ENSG00000184903	HGNC:14598													
INS	gene	INS	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Diabetes mellitus, permanent neonatal, MIM#606176			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000254647	ENSG00000254647	HGNC:6081													
INSR	gene	INSR	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leprechaunism, MIM# 246200;Rabson-Mendenhall syndrome, MIM# 262190			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000171105	ENSG00000171105	HGNC:6091													
INTS8	gene	INTS8	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebellar hypoplasia and spasticity, MIM# 618572			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28542170		False	1	0;0;100	2.156	True		ENSG00000164941	ENSG00000164941	HGNC:26048													
IYD	gene	IYD	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thyroid dyshormonogenesis 4, MIM#274800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000009765	ENSG00000009765	HGNC:21071													
JAG1	gene	JAG1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alagille syndrome 1, MIM#118450			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000101384	ENSG00000101384	HGNC:6188													
KANK1	gene	KANK1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebral palsy, spastic quadriplegic, 2, MIM#612900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16301218;30684669		False	1	0;0;100	2.156	True		ENSG00000107104	ENSG00000107104	HGNC:19309													
KATNAL2	gene	KATNAL2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22495311;21572417;22495309;22495306		False	1	0;0;100	2.156	True		ENSG00000167216	ENSG00000167216	HGNC:25387													
KCNC3	gene	KCNC3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 13, MIM#605259			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000131398	ENSG00000131398	HGNC:6235													
KCNJ11	gene	KCNJ11	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	{Diabetes mellitus, type 2, susceptibility to} 125853;Diabetes mellitus, transient neonatal, 3 610582;Diabetes, permanent neonatal, with or without neurologic features 606176;Hyperinsulinemic hypoglycemia, familial, 2 601820;Maturity-onset diabetes of the young, type 13 616329 AD			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000187486	ENSG00000187486	HGNC:6257													
KCTD13	gene	KCTD13	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO#0700092), KCTD13-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22596160;29088697		False	1	0;0;100	2.156	True		ENSG00000174943	ENSG00000174943	HGNC:22234													
KIF16B	gene	KIF16B	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29736960		False	1	0;0;100	2.156	True		ENSG00000089177	ENSG00000089177	HGNC:15869													
KIF1B	gene	KIF1B	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia;coloboma;hypoplasia of the corpus callosum;severe neurodevelopmental delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33710394		False	1	0;0;100	2.156	True		ENSG00000054523	ENSG00000054523	HGNC:16636													
KIF6	gene	KIF6	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, KIF6-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30475797		False	1	0;0;100	2.156	True		ENSG00000164627	ENSG00000164627	HGNC:21202													
KIRREL3	gene	KIRREL3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder, MONDO:0100038, KIRREL3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19012874;42590949		False	1	0;0;100	2.156	True		ENSG00000149571	ENSG00000149571	HGNC:23204													
KLF8	gene	KLF8	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11836360		False	1	0;0;100	2.156	True		ENSG00000102349	ENSG00000102349	HGNC:6351													
KLLN	gene	KLLN	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21177507		False	1	0;0;100	2.156	True		ENSG00000227268	ENSG00000227268	HGNC:37212													
KYNU	gene	KYNU	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Hydroxykynureninuria, MIM#236800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28792876;17334708		False	1	0;0;100	2.156	True		ENSG00000115919	ENSG00000115919	HGNC:6469													
LBR	gene	LBR	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Greenberg skeletal dysplasia, MIM#215140;3 Pelger-Huet anomaly, MIM#169400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000143815	ENSG00000143815	HGNC:6518													
LGI4	gene	LGI4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Arthrogryposis multiplex congenita, neurogenic, with myelin defect, MIM#617468			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000153902	ENSG00000153902	HGNC:18712													
LHX3	gene	LHX3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pituitary hormone deficiency, combined, 3 (MIM#221750)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28302169		False	1	0;0;100	2.156	True		ENSG00000107187	ENSG00000107187	HGNC:6595													
LMNA	gene	LMNA	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000160789	ENSG00000160789	HGNC:6636													
LRP5	gene	LRP5	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Exudative vitreoretinopathy 4, MIM# 601813;Hyperostosis, endosteal, MIM# 144750;Osteopetrosis, autosomal dominant 1, MIM# 607634;Osteoporosis-pseudoglioma syndrome, MIM# 259770;Osteosclerosis, MIM# 144750;Polycystic liver disease 4 with or without kidney cysts, MIM# 617875;van Buchem disease, type 2 607636			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000162337	ENSG00000162337	HGNC:6697													
LSM11	gene	LSM11	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 8, MIM# 619486			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33230297		False	1	0;0;100	2.156	True		ENSG00000155858	ENSG00000155858	HGNC:30860													
MACROD2	gene	MACROD2	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disease, MONDO:0002254, MACROD2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31055587		False	1	0;0;100	2.156	True		ENSG00000172264	ENSG00000172264	HGNC:16126													
MAGT1	gene	MAGT1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	X-linked intellectual disability MONDO:0100284;Congenital disorder of glycosylation, type Icc, OMIM #301031			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31036665		False	1	0;50;50	2.156	True		ENSG00000102158	ENSG00000102158	HGNC:28880													
MARK4	gene	MARK4	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), MARK4-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 38041405		False	1	0;100;0	2.156	True	Other	ENSG00000007047	ENSG00000007047	HGNC:13538													
MARS2	gene	MARS2	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Combined oxidative phosphorylation deficiency 25, OMIM #616430;Spastic ataxia 3, autosomal recessive, OMIM #611390			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 25754315		False	1	0;50;50	2.156	True		ENSG00000247626	ENSG00000247626	HGNC:25133													
MCM4	gene	MCM4	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 54;OMIM #609981			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000104738	ENSG00000104738	HGNC:6947													
MED14	gene	MED14	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder (MONDO:0700092), MED14-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40597352		False	1	0;0;100	2.156	True		ENSG00000180182	ENSG00000180182	HGNC:2370													
MELK	gene	MELK	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, MELK-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41973119		False	1	0;0;100	2.156	False		ENSG00000165304	ENSG00000165304	HGNC:16870													
MEPCE	gene	MEPCE	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;seizures;no OMIM number yet			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31467394		False	1	0;0;100	2.156	True		ENSG00000146834	ENSG00000146834	HGNC:20247													
MET	gene	MET	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder, MONDO:0100038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000105976	ENSG00000105976	HGNC:7029													
METAP1	gene	METAP1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability, aggression, neurodevelopmental delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32764695		False	1	0;0;100	2.156	True		ENSG00000164024	ENSG00000164024	HGNC:15789													
MFN2	gene	MFN2	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2A2A, OMIM #609260;Charcot-Marie-Tooth disease, axonal, type 2A2B, OMIM #617087;Hereditary motor and sensory neuropathy VIA, OMIM #601152			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000116688	ENSG00000116688	HGNC:16877													
MGME1	gene	MGME1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 11;OMIM#615084			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 23313956		False	1	0;0;100	2.156	True		ENSG00000125871	ENSG00000125871	HGNC:16205													
MGP	gene	MGP	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Keutel syndrome;OMIM #245150			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000111341	ENSG00000111341	HGNC:7060													
MID2	gene	MID2	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	?Mental retardation, X-linked 101;OMIM#300928			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 24115387		False	1	0;0;100	2.156	True		ENSG00000080561	ENSG00000080561	HGNC:7096													
MIS18BP1	gene	MIS18BP1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cornelia de Lange syndrome (MONDO:0016033)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40677927		False	1	0;0;100	2.156	True		ENSG00000129534	ENSG00000129534	HGNC:20190													
MLH1	gene	MLH1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mismatch repair cancer syndrome, OMIM #276300;Muir-Torre syndrome, OMIM #158320			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000076242	ENSG00000076242	HGNC:7127													
MNX1	gene	MNX1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Currarino syndrome;OMIM #176450			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000130675	ENSG00000130675	HGNC:4979													
MORF4L1	gene	MORF4L1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, MORF4L1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42457791		False	1	0;0;100	2.156	True		ENSG00000185787	ENSG00000185787	HGNC:16989													
MPI	gene	MPI	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ib, MIM# 602579;MPI-CDG MONDO:0011257			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12414827;9585601;10980531;33098580;33204592;32905087;32266963;30242110		False	1	0;0;100	2.156	True		ENSG00000178802	ENSG00000178802	HGNC:7216													
MPZ	gene	MPZ	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Various CMT types			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000158887	ENSG00000158887	HGNC:7225													
MRAP	gene	MRAP	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glucocorticoid deficiency 2;OMIM #607398			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000170262	ENSG00000170262	HGNC:1304													
MRPS16	gene	MRPS16	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 2;OMIM #610498			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 15505824		False	1	0;0;100	2.156	True		ENSG00000182180	ENSG00000182180	HGNC:14048													
MSH6	gene	MSH6	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Colorectal cancer, hereditary nonpolyposis, type 5, OMIM #614350;Mismatch repair cancer syndrome, OMIM #276300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000116062	ENSG00000116062	HGNC:7329													
MTM1	gene	MTM1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Myotubular myopathy, X-linked;OMIM#310400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000171100	ENSG00000171100	HGNC:7448													
MTMR2	gene	MTMR2	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4B1;OMIM #601382			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000087053	ENSG00000087053	HGNC:7450													
MTPAP	gene	MTPAP	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Spastic ataxia 4, autosomal recessive;OMIM#613672			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000107951	ENSG00000107951	HGNC:25532													
MYCBP2	gene	MYCBP2	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, MYCBP2-related;corpus callosum abnormalities			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36200388		False	1	50;0;50	2.156	True		ENSG00000005810	ENSG00000005810	HGNC:23386													
MYH3	gene	MYH3	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Arthrogryposis, distal, type 2A (Freeman-Sheldon), OMIM #193700;Arthrogryposis, distal, type 2B3 (Sheldon-Hall), OMIM #618436;Contractures, pterygia, and variable skeletal fusions syndrome 1A, OMIM #178110;Contractures, pterygia, and variable skeletal fusions syndrome 1B, OMIM #618469			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000109063	ENSG00000109063	HGNC:7573													
MYMK	gene	MYMK	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carey-Fineman-Ziter syndrome;OMIM #254940			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;100;0	2.156	True		ENSG00000187616	ENSG00000187616	HGNC:33778													
MYO7A	gene	MYO7A	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Deafness, autosomal dominant 11, OMIM #601317;Deafness, autosomal recessive 2, OMIM #600060;Usher syndrome, type 1B, OMIM #276900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000137474	ENSG00000137474	HGNC:7606													
MYT1	gene	MYT1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33710394		False	1	0;0;100	2.156	True		ENSG00000196132	ENSG00000196132	HGNC:7622													
NAA30	gene	NAA30	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, MONDO:0700092, NAA30-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 37387332		False	1	0;0;100	2.156	True		ENSG00000139977	ENSG00000139977	HGNC:19844													
NAGS	gene	NAGS	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	N-acetylglutamate synthase deficiency, MIM#237310			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000161653	ENSG00000161653	HGNC:17996													
NAT8L	gene	NAT8L	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	N-acetylaspartate deficiency - MIM#614063			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11310630;19807691;32275776		False	1	0;50;50	2.156	True		ENSG00000185818	ENSG00000185818	HGNC:26742													
NDN	gene	NDN	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	"Prader-Willi syndrome, MIM#	176270"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000182636	ENSG00000182636	HGNC:7675													
NEGR1	gene	NEGR1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000172260	ENSG00000172260	HGNC:17302													
NFE2L1	gene	NFE2L1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disease, MONDO:0002254			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35112409		False	1	0;0;100	2.156	True		ENSG00000082641	ENSG00000082641	HGNC:7781													
NGF	gene	NGF	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type V, MIM# 608654			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000134259	ENSG00000134259	HGNC:7808													
NHEJ1	gene	NHEJ1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation, MIM#611291			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16439204		False	1	0;0;100	2.156	True		ENSG00000187736	ENSG00000187736	HGNC:25737													
NHLRC1	gene	NHLRC1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2B (Lafora), MIM#254780			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000187566	ENSG00000187566	HGNC:21576													
NIN	gene	NIN	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seckel syndrome 7, MIM#614851			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22933543		False	1	0;0;100	2.156	True		ENSG00000100503	ENSG00000100503	HGNC:14906													
NOP10	gene	NOP10	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dyskeratosis congenita, autosomal recessive 1, MIM#224230			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17507419		False	1	0;0;100	2.156	True		ENSG00000182117	ENSG00000182117	HGNC:14378													
NOP58	gene	NOP58	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, NOP58-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41383020		False	1	0;0;100	2.156	True		ENSG00000055044	ENSG00000055044	HGNC:29926													
NRXN2	gene	NRXN2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21424692;30709877;25745399		False	1	0;0;100	2.156	True		ENSG00000110076	ENSG00000110076	HGNC:8009													
NTNG1	gene	NTNG1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000162631	ENSG00000162631	HGNC:23319													
NUP62	gene	NUP62	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Striatonigral degeneration, infantile, MIM#271930			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16786527		False	1	0;0;100	2.156	True		ENSG00000213024	ENSG00000213024	HGNC:8066													
ORC1	gene	ORC1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Meier-Gorlin syndrome 1, MIM# 224690			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000085840	ENSG00000085840	HGNC:8487													
ORC4	gene	ORC4	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Meier-Gorlin syndrome 2;OMIM #613800			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000115947	ENSG00000115947	HGNC:8490													
ORC6	gene	ORC6	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Meier-Gorlin syndrome 3;OMIM #613803			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000091651	ENSG00000091651	HGNC:17151													
PANK2	gene	PANK2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 1, MIM#234200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PAX2	gene	PAX2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Papillorenal syndrome, MIM#120330			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000075891	ENSG00000075891	HGNC:8616													
PAX3	gene	PAX3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Craniofacial-deafness-hand syndrome, MIM#122880;Waardenburg syndrome, type 1, MIM#193500;Waardenburg syndrome, type 3, MIM#148820			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000135903	ENSG00000135903	HGNC:8617													
PAX7	gene	PAX7	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, congenital, progressive, with scoliosis, MIM# 618578			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000009709	ENSG00000009709	HGNC:8621													
PCBD1	gene	PCBD1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, D, MIM#264070			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000166228	ENSG00000166228	HGNC:8646													
PCDH10	gene	PCDH10	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	27567313;18621663		False	1	0;0;100	2.156	True		ENSG00000138650	ENSG00000138650	HGNC:13404													
PCDH15	gene	PCDH15	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Deafness, autosomal recessive 23, MIM#609533			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000150275	ENSG00000150275	HGNC:14674													
PCDH9	gene	PCDH9	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000184226	ENSG00000184226	HGNC:8661													
PDE11A	gene	PDE11A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Pigmented nodular adrenocortical disease, primary, 2, MIM#610475			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000128655	ENSG00000128655	HGNC:8773													
PDGFB	gene	PDGFB	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 5, MIM#615483			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000100311	ENSG00000100311	HGNC:8800													
PDSS2	gene	PDSS2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 3 MIM#614652			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28125198;29032433;25349199;17186472;21723727;10972372		False	1	0;0;100	2.156	True		ENSG00000164494	ENSG00000164494	HGNC:23041													
PHKA2	gene	PHKA2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Glycogen storage disease, type IXa1, MIM#306000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000044446	ENSG00000044446	HGNC:8926													
PHKG2	gene	PHKG2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease IXc, MIM#613027			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000156873	ENSG00000156873	HGNC:8931													
PIGF	gene	PIGF	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Onychodystrophy, osteodystrophy, impaired intellectual development, and seizures syndrome, MIM# 619356			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33386993		False	1	0;0;100	2.156	True		ENSG00000151665	ENSG00000151665	HGNC:8962													
PIK3C3	gene	PIK3C3	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cornelia de Lange syndrome - MONDO:0016033			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40677927		False	1	0;0;100	2.156	True		ENSG00000078142	ENSG00000078142	HGNC:8974													
PIK3R1	gene	PIK3R1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	SHORT syndrome, MIM#269880			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000145675	ENSG00000145675	HGNC:8979													
PINK1	gene	PINK1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Parkinson disease 6, early onset, MIM#605909			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000158828	ENSG00000158828	HGNC:14581													
PIP5K1B	gene	PIP5K1B	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000107242	ENSG00000107242	HGNC:8995													
PNP	gene	PNP	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM#613179			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000198805	ENSG00000198805	HGNC:7892													
POLD1	gene	POLD1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;immunodeficiency			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31449058		False	1	0;0;100	2.156	True		ENSG00000062822	ENSG00000062822	HGNC:9175													
POLD2	gene	POLD2	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;immunodeficiency			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31449058		False	1	0;0;100	2.156	True		ENSG00000106628	ENSG00000106628	HGNC:9176													
POLR3D	gene	POLR3D	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, MONDO:0019046, POLR3D-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37915380		False	1	0;0;100	2.156	True		ENSG00000168495	ENSG00000168495	HGNC:1080													
PON3	gene	PON3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000105852	ENSG00000105852	HGNC:9206													
POP1	gene	POP1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Anauxetic dysplasia 2, MIM#617396			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	38351533		False	1	0;50;50	2.156	True		ENSG00000104356	ENSG00000104356	HGNC:30129													
POU1F1	gene	POU1F1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Pituitary hormone deficiency, combined, 1, MIM# 613038			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000064835	ENSG00000064835	HGNC:9210													
PPID	gene	PPID	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Stutter disorder, (MONDO:0000723), PPID-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	37977818		False	1	0;0;100	2.156	True		ENSG00000171497	ENSG00000171497	HGNC:9257													
PPOX	gene	PPOX	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Porphyria variegata, MIM#176200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000143224	ENSG00000143224	HGNC:9280													
PPP1R2	gene	PPP1R2	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, PPP1R2-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40597352;26558779		False	1	0;0;100	2.156	True		ENSG00000184203	ENSG00000184203	HGNC:9288													
PPP2R5E	gene	PPP2R5E	Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mendelian neurodevelopmental disorder MONDO:0100500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 39284558		False	1	0;0;100	2.156	False		ENSG00000154001	ENSG00000154001	HGNC:9313													
PRDM8	gene	PRDM8	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic, 10, MIM#616640			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22961547		False	1	0;0;100	2.156	True		ENSG00000152784	ENSG00000152784	HGNC:13993													
PREPL	gene	PREPL	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenic syndrome, congenital, 22, MIM#616224			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28726805		False	1	0;0;100	2.156	True		ENSG00000138078	ENSG00000138078	HGNC:30228													
PREX1	gene	PREX1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), PREX1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42399407;26621702		False	1	0;0;100	2.156	True		ENSG00000124126	ENSG00000124126	HGNC:32594													
PRF1	gene	PRF1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hemophagocytic lymphohistiocytosis, familial, 2, MIM#603553			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000180644	ENSG00000180644	HGNC:9360													
PRICKLE1	gene	PRICKLE1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Epilepsy, progressive myoclonic 1B, MIM#612437			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000139174	ENSG00000139174	HGNC:17019													
PRKDC	gene	PRKDC	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 26, with or without neurologic abnormalities, MIM#615966			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19075392;23722905		False	1	0;0;100	2.156	True		ENSG00000253729	ENSG00000253729	HGNC:9413													
PRKN	gene	PRKN	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease, juvenile, type 2, MIM#600116			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRKRA	gene	PRKRA	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 16, MIM#612067			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000180228	ENSG00000180228	HGNC:9438													
PROSER1	gene	PROSER1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disease MONDO:0002254, PROSER1-related;Developmental delay, hypotonia, seizures, failure-to-thrive, strabismus, drooling, recurrent otitis media, hearing impairment, and genitourinary malformations, no OMIM #			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35229282		False	1	0;0;100	2.156	True		ENSG00000120685	ENSG00000120685	HGNC:20291													
PRRX1	gene	PRRX1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Agnathia-otocephaly complex, MIM#202650			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000116132	ENSG00000116132	HGNC:9142													
PRX	gene	PRX	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4F, MIM#614895			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000105227	ENSG00000105227	HGNC:13797													
PSMC1	gene	PSMC1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Birk-Aharoni syndrome MIM# 620071			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 35861243		False	1	0;0;100	2.156	True		ENSG00000100764	ENSG00000100764	HGNC:9547													
PYGL	gene	PYGL	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease VI, MIM#232700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000100504	ENSG00000100504	HGNC:9725													
QSER1	gene	QSER1	Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, QSER1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 41139957		False	1	0;0;100	2.156	True		ENSG00000060749	ENSG00000060749	HGNC:26154													
RAB27A	gene	RAB27A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Griscelli syndrome, type 2, MIM#607624			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000069974	ENSG00000069974	HGNC:9766													
RAB40AL	gene	RAB40AL	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	MENTAL RETARDATION, X-LINKED, SYNDROMIC, MARTIN-PROBST TYPE			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25044830		False	1	0;0;100	2.156	True		ENSG00000102128	ENSG00000102128	HGNC:25410													
RAB5IF	gene	RAB5IF	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Craniofacial dysmorphism, skeletal anomalies, and impaired intellectual development syndrome 2, MIM# 616994			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35614220;24194475		False	1	0;0;100	2.156	True		ENSG00000101084	ENSG00000101084	HGNC:15870													
RALGAPB	gene	RALGAPB	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorders, autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 32853829		False	1	0;0;100	2.156	True		ENSG00000170471	ENSG00000170471	HGNC:29221													
RANBP2	gene	RANBP2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Encephalopathy, acute, infection-induced, 3, susceptibility to, MIM# 608033			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000153201	ENSG00000153201	HGNC:9848													
RAPSN	gene	RAPSN	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenic syndrome, congenital, 11, associated with acetylcholine receptor deficiency, MIM#616326			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000165917	ENSG00000165917	HGNC:9863													
RASA1	gene	RASA1	Expert Review;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000145715	ENSG00000145715	HGNC:9871													
RAX	gene	RAX	Expert Review;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	MICROPHTHALMIA, ISOLATED 3;MCOP3			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30762128;24033328		False	1	0;0;100	2.156	True		ENSG00000134438	ENSG00000134438	HGNC:18662													
RBFOX3	gene	RBFOX3	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), RBFOX3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35951651;36117209;24039908;40011789		False	1	0;100;0	2.156	False		ENSG00000167281	ENSG00000167281	HGNC:27097													
RBM8A	gene	RBM8A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thrombocytopenia-absent radius syndrome, MIM#274000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		-	ENSG00000265241	HGNC:9905													
RBPJ	gene	RBPJ	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Adams-Oliver syndrome 3, MIM#614814			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22883147;29924900		False	1	0;0;100	2.156	True		ENSG00000168214	ENSG00000168214	HGNC:5724													
RDH14	gene	RDH14	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, RDH14-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34848785		False	1	0;0;100	2.156	True		ENSG00000240857	ENSG00000240857	HGNC:19979													
RECQL4	gene	RECQL4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Baller-Gerold syndrome, MIM#218600;RAPADILINO syndrome, MIM#266280;Rothmund-Thomson syndrome, type 2,MIM#268400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000160957	ENSG00000160957	HGNC:9949													
RET	gene	RET	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Central hypoventilation syndrome, congenital, MIM#209880;Medullary thyroid carcinoma, MIM#155240;Multiple endocrine neoplasia IIA, MIM#171400;Multiple endocrine neoplasia IIB, MIM#162300			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000165731	ENSG00000165731	HGNC:9967													
RFX6	gene	RFX6	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitchell-Riley syndrome, MIM#615710			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000185002	ENSG00000185002	HGNC:21478													
RIMS1	gene	RIMS1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism;Cone-rod dystrophy 7 , MIM#603649			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25284784;12659814		False	1	0;0;100	2.156	True		ENSG00000079841	ENSG00000079841	HGNC:17282													
RIN2	gene	RIN2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Macrocephaly, alopecia, cutis laxa, and scoliosis, MIM#613075			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000132669	ENSG00000132669	HGNC:18750													
RNF135	gene	RNF135	Expert Review Red;Genetic Health Queensland;Victorian Clinical Genetics Services	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000181481	ENSG00000181481	HGNC:21158													
RNH1	gene	RNH1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, RNH1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 36935417		False	1	0;0;100	2.156	True		ENSG00000023191	ENSG00000023191	HGNC:10074													
RPL11	gene	RPL11	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Diamond-Blackfan anemia 7, MIM#612562			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000142676	ENSG00000142676	HGNC:10301													
RPS19	gene	RPS19	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Diamond-Blackfan anemia 1, MIM#105650			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000105372	ENSG00000105372	HGNC:10402													
RPS28	gene	RPS28	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Diamond Blackfan anemia 15 with mandibulofacial dysostosis, MIM#606164			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000233927	ENSG00000233927	HGNC:10418													
RUBCN	gene	RUBCN	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 15, MIM#615705			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30237576;20826435;23728897		False	1	0;0;100	2.156	True		ENSG00000145016	ENSG00000145016	HGNC:28991													
SALL1	gene	SALL1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Townes-Brocks syndrome 1, MIM#107480			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000103449	ENSG00000103449	HGNC:10524													
SAMD9L	gene	SAMD9L	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33710394		False	1	0;0;100	2.156	True		ENSG00000177409	ENSG00000177409	HGNC:1349													
SBDS	gene	SBDS	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Shwachman-Diamond syndrome, MIM#260400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19906387		False	1	0;0;100	2.156	True		ENSG00000126524	ENSG00000126524	HGNC:19440													
SCN11A	gene	SCN11A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuropathy, hereditary sensory and autonomic, type VII, MIM#615548			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000168356	ENSG00000168356	HGNC:10583													
SCN9A	gene	SCN9A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epilepsy, generalized, with febrile seizures plus, type 7, MIM#613863;HSAN2D, autosomal recessive, MIM#243000			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000169432	ENSG00000169432	HGNC:10597													
SCO1	gene	SCO1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 4, MIM# 619048			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11013136;19295170;31352446;23878101		False	1	0;0;100	2.156	True		ENSG00000133028	ENSG00000133028	HGNC:10603													
SEC24C	gene	SEC24C	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SEC24C-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40131364		False	1	0;0;100	2.156	True		ENSG00000176986	ENSG00000176986	HGNC:10705													
SELENON	gene	SELENON	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Muscular dystrophy, rigid spine, 1, MIM# 602771;Myopathy, congenital, with fiber-type disproportion, MIM# 255310			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000162430	ENSG00000162430	HGNC:15999													
SF3B4	gene	SF3B4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Acrofacial dysostosis 1, Nager type, MIM#154400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000143368	ENSG00000143368	HGNC:10771													
SGCA	gene	SGCA	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Muscular dystrophy, limb-girdle, autosomal recessive 3, MIM#608099			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000108823	ENSG00000108823	HGNC:10805													
SH3TC2	gene	SH3TC2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4C, MIM#601596			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000169247	ENSG00000169247	HGNC:29427													
SHROOM4	gene	SHROOM4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Stocco dos Santos X-linked mental retardation syndrome, 300434;Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16249884;26740508		False	1	0;50;50	2.156	True		ENSG00000158352	ENSG00000158352	HGNC:29215													
SLC12A1	gene	SLC12A1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bartter syndrome, type 1, MIM#601678			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000074803	ENSG00000074803	HGNC:10910													
SLC19A2	gene	SLC19A2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine-responsive megaloblastic anemia syndrome, MIM#249270			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000117479	ENSG00000117479	HGNC:10938													
SLC1A3	gene	SLC1A3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 6, MIM#612656			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000079215	ENSG00000079215	HGNC:10941													
SLC22A5	gene	SLC22A5	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Carnitine deficiency, systemic primary, MIM#212140			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000197375	ENSG00000197375	HGNC:10969													
SLC25A13	gene	SLC25A13	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Citrullinemia, type II, neonatal-onset, MIM#605814			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000004864	ENSG00000004864	HGNC:10983													
SLC25A19	gene	SLC25A19	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, Amish type, MIM#607196;Thiamine metabolism dysfunction syndrome 4 (progressive polyneuropathy type), MIM#613710			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31506564;31295743;12185364;19798730		False	1	0;0;100	2.156	True		ENSG00000125454	ENSG00000125454	HGNC:14409													
SLC25A20	gene	SLC25A20	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carnitine-acylcarnitine translocase deficiency, MIM#212138			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000178537	ENSG00000178537	HGNC:1421													
SLC25A24	gene	SLC25A24	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Fontaine progeroid syndrome, MIM#612289			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000085491	ENSG00000085491	HGNC:20662													
SLC25A4	gene	SLC25A4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 12A (cardiomyopathic type) AD, MIM#617184;Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type) AR, MIM#615418;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 2, MIM#609283			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000151729	ENSG00000151729	HGNC:10990													
SLC27A3	gene	SLC27A3	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Inherited neurodegenerative disorder, MONDO:0024237, SLC27A3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 41054338		False	1	0;0;100	2.156	True		ENSG00000143554	ENSG00000143554	HGNC:10997													
SLC29A3	gene	SLC29A3	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Histiocytosis-lymphadenopathy plus syndrome;OMIM #602782			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000198246	ENSG00000198246	HGNC:23096													
SLC2A10	gene	SLC2A10	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Arterial tortuosity syndrome;OMIM #208050			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000197496	ENSG00000197496	HGNC:13444													
SLC39A4	gene	SLC39A4	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acrodermatitis enteropathica;OMIM #201100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000147804	ENSG00000147804	HGNC:17129													
SLC44A1	gene	SLC44A1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	progressive ataxia;tremor;cognitive decline;dysphagia;optic atrophy;dysarthria			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31855247		False	1	100;0;0	2.156	True		ENSG00000070214	ENSG00000070214	HGNC:18798													
SLC5A2	gene	SLC5A2	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Renal glucosuria;OMIM #233100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000140675	ENSG00000140675	HGNC:11037													
SLC6A4	gene	SLC6A4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	autism spectrum disorder MONDO:0005258;{Obsessive-compulsive disorder}, MIM# 164230			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31629822		False	1	0;0;100	2.156	True		ENSG00000108576	ENSG00000108576	HGNC:11050													
SLC7A7	gene	SLC7A7	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysinuric protein intolerance, MIM# 222700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000155465	ENSG00000155465	HGNC:11065													
SLC9A9	gene	SLC9A9	ClinGen;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{?Autism susceptibility 16}, MIM# 613410			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18621663;31134136;27123481;26755066		False	1	0;0;100	2.156	True		ENSG00000181804	ENSG00000181804	HGNC:20653													
SLX4	gene	SLX4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fanconi anaemia, complementation group P, MIM# 613951			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21240277;21240275;23093618;26453996		False	1	0;0;100	2.156	True		ENSG00000188827	ENSG00000188827	HGNC:23845													
SMCHD1	gene	SMCHD1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bosma arhinia microphthalmia syndrome, OMIM #603457;Fascioscapulohumeral muscular dystrophy 2, digenic;OMIM #158901			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000101596	ENSG00000101596	HGNC:29090													
SMG5	gene	SMG5	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SMG5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41758221		False	1	0;0;100	2.156	True		ENSG00000198952	ENSG00000198952	HGNC:24644													
SMG6	gene	SMG6	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000070366	ENSG00000070366	HGNC:17809													
SNRPA	gene	SNRPA	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	no OMIM # yet			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 29437235		False	1	0;0;100	2.156	True		ENSG00000077312	ENSG00000077312	HGNC:11151													
SNRPE	gene	SNRPE	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypotrichosis 11;OMIM #615059			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	31671093;23246290		False	1	0;0;100	2.156	True		ENSG00000182004	ENSG00000182004	HGNC:11161													
SOBP	gene	SOBP	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Impaired intellectual development, anterior maxillary protrusion, and strabismus, MIM# 613671			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21035105		False	1	0;0;100	2.156	True		ENSG00000112320	ENSG00000112320	HGNC:29256													
SOST	gene	SOST	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Craniodiaphyseal dysplasia, autosomal dominant, OMIM #122860;Sclerosteosis 1 , OMIM #269500;Van Buchem disease, OMIM #239100			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000167941	ENSG00000167941	HGNC:13771													
SOX8	gene	SOX8	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), SOX8-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	https://www.neurology.org/doi/full/10.1212/NXG.0000000000200088		False	1	0;0;100	2.156	True		ENSG00000005513	ENSG00000005513	HGNC:11203													
SP7	gene	SP7	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Osteogenesis imperfecta, type XII;OMIM # 613849			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000170374	ENSG00000170374	HGNC:17321													
SPAG9	gene	SPAG9	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SPAG9-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39846792		False	1	0;0;100	2.156	True		ENSG00000008294	ENSG00000008294	HGNC:14524													
SPAST	gene	SPAST	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 4, autosomal dominant, MIM# 182601			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000021574	ENSG00000021574	HGNC:11233													
SPEG	gene	SPEG	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Centronuclear myopathy 5;OMIM #615959			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000072195	ENSG00000072195	HGNC:16901													
SPG7	gene	SPG7	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 7, autosomal recessive;OMIM #607259			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	50;0;50	2.156	True		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPINK5	gene	SPINK5	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Netherton syndrome;OMIM #256500			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000133710	ENSG00000133710	HGNC:15464													
SPRTN	gene	SPRTN	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ruijs-Aalfs syndrome, MIM# 616200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25261934		False	1	0;0;100	2.156	True		ENSG00000010072	ENSG00000010072	HGNC:25356													
SPTBN5	gene	SPTBN5	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SPTBN5-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	35782384;36117916;36238261		False	1	50;0;50	2.156	True		ENSG00000137877	ENSG00000137877	HGNC:15680													
SPTLC1	gene	SPTLC1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuropathy, hereditary sensory and autonomic, type IA;OMIM #162400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000090054	ENSG00000090054	HGNC:11277													
SRPX2	gene	SRPX2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Rolandic epilepsy, mental retardation, and speech dyspraxia, MIM# 300643			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16497722;23933820;23871722		False	1	0;0;100	2.156	True		ENSG00000102359	ENSG00000102359	HGNC:30668													
ST7	gene	ST7	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000004866	ENSG00000004866	HGNC:11351													
STAC3	gene	STAC3	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, congenital, Baily-Bloch;OMIM #255995			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000185482	ENSG00000185482	HGNC:28423													
STAT5B	gene	STAT5B	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Growth hormone insensitivity with immunodeficiency;OMIM #245590			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000173757	ENSG00000173757	HGNC:11367													
STK3	gene	STK3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000104375	ENSG00000104375	HGNC:11406													
STT3B	gene	STT3B	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Congenital disorder of glycosylation, type Ix;OMIM #615597			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 23842455		False	1	0;0;100	2.156	True		ENSG00000163527	ENSG00000163527	HGNC:30611													
STX11	gene	STX11	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hemophagocytic lymphohistiocytosis, familial, 4, MIM# 603552			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000135604	ENSG00000135604	HGNC:11429													
SYNE2	gene	SYNE2	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SYNE2 related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34573277		False	1	0;0;100	2.156	True		ENSG00000054654	ENSG00000054654	HGNC:17084													
SYT14	gene	SYT14	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 11, MIM# 614229			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21835308		False	1	0;0;100	2.156	True		ENSG00000143469	ENSG00000143469	HGNC:23143													
TECR	gene	TECR	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive, MIM#614020			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21212097		False	1	0;0;100	2.156	True		ENSG00000099797	ENSG00000099797	HGNC:4551													
TFAP2A	gene	TFAP2A	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Branchiooculofacial syndrome;OMIM #113620			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000137203	ENSG00000137203	HGNC:11742													
TFAP2B	gene	TFAP2B	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Char syndrome, OMIM #169100;Patent ductus arteriosus 2, OMIM #617035			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000008196	ENSG00000008196	HGNC:11743													
TFG	gene	TFG	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	?Spastic paraplegia 57, autosomal recessive, OMIM #615658;Hereditary motor and sensory neuropathy, Okinawa type, OMIM #604484			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000114354	ENSG00000114354	HGNC:11758													
TG	gene	TG	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thyroid dyshormonogenesis 3;OMIM #274700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000042832	ENSG00000042832	HGNC:11764													
TGFBR1	gene	TGFBR1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Loeys-Dietz syndrome 1;OMIM #609192			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000106799	ENSG00000106799	HGNC:11772													
TGFBR2	gene	TGFBR2	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Loeys-Dietz syndrome 2;OMIM #610168			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000163513	ENSG00000163513	HGNC:11773													
THAP1	gene	THAP1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 6, torsion;OMIM #602629			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000131931	ENSG00000131931	HGNC:20856													
THAP12	gene	THAP12	Expert Review Red;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, THAP12-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000137492	ENSG00000137492	HGNC:9440													
TIMM8A	gene	TIMM8A	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mohr-Tranebjaerg syndrome;OMIM #304700			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000126953	ENSG00000126953	HGNC:11817													
TMEM260	gene	TMEM260	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Structural heart defects and renal anomalies syndrome, MIM# 617478			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28318500		False	1	0;0;100	2.156	True		ENSG00000070269	ENSG00000070269	HGNC:20185													
TMLHE	gene	TMLHE	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	{Autism, susceptibility to, X-linked 6} 300872			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21865298		False	1	0;100;0	2.156	True		ENSG00000185973	ENSG00000185973	HGNC:18308													
TMPRSS7	gene	TMPRSS7	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, TMPRSS7-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40796295		False	1	0;0;100	2.156	True		ENSG00000176040	ENSG00000176040	HGNC:30846													
TP63	gene	TP63	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	TP63-related ectodermal dysplasia spectrum with limb and orofacial malformations, MONDO:1040001			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000073282	ENSG00000073282	HGNC:15979													
TPH2	gene	TPH2	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Attention deficit-hyperactivity disorder, susceptibility to, 7} 613003			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18347598		False	1	0;0;100	2.156	True		ENSG00000139287	ENSG00000139287	HGNC:20692													
TPK1	gene	TPK1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type), MIM# 614458			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000196511	ENSG00000196511	HGNC:17358													
TPR	gene	TPR	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 79, MIM# 620393			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34494102		False	1	0;0;100	2.156	True		ENSG00000047410	ENSG00000047410	HGNC:12017													
TRAPPC6A	gene	TRAPPC6A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000007255	ENSG00000007255	HGNC:23069													
TREM2	gene	TREM2	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2;OMIM #618193			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000095970	ENSG00000095970	HGNC:17761													
TRHR	gene	TRHR	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypothyroidism, congenital, nongoitrous, 7;OMIM #618573			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000174417	ENSG00000174417	HGNC:12299													
TRIM32	gene	TRIM32	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 11, MIM# 615988			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16606853		False	1	0;0;100	2.156	True		ENSG00000119401	ENSG00000119401	HGNC:16380													
TRIM37	gene	TRIM37	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mulibrey nanism;OMIM #253250			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000108395	ENSG00000108395	HGNC:7523													
TRIM74	gene	TRIM74	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, TRIM74-related, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40735933		False	1	0;0;100	2.156	True		ENSG00000155428	ENSG00000155428	HGNC:17453													
TRMT1L	gene	TRMT1L	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, TRMT1L-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39786990		False	1	0;0;100	2.156	True		ENSG00000121486	ENSG00000121486	HGNC:16782													
TSEN34	gene	TSEN34	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2C, MIM# 612390			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18711368		False	1	0;0;100	2.156	True		ENSG00000170892	ENSG00000170892	HGNC:15506													
TSHR	gene	TSHR	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypothyroidism, congenital, nongoitrous, 1, MIM# 275200			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000165409	ENSG00000165409	HGNC:12373													
TTBK1	gene	TTBK1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41545183		False	1	0;0;100	2.156	True		ENSG00000146216	ENSG00000146216	HGNC:19140													
TTC1	gene	TTC1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, MONDO:0020135, TTC1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40879651		False	1	0;0;100	2.156	True		ENSG00000113312	ENSG00000113312	HGNC:12391													
TTC14	gene	TTC14	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, TTC14-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42572047		False	1	0;0;100	2.156	True		ENSG00000163728	ENSG00000163728	HGNC:24697													
TTC21B	gene	TTC21B	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Nephronophthisis 12, OMIM #613820;Short-rib thoracic dysplasia 4 with or without polydactyly;OMIM #613819			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000123607	ENSG00000123607	HGNC:25660													
TTR	gene	TTR	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyloidosis, hereditary, transthyretin-related, OMIM #105210;Carpal tunnel syndrome, familial;OMIM #115430			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000118271	ENSG00000118271	HGNC:12405													
TUBA8	gene	TUBA8	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia, complex, with other brain malformations 8, MIM# 613180			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19896110;31481326;28388629		False	1	0;0;100	2.156	True		ENSG00000183785	ENSG00000183785	HGNC:12410													
TWNK	gene	TWNK	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), OMIM #271245;Perrault syndrome 5, OMIM #616138;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, OMIM #609286			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
TXNL4A	gene	TXNL4A	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Burn-McKeown syndrome, MIM# 608572			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000141759	ENSG00000141759	HGNC:30551													
UBE2U	gene	UBE2U	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Retinoschisis;cataracts;learning disabilities;developmental delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 33776059		False	1	0;0;100	2.156	True		ENSG00000177414	ENSG00000177414	HGNC:28559													
UBR4	gene	UBR4	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29062094;23982692;28600779		False	1	0;50;50	2.156	True		ENSG00000127481	ENSG00000127481	HGNC:30313													
UCHL1	gene	UCHL1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 79, autosomal recessive;OMIM #615491			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000154277	ENSG00000154277	HGNC:12513													
UGT1A1	gene	UGT1A1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Crigler-Najjar syndrome, type I, OMIM #218800;Crigler-Najjar syndrome, type II, OMIM #606785			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000241635	ENSG00000241635	HGNC:12530													
UNC13D	gene	UNC13D	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hemophagocytic lymphohistiocytosis, familial, 3;OMIM #608898			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000092929	ENSG00000092929	HGNC:23147													
UQCRB	gene	UQCRB	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 3;OMIM #615158			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 12709789;28604960		False	1	0;0;100	2.156	True		ENSG00000156467	ENSG00000156467	HGNC:12582													
UQCRC2	gene	UQCRC2	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 5;OMIM #615160			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000140740	ENSG00000140740	HGNC:12586													
UQCRQ	gene	UQCRQ	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 4;OMIM #615159			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 18439546		False	1	0;100;0	2.156	True		ENSG00000164405	ENSG00000164405	HGNC:29594													
UROC1	gene	UROC1	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Urocanase deficiency, MIM#276880			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19304569;30619714		False	1	0;0;100	2.156	True		ENSG00000159650	ENSG00000159650	HGNC:26444													
VAMP1	gene	VAMP1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic ataxia 1, autosomal dominant, OMIM #108600;Myasthenic syndrome, congenital, 25, OMIM #618323			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000139190	ENSG00000139190	HGNC:12642													
VANGL1	gene	VANGL1	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Caudal regression syndrome, OMIM #600145;{Neural tube defects, susceptibility to}, OMIM #182940			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000173218	ENSG00000173218	HGNC:15512													
VPS26C	gene	VPS26C	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), DSCR3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 31845315		False	1	0;0;100	2.156	True		ENSG00000157538	ENSG00000157538	HGNC:3044													
VPS45	gene	VPS45	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neutropenia, severe congenital, 5, autosomal recessive;OMIM #615285			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000136631	ENSG00000136631	HGNC:14579													
WASHC3	gene	WASHC3	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, WASHC3 related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40129681		False	1	0;0;100	2.156	True		ENSG00000120860	ENSG00000120860	HGNC:24256													
WASHC5	gene	WASHC5	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 8, autosomal dominant, OMIM #603563;Ritscher-Schinzel syndrome 1;OMIM #220210			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PubMed: 24065355		False	1	0;100;0	2.156	True		ENSG00000164961	ENSG00000164961	HGNC:28984													
WDR13	gene	WDR13	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000101940	ENSG00000101940	HGNC:14352													
WDR18	gene	WDR18	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cornelia de Lange syndrome - MONDO:0016033			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 40677927		False	1	0;0;100	2.156	True		ENSG00000065268	ENSG00000065268	HGNC:17956													
WDR19	gene	WDR19	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Short-rib thoracic dysplasia 5 with or without polydactyly, OMIM #614376;Nephronophthisis 13, OMIM #614377;Senior-Loken syndrome 8, OMIM#616307			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000157796	ENSG00000157796	HGNC:18340													
WDR83	gene	WDR83	Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, WDR83-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41381792		False	1	0;0;100	2.156	False	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000123154	ENSG00000123154	HGNC:32672													
WRAP53	gene	WRAP53	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dyskeratosis congenita, autosomal recessive 3;OMIM# 613988			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000141499	ENSG00000141499	HGNC:25522													
WWP1	gene	WWP1	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, WWP1-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41786693;32699206		False	1	0;0;100	2.156	True		ENSG00000123124	ENSG00000123124	HGNC:17004													
XIST	gene	XIST	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000229807	ENSG00000229807	HGNC:12810													
XPNPEP3	gene	XPNPEP3	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Nephronophthisis-like nephropathy 1, OMIM #613159			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20179356		False	1	0;0;100	2.156	True		ENSG00000196236	ENSG00000196236	HGNC:28052													
YBX3	gene	YBX3	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	39423228;38260399		False	1	0;0;100	2.156	True		ENSG00000060138	ENSG00000060138	HGNC:2428													
ZCCHC12	gene	ZCCHC12	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000174460	ENSG00000174460	HGNC:27273													
ZDHHC15	gene	ZDHHC15	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual disability, X-linked 91, 300577			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	34345675;32989326		False	1	0;0;100	2.156	True		ENSG00000102383	ENSG00000102383	HGNC:20342													
ZFP57	gene	ZFP57	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)	{Diabetes mellitus, transient neonatal, 1};OMIM# 601410			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000204644	ENSG00000204644	HGNC:18791													
ZNF185	gene	ZNF185	Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Cerebrooculonasal syndrome MONDO:0011575, ZNF185-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41404552		False	1	0;0;100	2.156	False		ENSG00000147394	ENSG00000147394	HGNC:12976													
ZNF41	gene	ZNF41	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	non-syndromic X-linked intellectual disability MONDO:0019181			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	14628291;23871722		False	1	0;0;100	2.156	True		ENSG00000147124	ENSG00000147124	HGNC:13107													
ZNF496	gene	ZNF496	Expert Review Red;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ZNF496-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	40806714		False	1	0;0;100	2.156	True		ENSG00000162714	ENSG00000162714	HGNC:23713													
ZNF507	gene	ZNF507	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000168813	ENSG00000168813	HGNC:23783													
ZNF674	gene	ZNF674	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	X-linked intellectual disability MONDO:0100284			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16385466		False	1	0;0;100	2.156	True		ENSG00000251192	ENSG00000251192	HGNC:17625													
ZNF804A	gene	ZNF804A	Expert list;Expert Review Red	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000170396	ENSG00000170396	HGNC:21711													
ZNF81	gene	ZNF81	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	X-linked intellectual disability MONDO:0100284			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	15121780		False	1	0;33;67	2.156	True		ENSG00000197779	ENSG00000197779	HGNC:13156													
ZNHIT6	gene	ZNHIT6	Expert Review Red;Genetic Health Queensland	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	1	0;0;100	2.156	True		ENSG00000117174	ENSG00000117174	HGNC:26089													
AFF2_FRAXE_GCC	str	AFF2	Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Fragile X syndrome, FRAXE type (OMIM 309548)			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	8334699;8673085;11388762		False	3	100;0;0	2.156	True		ENSG00000155966	ENSG00000155966	HGNC:3776	X	147582158	147582202	148500638	148500682	GCC	44	200					
ARX_EIEE1_GCN1	str	ARX	Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11889467;33811808		False	3	100;0;0	2.156	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031767	25031814	25013650	25013697	GCN	16	23					
ARX_EIEE1_GCN2	str	ARX	Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11889467;33811808		False	3	100;0;0	2.156	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031647	25031682	25013530	25013565	GCN	12	20					
BCLAF3_FRAXG_CCG	str	BCLAF3	Literature;Expert Review Green;Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	42482100		False	3	100;0;0	2.156	False		ENSG00000173681	ENSG00000173681	HGNC:27413	X	20009041	20009091	19990923	19990973	CCG	57	117					
DMPK_DM1_CTG	str	DMPK	Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myotonic dystrophy 1 MIM#160900			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301344;29325606		False	3	100;0;0	2.156	True		ENSG00000104936	ENSG00000104936	HGNC:2933	19	46273463	46273522	45770205	45770264	CTG	34	50					
EIF4A3_RCPS_complex	str	EIF4A3	Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Robin sequence with cleft mandible and limb anomalies MIM#268305;Richieri-Costa-Pereira syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24360810;29112243		False	3	100;0;0	2.156	True		ENSG00000141543	ENSG00000141543	HGNC:18683	17	78120803	78120938	80147004	80147139	TCGGCAGCGGCGCAGCGAGG	12	14					
FMR1_FXS_CGG	str	FMR1	Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Fragile X syndrome	MIM#300624"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33795824;25227148;1710175;2031184		False	3	100;0;0	2.156	True		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	200					
GLS_GDPAG_GCA	str	GLS	Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30970188		False	3	100;0;0	2.156	True		ENSG00000115419	ENSG00000115419	HGNC:4331	2	191745599	191745646	190880873	190880920	GCA	16	400					
XYLT1_DBQD2_GGC	str	XYLT1	Expert Review Green;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Desbuquois dysplasia 2 MIM#615777			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30554721		False	3	100;0;0	2.156	True		ENSG00000103489	ENSG00000103489	HGNC:15516	16	17564765	17564779	17470908	17470922	GGC	20	120					
ZIC2_HPE5_GCN	str	ZIC2	Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Holoprosencephaly 5 MIM#609637			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	11285244;33811808		False	3	100;0;0	2.156	False		ENSG00000043355	ENSG00000043355	HGNC:12873	13	100637703	100637747	99985449	99985493	GCN	15	25					
AFF3_FRA2A_CGG	str	AFF3	Expert Review Amber;Literature;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, AFF3-related			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24763282;39313615;33510257		False	2	0;100;0	2.156	True		ENSG00000144218	ENSG00000144218	HGNC:6473	2	100721262	100721285	100104800	100104823	CGG	20	300					
DIP2B_FRA12A_CGG	str	DIP2B	Expert Review Amber;Other	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, FRA12A type MIM#136630			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	17236128;33510257;39854091;41028987		False	2	0;100;0	2.156	True		ENSG00000066084	ENSG00000066084	HGNC:29284	12	50898787	50898807	50505004	50505024	CGG	23	280					
ZNF713_FRA7A_CGG	str	ZNF713	Expert Review Amber;Literature;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autism spectrum disorder			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25196122;33510257		False	2	0;100;0	2.156	True		ENSG00000178665	ENSG00000178665	HGNC:22043	7	55955295	55955330	55887602	55887637	CGG	22	450					
C11orf80_FRA11A_CGG	str	TOP6BL	Expert Review Red;Literature;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	Unknown	Neurodevelopmental disorder, MONDO:0700092			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18160775;453198		False	1	0;0;100	2.156	True		ENSG00000173715	ENSG00000173715	HGNC:26197	11	66512291	66512316	66744820	66744845	CGG	11	500					
CBL_FRA11B_CCG	str	CBL	Expert Review Red;Literature;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Jacobsen syndrome MIM#147791			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7881408;7603564;9508241;9927483;10767345;11076037;19267933		False	1	0;50;50	2.156	True		ENSG00000110395	ENSG00000110395	HGNC:1541	11	119076999	119077032	119206289	119206322	CCG	79	101					
TMEM185A_FRAXF_GCC	str	TMEM185A	Expert Review Red;Literature;Literature	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	7874164;10094554;8651274		False	1	0;0;100	2.156	True		-	ENSG00000269556	HGNC:17125	X	148713390	148713437	149631714	149631781	GCC	29	900					
ISCA-37390-Loss	region		Expert Review Green;Expert Review;Expert Review	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cri-du-chat syndrome MIM#123450;intellectual disability;microcephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	16953888		False	3	100;0;0	2.156	True					5			37695	11347150				3		80	small	Cri-du-chat syndrome, 5p15 terminal deletion syndrome
ISCA-37392-Gain	region		Expert Review Green;Expert Review;Expert Review	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 7q11.23 duplication syndrome, MIM#	609757;intellectual disability;hypotonia;macrocephaly;seizures;aortic dilatation"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	33187326;27615053;26610320		False	3	100;0;0	2.156	True					7			73330451	74728175					3	80	cnv_gain	7q11.23 duplication syndrome
ISCA-37392-Loss	region		Expert Review Green;Expert Review;Expert Review	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Williams-Beuren syndrome, MIM#	194050;intellectual disability;growth retardation;cardiovascular disease"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301427		False	3	100;0;0	2.156	True					7			73330451	74728175				3		80	cnv_loss	Williams-Beuren syndrome, 7q11.23 deletion syndrome
ISCA-37393-Gain	region		Expert Review Green;Expert Review;Expert Review	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Cat eye syndrome, MIM#	115470;coloboma;anal atresia;heart and renal malformations"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True					22			16912063	18109094					3	80	cnv_gain	Cat eye syndrome, 22q11.21 tetrasomy syndrome
ISCA-37394-Loss	region	HDAC4	Expert Review Green;Expert Review;Expert Review	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 2q37 deletion syndrome, MIM#	600430;brachydactyly;intellectual disability"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20691407		False	3	100;0;0	2.156	True		ENSG00000068024	ENSG00000068024	HGNC:14063	2			239032997	241988449				3		80	cnv_loss	2q37.3 deletion syndrome
ISCA-37396-Loss	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 15q24 deletion syndrome, MIM#613406;intellectual disability;facial dysmorphisms;congenital malformations of the hands and feet, eye, and genitalia;joint laxity;and growth retardation and failure to thrive			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22180641;19557438;19233321;22359776		False	3	100;0;0	2.156	True					15			72671374	75680568				3		80	cnv_loss	Chromosome 15q24 deletion syndrome
ISCA-37397-Gain	region		ClinGen;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 22q11.2 microduplication syndrome, MIM#608363, distal;intellectual disability;dysmorphic features;congenital anomalies			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21671380;31479204		False	3	100;0;0	2.156	True					22			21562828	22620608					3	80	cnv_gain	Chromosome 22q11.2 microduplication syndrome, MIM#608363, distal
ISCA-37397-Loss	region		ClinGen;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 22q11.2 deletion syndrome, distal, MIM#611867;intellectual disability;seizures;growth retardation;multiple congenital anomalies			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21671380;23765049;18179902		False	3	100;0;0	2.156	True					22			21562828	22620608				3		80	cnv_loss	Chromosome 22q11.2 deletion syndrome, distal, MIM#611867
ISCA-37400-Gain	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 16p11.2 duplication syndrome, MIM#	614671;intellectual disability;autism"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	21841781;18184952;21731881		False	3	100;0;0	2.156	True					16			29638675	30188534					3	80	cnv_gain	Chromosome 16p11.2 duplication syndrome, proximal
ISCA-37400-Loss	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 16p11.2 deletion syndrome, proximal, MIM#	611913;autism;intellectual disability;seizures"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True					16			29638675	30188534				3		80	cnv_loss	Chromosome 16p11.2 deletion syndrome, proximal
ISCA-37404-Gain	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 15q11q13 duplication syndrome;{Autism susceptibility 4}	608636;intellectual disability;seizures;ataxia"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24239951;24075935		False	3	100;0;0	2.156	True					15			22782170	28134729					3	80	cnv_gain	Chromosome 15q11q13 duplication syndrome
ISCA-37404-Loss	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Angelman syndrome, MIM#	105830;Prader-Willi syndrome, MIM#	176270"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301323;20301505		False	3	100;0;0	2.156	True					15			22782170	28134729				3		80	cnv_loss	Angelman and Prader-Willi syndromes
ISCA-37405-Loss	region	NPHP1	Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Nephronophthisis 1, juvenile, MIM#	256100;Joubert syndrome 4, MIM#	609583;Senior-Loken syndrome 1, MIM#	266900"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	29146700		False	3	100;0;0	2.156	False		ENSG00000144061	ENSG00000144061	HGNC:7905	2			110122329	110205017				3		80	cnv_loss	NPHP1 deletion
ISCA-37406-Loss	region	CREBBP	Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 16p13.3 deletion syndrome, Rubinstein-Taybi deletion syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20101707;17473832;16783566		False	3	100;0;0	2.156	True		ENSG00000005339	ENSG00000005339	HGNC:2348	16			3725055	3880120				3		80	cnv_loss	Chromosome 16p13.3 deletion syndrome, Rubinstein-Taybi deletion syndrome
ISCA-37411-Loss	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Chromosome 15q13.3 microdeletion syndrome, MIM#	612001;intellectual disability;epilepsy"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19372089;20979196		False	3	100;0;0	2.156	True					15			30844901	32153207				3		80	cnv_loss	Chromosome 15q13.3 microdeletion syndrome
ISCA-37415-Gain	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	16p13.11 microduplication syndrome;intellectual disability;autism;aortopathy			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	30287593		False	3	100;0;0	2.156	True					16			15410597	16198411					3	80	cnv_gain	16p13.11 microduplication syndrome
ISCA-37418-Gain	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Potocki-Lupski syndrome, MIM#	610883"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True					17			16853797	20316338					3	80	cnv_gain	Potocki-Lupski syndrome
ISCA-37418-Loss	region		Expert Review Green;NHS GMS;ClinGen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Smith-Magenis syndrome, MIM#182290			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20301487;37628566		False	3	100;0;0	2.156	True					17			16853797	20316338				3		80	cnv_loss	17p11.2 recurrent (SMS/PLS) region (includes RAI1) Loss
ISCA-37421-Gain	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 1q21.1 duplication syndrome, MIM#	612475;intellectual disability;autism;macrocephaly"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32655619		False	3	100;0;0	2.156	True					1			147105904	147922392					3	80	cnv_gain	Chromosome 1q21.1 duplication syndrome, distal BP3-BP4
ISCA-37421-Loss	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 1q21.1 deletion syndrome, MIM#	612474;intellectual disability;microcephaly;congenital anomalies"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	32655619		False	3	100;0;0	2.156	True					1			147105904	147922392				3		80	cnv_loss	Chromosome 1q21.1 deletion syndrome, distal BP3-BP4
ISCA-37423-Gain	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	8p23.1 duplication syndrome;intellectual disability;congenital heart disease			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	26097203;25520754		False	3	100;0;0	2.156	True					8			8261773	11908210					3	80	cnv_gain	8p23.1 duplication syndrome
ISCA-37423-Loss	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	8p23.1 deletion syndrome;congenital heart disease;developmental delay			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23696316;23011633;20969981		False	3	100;0;0	2.156	True					8			8261773	11908210				3		80	cnv_loss	8p23.1 deletion syndrome
ISCA-37424-Loss	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 10q22.3q23.2 deletion syndrome (LCR-3/4-flanked);intellectual disability;autism;macrocephaly			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20345475;25846706		False	3	100;0;0	2.156	True					10			79923892	86983483				3		80	cnv_loss	10q22.3q23.2 deletion syndrome (LCR-3/4-flanked)
ISCA-37425-Gain	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 5q35 duplication syndrome;microcephaly;failure to thrive;seizures			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	24819041		False	3	100;0;0	2.156	True					5			176301975	177586960					3	80	cnv_gain	Chromosome 5q35 duplication syndrome
ISCA-37425-Loss	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Sotos syndrome, chromosome 5q35 deletion;intellectual disability;overgrowth			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	23190751;19596467		False	3	100;0;0	2.156	True					5			176301975	177586960				3		80	cnv_loss	Sotos syndrome, chromosome 5q35 deletion
ISCA-37429-Loss	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Wolf-Hirschhorn syndrome, MIM#	194190;intellectual disability;growth retardation;seizures;dysmorphic features"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True					4			337779	2009235				3		80	cnv_loss	Wolf-Hirschhorn syndrome, chromosome 4p16.3 terminal deletion
ISCA-37430-Gain	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 17p13.3 duplication syndrome, centromeric, MIM#613215;intellectual disability			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	False					17			1344539	2685615					3	80	cnv_gain	Chromosome 17p13.3 duplication syndrome, centromeric
ISCA-37430-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Miller-Dieker lissencephaly syndrome, MIM#	247200"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	False					17			1344539	2685615				3		80	cnv_loss	Miller-Dieker syndrome, chromosome 17p13.3 deletion syndrome
ISCA-37431-Gain	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 17q11.2 duplication syndrome, 1.4-Mb	MIM#618874;NF1 microduplication;intellectual disability;micro- and macrocephaly;seizures;dysmorphic features"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22241097		False	3	100;0;0	2.156	False					17			30835804	31891648					3	80	cnv_gain	Chromosome 17q11.2 duplication syndrome
ISCA-37431-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 17q11.2 deletion syndrome, MIM#613675;NF1 deletion syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	12660952;14729829		False	3	100;0;0	2.156	False					17			30835804	31891648				3		80	cnv_loss	Chromosome 17q11.2 deletion syndrome, NF1 deletion syndrome
ISCA-37432-Gain	region		Expert list;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Chromosome 17q12 duplication syndrome	614526;intellectual disability;seizures;congenital anomalies"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 19844256		False	3	100;0;0	2.156	False					17			36458167	37854617					3	80	cnv_gain	Chromosome 17q12 duplication syndrome
ISCA-37432-Loss	region		Expert list;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Chromosome 17q12 deletion syndrome	MIM#614527;Renal cysts and diabetes (RCAD) syndrome"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 19844256		False	3	100;0;0	2.156	False					17			36458167	37854617				3		80	cnv_loss	Chromosome 17q12 deletion syndrome
ISCA-37433-Gain	region		Expert list;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Chromosome 22q11.2 microduplication syndrome	MIM#608363"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 18707033		False	3	100;0;0	2.156	False					22			18924718	20299686					3	80	cnv_gain	Chromosome 22q11.2 microduplication syndrome
ISCA-37433-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	DiGeorge syndrome MIM#188400			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	False					22			18924718	20299686				3		80	cnv_loss	DiGeorge syndrome
ISCA-37434-Loss	region		Expert list;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Chromosome 1p36 deletion syndrome MIM#607872;intellectual disability;hypotonia;congenital anomalies			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 12974736;18245432		False	3	100;0;0	2.156	False					1			898703	6229913				3		80	cnv_loss	Chromosome 1p36 deletion syndrome
ISCA-37439-Gain	region		Expert list;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Chromosome Xq28 duplication syndrome MIM#300815			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 20004760		False	3	100;0;0	2.156	False					X			154336276	154660745					3	80	cnv_gain	Chromosome Xq28 duplication syndrome
ISCA-37440-Loss	region		Expert list;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"2p21 deletion syndrome;Hypotonia-cystinuria syndrome, MIM#	606407"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 18234729;23794250		False	3	100;0;0	2.156	False					2			44183133	44362502				30		80	cnv_loss	2p21 deletion syndrome
ISCA-37441-Loss	region		Expert list;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Potocki-Shaffer syndrome MIM#601224;intellectual disability;multiple exostoses;biparietal foramina			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 20140962		False	3	100;0;0	2.156	False					11			43873250	46130899				3		80	cnv_loss	Potocki-Shaffer syndrome
ISCA-37443-Loss	region		Expert list;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Chromosome 3q29 microdeletion syndrome MIM#609425;intellectual disability;autism			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 20830797;19460468;19610115		False	3	100;0;0	2.156	False					3			196029183	197617794				3		80	cnv_loss	Chromosome 3q29 microdeletion syndrome
ISCA-37446-Gain	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Chromosome 22q11.2 microduplication syndrome MIM#608363, proximal A-D			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 18707033		False	3	100;0;0	2.156	False					22			18924718	21111384					3	80	cnv_gain	Chromosome 22q11.2 microduplication syndrome
ISCA-37446-Loss	region		Expert Review Green;ClinGen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 22q11.2 deletion syndrome, distal MIM#611867;intellectual disability;autism;multiple congenital anomalies			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	18179902;23765049;21671380		False	3	100;0;0	2.156	True					22			18924718	21111384				3		80	cnv_loss	Chromosome 22q11.2 deletion syndrome, DiGeorge syndrome
ISCA-37447-Loss	region		Expert Review Green;ClinGen;ClinGen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	Temple syndrome MIM#616222;Kagami-Ogata syndrome MIM#608149			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	41926606;39446997		False	3	100;0;0	2.156	True					14			100724515	100833215						80	cnv_loss	DLK1-MEG3 Intergenic Region
ISCA-37448-Loss	region	NIPA1	Expert Review Green;ClinGen;ClinGen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 15q11.2 deletion syndrome, MIM#615656			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	False		ENSG00000170113	ENSG00000170113	HGNC:17043	15			22782170	23040134				3	40	80	cnv_loss	Chromosome 15q11.2 deletion syndrome, MIM#615656
ISCA-37468-Loss	region	MAOB	Expert Review Green;ClinGen;ClinGen;Expert Review Green	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Chromosome Xp11.23 deletion syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 22126752;16385466;20186789		False	3	100;0;0	2.156	False		ENSG00000069535	ENSG00000069535	HGNC:6834	X			43654906	43882474				3		80	cnv_loss	Xp11.23 region (includes MAOA and MAOB) Loss
ISCA-37478-Gain	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 15q11q13 duplication syndrome, MIM#608636;autism;intellectual disability;ataxia			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	False					15			23513243	28312040					3	80	cnv_gain	Chromosome 15q11q13 duplication syndrome
ISCA-37478-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Angelman syndrome, MIM# 105830;Prader-Willi syndrome, MIM# 176270			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	22045295		False	3	100;0;0	2.156	False					15			23513243	28312040				3		80	cnv_loss	Angelman and Prader-Willi syndromes, Class 2 BP2-BP3 deletions
ISCA-37486-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 16p11.2 deletion syndrome, MIM#611913, distal BP2-BP3;intellectual disability;autism;obesity			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19914906;32993859;32732550;32597026;32537635		False	3	100;0;0	2.156	False					16			28811313	29035181				3		80	cnv_loss	Chromosome 16p11.2 deletion syndrome
ISCA-37493-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	1q43q44 microdeletion syndrome;intellectual disability;seizures;microcephaly;corpus callosum abnormalities			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	28283832;31929334;31830750;30853971		False	3	100;0;0	2.156	False					1			243124428	245154985				3		80	cnv_loss	1q43q44 microdeletion syndrome
ISCA-37494-Gain	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Chromosome Xq28 duplication syndrome MIM#300815;intellectual disability;hypotonia;seizures;spasticity;recurrent respiratory infections			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	25927380;20301461;32043567;32112660		False	3	100;0;0	2.156	False					X			154890328	155335092					3	80	cnv_gain	Chromosome Xq28 duplication syndrome
ISCA-37498-Loss	region	SHANK2	Expert Review Green;ClinGen;ClinGen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	11q13.2q13.4 deletion syndrome			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	False		ENSG00000162105	ENSG00000162105	HGNC:14295	11			67996175	71525885				3	0	80	cnv_loss	11q13.2q13.4 recurrent region
ISCA-37500-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 15q25 deletion syndrome	MIM#614294;intellectual disability;congenital abnormalities;haematological abnormalities"			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	20921022;24352913		False	3	100;0;0	2.156	False					15			82534141	84045981				3		80	cnv_loss	Chromosome 15q25 deletion syndrome
ISCA-46290-Gain	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Chromosome Xp11.23-p11.22 duplication syndrome MIM#300801;intellectual disability;seizures			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	19716111;27605428;29707408;16900295		False	3	100;0;0	2.156	False					X			48447780	52444265					3	80	cnv_gain	Chromosome Xp11.23-p11.22 duplication syndrome
ISCA-46295-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Chromosome 15q13.3 microdeletion syndrome MIM#612001;intellectual disability;seizures			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 19289393		False	3	100;0;0	2.156	False					15			31727418	32153205				3		80	cnv_loss	Chromosome 15q13.3 microdeletion syndrome
ISCA-46296-Loss	region		Expert Review Green;ClinGen;ClinGen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted				Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 25217958		False	3	0;0;0	2.156	False					15			72671374	75215971				3		80	cnv_loss	15q24 recurrent deletion (LCR A- LCR C)
ISCA-46299-Gain	region		Expert Review Green;Expert list;Expert list	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Xp11.22 microduplication syndrome MIM#300705			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 22840365		False	3	100;0;0	2.156	True					X			53334251	53766556					3	80	cnv_gain	Xp11.22 microduplication syndrome
ISCA-46300-Loss	region	SIN3A	Expert Review Green;ClinGen;ClinGen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 15q24 deletion syndrome, MONDO:0013256			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000169375	ENSG00000169375	HGNC:19353	15			75339446	75680568				3	0	80	cnv_loss	Chromosome 15q24 deletion syndrome distal
ISCA-46304-Gain	region	MECP2	Expert Review Green;ClinGen;ClinGen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Syndromic X-linked intellectual disability Lubs type, MONDO:0010283			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758	PMID: 29141583, 22679399		False	3	100;0;0	2.156	True		ENSG00000169057	ENSG00000169057	HGNC:6990	X			154008529	154110279				0	3	80	cnv_gain	Xq28 (includes MECP2) gain
ISCA-46743-Gain	region	STAG2	Expert Review Green;ClinGen;ClinGen	Intellectual disability syndromic and non-syndromic		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Xq25 duplication syndrome, MIM#300979			Intellectual disability;HP:0001249; Neurodevelopmental delay;HP:0012758			False	3	100;0;0	2.156	True		ENSG00000101972	ENSG00000101972	HGNC:11355	X			123900469	124102669				3	3	80	cnv_both	Xq25 duplication syndrome, MIM#300979
