Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
ADAR	gene	ADAR	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 6;neuroinflammatory disorder with cerebral calcification;progressive loss of cognition;spasticity;dystonia;parkinsonism;OMIM 615010			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 32911246		False	3	100;0;0	2.55	True		ENSG00000160710	ENSG00000160710	HGNC:225													
ATP13A2	gene	ATP13A2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	parkinsonism due to ATP13A2 deficiency MONDO:0017809			Abnormality of extrapyramidal motor function;HP:0002071	25900096;20301402		False	3	100;0;0	2.55	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP1A3	gene	ATP1A3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder MONDO:0700002			Abnormality of extrapyramidal motor function;HP:0002071	20301294;17282997;15260953;17595045;17516473;22534615		False	3	100;0;0	2.55	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP6AP2	gene	ATP6AP2	Expert list;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Parkinsonism with spasticity, X-linked, MIM#	300911"			Abnormality of extrapyramidal motor function;HP:0002071	30985297;23595882		False	3	100;0;0	2.55	True		ENSG00000182220	ENSG00000182220	HGNC:18305													
ATP7B	gene	ATP7B	Expert list;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease MIM#277900			Abnormality of extrapyramidal motor function;HP:0002071	17435591		False	3	50;50;0	2.55	True		ENSG00000123191	ENSG00000123191	HGNC:870													
C19orf12	gene	C19orf12	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodegeneration with brain iron accumulation 4 MONDO:0013674			Abnormality of extrapyramidal motor function;HP:0002071	21981780;23278385;23447832		False	3	100;0;0	2.55	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
C9orf3	gene	C9orf3	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 31, MIM# 619565;Childhood/Adolescence onset generalised dystonia;Dystonia parkinsonism;Zech-Boesch Syndrome			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 35306330		False	3	100;0;0	2.55	True		ENSG00000148120	ENSG00000148120	HGNC:1361													
CHCHD2	gene	CHCHD2	Expert list;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 22, autosomal dominant MIM#616710			Abnormality of extrapyramidal motor function;HP:0002071	32068847;25662902;31600778;26705026		False	3	100;0;0	2.55	False		ENSG00000106153	ENSG00000106153	HGNC:21645													
CLN3	gene	CLN3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 3 MIM#204200			Abnormality of extrapyramidal motor function;HP:0002071	19489875;11342698		False	3	100;0;0	2.55	True		ENSG00000188603	ENSG00000188603	HGNC:2074													
CP	gene	CP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminaemia, MIM#604290			Abnormality of extrapyramidal motor function;HP:0002071			False	3	100;0;0	2.55	True		ENSG00000047457	ENSG00000047457	HGNC:2295													
CSF1R	gene	CSF1R	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	leukoencephalopathy, diffuse hereditary, with spheroids 1 MONDO:0800027			Abnormality of extrapyramidal motor function;HP:0002071	25935893;22934315;22934315		False	3	100;0;0	2.55	True		ENSG00000182578	ENSG00000182578	HGNC:2433													
CYP27A1	gene	CYP27A1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebrotendinous xanthomatosis, MIM#	213700;Cerebrotendinous xanthomatosis,  infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas;Epilepsy;Parkinsonism;Ataxia;Peripheral neuropathy"			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 30054180		False	3	100;0;0	2.55	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
DAGLB	gene	DAGLB	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease, MONDO:0005180, DALGB-related			Abnormality of extrapyramidal motor function;HP:0002071	35715418;40244389		False	3	100;0;0	2.55	True		ENSG00000164535	ENSG00000164535	HGNC:28923													
DCTN1	gene	DCTN1	Expert list;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Perry syndrome, MONDO:0008201			Abnormality of extrapyramidal motor function;HP:0002071	20945553, 19136952, 24343258		False	3	100;0;0	2.55	True		ENSG00000204843	ENSG00000204843	HGNC:2711													
DNAJC12	gene	DNAJC12	Expert Review;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384			Abnormality of extrapyramidal motor function;HP:0002071			False	3	100;0;0	2.55	True		ENSG00000108176	ENSG00000108176	HGNC:28908													
DNAJC5	gene	DNAJC5	Expert list;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083			Abnormality of extrapyramidal motor function;HP:0002071	22978711;21820099;22235333		False	3	100;0;0	2.55	True		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNAJC6	gene	DNAJC6	Expert list;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 19a, juvenile-onset - MIM#615528;Parkinson disease 19b, early-onset - MIM#615528			Abnormality of extrapyramidal motor function;HP:0002071	22563501, 23211418, 26528954, 33983693		False	3	100;0;0	2.55	True		ENSG00000116675	ENSG00000116675	HGNC:15469													
EIF2AK2	gene	EIF2AK2	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877;Neurodevelopmental Syndrome;Developmental delays;Ataxia;Parkinsonism;White matter alterations			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 32197074		False	3	100;0;0	2.55	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
FBXO7	gene	FBXO7	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	parkinsonian-pyramidal syndrome MONDO:0009830			Abnormality of extrapyramidal motor function;HP:0002071	20301402		False	3	100;0;0	2.55	True		ENSG00000100225	ENSG00000100225	HGNC:13586													
FOXG1	gene	FOXG1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Rett syndrome, congenital variant, MIM#	613454;Developmental and Epileptic Encephalopathy;Dystonia,;Athetosis;Parkinsonism;Stereotypies"			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 21953941		False	3	100;0;0	2.55	True		ENSG00000176165	ENSG00000176165	HGNC:3811													
FRRS1L	gene	FRRS1L	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 37, MIM# 616981;Seizures;Chorea;Parkinsonism;Developmental delay			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 29086067		False	3	100;0;0	2.55	True		ENSG00000260230	ENSG00000260230	HGNC:1362													
FTL	gene	FTL	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted				Abnormality of extrapyramidal motor function;HP:0002071	23447832;20301320		False	3	100;0;0	2.55	False		ENSG00000087086	ENSG00000087086	HGNC:3999													
GBA	gene	GBA	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson's disease, MONDO:0005180, GBA-related			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 12809640;35639160		False	3	100;0;0	2.55	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GCH1	gene	GCH1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230			Abnormality of extrapyramidal motor function;HP:0002071	32170445;32278297;32746945;30314816		False	3	100;0;0	2.55	True		ENSG00000131979	ENSG00000131979	HGNC:4193													
GLB1	gene	GLB1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1-gangliosidosis, type III , MIM#230650;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 34514040		False	3	100;0;0	2.55	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GRN	gene	GRN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM# 607485			Abnormality of extrapyramidal motor function;HP:0002071	17923627;20301545		False	3	100;0;0	2.55	False		ENSG00000030582	ENSG00000030582	HGNC:4601													
KIAA1161	gene	KIAA1161	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317;Primary familial brain calcification;Atypical parkinsonism;Supranuclear gaze palsy			Abnormality of extrapyramidal motor function;HP:0002071	32211515;30656188;30649222;30460687;29910000;31951047		False	3	100;0;0	2.55	True		ENSG00000164976	ENSG00000164976	HGNC:19918													
KMT2B	gene	KMT2B	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 28, childhood-onset , MIM#617284			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 33816656		False	3	100;0;0	2.55	True		ENSG00000272333	ENSG00000272333	HGNC:15840													
LRRK2	gene	LRRK2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted				Abnormality of extrapyramidal motor function;HP:0002071			False	3	100;0;0	2.55	False		ENSG00000188906	ENSG00000188906	HGNC:18618													
LYST	gene	LYST	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chediak-Higashi syndrome MONDO:0008963			Abnormality of extrapyramidal motor function;HP:0002071	23436631;23521865;20301751		False	3	100;0;0	2.55	True		ENSG00000143669	ENSG00000143669	HGNC:1968													
MAPT	gene	MAPT	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	late-onset Parkinson disease MONDO:0008199			Abnormality of extrapyramidal motor function;HP:0002071	20301678		False	3	100;0;0	2.55	True		ENSG00000186868	ENSG00000186868	HGNC:6893													
MECP2	gene	MECP2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	MECP2-related disorders;Rett syndrome, MIM# 312750;Mental retardation, X-linked, syndromic 13, MIM# 300055			Abnormality of extrapyramidal motor function;HP:0002071	31970230;27050783		False	3	100;0;0	2.55	True		ENSG00000169057	ENSG00000169057	HGNC:6990													
NPC1	gene	NPC1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Niemann-Pick disease, MIM# 257220;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	24035292;30369906		False	3	100;0;0	2.55	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC2	gene	NPC2	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann Pick C2, OMIM 607625;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 35695805		False	3	100;0;0	2.55	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NR4A2	gene	NR4A2	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911			Abnormality of extrapyramidal motor function;HP:0002071	31922365		False	3	100;0;0	2.55	True		ENSG00000153234	ENSG00000153234	HGNC:7981													
NUS1	gene	NUS1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder, autosomal dominant 55, with seizures, MIM#	617831;Parkinsonism;Developmental delay;Intellectual disability;Ataxia;Myoclonus"			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 32485575;30348779		False	3	100;0;0	2.55	True		ENSG00000153989	ENSG00000153989	HGNC:21042													
PANK2	gene	PANK2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	pantothenate kinase-associated neurodegeneration MONDO:0009319			Abnormality of extrapyramidal motor function;HP:0002071	23447832;20301663		False	3	0;0;0	2.55	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PARK7	gene	PARK7	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive early-onset Parkinson disease 7 MONDO:0011658			Abnormality of extrapyramidal motor function;HP:0002071	20301402		False	3	100;0;0	2.55	True		ENSG00000116288	ENSG00000116288	HGNC:16369													
PDE8B	gene	PDE8B	Expert Review;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Striatal degeneration, autosomal dominant, MIM#609161			Abnormality of extrapyramidal motor function;HP:0002071	20085714;26769607;26475694		False	3	100;0;0	2.55	True		ENSG00000113231	ENSG00000113231	HGNC:8794													
PDGFB	gene	PDGFB	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 5, MIM# 615483			Abnormality of extrapyramidal motor function;HP:0002071	23913003		False	3	100;0;0	2.55	True		ENSG00000100311	ENSG00000100311	HGNC:8800													
PDGFRB	gene	PDGFRB	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 4, MIM# 615007			Abnormality of extrapyramidal motor function;HP:0002071	23255827;30979360		False	3	100;0;0	2.55	True		ENSG00000113721	ENSG00000113721	HGNC:8804													
PGK1	gene	PGK1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Phosphoglycerate kinase 1 deficiency, MIM# 300653;Haemolytic anaemia;Rhabdomyolysis;Myopathy;Juvenile Parkinsonism;OMIM 300653			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 30975619		False	3	100;0;0	2.55	True		ENSG00000102144	ENSG00000102144	HGNC:8896													
PINK1	gene	PINK1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 6, early onset MIM#605909			Abnormality of extrapyramidal motor function;HP:0002071	28980524		False	3	100;0;0	2.55	True		ENSG00000158828	ENSG00000158828	HGNC:14581													
PLA2G6	gene	PLA2G6	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive Parkinson disease 14 MONDO:0013060			Abnormality of extrapyramidal motor function;HP:0002071	20301718		False	3	100;0;0	2.55	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
POLG	gene	POLG	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	autosomal dominant progressive external ophthalmoplegia MONDO:0008003			Abnormality of extrapyramidal motor function;HP:0002071	20301791;15351195		False	3	100;0;0	2.55	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLR3A	gene	POLR3A	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 33652360		False	3	100;0;0	2.55	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
PPP2R5D	gene	PPP2R5D	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early onset Parkinsonism;Houge-Janssens syndrome 1, MIM#616355			Abnormality of extrapyramidal motor function;HP:0002071	33338668;32743835		False	3	100;0;0	2.55	True		ENSG00000112640	ENSG00000112640	HGNC:9312													
PRKCG	gene	PRKCG	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 14, MIM# 605361;Myoclonus;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 29603387		False	3	100;0;0	2.55	True		ENSG00000126583	ENSG00000126583	HGNC:9402													
PRKN	gene	PRKN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive juvenile Parkinson disease 2 MONDO:0010820			Abnormality of extrapyramidal motor function;HP:0002071			False	3	100;0;0	2.55	True		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRKRA	gene	PRKRA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	dystonia 16 MONDO:0012789			Abnormality of extrapyramidal motor function;HP:0002071	33502045		False	3	100;0;0	2.55	True		ENSG00000180228	ENSG00000180228	HGNC:9438													
PRNP	gene	PRNP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	inherited Creutzfeldt-Jakob disease MONDO:0007403;Gerstmann-Straussler-Scheinker syndrome MONDO:0007656			Abnormality of extrapyramidal motor function;HP:0002071	20301407		False	3	100;0;0	2.55	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PSAP	gene	PSAP	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491			Abnormality of extrapyramidal motor function;HP:0002071	32201884		False	3	100;0;0	2.55	True		ENSG00000197746	ENSG00000197746	HGNC:9498													
PSEN1	gene	PSEN1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease 3 MONDO:0011913			Abnormality of extrapyramidal motor function;HP:0002071	3548932;34843019;36825052		False	3	100;0;0	2.55	True		ENSG00000080815	ENSG00000080815	HGNC:9508													
PSMF1	gene	PSMF1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related			Abnormality of extrapyramidal motor function;HP:0002071	https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1		False	3	100;0;0	2.55	True		ENSG00000125818	ENSG00000125818	HGNC:9571													
PTRHD1	gene	PTRHD1	Expert list;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747			Abnormality of extrapyramidal motor function;HP:0002071	27753167;27134041;30398675;29143421		False	3	100;0;0	2.55	True		ENSG00000184924	ENSG00000184924	HGNC:33782													
PTS	gene	PTS	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal				Abnormality of extrapyramidal motor function;HP:0002071			False	3	100;0;0	2.55	True		ENSG00000150787	ENSG00000150787	HGNC:9689													
QDPR	gene	QDPR	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, C, MIM#261630;Dehydropteridin reductase deficiency, Infantile-onset dystonia;Parkinsonism;Epilepsy;Autonomic dysfunction;Hyperphenylalaninemia			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 28413401		False	3	100;0;0	2.55	True		ENSG00000151552	ENSG00000151552	HGNC:9752													
RAB32	gene	RAB32	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Parkinson disease 26, autosomal dominant, susceptibility to}, MIM# 620923			Abnormality of extrapyramidal motor function;HP:0002071	38858457;38614108;38293014;40118982;40568674;41103171		False	3	33;33;33	2.55	True	Other	ENSG00000118508	ENSG00000118508	HGNC:9772													
RAB39B	gene	RAB39B	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Early-onset parkinsonism-intellectual disability syndrome MONDO:0010709			Abnormality of extrapyramidal motor function;HP:0002071	25434005;26399558;26739247		False	3	100;0;0	2.55	True		ENSG00000155961	ENSG00000155961	HGNC:16499													
SCN1A	gene	SCN1A	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dravet syndrome, MIM# 607208;Epilepsy, Paekinsonism			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 28186331;24850485		False	3	100;0;0	2.55	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SERAC1	gene	SERAC1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 29332177;16527507		False	3	100;0;0	2.55	True		ENSG00000122335	ENSG00000122335	HGNC:21061													
SLC18A2	gene	SLC18A2	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia, infantile, 2 , MIM# 618049;Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	33983693;23363473;31240161;26497564		False	3	100;0;0	2.55	True		ENSG00000165646	ENSG00000165646	HGNC:10935													
SLC19A3	gene	SLC19A3	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483;Childhood onset Dystonia and Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 24260777		False	3	100;0;0	2.55	True		ENSG00000135917	ENSG00000135917	HGNC:16266													
SLC20A2	gene	SLC20A2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 1, MIM# 213600			Abnormality of extrapyramidal motor function;HP:0002071	22327515;23334463		False	3	100;0;0	2.55	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC30A10	gene	SLC30A10	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome MONDO:0013208			Abnormality of extrapyramidal motor function;HP:0002071	22341971;22341972		False	3	100;0;0	2.55	True		ENSG00000196660	ENSG00000196660	HGNC:25355													
SLC39A14	gene	SLC39A14	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermanganesemia with dystonia 2 (MIM# 617013)			Abnormality of extrapyramidal motor function;HP:0002071	27231142;32626807;29685658;30232769		False	3	100;0;0	2.55	True		ENSG00000104635	ENSG00000104635	HGNC:20858													
SLC6A3	gene	SLC6A3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia, infantile, 1, MIM# 613135			Abnormality of extrapyramidal motor function;HP:0002071	21112253		False	3	100;0;0	2.55	True		ENSG00000142319	ENSG00000142319	HGNC:11049													
SLC9A6	gene	SLC9A6	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142			Abnormality of extrapyramidal motor function;HP:0002071	35198730;39810750;35198730;31192222		False	3	100;0;0	2.55	True		ENSG00000198689	ENSG00000198689	HGNC:11079													
SNCA	gene	SNCA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543)			Abnormality of extrapyramidal motor function;HP:0002071	32849182;26858591;32740728		False	3	100;0;0	2.55	True		ENSG00000145335	ENSG00000145335	HGNC:11138													
SOX6	gene	SOX6	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Tolchin-Le Caignec syndrome, MIM#	618971;Developmental delay;ID;ASD;ADHD;Parkinsonism;Syringomyelia"			Abnormality of extrapyramidal motor function;HP:0002071	24453155;25127144		False	3	100;0;0	2.55	True		ENSG00000110693	ENSG00000110693	HGNC:16421													
SPG11	gene	SPG11	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary spastic paraplegia 11 MONDO:0011445			Abnormality of extrapyramidal motor function;HP:0002071	35036589;23121729;21381113;27217339		False	3	100;0;0	2.55	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG7	gene	SPG7	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 7, autosomal recessive, MIM#	607259;Ataxia;Progressive external opthalmoplegia;Parkinsonism"			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 31433872		False	3	100;0;0	2.55	True		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPR	gene	SPR	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994			Abnormality of extrapyramidal motor function;HP:0002071	22522443;11920285;14663042;16443856;21782285;32813147		False	3	0;100;0	2.55	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
STUB1	gene	STUB1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar Ataxia 48, OMIM 618093;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	30381368;32285148;32337344		False	3	100;0;0	2.55	True		ENSG00000103266	ENSG00000103266	HGNC:11427													
STXBP1	gene	STXBP1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 4, MIM# 612164;Juvenile onset Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	25418441;32643187;29929108		False	3	100;0;0	2.55	True		ENSG00000136854	ENSG00000136854	HGNC:11444													
SYNJ1	gene	SYNJ1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 20, early-onset, MIM# 615530			Abnormality of extrapyramidal motor function;HP:0002071	23804563;23804577;27496670;33841314		False	3	100;0;0	2.55	True		ENSG00000159082	ENSG00000159082	HGNC:11503													
TBC1D24	gene	TBC1D24	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 16, MIM# 615338;Intellectual disability;Parkinsonism;Seizures;Psychosis			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 28663785;21087195		False	3	100;0;0	2.55	True		ENSG00000162065	ENSG00000162065	HGNC:29203													
TH	gene	TH	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Tyrosine hydroxylase deficiency MONDO:0100064			Abnormality of extrapyramidal motor function;HP:0002071	20301334;20301610		False	3	100;0;0	2.55	True		ENSG00000180176	ENSG00000180176	HGNC:11782													
TPP1	gene	TPP1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 21940688		False	3	100;0;0	2.55	True		ENSG00000166340	ENSG00000166340	HGNC:2073													
TWNK	gene	TWNK	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286			Abnormality of extrapyramidal motor function;HP:0002071	24076137;22949510;22580846;19353676		False	3	100;0;0	2.55	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
UBTF	gene	UBTF	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;Parkinsonism;Dystonia;Chorea;Brain atrophy			Abnormality of extrapyramidal motor function;HP:0002071	PubMed: 28777933;29300972		False	3	100;0;0	2.55	True		ENSG00000108312	ENSG00000108312	HGNC:12511													
VAC14	gene	VAC14	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Striatonigral degeneration, childhood-onset, MIM# 617054;Dystonia;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 31392254;28502045		False	3	100;0;0	2.55	True		ENSG00000103043	ENSG00000103043	HGNC:25507													
VCP	gene	VCP	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507			Abnormality of extrapyramidal motor function;HP:0002071	38283104;38145206		False	3	100;0;0	2.55	True	Other	ENSG00000165280	ENSG00000165280	HGNC:12666													
VPS13A	gene	VPS13A	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	chorea-acanthocytosis MONDO:0008695			Abnormality of extrapyramidal motor function;HP:0002071	20301561;37636221		False	3	100;0;0	2.55	True		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13C	gene	VPS13C	Expert list;Expert Review Green	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 23, autosomal recessive, early onset MIM#616840			Abnormality of extrapyramidal motor function;HP:0002071	26942284;30452786;28862745		False	3	100;0;0	2.55	True		ENSG00000129003	ENSG00000129003	HGNC:23594													
VPS35	gene	VPS35	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 17, MIM# 614203			Abnormality of extrapyramidal motor function;HP:0002071	21763482;21763483;22801713;34704029		False	3	100;0;0	2.55	True		ENSG00000069329	ENSG00000069329	HGNC:13487													
WARS2	gene	WARS2	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 29120065;34890876;31970218		False	3	100;0;0	2.55	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WDR45	gene	WDR45	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	X-linked complex neurodevelopmental disorder MONDO:0100148			Abnormality of extrapyramidal motor function;HP:0002071	28211668		False	3	100;0;0	2.55	True		ENSG00000196998	ENSG00000196998	HGNC:28912													
XPR1	gene	XPR1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 6, MIM# 616413			Abnormality of extrapyramidal motor function;HP:0002071	25938945		False	3	100;0;0	2.55	True		ENSG00000143324	ENSG00000143324	HGNC:12827													
ZFYVE26	gene	ZFYVE26	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 15, autosomal recessive, MIM#	270700;Spastic paraplegia and retinal degeneration;Kjellin syndrome;Parkinsonism"			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 33033739;21462267		False	3	100;0;0	2.55	True		ENSG00000072121	ENSG00000072121	HGNC:20761													
AFG3L2	gene	AFG3L2	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 28, MIM# 610246;optic atrophy;spastic ataxia;L-dopa-responsive parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	30252181;36110148		False	2	33;33;33	2.55	True		ENSG00000141385	ENSG00000141385	HGNC:315													
APP	gene	APP	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease 1, familial, MIM# 104300			Abnormality of extrapyramidal motor function;HP:0002071			False	2	0;100;0	2.55	True		ENSG00000142192	ENSG00000142192	HGNC:620													
COASY	gene	COASY	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 6, MIM# 615643			Abnormality of extrapyramidal motor function;HP:0002071	28489334;24360804		False	2	0;100;0	2.55	True		ENSG00000068120	ENSG00000068120	HGNC:29932													
DDC	gene	DDC	Expert Review Amber;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aromatic L-amino acid decarboxylase deficiency, MIM# 608643;Infantile-onset parkinsonism & dystonia;Bulbar dysfunction;Oculogyric crisis;Autonomic dysfunction;Intellectual disability			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 33983693		False	2	50;50;0	2.55	True		ENSG00000132437	ENSG00000132437	HGNC:2719													
DHDDS	gene	DHDDS	Expert Review Amber;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental delay and seizures with or without movement abnormalities, MIM# 617836;Myoclonic Epilepsy;Parkinsonism;Ataxia;Intellectual disability			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 34837344;29100083		False	2	50;50;0	2.55	True		ENSG00000117682	ENSG00000117682	HGNC:20603													
EPM2A	gene	EPM2A	Expert Review Amber;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780;Progressive Myoclonic Epilepsy;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	27574708;28818698		False	2	50;50;0	2.55	True		ENSG00000112425	ENSG00000112425	HGNC:3413													
KIF5A	gene	KIF5A	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 10, autosomal dominant MIM#604187			Abnormality of extrapyramidal motor function;HP:0002071	18853458		False	2	0;100;0	2.55	True		ENSG00000155980	ENSG00000155980	HGNC:6323													
NHLRC1	gene	NHLRC1	Expert Review Amber;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2B (Lafora), MIM# 254780;Lafora disease;Progressive Myoclonic Epilepsy;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	22425593;32301727		False	2	50;50;0	2.55	True		ENSG00000187566	ENSG00000187566	HGNC:21576													
PNPLA6	gene	PNPLA6	Expert Review Amber;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PNPLA6-related spastic paraplegia with or without ataxia MONDO:0100149			Abnormality of extrapyramidal motor function;HP:0002071	32623594;36825042		False	2	0;100;0	2.55	True		ENSG00000032444	ENSG00000032444	HGNC:16268													
PTPA	gene	PTPA	Expert Review Amber;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual disability, MONDO: 36073231, PTPA-related;Parkinson disease MONDO:0005180, PTPA-related			Abnormality of extrapyramidal motor function;HP:0002071	36073231;37448355;37046398		False	2	0;100;0	2.55	True		ENSG00000119383	ENSG00000119383	HGNC:9308													
TENM4	gene	TENM4	Expert Review Amber;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	tremor, hereditary essential, 5 MONDO:0014756			Abnormality of extrapyramidal motor function;HP:0002071	41449293;36689009;26188006;29249217;34589676;22915103		False	2	0;100;0	2.55	False		ENSG00000149256	ENSG00000149256	HGNC:29945													
UQCRC1	gene	UQCRC1	Expert Review Amber;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinsonism with polyneuropathy, MIM# 619279			Abnormality of extrapyramidal motor function;HP:0002071	33141179;33248804		False	2	50;50;0	2.55	True		ENSG00000010256	ENSG00000010256	HGNC:12585													
ALPL	gene	ALPL	Expert Review Red;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Hypophosphatasia, adult, MIM# 146300;Osteomalacia;Parkinsonism			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 32956941		False	1	50;0;50	2.55	True		ENSG00000162551	ENSG00000162551	HGNC:438													
ANG	gene	ANG	Expert Review Red;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	Unknown	Parkinson disease MONDO:0005180			Abnormality of extrapyramidal motor function;HP:0002071	33875291;25386690		False	1	0;0;100	2.55	True		ENSG00000214274	ENSG00000214274	HGNC:483													
ATXN10	gene	ATXN10	Expert Review Red;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar Ataxia 10;Parkinsonism;OMIM 603516			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 28890930		False	1	100;0;0	2.55	True		ENSG00000130638	ENSG00000130638	HGNC:10549													
DCAF17	gene	DCAF17	Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	Unknown				Abnormality of extrapyramidal motor function;HP:0002071			False	1	0;0;100	2.55	True		ENSG00000115827	ENSG00000115827	HGNC:25784													
DNAJC13	gene	DNAJC13	Expert list;Expert Review Red	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted				Abnormality of extrapyramidal motor function;HP:0002071	30788857;24218364;29309590;31082451;29887357;27270108		False	1	0;100;0	2.55	True		ENSG00000138246	ENSG00000138246	HGNC:30343													
FUS	gene	FUS	Expert Review Red;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"tremor, hereditary essential, 4	MONDO:0013888"			Abnormality of extrapyramidal motor function;HP:0002071	22863194;23834483;23825177;38626532		False	1	0;0;100	2.55	True		ENSG00000089280	ENSG00000089280	HGNC:4010													
GIGYF2	gene	GIGYF2	Expert Review Red;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Parkinson disease 11} , OMIM # 607688			Abnormality of extrapyramidal motor function;HP:0002071	18358451;33239198;25279164;20060621;19250854;26152800;19449032		False	1	0;50;50	2.55	True		ENSG00000204120	ENSG00000204120	HGNC:11960													
HEXA	gene	HEXA	Expert Review Red;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2 Gangliosidosis;Tay-Sachs disease;Parkinsonism;OMIM 272800			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 33069254		False	1	50;0;50	2.55	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
KCNJ15	gene	KCNJ15	Expert Review Red;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease, MONDO:0005180, KCNJ15-related			Abnormality of extrapyramidal motor function;HP:0002071	40566643		False	1	0;0;100	2.55	True		ENSG00000157551	ENSG00000157551	HGNC:6261													
MT-ND6	gene	MT-ND6	Expert Review Red;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Leber Optic Atrophy;Parkinsonism;OMIM 516006			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 33109474		False	1	50;0;50	2.55	True		ENSG00000198695	ENSG00000198695	HGNC:7462													
OPA3	gene	OPA3	Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	Unknown				Abnormality of extrapyramidal motor function;HP:0002071			False	1	0;0;100	2.55	True		ENSG00000125741	ENSG00000125741	HGNC:8142													
PODXL	gene	PODXL	Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	Unknown	juvenile-onset Parkinson disease			Abnormality of extrapyramidal motor function;HP:0002071	26864383;20706633		False	1	0;100;0	2.55	False		ENSG00000128567	ENSG00000128567	HGNC:9171													
PSEN2	gene	PSEN2	Expert Review Red;Other	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinsonism;Alzheimer disease-4 MIM#606889			Abnormality of extrapyramidal motor function;HP:0002071	22118943;26422362;18427071;29692703		False	1	0;0;100	2.55	True		ENSG00000143801	ENSG00000143801	HGNC:9509													
RIC3	gene	RIC3	Expert Review Red;Other	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease			Abnormality of extrapyramidal motor function;HP:0002071	27055476;28153381;28606768;32794657		False	1	0;0;100	2.55	True		ENSG00000166405	ENSG00000166405	HGNC:30338													
TMEM230	gene	TMEM230	Expert list	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 21, MIM#616361			Abnormality of extrapyramidal motor function;HP:0002071	30804554;27270108;28115417;28017548;30804555;30804556;31323517		False	1	0;100;0	2.55	False		ENSG00000089063	ENSG00000089063	HGNC:15876													
TUBB4A	gene	TUBB4A	Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted				Abnormality of extrapyramidal motor function;HP:0002071			False	1	0;0;100	2.55	True		ENSG00000104833	ENSG00000104833	HGNC:20774													
WASL	gene	WASL	Expert Review Red;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson's disease, MONDO:0005180, WASL-related			Abnormality of extrapyramidal motor function;HP:0002071	PMID: 33571872		False	1	50;0;50	2.55	True		ENSG00000106299	ENSG00000106299	HGNC:12735													
ATXN1_SCA1_CAG	str	ATXN1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar Ataxia type 1;Parkinsonism;OMIM 164400			Abnormality of extrapyramidal motor function;HP:0002071	" 	PMID: 24602359"		False	3	100;0;0	2.55	True		ENSG00000124788	ENSG00000124788	HGNC:10548	6	16327867	16327953	16327636	16327722	CAG	36	45					
ATXN2_SCA2_CAG	str	ATXN2	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 2 MIM#183090			Abnormality of extrapyramidal motor function;HP:0002071	11761482;17923635;8896555;29325606;20301452		False	3	100;0;0	2.55	True		ENSG00000204842	ENSG00000204842	HGNC:10555	12	112036755	112036823	111598951	111599019	CAG	31	35					
ATXN3_SCA3_CAG	str	ATXN3	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3			Abnormality of extrapyramidal motor function;HP:0002071	11176969;7574470;7874163;20301375;29325606		False	3	100;0;0	2.55	True		ENSG00000066427	ENSG00000066427	HGNC:7106	14	92537355	92537396	92071011	92071052	CAG	44	60					
ATXN8OS_SCA8_CTG	str	ATXN8OS	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 8 MIM#608768			Abnormality of extrapyramidal motor function;HP:0002071	24285970;20301445;10192387		False	3	100;0;0	2.55	True		ENSG00000230223	ENSG00000230223	HGNC:10561	13	70713486	70713560	70139354	70139428	CTG	50	80					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Expert list	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550			Abnormality of extrapyramidal motor function;HP:0002071	25577942;21944779;21944778;31779815		False	3	100;0;0	2.55	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
FMR1_FXTAS_CGG	str	FMR1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Fragile X tremor/ataxia syndrome MIM#300623			Abnormality of extrapyramidal motor function;HP:0002071	27340021;28176767;20301558;23765048;25227148;11445641		False	3	100;0;0	2.55	True		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	55					
HTT_HD_CAG	str	HTT	Expert Review Green;Expert list	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease MIM#143100			Abnormality of extrapyramidal motor function;HP:0002071	20301482;29325606		False	3	100;0;0	2.55	False		ENSG00000197386	ENSG00000197386	HGNC:4851	4	3076604	3076666	3074877	3074939	CAG	26	40					
JPH3_HDL2_CTG	str	JPH3	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438			Abnormality of extrapyramidal motor function;HP:0002071	11558794;20301701		False	3	100;0;0	2.55	True		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866			Abnormality of extrapyramidal motor function;HP:0002071	31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	2.55	True		ENSG00000286219	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
PPP2R2B_SCA12_CAG	str	PPP2R2B	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 12 MIM#604326			Abnormality of extrapyramidal motor function;HP:0002071	31286011;27864267;33811808;10581021		False	3	100;0;0	2.55	True		ENSG00000156475	ENSG00000156475	HGNC:9305	5	146258292	146258321	146878729	146878758	CAG	32	51					
PRNP_CJD_octapeptide	str	PRNP	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440			Abnormality of extrapyramidal motor function;HP:0002071	2159587;20301407		False	3	100;0;0	2.55	True		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
RFC1_CANVAS_ANNGN	str	RFC1	Expert Review Green;Literature	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease MONDO:0005180			Abnormality of extrapyramidal motor function;HP:0002071	39833204;39152783;38789445;36705320;35013364		False	3	100;0;0	2.55	True		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	ANNGN	0	400					
TAF1_XDP_CCCTCT	str	TAF1	Expert Review Green;Expert list	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia-Parkinsonism, X-linked MIM#314250			Abnormality of extrapyramidal motor function;HP:0002071	17273961;29229810		False	3	100;0;0	2.55	True		ENSG00000147133	ENSG00000147133	HGNC:11535	X	70672905	70672979	71453055	71453129	CCCTCT	13	30					
TBP_SCA17_CAG	str	TBP	Expert Review Green;Expert list	Early-onset Parkinson disease		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136			Abnormality of extrapyramidal motor function;HP:0002071	10484774;20301611;29325606;27172828;14638975;11313753;11914409		False	3	100;0;0	2.55	True		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
