Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name AAAS gene AAAS Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Triple A syndrome, 231550;Achalasia-addisonianism-alacrimia syndrome, 231550 Ataxia;HP:0001251 False 3 100;0;0 1.63 True ENSG00000094914 ENSG00000094914 HGNC:13666 ABCD1 gene ABCD1 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenoleukodystrophy Ataxia;HP:0001251 False 3 100;0;0 1.63 True ENSG00000101986 ENSG00000101986 HGNC:61 ABHD12 gene ABHD12 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, Hearing Loss, Ataxia, Retinitis Pigmentosa and Cataract (PHARC);Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa and cataract, 612674;Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000100997 ENSG00000100997 HGNC:15868 AFG3L2 gene AFG3L2 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Ataxia, spastic, 5, autosomal recessive;spastic ataxia 5, 614487;Spinocerebellar ataxia 28;Spinocerebellar ataxia 28, 610246;Spinocerebellar Ataxia, Dominant Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000141385 ENSG00000141385 HGNC:315 ANO10 gene ANO10 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia autosomal recessive type 10, 613728;Spinocerebellar ataxia, autosomal recessive 10 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000160746 ENSG00000160746 HGNC:25519 ATM gene ATM Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia, 607585;Ataxia-Telangiectasia Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000149311 ENSG00000149311 HGNC:795 ATP13A2 gene ATP13A2 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 Ataxia;HP:0001251 21362476;21696388;31588715;32559632;33033738;33091395;34405108 False 3 100;0;0 1.63 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP1A3 gene ATP1A3 Expert list;Expert Review Green Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 Ataxia;HP:0001251 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 1.63 False ENSG00000105409 ENSG00000105409 HGNC:801 CACNA1A gene CACNA1A Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6;familial hemiplegic migraine type 1, 141500;Familial hemiplegic migraine 1, 141500;SCA6, 183086;episodic ataxia type 2 (EA2),108500;Episodic ataxia type 2, 108500;Migraine, familial hemiplegic, 1, with progressive cerebellar ataxia;Episodic ataxia, type 2 Ataxia;HP:0001251 False 3 0;100;0 1.63 False ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1G gene CACNA1G Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown early-onset SCA42 with neurodevelopmental deficits, 618087;Spinocerebellar ataxia 42, 616795 Ataxia;HP:0001251 False 3 100;0;0 1.63 True ENSG00000006283 ENSG00000006283 HGNC:1394 CAPN1 gene CAPN1 Expert list;Expert Review Amber;Expert Review Green Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76, autosomal recessive, 616907;MONDO:0014827 Ataxia;HP:0001251 27320912;29678961;30572172;31023339;31104286 False 3 50;50;0 1.63 True ENSG00000014216 ENSG00000014216 HGNC:1476 CLCN2 gene CLCN2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Epilepsy, juvenile absence, susceptibility to, 2}, 607628;Leukoencephalopathy with ataxia, 615651;{Epilepsy, juvenile myoclonic, susceptibility to, 8}, 607628;{Epilepsy, idiopathic generalized, susceptibility to, 11}, 607628 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000114859 ENSG00000114859 HGNC:2020 COA7 gene COA7 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia with axonal neuropathy Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000162377 ENSG00000162377 HGNC:25716 COQ4 gene COQ4 Expert Review;Expert Review Green Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 10, autosomal recessive, MIM# 620666 Ataxia;HP:0001251 36047608;38014483;38013626 False 3 100;0;0 1.63 True ENSG00000167113 ENSG00000167113 HGNC:19693 CP gene CP Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000047457 ENSG00000047457 HGNC:2295 CSF1R gene CSF1R Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia Ataxia;HP:0001251 24198292;25563800;25935893 False 3 100;0;0 1.63 True ENSG00000182578 ENSG00000182578 HGNC:2433 DNAJC5 gene DNAJC5 Expert list;Expert Review Green Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNMT1 gene DNMT1 ClinGen;Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 Ataxia;HP:0001251 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 False 3 100;0;0 1.63 False ENSG00000130816 ENSG00000130816 HGNC:2976 EIF2B1 gene EIF2B1 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Ataxia;HP:0001251 31438897 False 3 100;0;0 1.63 False ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B2 gene EIF2B2 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Ataxia;HP:0001251 31438897 False 3 100;0;0 1.63 False ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B3 gene EIF2B3 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Ataxia;HP:0001251 31438897 False 3 100;0;0 1.63 False ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B4 gene EIF2B4 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Ataxia;HP:0001251 31438897 False 3 100;0;0 1.63 False ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B5 gene EIF2B5 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896;Childhood ataxia with central nervous system hypomyelination/vanishing white matter disease Ataxia;HP:0001251 31438897 False 3 100;0;0 1.63 False ENSG00000145191 ENSG00000145191 HGNC:3261 ELOVL4 gene ELOVL4 Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000118402 ENSG00000118402 HGNC:14415 ELOVL5 gene ELOVL5 Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 38, MIM#615957 Ataxia;HP:0001251 25065913 False 3 100;0;0 1.63 True ENSG00000012660 ENSG00000012660 HGNC:21308 ERCC4 gene ERCC4 Expert list;Expert Review Green Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM# 278760" Ataxia;HP:0001251 29403087;28431612;29892709 False 3 100;0;0 1.63 True ENSG00000175595 ENSG00000175595 HGNC:3436 FAT2 gene FAT2 Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 45, MIM#617769 Ataxia;HP:0001251 29053796;33884300 False 3 50;50;0 1.63 True ENSG00000086570 ENSG00000086570 HGNC:3596 FGF14 gene FGF14 Expert Review Green;Literature;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia type 27, 609307;Spinocerebellar ataxia 27 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000102466 ENSG00000102466 HGNC:3671 FLVCR1 gene FLVCR1 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Posterior column ataxia with retinitis pigmentosa, 609033;Ataxia, posterior column, with retinitis pigmentosa,;Posterior Column Ataxia with Retinitis Pigmentosa Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000162769 ENSG00000162769 HGNC:24682 FXN gene FXN Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia with retained reflexes,229300;Friedreich ataxia, 229300;Friedreichataxia, 229300 Ataxia;HP:0001251 False 3 0;0;0 1.63 False ENSG00000165060 ENSG00000165060 HGNC:3951 GDAP2 gene GDAP2 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000196505 ENSG00000196505 HGNC:18010 GFAP gene GFAP Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000131095 ENSG00000131095 HGNC:4235 ITM2B gene ITM2B Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia Ataxia;HP:0001251 10391242;10781099;33814452 False 3 100;0;0 1.63 True ENSG00000136156 ENSG00000136156 HGNC:6174 ITPR1 gene ITPR1 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Gillespie syndrome, 206700;Spinocerebellar ataxia 29;Spinocerebellar ataxia 29, 117360;Spinocerebellar ataxia 15;Spinocerebellar ataxia 15, 606658 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000150995 ENSG00000150995 HGNC:6180 KCNC3 gene KCNC3 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 13;Spinocerebellar ataxia 13, 605259 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000131398 ENSG00000131398 HGNC:6235 KCND3 gene KCND3 Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 19, MIM# 607346 Ataxia;HP:0001251 23280837;23280838;34361012;34067185;33575485;32823520 False 3 100;0;0 1.63 True ENSG00000171385 ENSG00000171385 HGNC:6239 KIF1C gene KIF1C Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2,autosomal recessive;Autosomal recessive spastic ataxia 2, 611302 Ataxia;HP:0001251 24482476;24319291;31413903;29544888 False 3 100;0;0 1.63 True ENSG00000129250 ENSG00000129250 HGNC:6317 LMNB1 gene LMNB1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant MIM#169500 Ataxia;HP:0001251 31695592 False 3 100;0;0 1.63 True ENSG00000113368 ENSG00000113368 HGNC:6637 MARS2 gene MARS2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive, 611390 Ataxia;HP:0001251 False 3 100;0;0 1.63 True ENSG00000247626 ENSG00000247626 HGNC:25133 MSTO1 gene MSTO1 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial myopathy and ataxia, 617675 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000125459 ENSG00000125459 HGNC:29678 NPC1 gene NPC1 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 MONDO:0009757;ataxia Ataxia;HP:0001251 10480349;17003072;25497598;33228797 False 3 100;0;0 1.63 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPTX1 gene NPTX1 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cerebellar ataxia MONDO#0000437, NPTX1-related Ataxia;HP:0001251 34788392;35288776;35285082;35560436 False 3 100;0;0 1.63 True ENSG00000171246 ENSG00000171246 HGNC:7952 PDYN gene PDYN Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000101327 ENSG00000101327 HGNC:8820 PEX7 gene PEX7 Expert list;Expert Review Green Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 9B, MIM# 614879 Ataxia;HP:0001251 25851898 False 3 100;0;0 1.63 True ENSG00000112357 ENSG00000112357 HGNC:8860 PNPLA6 gene PNPLA6 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic paraplegia 39 (#612020), ataxia seen in some patients;Boucher-Neuhauser syndrome, 215470;Sapstic paraplegia 39, 612020;Oliver-McFarlane syndrome (#603197);Spinocerebellar ataxia, hypogonadotropic hypogonadism and chorioretinal dystrophy (Boucher-Neuhauser syndrome, #215470);Oliver-McFarlane syndrome, 275400 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000032444 ENSG00000032444 HGNC:16268 PNPT1 gene PNPT1 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 25, MIM# 608703" Ataxia;HP:0001251 35411967;37935417;39729134;39899068;39924761;40757543 False 3 60;40;0 1.63 True ENSG00000138035 ENSG00000138035 HGNC:23166 POLG gene POLG Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE);Mitochondrial recessive ataxia syndrome, 607459;Mitochondrial DNA depletion types 4A, 203700 and 4B, 613662;autosomal recessive progressive external opthalmoplegia, 258450;autosomal dominant progressive external ophthalmoplegia, 157640 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000140521 ENSG00000140521 HGNC:9179 PRDX3 gene PRDX3 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia MONDO:0000437, PRDX3-related Ataxia;HP:0001251 33889951 False 3 100;0;0 1.63 True ENSG00000165672 ENSG00000165672 HGNC:9354 PRKCG gene PRKCG Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14 MIM#605361 Ataxia;HP:0001251 25217572;18577575;31158466 False 3 100;0;0 1.63 True Other ENSG00000126583 ENSG00000126583 HGNC:9402 PRNP gene PRNP Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease Ataxia;HP:0001251 2564168;34324063;20301407 False 3 100;0;0 1.63 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRRT2 gene PRRT2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown PRRT2-associated paroxysmal movement disorder MONDO:0100556 Ataxia;HP:0001251 26598494;31193310;30501978;30713971 False 3 100;0;0 1.63 True ENSG00000167371 ENSG00000167371 HGNC:30500 PUM1 gene PUM1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 47, 617931 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000134644 ENSG00000134644 HGNC:14957 RAB3A gene RAB3A Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant cerebellar ataxia MONDO:0020380 Ataxia;HP:0001251 40166812 False 3 100;0;0 1.63 True ENSG00000105649 ENSG00000105649 HGNC:9777 RFC1 gene RFC1 Expert list;Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Ataxia;HP:0001251 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 1.63 True ENSG00000035928 ENSG00000035928 HGNC:9969 RNF170 gene RNF170 Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia, sensory, 1, autosomal dominant, MIM# 608984 Ataxia;HP:0001251 32943585;21115467 False 3 100;0;0 1.63 True ENSG00000120925 ENSG00000120925 HGNC:25358 RNF216 gene RNF216 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotrophic hypogonadism;Cerebellar ataxia and hypogonadotropic hypogonadism, 212840 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000011275 ENSG00000011275 HGNC:21698 SACS gene SACS Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type;Charlevoix-Saguenay spastic ataxia, 270550 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000151835 ENSG00000151835 HGNC:10519 SAMD9L gene SAMD9L Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550 Ataxia;HP:0001251 35310830;33884299;28570036 False 3 100;0;0 1.63 True ENSG00000177409 ENSG00000177409 HGNC:1349 SETX gene SETX Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia type 1, 606002;ataxia with oculomotor apraxia type 2 (AOA2), juvenile amyotrophic lateral sclerosis (ALS4) and autosomal dominant ataxia;Ataxia-ocular apraxia-2 Ataxia;HP:0001251 14770181;20301333 False 3 100;0;0 1.63 True ENSG00000107290 ENSG00000107290 HGNC:445 SLC1A3 gene SLC1A3 Expert Review Green;Literature;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 6 MIM#612656 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000079215 ENSG00000079215 HGNC:10941 SPG7 gene SPG7 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000197912 ENSG00000197912 HGNC:11237 SPTAN1 gene SPTAN1 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia MONDO:0957813 Ataxia;HP:0001251 36331550 False 3 100;0;0 1.63 True Other ENSG00000197694 ENSG00000197694 HGNC:11273 SPTBN2 gene SPTBN2 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinocerebellar ataxia 5, 600224;Spinocerebellar ataxia, autosomal recessive 14, 615386 Ataxia;HP:0001251 False 3 100;0;0 1.63 True ENSG00000173898 ENSG00000173898 HGNC:11276 STUB1 gene STUB1 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinocerebellar ataxia 48, MIM#618093 Ataxia;HP:0001251 32337344;30381368;31126790 False 3 100;0;0 1.63 True ENSG00000103266 ENSG00000103266 HGNC:11427 SYNE1 gene SYNE1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 8;Cerebellar Ataxia;Autosomal recessive spinocerebellar ataxia type 8 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000131018 ENSG00000131018 HGNC:17089 TMEM240 gene TMEM240 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 21, 607454 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000205090 ENSG00000205090 HGNC:25186 TTBK2 gene TTBK2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11 Ataxia;HP:0001251 False 3 50;50;0 1.63 False ENSG00000128881 ENSG00000128881 HGNC:19141 TTPA gene TTPA Expert list;Expert Review Green;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia with isolated vitamin E deficiency;Ataxia with Vitamin E Deficiency;Ataxia with isolated vitamin E deficiency, 277460 Ataxia;HP:0001251 False 3 100;0;0 1.63 False ENSG00000137561 ENSG00000137561 HGNC:12404 TUBA4A gene TUBA4A Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic ataxia 11, autosomal dominant, MIM# 621226 Ataxia;HP:0001251 38884572;37418012 False 3 100;0;0 1.63 True ENSG00000127824 ENSG00000127824 HGNC:12407 VPS13D gene VPS13D Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 4, 607317 Ataxia;HP:0001251 False 3 100;0;0 1.63 True ENSG00000048707 ENSG00000048707 HGNC:23595 XRCC1 gene XRCC1 Expert Review Green;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ocular motor apraxia, axonal neuropathy, and progressive cerebellar ataxia;Autosomal recessive spinocerebellar ataxia 26, 617633 Ataxia;HP:0001251 29472272;28002403 False 3 100;0;0 1.63 False ENSG00000073050 ENSG00000073050 HGNC:12828 CCDC88C gene CCDC88C Expert Review Amber;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown autosomal dominant spinocerebellar ataxia;?Spinocerebellar ataxia 40, 616053 Ataxia;HP:0001251 25062847;30398676 False 2 33;67;0 1.63 True ENSG00000015133 ENSG00000015133 HGNC:19967 CHP1 gene CHP1 Expert Review Amber;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 9, autosomal recessive, OMIM #618438 Ataxia;HP:0001251 29379881;32787936 False 2 50;50;0 1.63 True ENSG00000187446 ENSG00000187446 HGNC:17433 FDXR gene FDXR Expert list;Expert Review Amber;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Auditory neuropathy and optic atrophy, 617717;Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 Ataxia;HP:0001251 30250212;28965846;29040572;33348459;37046037;37481223 False 2 0;50;50 1.63 True ENSG00000161513 ENSG00000161513 HGNC:3642 MTCL1 gene MTCL1 Expert list;Expert Review Amber Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spinocerebellar ataxia Ataxia;HP:0001251 30548255;28283581 False 2 0;100;0 1.63 True ENSG00000168502 ENSG00000168502 HGNC:29121 PLD3 gene PLD3 Expert Review Amber;GeneReviews;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Spinocerebellar ataxia 46 Ataxia;HP:0001251 30312375;30312384;29053796 False 2 0;100;0 1.63 False ENSG00000105223 ENSG00000105223 HGNC:17158 PRPS1 gene PRPS1 Expert Review Amber;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy Ataxia;HP:0001251 33898739;28967191 False 2 33;67;0 1.63 True ENSG00000147224 ENSG00000147224 HGNC:9462 SDHA gene SDHA Expert list;Expert Review Amber Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259 Ataxia;HP:0001251 10976639;27683074 False 2 0;100;0 1.63 True ENSG00000073578 ENSG00000073578 HGNC:10680 TDP1 gene TDP1 Expert Review Amber;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250 Ataxia;HP:0001251 31182267;12244316 False 2 0;100;0 1.63 True ENSG00000042088 ENSG00000042088 HGNC:18884 TRPC3 gene TRPC3 Expert Review Amber;GeneReviews;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Ataxia;HP:0001251 25477146;26112884 False 2 0;100;0 1.63 True ENSG00000138741 ENSG00000138741 HGNC:12335 VAMP1 gene VAMP1 Expert Review Amber;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Autosomal dominant spastic ataxia 1, 108600;Spastic ataxia 1, autosomal dominant, 108600 Ataxia;HP:0001251 22958904 False 2 0;100;0 1.63 True ENSG00000139190 ENSG00000139190 HGNC:12642 ZFYVE26 gene ZFYVE26 Expert Review Amber;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic paraplegia 15, 270700 Ataxia;HP:0001251 24367272;18394578 False 2 50;50;0 1.63 True ENSG00000072121 ENSG00000072121 HGNC:20761 ATP1A2 gene ATP1A2 Expert Review Red;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alternating hemiplegia of childhood 1, 104290;Familial hemiplegic migraine 2, 602481 Ataxia;HP:0001251 False 1 0;0;100 1.63 True ENSG00000018625 ENSG00000018625 HGNC:800 ATP7B gene ATP7B Expert Review Red;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease 277900;Wilson disease, 277900 Ataxia;HP:0001251 False 1 0;0;100 1.63 True ENSG00000123191 ENSG00000123191 HGNC:870 CACNB4 gene CACNB4 Expert list;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia type 5, 613855 Ataxia;HP:0001251 10762541;27003325;9628818 False 1 0;50;50 1.63 True ENSG00000182389 ENSG00000182389 HGNC:1404 CHCHD10 gene CHCHD10 Expert Review Red;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532 Ataxia;HP:0001251 24934289 False 1 0;0;100 1.63 True ENSG00000250479 ENSG00000250479 HGNC:15559 EEF2 gene EEF2 Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Spinocerebellar ataxia 26 Ataxia;HP:0001251 15732118;23001565 False 1 100;0;0 1.63 True ENSG00000167658 ENSG00000167658 HGNC:3214 IFRD1 gene IFRD1 Expert Review;Expert Review Red;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hereditary spastic paraplegia MONDO:0019064, IFRD1-related Ataxia;HP:0001251 29362493;28601596;19409521 False 1 0;0;100 1.63 True ENSG00000006652 ENSG00000006652 HGNC:5456 MME gene MME Expert Review Green;Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?Spinocerebellar ataxia type 43, 617018 Ataxia;HP:0001251 27583304 False 1 50;0;50 1.63 False ENSG00000196549 ENSG00000196549 HGNC:7154 NOL3 gene NOL3 Expert Review Red;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myoclonus, familial cortical Ataxia;HP:0001251 22926851 False 1 0;0;100 1.63 True ENSG00000140939 ENSG00000140939 HGNC:7869 SEPSECS gene SEPSECS Expert list;Expert Review Red;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2D, 613811;cerebellar ataxia and cognitive impairment Ataxia;HP:0001251 29464431 False 1 50;0;50 1.63 True ENSG00000109618 ENSG00000109618 HGNC:30605 SYT14 gene SYT14 Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Spinocerebellarataxia,autosomalrecessive11,614229 Ataxia;HP:0001251 21835308 False 1 0;0;100 1.63 False ENSG00000143469 ENSG00000143469 HGNC:23143 TGM6 gene TGM6 Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 35, 613908;Spinocerebellar ataxia 35 Ataxia;HP:0001251 25253745;21106500;28934387;22554020;30670339;29053796;23206699 False 1 0;0;100 1.63 True ENSG00000166948 ENSG00000166948 HGNC:16255 TSEN54 gene TSEN54 Expert list;Expert Review Red Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown adult-onset cerebellar ataxia Ataxia;HP:0001251 24938831 False 1 0;0;100 1.63 False ENSG00000182173 ENSG00000182173 HGNC:27561 VWA3B gene VWA3B Expert Review Red;GeneReviews;Royal Melbourne Hospital Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Spinocerebellar ataxia, autosomal recessive 22 Ataxia;HP:0001251 26157035 False 1 0;0;100 1.63 False ENSG00000168658 ENSG00000168658 HGNC:28385 ATN1_DRPLA_CAG str ATN1 Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 Ataxia;HP:0001251 29325606;20301664 False 3 100;0;0 1.63 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 ATXN10_SCA10_ATTCT str ATXN10 Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 10 MIM#603516 Ataxia;HP:0001251 20301354 False 3 0;0;0 1.63 True ENSG00000130638 ENSG00000130638 HGNC:10549 22 46191235 46191304 45795355 45795424 ATTCT 32 800 ATXN1_SCA1_CAG str ATXN1 Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 1 MIM#164400 Ataxia;HP:0001251 29325606;20301363 False 3 100;0;0 1.63 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327918 16327953 16327687 16327722 CAG 35 39 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 Ataxia;HP:0001251 29325606;20301452 False 3 100;0;0 1.63 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 ATXN3_SCA3_CAG str ATXN3 Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 Ataxia;HP:0001251 20301375;29325606 False 3 100;0;0 1.63 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 ATXN7_SCA7_CAG str ATXN7 Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 7 MIM#164500 Ataxia;HP:0001251 29325606;20301433 False 3 100;0;0 1.63 True ENSG00000163635 ENSG00000163635 HGNC:10560 3 63898362 63898391 63912686 63912715 CAG 27 37 ATXN8OS_SCA8_CTG str ATXN8OS Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 Ataxia;HP:0001251 20301445 False 3 100;0;0 1.63 True ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139428 CTG 50 80 BEAN1_SCA31_TGGAA str BEAN1 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 31 MIM#117210 Ataxia;HP:0001251 19878914;31755042 False 3 100;0;0 1.63 True ENSG00000166546 ENSG00000166546 HGNC:24160 16 66524300 66524369 66490397 66490466 TGGAA 22 80 CACNA1A_SCA6_CAG str CACNA1A Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500 Ataxia;HP:0001251 20301319;29325606 False 3 100;0;0 1.63 True ENSG00000141837 ENSG00000141837 HGNC:1388 19 13318673 13318691 13207859 13207897 CAG 18 20 CSTB_EPM1_CCCCGCCCCGCG str CSTB Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Ataxia;HP:0001251 29325606;20301321 False 3 100;0;0 1.63 True ENSG00000160213 ENSG00000160213 HGNC:2482 21 45196325 45196360 43776444 43776479 CCCCGCCCCGCG 3 30 DAB1_SCA37_ATTTC str DAB1 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 37 MIM#615945 Ataxia;HP:0001251 28686858;31145571 False 3 100;0;0 1.63 True ENSG00000173406 ENSG00000173406 HGNC:2661 1 57832716 57832797 57367044 57367121 ATTTC 0 31 FGF14_SCA27B_GAA str FGF14 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs) Ataxia;HP:0001251 37165652;36516086;36493768 False 3 100;0;0 1.63 True ENSG00000102466 ENSG00000102466 HGNC:3671 13 102813926 102814076 102161576 102161726 GAA 249 300 FMR1_FXTAS_CGG str FMR1 Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 Ataxia;HP:0001251 23765048;25227148 False 3 100;0;0 1.63 True ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FXN_FRDA_GAA str FXN Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 Ataxia;HP:0001251 20301458 False 3 100;0;0 1.63 True ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 NOP56_SCA36_GGCCTG str NOP56 Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 36 MIM#614153 Ataxia;HP:0001251 21683323 False 3 100;0;0 1.63 True ENSG00000101361 ENSG00000101361 HGNC:15911 20 2633380 2633403 2652734 2652757 GGCCTG 14 650 PPP2R2B_SCA12_CAG str PPP2R2B Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 Ataxia;HP:0001251 27864267;33811808 False 3 100;0;0 1.63 True ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 PRNP_CJD_octapeptide str PRNP Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 Ataxia;HP:0001251 2159587;20301407 False 3 100;0;0 1.63 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699424 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 RFC1_CANVAS_ANNGN str RFC1 Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Ataxia;HP:0001251 30926972 False 3 100;0;0 1.63 False ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 TBP_SCA17_CAG str TBP Expert Review Green;Expert list Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 Ataxia;HP:0001251 20301611;29325606 False 3 100;0;0 1.63 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 ZFHX3_SCA4_GGC str ZFHX3 Expert Review Green;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 Ataxia;HP:0001251 38035881;38197134 False 3 100;0;0 1.63 True ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 THAP11_SCA51_CAG str THAP11 Expert Review Amber;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 51 MONDO:0975800 Ataxia;HP:0001251 15368101;24677642;34165550;38113319;40459937;39651830;37148549 False 2 0;100;0 1.63 True ENSG00000168286 ENSG00000168286 HGNC:23194 16 67876766 67876853 67842863 67842950 CAG 39 47 LMNB1 upstream region region Literature;Literature Ataxia - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Adult-onset autosomal dominant demyelinating leukodystrophy, MONDO:0008215 Ataxia;HP:0001251 PMID: 30842973;30697589;25701871 False 1 100;0;0 1.63 False 5 126522203 126689287 80 cnv_loss LMNB1 upstream region