Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name AAAS gene AAAS Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Achalasia-addisonianism-alacrimia syndrome MIM#231550 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000094914 ENSG00000094914 HGNC:13666 AARS2 gene AARS2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970;ovarioleukodystrophy, MONDO:0020506 Ataxia;HP:0001251 39853526;38507676;35084689;31705293;31347571;31099476;30706699;29666464;28322004 False 3 100;0;0 2.175 True ENSG00000124608 ENSG00000124608 HGNC:21022 ABCA2 gene ABCA2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal intellectual developmental disorder with poor growth and with or without seizures or ataxia, MONDO:0032930 Ataxia;HP:0001251 38228874 False 3 100;0;0 2.175 True ENSG00000107331 ENSG00000107331 HGNC:32 ABCB7 gene ABCB7 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Anaemia, sideroblastic, with ataxia, MIM# 301310 Ataxia;HP:0001251 10196363;10196363;33157103;31772327;31511561;26242992 False 3 100;0;0 2.175 True ENSG00000131269 ENSG00000131269 HGNC:48 ABCD1 gene ABCD1 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenoleukodystrophy MIM# 300100, XLR Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000101986 ENSG00000101986 HGNC:61 ABHD12 gene ABHD12 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000100997 ENSG00000100997 HGNC:15868 ACBD6 gene ACBD6 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 Ataxia;HP:0001251 37951597 False 3 100;0;0 2.175 True ENSG00000230124 ENSG00000230124 HGNC:23339 ACO2 gene ACO2 Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile cerebellar-retinal degeneration, MIM#614559 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000100412 ENSG00000100412 HGNC:118 ADGRG1 gene ADGRG1 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polymicrogyria, Frontoparietal, 606854;Polymicrogyria, perisylvian type, 615752 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000205336 ENSG00000205336 HGNC:4512 ADPRS gene ADPRS Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced with variable ataxia and seizures, 618170 Ataxia;HP:0001251 30100084;30401461 False 3 100;0;0 2.175 True ENSG00000116863 ENSG00000116863 HGNC:21304 AFG3L2 gene AFG3L2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive MIM#614487;Spinocerebellar ataxia 28 MIM#610246 Ataxia;HP:0001251 20725928 False 3 100;0;0 2.175 True ENSG00000141385 ENSG00000141385 HGNC:315 AGTPBP1 gene AGTPBP1 Expert Review;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650 Ataxia;HP:0001251 30420557, 28600779, 30976113, 38153683, 28325758 False 3 100;0;0 2.175 True ENSG00000135049 ENSG00000135049 HGNC:17258 AHI1 gene AHI1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 3 Ataxia;HP:0001251 25616960 False 3 100;0;0 2.175 True ENSG00000135541 ENSG00000135541 HGNC:21575 AIFM1 gene AIFM1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot-Marie-Tooth disease X-linked recessive 4, MONDO:0010689;X-linked hereditary sensory and autonomic neuropathy with hearing loss, MONDO:0010378;severe X-linked mitochondrial encephalomyopathy, MONDO:0010437;spondyloepimetaphyseal dysplasia, Bieganski type, MONDO:0010275 Ataxia;HP:0001251 39601015;37603145;32337346;31523922;31188924;28842795;25934856 False 3 100;0;0 2.175 True ENSG00000156709 ENSG00000156709 HGNC:8768 ALDH5A1 gene ALDH5A1 Expert Review Green;NHS GMS;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 Ataxia;HP:0001251 14635103 False 3 100;0;0 2.175 True ENSG00000112294 ENSG00000112294 HGNC:408 ALG6 gene ALG6 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ALG6-congenital disorder of glycosylation 1C, MONDO:0011291 Ataxia;HP:0001251 27287710 False 3 100;0;0 2.175 True ENSG00000088035 ENSG00000088035 HGNC:23157 ANK3 gene ANK3 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092 Ataxia;HP:0001251 40879451;36777705 False 3 100;0;0 2.175 True ENSG00000151150 ENSG00000151150 HGNC:494 ANO10 gene ANO10 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 10 MIM#613728 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000160746 ENSG00000160746 HGNC:25519 AP1S2 gene AP1S2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Pettigrew syndrome, MIM# 304340 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000182287 ENSG00000182287 HGNC:560 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminaemia MIM#208920 Ataxia;HP:0001251 30986824;26256098;11586299 False 3 100;0;0 2.175 True ENSG00000137074 ENSG00000137074 HGNC:15984 ARL13B gene ARL13B Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 8, MIM# 612291" Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000169379 ENSG00000169379 HGNC:25419 ARSA gene ARSA Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic Leukodystrophy, 250100;Metachromatic leukodystrophy (#250100) Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000100299 ENSG00000100299 HGNC:713 ARV1 gene ARV1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal developmental and epileptic encephalopathy, 38, MONDO:0014868 Ataxia;HP:0001251 37749428;32165008 False 3 100;0;0 2.175 True ENSG00000173409 ENSG00000173409 HGNC:29561 ATCAY gene ATCAY Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, cerebellar, Cayman type, MIM# 601238;MONDO:0011025 Ataxia;HP:0001251 14556008;29449188;23226316;26343454 False 3 50;50;0 2.175 True ENSG00000167654 ENSG00000167654 HGNC:779 ATG7 gene ATG7 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, SCAR31, MIM#619422 Ataxia;HP:0001251 34161705 False 3 100;0;0 2.175 True ENSG00000197548 ENSG00000197548 HGNC:16935 ATM gene ATM Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia MIM#208900 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000149311 ENSG00000149311 HGNC:795 ATP13A2 gene ATP13A2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 Ataxia;HP:0001251 21362476;21696388;31588715;32559632;33033738;33091395;34405108 False 3 100;0;0 2.175 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP1A3 gene ATP1A3 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 Ataxia;HP:0001251 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 2.175 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP2B2 gene ATP2B2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related Ataxia;HP:0001251 PMID: 37675773 False 3 100;0;0 2.175 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157087 ENSG00000157087 HGNC:815 ATP2B3 gene ATP2B3 Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Spinocerebellar ataxia, X-linked 1 Ataxia;HP:0001251 37821930;36207321;31680123;28807751;28720891;27653636;25953895 False 3 50;50;0 2.175 True ENSG00000067842 ENSG00000067842 HGNC:816 ATP6V0A1 gene ATP6V0A1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971 Ataxia;HP:0001251 PMID:34909687 False 3 50;50;0 2.175 True ENSG00000033627 ENSG00000033627 HGNC:865 ATP8A2 gene ATP8A2 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268 Ataxia;HP:0001251 22892528;31612321 False 3 100;0;0 2.175 True ENSG00000132932 ENSG00000132932 HGNC:13533 B4GALNT1 gene B4GALNT1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary spastic paraplegia 26, MONDO:0012213 Ataxia;HP:0001251 40171946;39145292;37510308;35775650 False 3 100;0;0 2.175 True ENSG00000135454 ENSG00000135454 HGNC:4117 BBS1 gene BBS1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 1, 209900 Ataxia;HP:0001251 15637713 False 3 100;0;0 2.175 True ENSG00000174483 ENSG00000174483 HGNC:966 BCKDHB gene BCKDHB Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Episodic ataxia during metabolic crises;paroxysmal nonkinesigenic dyskinesia Ataxia;HP:0001251 PMID 32151765 False 3 0;0;0 2.175 True ENSG00000083123 ENSG00000083123 HGNC:987 BRAT1 gene BRAT1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056 Ataxia;HP:0001251 26483087;26494257;27282546 False 3 100;0;0 2.175 True ENSG00000106009 ENSG00000106009 HGNC:21701 C19orf12 gene C19orf12 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodegeneration with brain iron accumulation 4, MONDO:0013674 Ataxia;HP:0001251 39755877 False 3 100;0;0 2.175 True ENSG00000131943 ENSG00000131943 HGNC:25443 CA8 gene CA8 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3;Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3, 613227 Ataxia;HP:0001251 21937992;19461874 False 3 100;0;0 2.175 True ENSG00000178538 ENSG00000178538 HGNC:1382 CACNA1A gene CACNA1A Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500 Ataxia;HP:0001251 False 3 50;50;0 2.175 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1C gene CACNA1C Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092 Ataxia;HP:0001251 34163037;31291898 False 3 100;0;0 2.175 True ENSG00000151067 ENSG00000151067 HGNC:1390 CACNA1G gene CACNA1G Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits MIM#618087 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA2D2 gene CACNA2D2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar atrophy with seizures and variable developmental delay MIM#618501 Ataxia;HP:0001251 23339110;24358150;30410802;29997391;31402629 False 3 100;0;0 2.175 True ENSG00000007402 ENSG00000007402 HGNC:1400 CAD gene CAD Expert list;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 50;OMIM # 616457 Ataxia;HP:0001251 PMID: 32820246 False 3 100;0;0 2.175 True ENSG00000084774 ENSG00000084774 HGNC:1424 CAMTA1 gene CAMTA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellarataxia, nonprogressive, with mental retardation, 614756;Cerebellar ataxia with mental retardation, 614756 Ataxia;HP:0001251 32157189;22693284 False 3 100;0;0 2.175 True ENSG00000171735 ENSG00000171735 HGNC:18806 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy Ataxia;HP:0001251 39878554 False 3 100;0;0 2.175 True ENSG00000135387 ENSG00000135387 HGNC:6743 CASK gene CASK Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) FG syndrome 4, 300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000147044 ENSG00000147044 HGNC:1497 CBY1 gene CBY1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal intellectual disability;cerebellar ataxia;molar tooth sign;polydactyly;Joubert syndrome Ataxia;HP:0001251 33131181;25103236;25220153 False 3 100;0;0 2.175 True ENSG00000100211 ENSG00000100211 HGNC:1307 CC2D2A gene CC2D2A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 9, MIM#612285 Ataxia;HP:0001251 18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408 False 3 100;0;0 2.175 True ENSG00000048342 ENSG00000048342 HGNC:29253 CD99L2 gene CD99L2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodevelopmental disorder, MONDO:0700092;CD99L2-related Ataxia;HP:0001251 41690933 False 3 100;0;0 2.175 True ENSG00000102181 ENSG00000102181 HGNC:18237 CEP104 gene CEP104 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 25, MONDO:0014770;ciliopathy, MONDO:0005308 Ataxia;HP:0001251 41965849;35359234;31625690;26477546 False 3 100;0;0 2.175 True ENSG00000116198 ENSG00000116198 HGNC:24866 CEP120 gene CEP120 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 31, MONDO:0033310 Ataxia;HP:0001251 38050708;27208211 False 3 100;0;0 2.175 True ENSG00000168944 ENSG00000168944 HGNC:26690 CEP290 gene CEP290 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 5, MIM# 610188 Ataxia;HP:0001251 18327255;20690115;16682973;16682970;17564967;16909394;17564974 False 3 100;0;0 2.175 True ENSG00000198707 ENSG00000198707 HGNC:29021 CEP41 gene CEP41 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 15, MIM# 614464 Ataxia;HP:0001251 22246503 False 3 100;0;0 2.175 True ENSG00000106477 ENSG00000106477 HGNC:12370 CLCN2 gene CLCN2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with ataxia, MIM# 615651 Ataxia;HP:0001251 29403011;29403012;23707145 False 3 100;0;0 2.175 True ENSG00000114859 ENSG00000114859 HGNC:2020 CLN5 gene CLN5 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis neuronal 5, MIM# 256731 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000102805 ENSG00000102805 HGNC:2076 CLN6 gene CLN6 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300 Ataxia;HP:0001251 11791207;11727201;21549341;30561534 False 3 100;0;0 2.175 True ENSG00000128973 ENSG00000128973 HGNC:2077 CLN8 gene CLN8 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neuronal ceroid lipofuscinosis 8, MONDO:0010830 Ataxia;HP:0001251 36011304;31982899;30741402 False 3 100;0;0 2.175 True ENSG00000182372 ENSG00000182372 HGNC:2079 CLPP gene CLPP Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 3, MIM# 614129 Ataxia;HP:0001251 25254289 False 3 100;0;0 2.175 True ENSG00000125656 ENSG00000125656 HGNC:2084 COA7 gene COA7 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000162377 ENSG00000162377 HGNC:25716 COASY gene COASY Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodegeneration with brain iron accumulation 6, MONDO:0014290 Ataxia;HP:0001251 38750253;36877387;28489334 False 3 100;0;0 2.175 True ENSG00000068120 ENSG00000068120 HGNC:29932 COQ4 gene COQ4 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Childhood-onset ataxia Ataxia;HP:0001251 30225196;33704555;30847826 False 3 100;0;0 2.175 True ENSG00000167113 ENSG00000167113 HGNC:19693 COQ5 gene COQ5 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 9 MIM#619028 Ataxia;HP:0001251 29044765;37599337;21937992;41199775;36266294 False 3 33;0;67 2.175 True ENSG00000110871 ENSG00000110871 HGNC:28722 COQ8A gene COQ8A Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 Ataxia;HP:0001251 32337771 False 3 100;0;0 2.175 True ENSG00000163050 ENSG00000163050 HGNC:16812 COX20 gene COX20 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, 220110;Mitochondrial complex IV deficiency Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000203667 ENSG00000203667 HGNC:26970 CP gene CP Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290 Ataxia;HP:0001251 20301666 False 3 100;0;0 2.175 False ENSG00000047457 ENSG00000047457 HGNC:2295 CPLANE1 gene CPLANE1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 17, MIM# 614615" Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000197603 ENSG00000197603 HGNC:25801 CSF1R gene CSF1R Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia Ataxia;HP:0001251 24198292;25563800;25935893 False 3 100;0;0 2.175 False ENSG00000182578 ENSG00000182578 HGNC:2433 CSNK2B gene CSNK2B Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732 Ataxia;HP:0001251 PMID: 34041744 False 3 100;0;0 2.175 True ENSG00000204435 ENSG00000204435 HGNC:2460 CSTB gene CSTB Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM#254800 Ataxia;HP:0001251 9012407;9054946 False 3 50;50;0 2.175 True ENSG00000160213 ENSG00000160213 HGNC:2482 CTBP1 gene CTBP1 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, MIM#617915 Ataxia;HP:0001251 27094857;28955726;31041561 False 3 100;0;0 2.175 True ENSG00000159692 ENSG00000159692 HGNC:2494 CTNNB1 gene CTNNB1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CTNNB1-related neurodevelopmental disorder and/or vitreoretinopathy, MONDO:0100571 Ataxia;HP:0001251 39935833;35880249 False 3 100;0;0 2.175 True ENSG00000168036 ENSG00000168036 HGNC:2514 CWF19L1 gene CWF19L1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 17, 616127;Autosomal recessive spinocerebellar ataxia type 17, 616127 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000095485 ENSG00000095485 HGNC:25613 CYP27A1 gene CYP27A1 Expert Review Green;NHS GMS;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP7B1 gene CYP7B1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary spastic paraplegia 5A, MONDO:0010047 Ataxia;HP:0001251 40782215;29126212 False 3 100;0;0 2.175 True ENSG00000172817 ENSG00000172817 HGNC:2652 DAGLA gene DAGLA Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuroocular syndrome 2, paroxysmal type, MIM# 168885 Ataxia;HP:0001251 35737950 False 3 100;0;0 2.175 True ENSG00000134780 ENSG00000134780 HGNC:1165 DARS2 gene DARS2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation;Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000117593 ENSG00000117593 HGNC:25538 DDHD2 gene DDHD2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive paraplegia 54 (#615033). Complex form of disease ataxia reported amongst the phenotypic features in Citterio et al. (2014), Journal of Neurology, 261, pp.373-381 and Doi et al. (2014), Scientific Reports, 4, 7132.;Spastic paraplegia 54 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000085788 ENSG00000085788 HGNC:29106 DDX41 gene DDX41 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Inherited retinal dystrophy, MONDO:0019118, DDX41-related Ataxia;HP:0001251 41646732 False 3 100;0;0 2.175 True ENSG00000183258 ENSG00000183258 HGNC:18674 DHDDS gene DHDDS Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay and seizures with or without movement abnormalities, OMIM:617836 Ataxia;HP:0001251 29100083;33798445;34182312;34382076 False 3 100;0;0 2.175 True ENSG00000117682 ENSG00000117682 HGNC:20603 DNAJC19 gene DNAJC19 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type V 610198;dilated cardiomyopathy with ataxia (DCMA) syndrome;3-methylglutaconic aciduria type V, 610198 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000205981 ENSG00000205981 HGNC:30528 DNAJC3 gene DNAJC3 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile-onset diabetes mellitus-central and peripheral neurodegeneration syndrome, MONDO:0014523 Ataxia;HP:0001251 34654017;34630333;33486469;32738013;28940199 False 3 100;0;0 2.175 True ENSG00000102580 ENSG00000102580 HGNC:9439 DNAJC5 gene DNAJC5 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNM1L gene DNM1L Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted encephalopathy due to mitochondrial and peroxisomal fission defect, MONDO:0054865 Ataxia;HP:0001251 41244260;38481935;36212643;33718295;31868880 False 3 100;0;0 2.175 True ENSG00000087470 ENSG00000087470 HGNC:2973 DNMT1 gene DNMT1 ClinGen;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 Ataxia;HP:0001251 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 False 3 100;0;0 2.175 False ENSG00000130816 ENSG00000130816 HGNC:2976 DOCK3 gene DOCK3 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000088538 ENSG00000088538 HGNC:2989 DYRK1A gene DYRK1A Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted DYRK1A-related intellectual disability syndrome, MONDO:0013578 Ataxia;HP:0001251 40206408;25944381 False 3 100;0;0 2.175 True ENSG00000157540 ENSG00000157540 HGNC:3091 EBF3 gene EBF3 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia and delayed development syndrome, 617330 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000108001 ENSG00000108001 HGNC:19087 EEFSEC gene EEFSEC Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102 Ataxia;HP:0001251 39753114 False 3 100;0;0 2.175 True ENSG00000132394 ENSG00000132394 HGNC:24614 EIF2AK2 gene EIF2AK2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MONDO:0030035 Ataxia;HP:0001251 37284702;32197074 False 3 100;0;0 2.175 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2B1 gene EIF2B1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B2 gene EIF2B2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B3 gene EIF2B3 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B4 gene EIF2B4 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B5 gene EIF2B5 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000145191 ENSG00000145191 HGNC:3261 ELFN1 gene ELFN1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dursun-Ozgul neurodevelopmental syndrome, MIM# 621344 Ataxia;HP:0001251 PMID:40576023 False 3 100;0;0 2.175 True ENSG00000225968 ENSG00000225968 HGNC:33154 ELOVL4 gene ELOVL4 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000118402 ENSG00000118402 HGNC:14415 ELOVL5 gene ELOVL5 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 38, MIM#615957 Ataxia;HP:0001251 25065913 False 3 100;0;0 2.175 False ENSG00000012660 ENSG00000012660 HGNC:21308 EPM2A gene EPM2A Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2A, Lafora, 254780;Epilepsy, progressive myoclonic 2A (Lafora) 254780 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000112425 ENSG00000112425 HGNC:3413 ERCC4 gene ERCC4 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM# 278760" Ataxia;HP:0001251 29403087;28431612;29892709 False 3 100;0;0 2.175 False ENSG00000175595 ENSG00000175595 HGNC:3436 ERCC6 gene ERCC6 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome type 2, MONDO:0019570 Ataxia;HP:0001251 38674442;37532514 False 3 100;0;0 2.175 True ENSG00000225830 ENSG00000225830 HGNC:3438 ESRRG gene ESRRG Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Movement disorder, congenital nonprogressive, with ataxia and eye movement abnormalities, MIM# 621639 Ataxia;HP:0001251 41265451 False 3 100;0;0 2.175 True ENSG00000196482 ENSG00000196482 HGNC:3474 EXOSC5 gene EXOSC5 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, brain abnormalities, and cardiac conduction defects, MIM# 619576;Short stature;Motor developmental delays;Cerebellar hypoplasia;Ataxia Ataxia;HP:0001251 32504085;29302074 False 3 100;0;0 2.175 True ENSG00000077348 ENSG00000077348 HGNC:24662 FA2H gene FA2H Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 35, autosomal recessive MIM#612319" Ataxia;HP:0001251 31135052 False 3 100;0;0 2.175 True ENSG00000103089 ENSG00000103089 HGNC:21197 FAM149B1 gene FAM149B1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 36, MONDO:0032902 Ataxia;HP:0001251 34828254;30905400 False 3 100;0;0 2.175 True ENSG00000138286 ENSG00000138286 HGNC:29162 FAT2 gene FAT2 Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 45, MIM#617769 Ataxia;HP:0001251 29053796;33884300 False 3 50;50;0 2.175 False ENSG00000086570 ENSG00000086570 HGNC:3596 FBXL4 gene FBXL4 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type), MIM# 615471 Ataxia;HP:0001251 28383868 False 3 100;0;0 2.175 True ENSG00000112234 ENSG00000112234 HGNC:13601 FDXR gene FDXR Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 Ataxia;HP:0001251 30250212;28965846;29040572;33348459;37046037;37481223 False 3 100;0;0 2.175 True ENSG00000161513 ENSG00000161513 HGNC:3642 FGF14 gene FGF14 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 27 MIM#609307 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000102466 ENSG00000102466 HGNC:3671 FLVCR1 gene FLVCR1 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, posterior column, with retinitis pigmentosa MIM#609033 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000162769 ENSG00000162769 HGNC:24682 FOLR1 gene FOLR1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration due to cerebral folate transport deficiency, 613068;Neurodegeneration due to cerebral folate transport deficiency Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000110195 ENSG00000110195 HGNC:3791 FRMD5 gene FRMD5 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094 Ataxia;HP:0001251 36206744 False 3 100;0;0 2.175 True ENSG00000171877 ENSG00000171877 HGNC:28214 FXN gene FXN Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000165060 ENSG00000165060 HGNC:3951 GABRB2 gene GABRB2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted complex neurodevelopmental disorder, MONDO:0100038 Ataxia;HP:0001251 33325057;29100083 False 3 100;0;0 2.175 True ENSG00000145864 ENSG00000145864 HGNC:4082 GALC gene GALC Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe disease, MONDO:0009499 Ataxia;HP:0001251 36341094;35002157;32484059;26915362 False 3 100;0;0 2.175 True ENSG00000054983 ENSG00000054983 HGNC:4115 GAN gene GAN Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal giant axonal neuropathy 1, MONDO:0009749 Ataxia;HP:0001251 39602023;38011432;36866531;34114613;32999401;31655922;30532362;30246730 False 3 100;0;0 2.175 True ENSG00000261609 ENSG00000261609 HGNC:4137 GBA1 gene GBA1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gaucher disease type III, MONDO:0009267 Ataxia;HP:0001251 28736718;28736718;28003644;28003644 False 3 100;0;0 2.175 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA2 gene GBA2 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, MIM# 614409;MONDO:0013737 Ataxia;HP:0001251 23332916;23332917;29524657 False 3 100;0;0 2.175 True ENSG00000070610 ENSG00000070610 HGNC:18986 GDAP2 gene GDAP2 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000196505 ENSG00000196505 HGNC:18010 GEMIN5 gene GEMIN5 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, OMIM # 619333 Ataxia;HP:0001251 34569062;33963192 False 3 100;0;0 2.175 True ENSG00000082516 ENSG00000082516 HGNC:20043 GFAP gene GFAP Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000131095 ENSG00000131095 HGNC:4235 GJC2 gene GJC2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating leukodystrophy 2, 608804;Leukodystrophy, hypomyelinating, 2;Autosomal Recessive Ataxia;Spastic paraplegia 44, 613206 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000198835 ENSG00000198835 HGNC:17494 GLS gene GLS Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal glutaminase deficiency, MONDO:0600001 Ataxia;HP:0001251 38877099;38260514;35913761;30970188 False 3 100;0;0 2.175 True ENSG00000115419 ENSG00000115419 HGNC:4331 GOSR2 gene GOSR2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 6, 614018;Progressive myoclonic epilepsy 6, 614018 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000108433 ENSG00000108433 HGNC:4431 GPAA1 gene GPAA1 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 15, 617810 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000197858 ENSG00000197858 HGNC:4446 GRID2 gene GRID2 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 18, 616204 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000152208 ENSG00000152208 HGNC:4576 GRM1 gene GRM1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 13;Spinocerebellar ataxia 44, 617691, autosomal recessive spinocerebellar ataxia type 13, 614831 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000152822 ENSG00000152822 HGNC:4593 GRN gene GRN Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neuronal ceroid lipofuscinosis 11, MONDO:0013866 Ataxia;HP:0001251 39812704;39394881;31855245 False 3 100;0;0 2.175 True ENSG00000030582 ENSG00000030582 HGNC:4601 GSS gene GSS Expert Review Green;NHS GMS;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gluthathione synthetase deficiency, MIM# 266130 Ataxia;HP:0001251 15717202 False 3 100;0;0 2.175 True ENSG00000100983 ENSG00000100983 HGNC:4624 HEXA gene HEXA Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms, 272800;Tay-Sachs disease, 272800 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000213614 ENSG00000213614 HGNC:4878 HEXB gene HEXB Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms, 268800;Sandhoff disease, 268800 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000049860 ENSG00000049860 HGNC:4879 HSD17B4 gene HSD17B4 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 1, MONDO:0009300;d-bifunctional protein deficiency, MONDO:0009855 Ataxia;HP:0001251 42231982;41367148;40102401;39379670;38249302;32042923;28830375;27790638;27528516 False 3 100;0;0 2.175 True ENSG00000133835 ENSG00000133835 HGNC:5213 HSPD1 gene HSPD1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted hypomyelinating leukodystrophy 4, MONDO:0012824 Ataxia;HP:0001251 39500555 False 3 100;0;0 2.175 True ENSG00000144381 ENSG00000144381 HGNC:5261 INPP4A gene INPP4A Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092 Ataxia;HP:0001251 39315527 False 3 100;0;0 2.175 True ENSG00000040933 ENSG00000040933 HGNC:6074 INPP5E gene INPP5E Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 1 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000148384 ENSG00000148384 HGNC:21474 IQSEC2 gene IQSEC2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) intellectual disability, X-linked 1, MONDO:0010656 Ataxia;HP:0001251 30666632 False 3 100;0;0 2.175 True ENSG00000124313 ENSG00000124313 HGNC:29059 IRF2BPL gene IRF2BPL Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with regression, abnormal movement, loss of speech and seizures, 618088 Ataxia;HP:0001251 30057031 False 3 100;0;0 2.175 True ENSG00000119669 ENSG00000119669 HGNC:14282 ITM2B gene ITM2B Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia Ataxia;HP:0001251 10391242;10781099;33814452 False 3 100;0;0 2.175 False ENSG00000136156 ENSG00000136156 HGNC:6174 ITPR1 gene ITPR1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 15 MIM#606658;Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000150995 ENSG00000150995 HGNC:6180 JAM2 gene JAM2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal basal ganglia calcification, idiopathic, 8, autosomal recessive, MONDO:0032938 Ataxia;HP:0001251 32142645 False 3 100;0;0 2.175 True ENSG00000154721 ENSG00000154721 HGNC:14686 KARS1 gene KARS1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal leukoencephalopathy, progressive, infantile-onset, with or without deafness, MONDO:0030893 Ataxia;HP:0001251 34172899;31192300;31192300 False 3 100;0;0 2.175 True ENSG00000065427 ENSG00000065427 HGNC:6215 KATNIP gene KATNIP Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome, MONDO:0018772 Ataxia;HP:0001251 40621737;32164589;32164589;30982090;30982090;27245168;27245168;26714646;26714646 False 3 100;0;0 2.175 True ENSG00000047578 ENSG00000047578 HGNC:29068 KCNA1 gene KCNA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown EPISODIC ATAXIA, TYPE 1;myokymia with periodic ataxia;Episodic ataxia/myokymia syndrome, 160120;Episodic ataxia/myokymia syndrome Ataxia;HP:0001251 11026449 False 3 100;0;0 2.175 True Other ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA2 gene KCNA2 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 32, 616366 Ataxia;HP:0001251 29050392 False 3 100;0;0 2.175 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNC1 gene KCNC1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted complex neurodevelopmental disorder, MONDO:0100038;progressive myoclonic epilepsy type 7, MONDO:0014521 Ataxia;HP:0001251 42347804;40765656;37203213;34733949;32972906;31353862;28380698;27629860 False 3 100;0;0 2.175 True ENSG00000129159 ENSG00000129159 HGNC:6233 KCNC3 gene KCNC3 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 13 MIM#605259 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000131398 ENSG00000131398 HGNC:6235 KCND3 gene KCND3 Expert Review;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 19, MIM# 607346" Ataxia;HP:0001251 32823520 False 3 100;0;0 2.175 True ENSG00000171385 ENSG00000171385 HGNC:6239 KCNJ10 gene KCNJ10 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Seizures, Sensorineural Deafness, Ataxia, Mental Retardation, and Electrolyte Imbalance Syndrome;SESAME syndrome, 612780 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000177807 ENSG00000177807 HGNC:6256 KCNMA1 gene KCNMA1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Liang-Wang syndrome, MONDO:0032886;Neurodevelopmental disorder, MONDO:0700092 Ataxia;HP:0001251 35730691;35156297;33178487;32132200;31152168 False 3 100;0;0 2.175 True ENSG00000156113 ENSG00000156113 HGNC:6284 KCNN2 gene KCNN2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 Ataxia;HP:0001251 33242881 False 3 100;0;0 2.175 True ENSG00000080709 ENSG00000080709 HGNC:6291 KCTD7 gene KCTD7 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal progressive myoclonic epilepsy type 3, MONDO:0012721 Ataxia;HP:0001251 38231304;27742667 False 3 100;0;0 2.175 True ENSG00000243335 ENSG00000243335 HGNC:21957 KIAA0586 gene KIAA0586 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 23, MONDO:0014664 Ataxia;HP:0001251 40448720;39898050;37131188;36635699;32381069;30120217;26386247;26386044;26026149 False 3 100;0;0 2.175 True ENSG00000100578 ENSG00000100578 HGNC:19960 KIF1A gene KIF1A Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092 Ataxia;HP:0001251 38785164;38681507;36305856;36233161;35326432;30778698;27146152 False 3 100;0;0 2.175 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1C gene KIF1C Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive MIM#611302 Ataxia;HP:0001251 24482476;24319291;31413903;29544888 False 3 100;0;0 2.175 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF5A gene KIF5A Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted hereditary spastic paraplegia 10, MONDO:0011408 Ataxia;HP:0001251 40518753;31286494;30778698;30480035;29892902 False 3 100;0;0 2.175 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF7 gene KIF7 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Koubert syndrome 12;Acrocallosal syndrome, Schinzel type Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000166813 ENSG00000166813 HGNC:30497 L2HGDH gene L2HGDH Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal L-2-hydroxyglutaric aciduria, MONDO:0009370 Ataxia;HP:0001251 42205672;40870031;40660807;38716347;37275239;36462087;33061758 False 3 100;0;0 2.175 True ENSG00000087299 ENSG00000087299 HGNC:20499 LAMA1 gene LAMA1 Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Poretti-Boltshauser syndrome;Cerebellar ataxia, intellectual disability, oculomotor apraxia, cerebellar cysts syndrome Ataxia;HP:0001251 26932191;25105227 False 3 100;0;0 2.175 True ENSG00000101680 ENSG00000101680 HGNC:6481 LARS2 gene LARS2 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021;Leukodystrophy Ataxia;HP:0001251 29205794;32423379;30737337 False 3 100;0;0 2.175 True ENSG00000011376 ENSG00000011376 HGNC:17095 LETM1 gene LETM1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089 Ataxia;HP:0001251 36055214 False 3 100;0;0 2.175 True ENSG00000168924 ENSG00000168924 HGNC:6556 LMNB1 gene LMNB1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant MIM#169500 Ataxia;HP:0001251 31695592 False 3 100;0;0 2.175 False ENSG00000113368 ENSG00000113368 HGNC:6637 LRSAM1 gene LRSAM1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease axonal type 2P, MONDO:0013753 Ataxia;HP:0001251 30996334 False 3 100;0;0 2.175 True ENSG00000148356 ENSG00000148356 HGNC:25135 LYST gene LYST Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chediak-Higashi syndrome, MONDO:0008963 Ataxia;HP:0001251 34483340;28193763;26944273;26307451 False 3 100;0;0 2.175 True ENSG00000143669 ENSG00000143669 HGNC:1968 MAB21L1 gene MAB21L1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal cerebellar, ocular, craniofacial, and genital syndrome, MONDO:0032774 Ataxia;HP:0001251 30487245 False 3 100;0;0 2.175 True ENSG00000180660 ENSG00000180660 HGNC:6757 MAG gene MAG Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 75, autosomal recessive, MIM# 616680;Cerebellar ataxia;Oculomotor apraxia" Ataxia;HP:0001251 32629324;32340215;32629324 False 3 100;0;0 2.175 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAN2B1 gene MAN2B1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal alpha-mannosidosis, MONDO:0009561 Ataxia;HP:0001251 35242565;34486965 False 3 100;0;0 2.175 True ENSG00000104774 ENSG00000104774 HGNC:6826 MARS2 gene MARS2 Australian Genomics Health Alliance Mitochondrial Flagship;Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000247626 ENSG00000247626 HGNC:25133 MBOAT7 gene MBOAT7 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder, MONDO:0100038 Ataxia;HP:0001251 30701556 False 3 100;0;0 2.175 True ENSG00000125505 ENSG00000125505 HGNC:15505 MED13L gene MED13L Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted syndromic intellectual disability, MONDO:0000508 Ataxia;HP:0001251 29511999 False 3 100;0;0 2.175 True ENSG00000123066 ENSG00000123066 HGNC:22962 MED27 gene MED27 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MONDO:0859137 Ataxia;HP:0001251 41017421;37517035 False 3 100;0;0 2.175 True ENSG00000160563 ENSG00000160563 HGNC:2377 MFSD8 gene MFSD8 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neuronal ceroid lipofuscinosis 7, MONDO:0012588 Ataxia;HP:0001251 41045016;39108195;38153683;37090936;35216386;30144815;27146152 False 3 100;0;0 2.175 True ENSG00000164073 ENSG00000164073 HGNC:28486 MICU1 gene MICU1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal proximal myopathy with extrapyramidal signs, MONDO:0014300 Ataxia;HP:0001251 40434710;38380193;33969448;33428302 False 3 100;0;0 2.175 True ENSG00000107745 ENSG00000107745 HGNC:1530 MINPP1 gene MINPP1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pontocerebellar hypoplasia, MONDO:0020135 Ataxia;HP:0001251 40508022;33257696;33168985 False 3 100;0;0 2.175 True ENSG00000107789 ENSG00000107789 HGNC:7102 MKS1 gene MKS1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 28 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000011143 ENSG00000011143 HGNC:7121 MLC1 gene MLC1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal megalencephalic leukoencephalopathy with subcortical cysts 1, MONDO:0024555 Ataxia;HP:0001251 41483250;35468122;34918859;31942423 False 3 100;0;0 2.175 True ENSG00000100427 ENSG00000100427 HGNC:17082 MMACHC gene MMACHC Expert Review Green;NHS GMS;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria and homocystinuria cblC type, 277400;Methylmalonic aciduria and homocystinuria, cblC type, 277400;Ataxia and hypogonadism Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000132763 ENSG00000132763 HGNC:24525 MORC2 gene MORC2 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Axonal type CMT disease type 2Z, 616688;Cerebellar ataxia Ataxia;HP:0001251 28402445 False 3 50;0;50 2.175 True ENSG00000133422 ENSG00000133422 HGNC:23573 MPZ gene MPZ Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease type 1B, MONDO:0007307 Ataxia;HP:0001251 33960567 False 3 100;0;0 2.175 True ENSG00000158887 ENSG00000158887 HGNC:7225 MRE11 gene MRE11 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-Telangiectasia-Like Disorder;Ataxia-telangiectasia-like disorder 1, 604391 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000020922 ENSG00000020922 HGNC:7230 MSTO1 gene MSTO1 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy, mitochondrial, and ataxia MIM#617675 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000125459 ENSG00000125459 HGNC:29678 MT-ATP6 gene MT-ATP6 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related Ataxia;HP:0001251 40112238 False 3 100;0;0 2.175 True ENSG00000198899 ENSG00000198899 HGNC:7414 MTCL1 gene MTCL1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal slowly progressive cerebellar ataxia, mild intellectual disability, seizures in childhood and episodic pain in the lower limbs Ataxia;HP:0001251 30548255;28283581 False 3 100;0;0 2.175 True ENSG00000168502 ENSG00000168502 HGNC:29121 MT-CO1 gene MT-CO1 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related Ataxia;HP:0001251 30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519 False 3 100;0;0 2.175 True ENSG00000198804 ENSG00000198804 HGNC:7419 MT-CO2 gene MT-CO2 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related Ataxia;HP:0001251 34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519 False 3 100;0;0 2.175 True ENSG00000198712 ENSG00000198712 HGNC:7421 MT-CYB gene MT-CYB Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related Ataxia;HP:0001251 39858655;34804306;26937408 False 3 100;0;0 2.175 True ENSG00000198727 ENSG00000198727 HGNC:7427 MTFMT gene MTFMT Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 15 MIM#614947;Mitochondrial complex I deficiency, nuclear type 27 MIM#618248 Ataxia;HP:0001251 26060307;24461907 False 3 100;0;0 2.175 True ENSG00000103707 ENSG00000103707 HGNC:29666 MT-ND4 gene MT-ND4 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND4-related Ataxia;HP:0001251 12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231 False 3 100;0;0 2.175 True ENSG00000198886 ENSG00000198886 HGNC:7459 MT-ND5 gene MT-ND5 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Leber hereditary optic neuropathy, MONDO:0010788;MELAS syndrome, MONDO:0010789;Mitochondrial disease, MONDO:0044970 Ataxia;HP:0001251 35719398;34025555;29506874 False 3 100;0;0 2.175 True ENSG00000198786 ENSG00000198786 HGNC:7461 MTO1 gene MTO1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970 Ataxia;HP:0001251 29331171 False 3 100;0;0 2.175 True ENSG00000135297 ENSG00000135297 HGNC:19261 MT-TE gene MT-TE Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TE-related Ataxia;HP:0001251 8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256 False 3 100;0;0 2.175 True ENSG00000210194 ENSG00000210194 HGNC:7479 MT-TG gene MT-TG Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related Ataxia;HP:0001251 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 2.175 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TH gene MT-TH Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TH-related Ataxia;HP:0001251 12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194 False 3 100;0;0 2.175 True ENSG00000210176 ENSG00000210176 HGNC:7487 MT-TK gene MT-TK Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL MERRF syndrome, MONDO:0010790;Mitochondrial disease, MONDO:0044970 Ataxia;HP:0001251 34025555;32538863;29756269;26995359;25559684 False 3 100;0;0 2.175 True ENSG00000210156 ENSG00000210156 HGNC:7489 MT-TL1 gene MT-TL1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL MERRF syndrome, MONDO:0010790;Mitochondrial disease, MONDO:0044970 Ataxia;HP:0001251 40787093;40707189;37311680;36684660;35869996;32821290;32357846;32357846;29430542;28458318 False 3 100;0;0 2.175 True ENSG00000209082 ENSG00000209082 HGNC:7490 MTTP gene MTTP Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Abetalipoproteinemia, 200100;Abetalipoproteinemia Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000138823 ENSG00000138823 HGNC:7467 MT-TS2 gene MT-TS2 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS2-related Ataxia;HP:0001251 9792552;10090882;16950817;21257182;22369973;22378285 False 3 100;0;0 2.175 True ENSG00000210184 ENSG00000210184 HGNC:7498 MT-TV gene MT-TV Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related Ataxia;HP:0001251 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 2.175 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TW gene MT-TW Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related Ataxia;HP:0001251 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 2.175 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TY gene MT-TY Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related Ataxia;HP:0001251 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 2.175 True ENSG00000210144 ENSG00000210144 HGNC:7502 MVK gene MVK Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mevalonic aciduria 610377 Ataxia;HP:0001251 12563048;10401001;28095071 False 3 100;0;0 2.175 True ENSG00000110921 ENSG00000110921 HGNC:7530 MYORG gene MYORG Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal basal ganglia calcification, idiopathic, 7, autosomal recessive, MONDO:0032673 Ataxia;HP:0001251 39180105;32451491 False 3 100;0;0 2.175 True ENSG00000164976 ENSG00000164976 HGNC:19918 NARS1 gene NARS1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092;neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities, MONDO:0100348;neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities, MONDO:0030837 Ataxia;HP:0001251 38495304;32738225 False 3 100;0;0 2.175 True ENSG00000134440 ENSG00000134440 HGNC:7643 NAXE gene NAXE Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 1, MONDO:0020781 Ataxia;HP:0001251 38419707;37274027;36773198;35637064;34678889;34120322;31745726;30022751;27616477 False 3 100;0;0 2.175 True ENSG00000163382 ENSG00000163382 HGNC:18453 NDUFA13 gene NDUFA13 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial complex I deficiency, nuclear type 28, MONDO:0032632 Ataxia;HP:0001251 39963288 False 3 100;0;0 2.175 True ENSG00000186010 ENSG00000186010 HGNC:17194 NEU1 gene NEU1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal sialidosis type 1, MONDO:0019346 Ataxia;HP:0001251 39482827;38600684;33516873;32753397;32472645 False 3 100;0;0 2.175 False ENSG00000204386 ENSG00000204386 HGNC:7758 NHLRC1 gene NHLRC1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2B, Lafora, 254780;Epilepsy, progressive myoclonic 2B (Lafora) 254780 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000187566 ENSG00000187566 HGNC:21576 NKX2-1 gene NKX2-1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Choreoathetosis, hypothyroidism, and neonatal respiratory distress 610978;Choreoathetosis, hypothyroidism and neonatal respiratory distress, 610978;Chorea, hereditary benign 118700;Hereditary bening chorea, 118700 Ataxia;HP:0001251 10931427;27066577;26839702;26103969 False 3 100;0;0 2.175 True ENSG00000136352 ENSG00000136352 HGNC:11825 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic ataxia 8 with hypomyelinating leukodystrophy, 617560;Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000148826 ENSG00000148826 HGNC:19321 NOVA2 gene NOVA2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, OMIM #618859 Ataxia;HP:0001251 PMID: 32197073 False 3 100;0;0 2.175 True ENSG00000104967 ENSG00000104967 HGNC:7887 NPC1 gene NPC1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C1, 257220;Niemann-Pick disease types C1 and D (#257220) Ataxia;HP:0001251 10480349;17003072;25497598;33228797 False 3 100;0;0 2.175 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC2 gene NPC2 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C2, 607625;Niemann-Pick disease type C2 (#607625) Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPHP1 gene NPHP1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 4 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000144061 ENSG00000144061 HGNC:7905 NPTX1 gene NPTX1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cerebellar ataxia MONDO#0000437, NPTX1-related Ataxia;HP:0001251 34788392;35288776;35285082;35560436 False 3 100;0;0 2.175 False ENSG00000171246 ENSG00000171246 HGNC:7952 NUBPL gene NUBPL Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 21, OMIM # 618242 Ataxia;HP:0001251 23553477;32518176 False 3 100;0;0 2.175 True ENSG00000151413 ENSG00000151413 HGNC:20278 NUS1 gene NUS1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Epilepsy, myoclonus, ataxia and scoliosis;Mental retardation, autosomal dominant 55, with seizures, 617831 Ataxia;HP:0001251 PMID: 31656175;29100083 False 3 100;0;0 2.175 True ENSG00000153989 ENSG00000153989 HGNC:21042 OFD1 gene OFD1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 10 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000046651 ENSG00000046651 HGNC:2567 OGDHL gene OGDHL Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Yoon-Bellen neurodevelopmental syndrome, MONDO:0859221 Ataxia;HP:0001251 34800363 False 3 100;0;0 2.175 True ENSG00000197444 ENSG00000197444 HGNC:25590 OPA1 gene OPA1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal OPA1-related optic atrophy with or without extraocular features, MONDO:0800181 Ataxia;HP:0001251 30165240;28494813 False 3 100;0;0 2.175 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA3 gene OPA3 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, 258501;Optic atrophy 3 with cataract, 165300;3-methylglutaconic aciduria type III, 258501;Costeff syndrome Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000125741 ENSG00000125741 HGNC:8142 OPHN1 gene OPHN1 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked mental retardation with cerebellar hypoplasia and distinctive facial appearance, 300486;Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000079482 ENSG00000079482 HGNC:8148 PAK1 gene PAK1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted intellectual developmental disorder with macrocephaly, seizures, and speech delay, MONDO:0032568 Ataxia;HP:0001251 30290153 False 3 100;0;0 2.175 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000149269 ENSG00000149269 HGNC:8590 PDE1B gene PDE1B Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related Ataxia;HP:0001251 40492975 False 3 100;0;0 2.175 True ENSG00000123360 ENSG00000123360 HGNC:8775 PDHA1 gene PDHA1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) pyruvate dehydrogenase E1-alpha deficiency, MONDO:0010717 Ataxia;HP:0001251 41760389;35132535;31673819;29756269;26014431 False 3 100;0;0 2.175 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDYN gene PDYN Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000101327 ENSG00000101327 HGNC:8820 PEX16 gene PEX16 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Zellweger syndrome (614876);Peroxisome biogenesis disorder 8B (#614877) infantile progressive ataxia and spastic paresis;Peroxisome biogenesis disorder 8A, 614876;Peroxisome biogenesis disorder 8B, 614877 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000121680 ENSG00000121680 HGNC:8857 PEX7 gene PEX7 Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum disease;Peroxisome biogenesis disorder 9B, MIM#614879 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000112357 ENSG00000112357 HGNC:8860 PHYH gene PHYH Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Refsum disease, MIM# 266500" Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000107537 ENSG00000107537 HGNC:8940 PIEZO2 gene PIEZO2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal arthrogryposis, distal, with impaired proprioception and touch, MONDO:0014941 Ataxia;HP:0001251 27974811;27653382 False 3 100;0;0 2.175 True ENSG00000154864 ENSG00000154864 HGNC:26270 PIGK gene PIGK Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures, MONDO:0030037 Ataxia;HP:0001251 32220290 False 3 100;0;0 2.175 True ENSG00000142892 ENSG00000142892 HGNC:8965 PIGS gene PIGS Expert Review;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 95, OMIM # 618143 Ataxia;HP:0001251 30269814;33410539 False 3 100;0;0 2.175 True ENSG00000087111 ENSG00000087111 HGNC:14937 PITRM1 gene PITRM1 Expert list;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis Ataxia;HP:0001251 26697887;29764912 False 3 100;0;0 2.175 True ENSG00000107959 ENSG00000107959 HGNC:17663 PLA2G6 gene PLA2G6 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive Parkinson disease 14, 612953;Parkinson disease 14 (#612953);Infantile neuroaxonal dystrophy 1 (#256600);Infantile neuroaxonal dystrophy 1, 256600;Neurodegeneration with brain iron accumulation 2B (#610217);Neurodegeneration with brain iron accumulation 2B, 610217 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000184381 ENSG00000184381 HGNC:9039 PMPCA gene PMPCA Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200 Ataxia;HP:0001251 25808372;26657514;33272776;30617178 False 3 100;0;0 2.175 True ENSG00000165688 ENSG00000165688 HGNC:18667 PMPCB gene PMPCB Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 6, 617954 Ataxia;HP:0001251 29576218 False 3 100;0;0 2.175 True ENSG00000105819 ENSG00000105819 HGNC:9119 PNKD gene PNKD Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Paroxysmal nonkinesigenic dyskinesia 1, 118800 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000127838 ENSG00000127838 HGNC:9153 PNKP gene PNKP Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, seizures and developmental delay, 613402;Ataxia-oculomotor apraxia 4, 616267;Ataxia with oculomotor apraxia 4 (#616267) Ataxia;HP:0001251 31436889;31707899 False 3 100;0;0 2.175 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNPLA6 gene PNPLA6 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Boucher-Neuhauser syndrome MIM#215470;Laurence-Moon syndrome MIM#245800;Oliver-McFarlane syndrome MIM#275400;Spastic paraplegia 39, autosomal recessive MIM#612020 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPT1 gene PNPT1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 25, MIM# 608703" Ataxia;HP:0001251 35411967;37935417;39729134;39899068;39924761;40757543 False 3 60;40;0 2.175 False ENSG00000138035 ENSG00000138035 HGNC:23166 POLG gene POLG Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLR2A gene POLR2A Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder with hypotonia and variable intellectual and behavioral abnormalities, MONDO:0032829 Ataxia;HP:0001251 33665635 False 3 100;0;0 2.175 True ENSG00000181222 ENSG00000181222 HGNC:9187 POLR3A gene POLR3A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3B gene POLR3B Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#614381 Ataxia;HP:0001251 22036171;22036172 False 3 100;0;0 2.175 True ENSG00000013503 ENSG00000013503 HGNC:30348 POU4F1 gene POU4F1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia;intention tremor;hypotonia Ataxia;HP:0001251 33783914;8876243 False 3 100;0;0 2.175 True ENSG00000152192 ENSG00000152192 HGNC:9218 PRDX3 gene PRDX3 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia MONDO:0000437, PRDX3-related Ataxia;HP:0001251 33889951 False 3 100;0;0 2.175 True ENSG00000165672 ENSG00000165672 HGNC:9354 PRNP gene PRNP Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease Ataxia;HP:0001251 2564168;34324063;20301407 False 3 100;0;0 2.175 False ENSG00000171867 ENSG00000171867 HGNC:9449 PRRT2 gene PRRT2 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal PRRT2-associated paroxysmal movement disorder MONDO:0100556 Ataxia;HP:0001251 26598494;31193310;30501978;30713971 False 3 100;0;0 2.175 True ENSG00000167371 ENSG00000167371 HGNC:30500 PTPMT1 gene PTPMT1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with ataxia and brain abnormalities MONDO:0978300 Ataxia;HP:0001251 39279645 False 3 100;0;0 2.175 True ENSG00000110536 ENSG00000110536 HGNC:26965 PTRH2 gene PTRH2 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile multi-system neurologic, endocrine, and pancreatic disease, 616263 Ataxia;HP:0001251 25558065;25574476;31057140;27129381 False 3 100;0;0 2.175 True ENSG00000141378 ENSG00000141378 HGNC:24265 PUM1 gene PUM1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 47, 617931 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000134644 ENSG00000134644 HGNC:14957 PYCR2 gene PYCR2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hypomyelinating leukodystrophy 10, MONDO:0014632 Ataxia;HP:0001251 27860360;27130255 False 3 100;0;0 2.175 True ENSG00000143811 ENSG00000143811 HGNC:30262 RAB3A gene RAB3A Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 52, MIM# 621535 Ataxia;HP:0001251 40166812 False 3 100;0;0 2.175 True ENSG00000105649 ENSG00000105649 HGNC:9777 RFC1 gene RFC1 Expert list;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Ataxia;HP:0001251 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 2.175 False ENSG00000035928 ENSG00000035928 HGNC:9969 RFC4 gene RFC4 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Morimoto-Ryu-Malicdan neuromuscular syndrome, MONDO:0975848 Ataxia;HP:0001251 39106866 False 3 100;0;0 2.175 True ENSG00000163918 ENSG00000163918 HGNC:9972 RNF170 gene RNF170 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia, sensory, 1, autosomal dominant, MIM# 608984 Ataxia;HP:0001251 32943585;21115467 False 3 100;0;0 2.175 False ENSG00000120925 ENSG00000120925 HGNC:25358 RNF216 gene RNF216 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000011275 ENSG00000011275 HGNC:21698 RNF220 gene RNF220 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum Ataxia;HP:0001251 33964137;10881263 False 3 100;0;0 2.175 True ENSG00000187147 ENSG00000187147 HGNC:25552 RORA gene RORA Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, 618060 Ataxia;HP:0001251 29656859 False 3 100;0;0 2.175 True ENSG00000069667 ENSG00000069667 HGNC:10258 RPGRIP1L gene RPGRIP1L Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 7, MIM# 611560" Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000103494 ENSG00000103494 HGNC:29168 RUBCN gene RUBCN Expert Review Green;Royal Melbourne Hospital;Royal Melbourne Hospital Clinical Genetics Department;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 15, MIM#615705 Ataxia;HP:0001251 20826435;23728897 False 3 100;0;0 2.175 True ENSG00000145016 ENSG00000145016 HGNC:28991 SACS gene SACS Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type MIM#270550 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000151835 ENSG00000151835 HGNC:10519 SAMD9L gene SAMD9L Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550 Ataxia;HP:0001251 35310830;33884299;28570036 False 3 100;0;0 2.175 False ENSG00000177409 ENSG00000177409 HGNC:1349 SCN1A gene SCN1A Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 6 (Dravet syndrome), MIM# 607208 Ataxia;HP:0001251 27264139;27817982;28732259 False 3 67;33;0 2.175 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN2A gene SCN2A Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Early infantile epileptic encephalopathy 11, MIM# 613721 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000136531 ENSG00000136531 HGNC:10588 SCN8A gene SCN8A Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy 13, 614558;Cognitive impairment with or without cerebellar ataxia, 614306 Ataxia;HP:0001251 31904124;31887642;31675620 False 3 100;0;0 2.175 True ENSG00000196876 ENSG00000196876 HGNC:10596 SCYL1 gene SCYL1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 21, 616719;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy Ataxia;HP:0001251 29419818;17571074;26581903;30531813 False 3 100;0;0 2.175 True ENSG00000142186 ENSG00000142186 HGNC:14372 SETX gene SETX Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000107290 ENSG00000107290 HGNC:445 SIL1 gene SIL1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Marinesco-Sjogren syndrome, 248800 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000120725 ENSG00000120725 HGNC:24624 SKOR2 gene SKOR2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Valence-Farazi cerebellar ataxia syndrome, MIM# 621386 Ataxia;HP:0001251 40890458;29997391;21937600 False 3 100;0;0 2.175 True ENSG00000215474 ENSG00000215474 HGNC:32695 SLC13A3 gene SLC13A3 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384) Ataxia;HP:0001251 https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID) False 3 100;0;0 2.175 True ENSG00000158296 ENSG00000158296 HGNC:14430 SLC17A5 gene SLC17A5 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Salla disease;Sialic acid storage disease, severe infantile type, MIM# 269920 Ataxia;HP:0001251 26171070 False 3 100;0;0 2.175 True ENSG00000119899 ENSG00000119899 HGNC:10933 SLC1A3 gene SLC1A3 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Episodic ataxia, type 6;Episodic ataxia type 6, 612656 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000079215 ENSG00000079215 HGNC:10941 SLC25A46 gene SLC25A46 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary motor and sensory neuropathy type VIB, MIM#616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303 Ataxia;HP:0001251 30178502;26168012;27543974;27430653;27390132;28934388;28558379 False 3 100;0;0 2.175 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC2A1 gene SLC2A1 Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal dystonia 9;GLUT1 deficiency syndrome 2, 612126;GLUT1 DEFICIENCY SYNDROME 1;paroxysmal exertion-induced dyskinesia with or without epilepsy and/or hemolytic anemia;GLUT1 deficiency syndrome 1, 606777;Dystonia 9, 601042;EPILEPSY, IDIOPATHIC GENERALIZED Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000117394 ENSG00000117394 HGNC:11005 SLC44A1 gene SLC44A1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration;progressive ataxia tremor cognitive decline dysphagia optic atrophy dysarthria Ataxia;HP:0001251 31855247 False 3 100;0;0 2.175 True ENSG00000070214 ENSG00000070214 HGNC:18798 SLC52A2 gene SLC52A2 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bwon-Vialetto-Van Laere syndrome 2, 614707 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC9A1 gene SLC9A1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lichtenstein-Knorr Syndrome, MIM# 616291" Ataxia;HP:0001251 25205112;30018422;25760855 False 3 50;50;0 2.175 True ENSG00000090020 ENSG00000090020 HGNC:11071 SLC9A6 gene SLC9A6 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation, X-linked syndromic, Christianson type, 300243 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000198689 ENSG00000198689 HGNC:11079 SNAP25 gene SNAP25 Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Myasthenic syndrome, congenital, 18, 616330;cerebellar ataxia and seizures Ataxia;HP:0001251 29491473;25381298;17283335 False 3 100;0;0 2.175 True ENSG00000132639 ENSG00000132639 HGNC:11132 SNX14 gene SNX14 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 20, 616354;Autosomal recessive spinocerebellar ataxia (#616354) Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000135317 ENSG00000135317 HGNC:14977 SPG7 gene SPG7 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000197912 ENSG00000197912 HGNC:11237 SPR gene SPR Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiaterin reductase deficiency, 612716;Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPTAN1 gene SPTAN1 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia MONDO:0957813 Ataxia;HP:0001251 36331550 False 3 100;0;0 2.175 True Other ENSG00000197694 ENSG00000197694 HGNC:11273 SPTBN2 gene SPTBN2 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386;Spinocerebellar ataxia 5, MIM# 600224" Ataxia;HP:0001251 23236289;23838597;22781464;31617442;31066025 False 3 100;0;0 2.175 True ENSG00000173898 ENSG00000173898 HGNC:11276 SQSTM1 gene SQSTM1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 Ataxia;HP:0001251 27545679 False 3 100;0;0 2.175 True ENSG00000161011 ENSG00000161011 HGNC:11280 SRD5A3 gene SRD5A3 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kahrizi syndrome, 612713;Congenital disorder of glycosylation, type Iq, 612379;Congenital disorder of glycosylation type Iq, 612379 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000128039 ENSG00000128039 HGNC:25812 STUB1 gene STUB1 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768" Ataxia;HP:0001251 25258038;24742043 False 3 100;0;0 2.175 True ENSG00000103266 ENSG00000103266 HGNC:11427 SUFU gene SUFU Expert Review Green;Literature;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Joubert syndrome 32, MIM#617757;Neurodevelopmental disorder, MONDO:0700092, SUFU-related Ataxia;HP:0001251 33024317 False 3 100;0;0 2.175 True ENSG00000107882 ENSG00000107882 HGNC:16466 SVBP gene SVBP Expert list;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, 618569 Ataxia;HP:0001251 31363758;30607023 False 3 100;0;0 2.175 True ENSG00000177868 ENSG00000177868 HGNC:29204 SYNE1 gene SYNE1 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 8, MIM# 610743" Ataxia;HP:0001251 23325900;27086870 False 3 100;0;0 2.175 True ENSG00000131018 ENSG00000131018 HGNC:17089 TARS2 gene TARS2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal combined oxidative phosphorylation defect type 21, MONDO:0014398 Ataxia;HP:0001251 37454282 False 3 100;0;0 2.175 True ENSG00000143374 ENSG00000143374 HGNC:30740 TBC1D23 gene TBC1D23 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 11, 617695 Ataxia;HP:0001251 28823707;28823706 False 3 100;0;0 2.175 True ENSG00000036054 ENSG00000036054 HGNC:25622 TBCE gene TBCE Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, with amyotrophy and optic atrophy, OMIM #617207 Ataxia;HP:0001251 PubMed: 27666369 False 3 100;0;0 2.175 True - ENSG00000284770 HGNC:11582 TCTN1 gene TCTN1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 13, MIM# 614173" Ataxia;HP:0001251 31302911;28631893;21725307;26477546;26489806 False 3 100;0;0 2.175 True ENSG00000204852 ENSG00000204852 HGNC:26113 TCTN2 gene TCTN2 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 24, MIM# 616654" Ataxia;HP:0001251 25118024;21565611 False 3 100;0;0 2.175 True ENSG00000168778 ENSG00000168778 HGNC:25774 TCTN3 gene TCTN3 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 18, MIM# 614815;Orofaciodigital syndrome IV, MIM# 258860 Ataxia;HP:0001251 22883145;25118024 False 3 100;0;0 2.175 True ENSG00000119977 ENSG00000119977 HGNC:24519 TDP2 gene TDP2 Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 23 Ataxia;HP:0001251 31410782;30109272;24658003 False 3 100;0;0 2.175 True ENSG00000111802 ENSG00000111802 HGNC:17768 TELO2 gene TELO2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal TELO2-related intellectual disability-neurodevelopmental disorder, MONDO:0014848 Ataxia;HP:0001251 36797513 False 3 100;0;0 2.175 True ENSG00000100726 ENSG00000100726 HGNC:29099 TINF2 gene TINF2 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant dyskeratosis congenita 3, 613990;Revesz syndrome, 268130 Ataxia;HP:0001251 18252230;21477109;18979121 False 3 100;0;0 2.175 True ENSG00000092330 ENSG00000092330 HGNC:11824 TMEM106B gene TMEM106B Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypomyelinating leukodystrophy 16, 617964 Ataxia;HP:0001251 29186371;29444210 False 3 100;0;0 2.175 True ENSG00000106460 ENSG00000106460 HGNC:22407 TMEM216 gene TMEM216 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 2, MIM# 608091" Ataxia;HP:0001251 20036350;20512146 False 3 100;0;0 2.175 True ENSG00000187049 ENSG00000187049 HGNC:25018 TMEM237 gene TMEM237 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 14, MIM# 614424" Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000155755 ENSG00000155755 HGNC:14432 TMEM240 gene TMEM240 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 21, MIM# 607454" Ataxia;HP:0001251 25070513 False 3 100;0;0 2.175 True ENSG00000205090 ENSG00000205090 HGNC:25186 TMEM67 gene TMEM67 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 6, MIM# 610688" Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000164953 ENSG00000164953 HGNC:28396 TPP1 gene TPP1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 7, 609270;Neuronal ceroid lipofuscinosis, 204500;Spinocerebellar ataxia, autosomal recessive 7, 609270;Ceroid lipofuscinosis, neuronal, 2, 204500 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000166340 ENSG00000166340 HGNC:2073 TSFM gene TSFM Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000123297 ENSG00000123297 HGNC:12367 TTBK2 gene TTBK2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11 Ataxia;HP:0001251 False 3 50;50;0 2.175 False ENSG00000128881 ENSG00000128881 HGNC:19141 TTC19 gene TTC19 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency nuclear type II, 615157;Mitochondrial complex III deficiency, nuclear type 2, 615157 Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000011295 ENSG00000011295 HGNC:26006 TTI1 gene TTI1 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445 Ataxia;HP:0001251 26539891;30315573;36724785 False 3 50;25;25 2.175 True ENSG00000101407 ENSG00000101407 HGNC:29029 TTPA gene TTPA Expert list;Expert Review Green;NHS GMS Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia with isolated vitamin E deficiency, MIM# 277460" Ataxia;HP:0001251 False 3 100;0;0 2.175 True ENSG00000137561 ENSG00000137561 HGNC:12404 TUBA4A gene TUBA4A Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic ataxia 11, autosomal dominant, MIM# 621226 Ataxia;HP:0001251 38884572;37418012 False 3 100;0;0 2.175 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBB4A gene TUBB4A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukodystrophy, hypomyelinating, 6, 612438;Dystonia 4, 128101, Hypomyelinating leukodystrophy 6, 612438;Dystonia 4, torsion, autosomal dominant, 128101 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000104833 ENSG00000104833 HGNC:20774 TWNK gene TWNK Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 7, 271245;Ataxia Neuropathy Spectrum Disorders, Dominant;Progressive external ophthalmoplegia with mitochondrial DNA deletions, 609286;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, 609286;Perrault syndrome 5, 616138;Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), 271245;Spinocerebellar Ataxia, Recessive Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000107815 ENSG00000107815 HGNC:1160 UBTF gene UBTF Expert list;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701 Ataxia;HP:0001251 29300972 False 3 100;0;0 2.175 True ENSG00000108312 ENSG00000108312 HGNC:12511 UCHL1 gene UCHL1 Expert list;Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 79, autosomal recessive, MIM#615491;Neurodegenerative disease, MONDO:0005559, UCHL1-related Ataxia;HP:0001251 28007905;23359680;11555633;35986737 False 3 100;0;0 2.175 True ENSG00000154277 ENSG00000154277 HGNC:12513 UNC13A gene UNC13A Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456 Ataxia;HP:0001251 27648472;28192369;41125872 False 3 100;0;0 2.175 True Other ENSG00000130477 ENSG00000130477 HGNC:23150 VLDLR gene VLDLR Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation and dysequilibirum syndrome 1, 224050;Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, 224050 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000147852 ENSG00000147852 HGNC:12698 VPS13D gene VPS13D Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317" Ataxia;HP:0001251 29604224;29518281 False 3 100;0;0 2.175 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS41 gene VPS41 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay Ataxia;HP:0001251 32808683;33764426 False 3 100;0;0 2.175 True ENSG00000006715 ENSG00000006715 HGNC:12713 VWA3B gene VWA3B Expert Review Green;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 22 MIM#616948 Ataxia;HP:0001251 26157035 False 3 50;0;50 2.175 True ENSG00000168658 ENSG00000168658 HGNC:28385 WARS2 gene WARS2 Expert Review;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 Ataxia;HP:0001251 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 2.175 True ENSG00000116874 ENSG00000116874 HGNC:12730 WDR73 gene WDR73 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway Mowat syndrome, when patients are ambulant ataxia is a recognisednfeature;Galloway-Mowat Syndrome 1, 251300 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000177082 ENSG00000177082 HGNC:25928 WDR81 gene WDR81 Expert list;Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital hydrocephalus 3 with brain anomalies, 617967;Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Cerebellar ataxia, mental retardation and dysequilibrium syndrome 2, 610185 Ataxia;HP:0001251 21885617;28556411;28969387 False 3 33;0;67 2.175 True ENSG00000167716 ENSG00000167716 HGNC:26600 WFS1 gene WFS1 Expert Review Green;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wolfram syndrome 1, 222300 Ataxia;HP:0001251 25211237 False 3 100;0;0 2.175 True ENSG00000109501 ENSG00000109501 HGNC:12762 WWOX gene WWOX Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 12, 6143232;Early infantile epileptic encephalopathy 28, 616211;Autosomal recessive spinocerebellar ataxia 12, 614322 Ataxia;HP:0001251 False 3 100;0;0 2.175 False ENSG00000186153 ENSG00000186153 HGNC:12799 XRCC1 gene XRCC1 Expert list;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 26 MIM#617633 Ataxia;HP:0001251 28002403;29472272 False 3 100;0;0 2.175 True ENSG00000073050 ENSG00000073050 HGNC:12828 ACBD5 gene ACBD5 Expert list;Expert Review Amber;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy;syndromic cleft palate;ataxia;retinal dystrophy Ataxia;HP:0001251 27799409;23105016 False 2 50;50;0 2.175 True ENSG00000107897 ENSG00000107897 HGNC:23338 ACOX1 gene ACOX1 Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mitchell syndrome, MONDO:0030073 Ataxia;HP:0001251 38923841;37846133 False 2 0;100;0 2.175 True ENSG00000161533 ENSG00000161533 HGNC:119 ASL gene ASL Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal argininosuccinic aciduria, MONDO:0008815 Ataxia;HP:0001251 38044746 False 2 0;100;0 2.175 True ENSG00000126522 ENSG00000126522 HGNC:746 ATG12 gene ATG12 Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ATG12-related neurodevelopmental disorder, MONDO:0700092 Ataxia;HP:0001251 41895291 False 2 0;100;0 2.175 True ENSG00000145782 ENSG00000145782 HGNC:588 ATG5 gene ATG5 Expert Review Amber;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Spinocerebellar ataxia, autosomal recessive 25 Ataxia;HP:0001251 16625204;26812546 False 2 0;100;0 2.175 True ENSG00000057663 ENSG00000057663 HGNC:589 CAPN1 gene CAPN1 Expert list;Expert Review Amber;Expert Review Green Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76, autosomal recessive, 616907;MONDO:0014827 Ataxia;HP:0001251 27320912;29678961;30572172;31023339;31104286 False 2 50;50;0 2.175 False ENSG00000014216 ENSG00000014216 HGNC:1476 CCDC88C gene CCDC88C Expert Review Amber;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown autosomal dominant spinocerebellar ataxia;?Spinocerebellar ataxia 40, 616053 Ataxia;HP:0001251 25062847;30398676 False 2 33;67;0 2.175 False ENSG00000015133 ENSG00000015133 HGNC:19967 CHP1 gene CHP1 Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 9, autosomal recessive, OMIM #618438 Ataxia;HP:0001251 29379881;32787936 False 2 50;50;0 2.175 True ENSG00000187446 ENSG00000187446 HGNC:17433 CLP1 gene CLP1 Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pontocerebellar hypoplasia type 10, MONDO:0014349 Ataxia;HP:0001251 38622473;34584079 False 2 0;100;0 2.175 True ENSG00000172409 ENSG00000172409 HGNC:16999 HARS1 gene HARS1 Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal multisystem ataxic syndrome Ataxia;HP:0001251 32333447 False 2 33;67;0 2.175 True ENSG00000170445 ENSG00000170445 HGNC:4816 KCNQ2 gene KCNQ2 Expert list;Expert Review Amber;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 7, 613720;Myokymia, 121200 Ataxia;HP:0001251 22169383;20962009;10575255 False 2 33;67;0 2.175 True ENSG00000075043 ENSG00000075043 HGNC:6296 MAPK8IP3 gene MAPK8IP3 Expert Review Amber;Literature;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431 Ataxia;HP:0001251 30612693;30945334 False 2 0;100;0 2.175 True ENSG00000138834 ENSG00000138834 HGNC:6884 MKKS gene MKKS Expert list;Expert Review Amber;Expert Review Green;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 6, 605231 Ataxia;HP:0001251 15637713 False 2 67;33;0 2.175 True ENSG00000125863 ENSG00000125863 HGNC:7108 MTNAP1 gene MTNAP1 Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970 Ataxia;HP:0001251 41720819 False 2 0;100;0 2.175 True ENSG00000141219 ENSG00000141219 HGNC:29601 MTPAP gene MTPAP Expert Review Amber;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Ataxia, spastic, 4,;Autosomal recessive spastic ataxia 4, 613672 Ataxia;HP:0001251 20970105;26319014;25008111 False 2 50;50;0 2.175 True ENSG00000107951 ENSG00000107951 HGNC:25532 MT-TC gene MT-TC Expert list;Expert Review Amber Ataxia Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TC-related Ataxia;HP:0001251 8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363 False 2 0;100;0 2.175 True ENSG00000210140 ENSG00000210140 HGNC:7477 OGDH gene OGDH Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309 Ataxia;HP:0001251 42266417 False 2 0;100;0 2.175 True Other ENSG00000105953 ENSG00000105953 HGNC:8124 PCNA gene PCNA ClinGen;Expert Review Amber Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary ataxia MONDO:0100309 Ataxia;HP:0001251 24911150, 33426167, 36990216 False 2 0;100;0 2.175 True ENSG00000132646 ENSG00000132646 HGNC:8729 PLD3 gene PLD3 Expert Review Amber;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Spinocerebellar ataxia 46 Ataxia;HP:0001251 29053796;30312375;30312384;38059248 False 2 0;100;0 2.175 False ENSG00000105223 ENSG00000105223 HGNC:17158 PRKCG gene PRKCG Expert Review;Expert Review Amber Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14, MIM# 605361 Ataxia;HP:0001251 34292398 False 2 0;100;0 2.175 True ENSG00000126583 ENSG00000126583 HGNC:9402 PRPS1 gene PRPS1 Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy Ataxia;HP:0001251 33898739;28967191 False 2 0;100;0 2.175 False ENSG00000147224 ENSG00000147224 HGNC:9462 RFXANK gene RFXANK Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive Ataxia and Neurologic Regression;MHC class II deficiency, complementation group B MIM#209920 Ataxia;HP:0001251 PMID: 33855173;23314770;28676232 False 2 50;50;0 2.175 True ENSG00000064490 ENSG00000064490 HGNC:9987 SDHA gene SDHA Expert list;Expert Review Amber Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259 Ataxia;HP:0001251 10976639;27683074 False 2 0;100;0 2.175 False ENSG00000073578 ENSG00000073578 HGNC:10680 SIDT2 gene SIDT2 Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lysosomal storage disease, MONDO:0002561, SIDT2-related Ataxia;HP:0001251 PMID: 40541391 False 2 0;100;0 2.175 True ENSG00000149577 ENSG00000149577 HGNC:24272 SRPK3 gene SRPK3 Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females intellectual developmental disorder, X-linked 114, MONDO:0975828 Ataxia;HP:0001251 39073169 False 2 0;100;0 2.175 True ENSG00000184343 ENSG00000184343 HGNC:11402 SYNGAP1 gene SYNGAP1 Expert Review Amber;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant mental retardation 5, 612621 Ataxia;HP:0001251 26989088 False 2 0;100;0 2.175 True ENSG00000197283 ENSG00000197283 HGNC:11497 TDP1 gene TDP1 Expert Review Amber;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250 Ataxia;HP:0001251 31182267;12244316;39576382 False 2 0;100;0 2.175 True ENSG00000042088 ENSG00000042088 HGNC:18884 THG1L gene THG1L Expert Review Amber;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 28, MIM# 618800 Ataxia;HP:0001251 27307223;30214071;31168944 False 2 0;100;0 2.175 True ENSG00000113272 ENSG00000113272 HGNC:26053 TMEM138 gene TMEM138 Expert Review Amber;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 16, MIM# 614465" Ataxia;HP:0001251 False 2 0;100;0 2.175 True ENSG00000149483 ENSG00000149483 HGNC:26944 TMEM231 gene TMEM231 Expert Review Amber;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 20, MIM# 614970;Meckel syndrome 11 615397 Ataxia;HP:0001251 False 2 0;100;0 2.175 True ENSG00000205084 ENSG00000205084 HGNC:37234 TRPC3 gene TRPC3 Expert Review Amber;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Ataxia;HP:0001251 25477146;26112884 False 2 0;100;0 2.175 False ENSG00000138741 ENSG00000138741 HGNC:12335 UBA5 gene UBA5 Expert Review Amber;GeneReviews;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Autosomal recessive spinocerebellar ataxia 24, 617133;Early infantile epileptic encephalopathy 44, 617132 Ataxia;HP:0001251 26872069;29902590 False 2 0;100;0 2.175 True ENSG00000081307 ENSG00000081307 HGNC:23230 UBR4 gene UBR4 Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Episodic ataxia;Episodic ataxia type 8, 616055 Ataxia;HP:0001251 29062094;23982692;28600779 False 2 0;100;0 2.175 True ENSG00000127481 ENSG00000127481 HGNC:30313 VAMP1 gene VAMP1 Expert Review Amber;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Autosomal dominant spastic ataxia 1, 108600;Spastic ataxia 1, autosomal dominant, 108600 Ataxia;HP:0001251 22958904 False 2 0;100;0 2.175 False ENSG00000139190 ENSG00000139190 HGNC:12642 VRK1 gene VRK1 Expert list;Expert Review Amber Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 1A, 607596 Ataxia;HP:0001251 19646678;21937992;25609612;24126608;27281532 False 2 0;100;0 2.175 True ENSG00000100749 ENSG00000100749 HGNC:12718 ZFYVE26 gene ZFYVE26 Expert Review Amber;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic paraplegia 15, 270700 Ataxia;HP:0001251 24367272;18394578 False 2 0;100;0 2.175 False ENSG00000072121 ENSG00000072121 HGNC:20761 AMPD2 gene AMPD2 Expert Review Green;Expert Review Red;Other;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 9, 615809 Ataxia;HP:0001251 False 1 0;0;100 2.175 True ENSG00000116337 ENSG00000116337 HGNC:469 ARL6 gene ARL6 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 3, 600151 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000113966 ENSG00000113966 HGNC:13210 ARMC9 gene ARMC9 Expert list;Expert Review Red;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 30, MIM#617622 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000135931 ENSG00000135931 HGNC:20730 ATL2 gene ATL2 Expert Review Red;Other Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebellar ataxia, MONDO:0000437, ATL2-related Ataxia;HP:0001251 False 1 0;0;100 2.175 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000119787 ENSG00000119787 HGNC:24047 ATP1A2 gene ATP1A2 Expert Review Red;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alternating hemiplegia of childhood 1, 104290;Familial hemiplegic migraine 2, 602481 Ataxia;HP:0001251 False 1 0;0;100 2.175 False ENSG00000018625 ENSG00000018625 HGNC:800 ATP7B gene ATP7B Expert Review Red;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease 277900;Wilson disease, 277900 Ataxia;HP:0001251 False 1 0;0;100 2.175 False ENSG00000123191 ENSG00000123191 HGNC:870 BBS10 gene BBS10 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 10, 615987 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000179941 ENSG00000179941 HGNC:26291 BBS12 gene BBS12 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 12, 615989 Ataxia;HP:0001251 False 1 100;0;0 2.175 True ENSG00000181004 ENSG00000181004 HGNC:26648 BBS2 gene BBS2 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 2, 615981 Ataxia;HP:0001251 15637713 False 1 50;0;50 2.175 True ENSG00000125124 ENSG00000125124 HGNC:967 BBS4 gene BBS4 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 4, 615982 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000140463 ENSG00000140463 HGNC:969 BBS5 gene BBS5 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 5, 615983 Ataxia;HP:0001251 15637713 False 1 50;0;50 2.175 True ENSG00000163093 ENSG00000163093 HGNC:970 BBS7 gene BBS7 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 7, 615984 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000138686 ENSG00000138686 HGNC:18758 BBS9 gene BBS9 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 9, 615986 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000122507 ENSG00000122507 HGNC:30000 CACNB4 gene CACNB4 Expert list;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia type 5, 613855 Ataxia;HP:0001251 10762541;27003325;9628818 False 1 0;50;50 2.175 False ENSG00000182389 ENSG00000182389 HGNC:1404 CCDC28B gene CCDC28B Expert list;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders Other {Bardet-Biedl syndrome 1, modifier of}, 209900 Ataxia;HP:0001251 False 1 0;33;67 2.175 True ENSG00000160050 ENSG00000160050 HGNC:28163 CHCHD10 gene CHCHD10 Expert Review Red;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532 Ataxia;HP:0001251 24934289 False 1 0;0;100 2.175 False ENSG00000250479 ENSG00000250479 HGNC:15559 CHMP1A gene CHMP1A Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 8, 614961 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000131165 ENSG00000131165 HGNC:8740 CYP2U1 gene CYP2U1 Expert list;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 56, autosomal recessive, 615030 Ataxia;HP:0001251 False 1 0;0;100 2.175 True ENSG00000155016 ENSG00000155016 HGNC:20582 DAB1 gene DAB1 Expert list;Expert Review Red Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, DAB1-related Ataxia;HP:0001251 PMID: 33928188 False 1 33;33;33 2.175 True ENSG00000173406 ENSG00000173406 HGNC:2661 EEF2 gene EEF2 Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Spinocerebellar ataxia 26 Ataxia;HP:0001251 15732118;23001565 False 1 0;0;0 2.175 False ENSG00000167658 ENSG00000167658 HGNC:3214 ELOVL1 gene ELOVL1 Expert list;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, 618527 Ataxia;HP:0001251 False 1 0;33;67 2.175 True ENSG00000066322 ENSG00000066322 HGNC:14418 EXOSC3 gene EXOSC3 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1B, 614678 Ataxia;HP:0001251 False 1 100;0;0 2.175 True ENSG00000107371 ENSG00000107371 HGNC:17944 GSN gene GSN Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic ataxia, MONDO:0017845, GSN-related Ataxia;HP:0001251 . False 1 0;0;100 2.175 True ENSG00000148180 ENSG00000148180 HGNC:4620 HARS2 gene HARS2 Expert Review Red;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Perrault syndrome 2, MIM# 614926" Ataxia;HP:0001251 31827252 False 1 0;0;100 2.175 True ENSG00000112855 ENSG00000112855 HGNC:4817 IFRD1 gene IFRD1 Expert Review;Expert Review Red;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hereditary spastic paraplegia MONDO:0019064, IFRD1-related Ataxia;HP:0001251 29362493;28601596;19409521 False 1 0;0;100 2.175 False ENSG00000006652 ENSG00000006652 HGNC:5456 MME gene MME Expert Review Green;Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?Spinocerebellar ataxia type 43, 617018 Ataxia;HP:0001251 27583304 False 1 0;0;100 2.175 False ENSG00000196549 ENSG00000196549 HGNC:7154 NALCN gene NALCN Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted congenital contractures of the limbs and face, hypotonia, and developmental delay, MONDO:0014556 Ataxia;HP:0001251 41153398;37469362;27633718;25864427 False 1 100;0;0 2.175 False ENSG00000102452 ENSG00000102452 HGNC:19082 NEFM gene NEFM Expert Review Red;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, MONDO:0000437 Ataxia;HP:0001251 41913087 False 1 0;0;100 2.175 True ENSG00000104722 ENSG00000104722 HGNC:7734 NGLY1 gene NGLY1 Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal congenital disorder of deglycosylation 1, MONDO:0800044 Ataxia;HP:0001251 38070824;32395402;29997391 False 1 100;0;0 2.175 False ENSG00000151092 ENSG00000151092 HGNC:17646 NOL3 gene NOL3 Expert Review Red;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myoclonus, familial cortical Ataxia;HP:0001251 22926851 False 1 0;0;100 2.175 False ENSG00000140939 ENSG00000140939 HGNC:7869 PAX6 gene PAX6 Expert Review Red;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aniridia, 106210;Aniridia, Cerebellar Ataxia, And Mental Retardation Ataxia;HP:0001251 False 1 50;0;50 2.175 False ENSG00000007372 ENSG00000007372 HGNC:8620 PCDH12 gene PCDH12 Expert Review Green;Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal cerebellar ataxia, dystonia, retinopathy, and dysmorphism Ataxia;HP:0001251 30459466 False 1 50;0;50 2.175 True ENSG00000113555 ENSG00000113555 HGNC:8657 PCYT2 gene PCYT2 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy Ataxia;HP:0001251 31637422 False 1 50;0;50 2.175 True ENSG00000185813 ENSG00000185813 HGNC:8756 PIK3R5 gene PIK3R5 Expert Review Red;Literature;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-oculomotor apraxia 3, OMIM #615217 Ataxia;HP:0001251 PubMed: 22065524 False 1 0;0;100 2.175 True ENSG00000141506 ENSG00000141506 HGNC:30035 PRICKLE1 gene PRICKLE1 Expert Review Red;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 1B, 612437;Progressive Myoclonus Epilepsy with Ataxia Ataxia;HP:0001251 20301774 False 1 0;0;100 2.175 True ENSG00000139174 ENSG00000139174 HGNC:17019 RARS2 gene RARS2 Expert list;Expert Review Red Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 6, 611523;early onset cerebellar ataxia Ataxia;HP:0001251 31429931;17847012;25809939;20635367 False 1 0;0;100 2.175 True ENSG00000146282 ENSG00000146282 HGNC:21406 SAR1B gene SAR1B Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chylomicron retention disease, 246700 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000152700 ENSG00000152700 HGNC:10535 SEPSECS gene SEPSECS Expert list;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2D, 613811;cerebellar ataxia and cognitive impairment Ataxia;HP:0001251 29464431 False 1 0;0;100 2.175 False ENSG00000109618 ENSG00000109618 HGNC:30605 SLC27A3 gene SLC27A3 Expert Review Red;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Inherited neurodegenerative disorder, MONDO:0024237, SLC27A3-related Ataxia;HP:0001251 PMID: 41054338 False 1 0;0;100 2.175 True ENSG00000143554 ENSG00000143554 HGNC:10997 SYT14 gene SYT14 Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Spinocerebellarataxia,autosomalrecessive11,614229 Ataxia;HP:0001251 21835308 False 1 0;0;100 2.175 False ENSG00000143469 ENSG00000143469 HGNC:23143 TGM6 gene TGM6 Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 35, 613908;Spinocerebellar ataxia 35 Ataxia;HP:0001251 25253745;21106500;28934387;22554020;30670339;29053796;23206699 False 1 0;0;100 2.175 False ENSG00000166948 ENSG00000166948 HGNC:16255 TPR gene TPR Expert Review Red;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 79, MIM# 620393 Ataxia;HP:0001251 34494102 False 1 0;0;100 2.175 True ENSG00000047410 ENSG00000047410 HGNC:12017 TRIM32 gene TRIM32 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 8, 254110;?Bardet-Biedl syndrome 11, 615988 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000119401 ENSG00000119401 HGNC:16380 TSEN2 gene TSEN2 Expert list;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2B, 612389 Ataxia;HP:0001251 False 1 0;0;100 2.175 True ENSG00000154743 ENSG00000154743 HGNC:28422 TSEN34 gene TSEN34 Expert list;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Pontocerebellar hypoplasia type 2C, 612390 Ataxia;HP:0001251 False 1 0;0;100 2.175 True ENSG00000170892 ENSG00000170892 HGNC:15506 TSEN54 gene TSEN54 Expert list;Expert Review Red Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown adult-onset cerebellar ataxia Ataxia;HP:0001251 24938831 False 1 0;0;100 2.175 False ENSG00000182173 ENSG00000182173 HGNC:27561 TTC8 gene TTC8 Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 8, 615985 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000165533 ENSG00000165533 HGNC:20087 TUBA1A gene TUBA1A Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lissencephaly 3, 611603 Ataxia;HP:0001251 21403111 False 1 67;0;33 2.175 True ENSG00000167552 ENSG00000167552 HGNC:20766 TUBB2A gene TUBB2A Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?progressive spastic ataxia syndrome resembling sacsinopathy;Complex cortical dysplasia with other brain malformations 5, 615763 Ataxia;HP:0001251 29547997;32203252 False 1 50;0;50 2.175 True ENSG00000137267 ENSG00000137267 HGNC:12412 WDPCP gene WDPCP Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Bardet-Biedl syndrome 15, 615992;?Congenital heart defects, hamartomas of tongue, and polysyndactyly, 217085 Ataxia;HP:0001251 False 1 50;0;50 2.175 True ENSG00000143951 ENSG00000143951 HGNC:28027 ZNF423 gene ZNF423 Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nephronophthisis 14 Ataxia;HP:0001251 False 1 0;33;67 2.175 True ENSG00000102935 ENSG00000102935 HGNC:16762 ZNF592 gene ZNF592 Expert Review Red;Royal Melbourne Hospital Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 5;Galloway-Mowat Syndrome 1, 251300 Ataxia;HP:0001251 20531441;26123727 False 1 0;0;100 2.175 True ENSG00000166716 ENSG00000166716 HGNC:28986 ATN1_DRPLA_CAG str ATN1 Expert Review Green;Expert List Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 Ataxia;HP:0001251 29325606;20301664 False 3 100;0;0 2.175 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 ATXN10_SCA10_ATTCT str ATXN10 Expert Review Green;Expert List Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 10 MIM#603516 Ataxia;HP:0001251 20301354 False 3 100;0;0 2.175 True ENSG00000130638 ENSG00000130638 HGNC:10549 22 46191235 46191304 45795355 45795424 ATTCT 32 800 ATXN1_SCA1_CAG str ATXN1 Expert Review Green;Expert List Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 1 MIM#164400 Ataxia;HP:0001251 29325606;20301363 False 3 100;0;0 2.175 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327918 16327953 16327687 16327722 CAG 35 39 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 2 MONDO:0008458 Ataxia;HP:0001251 40741828 False 3 100;0;0 2.175 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 ATXN3_SCA3_CAG str ATXN3 Expert Review Green;Expert List Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 Ataxia;HP:0001251 20301375;29325606 False 3 100;0;0 2.175 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 ATXN7_SCA7_CAG str ATXN7 Expert Review Green;Expert List Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 7 MIM#164500 Ataxia;HP:0001251 29325606;20301433 False 3 100;0;0 2.175 True ENSG00000163635 ENSG00000163635 HGNC:10560 3 63898362 63898391 63912686 63912715 CAG 27 37 ATXN8OS_SCA8_CTG str ATXN8OS Expert Review Green;Expert List Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 Ataxia;HP:0001251 20301445 False 3 100;0;0 2.175 True ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139422 CTG 50 80 BEAN1_SCA31_TGGAA str BEAN1 Expert Review Green;Expert List Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 31 MIM#117210 Ataxia;HP:0001251 19878914;31755042 False 3 100;0;0 2.175 True ENSG00000166546 ENSG00000166546 HGNC:24160 16 66524300 66524369 66490397 66490466 TGGAA 22 80 CACNA1A_SCA6_CAG str CACNA1A Expert Review Green;Expert List Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500 Ataxia;HP:0001251 20301319;29325606 False 3 100;0;0 2.175 True ENSG00000141837 ENSG00000141837 HGNC:1388 19 13318673 13318691 13207859 13207897 CAG 18 20 CSTB_EPM1_CCCCGCCCCGCG str CSTB Literature;Expert Review Green;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Ataxia;HP:0001251 29325606;20301321 False 3 100;0;0 2.175 False ENSG00000160213 ENSG00000160213 HGNC:2482 21 45196325 45196360 43776444 43776479 CCCCGCCCCGCG 3 30 DAB1_SCA37_ATTTC str DAB1 Literature;Expert Review Green;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 37 MIM#615945 Ataxia;HP:0001251 28686858;31145571 False 3 100;0;0 2.175 False ENSG00000173406 ENSG00000173406 HGNC:2661 1 57832716 57832797 57367044 57367121 ATTTC 0 31 FGF14_SCA27B_GAA str FGF14 Literature;Expert Review Green;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs) Ataxia;HP:0001251 37165652;36516086;36493768 False 3 100;0;0 2.175 False ENSG00000102466 ENSG00000102466 HGNC:3671 13 102813926 102814076 102161576 102161726 GAA 249 300 FMR1_FXTAS_CGG str FMR1 Expert list;Expert Review Green;Expert Review Green;Expert list Ataxia Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 Ataxia;HP:0001251 23765048;25227148 False 3 100;0;0 2.175 False ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FXN_FRDA_GAA str FXN Expert list;Expert Review Green;Expert Review Green;Expert list Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 Ataxia;HP:0001251 20301458 False 3 100;0;0 2.175 False ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 GLS_GDPAG_GCA str GLS Literature;Expert Review Green;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 Ataxia;HP:0001251 30970188 False 3 100;0;0 2.175 False ENSG00000115419 ENSG00000115419 HGNC:4331 2 191745599 191745646 190880873 190880920 GCA 16 400 NOP56_SCA36_GGCCTG str NOP56 Expert list;Expert Review Green;Expert Review Green;Expert list Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 36 MIM#614153 Ataxia;HP:0001251 21683323 False 3 100;0;0 2.175 False ENSG00000101361 ENSG00000101361 HGNC:15911 20 2633380 2633403 2652734 2652757 GGCCTG 14 650 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Expert list;Expert list Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 Ataxia;HP:0001251 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 2.175 True - ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 PPP2R2B_SCA12_CAG str PPP2R2B Expert list;Expert Review Green;Expert Review Green;Expert list Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 Ataxia;HP:0001251 27864267;33811808 False 3 100;0;0 2.175 False ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 PRNP_CJD_octapeptide str PRNP Literature;Expert Review Green;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 Ataxia;HP:0001251 2159587;20301407 False 3 100;0;0 2.175 False ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699424 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 RFC1_CANVAS_ANNGN str RFC1 Expert list;Expert Review Green;Expert Review Green;Expert list Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Ataxia;HP:0001251 30926972 False 3 100;0;0 2.175 False ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 TBP_SCA17_CAG str TBP Expert list;Expert Review Green;Expert Review Green;Expert list Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 Ataxia;HP:0001251 20301611;29325606 False 3 100;0;0 2.175 False ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 ZFHX3_SCA4_GGC str ZFHX3 Literature;Expert Review Green;Expert Review Green;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 Ataxia;HP:0001251 38035881;38197134 False 3 100;0;0 2.175 False ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 EP400_SCA_CAG str EP400 Literature;Expert Review Amber;Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia, EP400-related MONDO:0000437 Ataxia;HP:0001251 10.1101/2025.01.06.631535 False 2 0;100;0 2.175 False ENSG00000183495 ENSG00000183495 HGNC:11958 12 132547069 132547156 132062524 132062611 CAG 39 71 THAP11_SCA51_CAG str THAP11 Literature;Expert Review Amber;Expert Review Amber;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 51 MONDO:0975800 Ataxia;HP:0001251 15368101;24677642;34165550;38113319;40459937;39651830;37148549 False 2 0;100;0 2.175 False ENSG00000168286 ENSG00000168286 HGNC:23194 16 67876766 67876853 67842863 67842950 CAG 39 47 ISCA-37404-Loss region Expert Review Green;Expert list;Expert list Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Angelman syndrome, MIM# 105830;Prader-Willi syndrome, MIM# 176270" Ataxia;HP:0001251 20301323;20301505 False 3 100;0;0 2.175 True 15 22782170 28134729 3 80 cnv_loss Angelman and Prader-Willi syndromes ISCA-37405-Loss region NPHP1 Expert Review Green;Expert list;Expert list Ataxia Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Nephronophthisis 1, juvenile, MIM# 256100;Joubert syndrome 4, MIM# 609583;Senior-Loken syndrome 1, MIM# 266900" Ataxia;HP:0001251 29146700 False 3 100;0;0 2.175 True ENSG00000144061 ENSG00000144061 HGNC:7905 2 110122329 110205017 3 80 cnv_loss NPHP1 deletion LMNB1 upstream region region Expert Review Green;Literature;Literature Ataxia Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Adult-onset autosomal dominant demyelinating leukodystrophy, MONDO:0008215 Ataxia;HP:0001251 PMID: 30842973;30697589;25701871 False 3 100;0;0 2.175 False 5 126522203 126689287 80 cnv_loss LMNB1 upstream region