Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
AAAS	gene	AAAS	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Achalasia-addisonianism-alacrimia syndrome MIM#231550			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000094914	ENSG00000094914	HGNC:13666													
ABCB7	gene	ABCB7	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Anaemia, sideroblastic, with ataxia, MIM# 301310			Ataxia;HP:0001251	10196363;10196363;33157103;31772327;31511561;26242992		False	3	100;0;0	2.7	True		ENSG00000131269	ENSG00000131269	HGNC:48													
ABCD1	gene	ABCD1	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Adrenoleukodystrophy MIM# 300100, XLR			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000101986	ENSG00000101986	HGNC:61													
ABHD12	gene	ABHD12	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000100997	ENSG00000100997	HGNC:15868													
ACBD6	gene	ACBD6	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785			Ataxia;HP:0001251	37951597		False	3	100;0;0	2.7	True		ENSG00000230124	ENSG00000230124	HGNC:23339													
ACO2	gene	ACO2	Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile cerebellar-retinal degeneration, MIM#614559			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000100412	ENSG00000100412	HGNC:118													
ADGRG1	gene	ADGRG1	Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polymicrogyria, Frontoparietal, 606854;Polymicrogyria, perisylvian type, 615752			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000205336	ENSG00000205336	HGNC:4512													
ADPRS	gene	ADPRS	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, stress-induced with variable ataxia and seizures, 618170			Ataxia;HP:0001251	30100084;30401461		False	3	100;0;0	2.7	True		ENSG00000116863	ENSG00000116863	HGNC:21304													
AFG3L2	gene	AFG3L2	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic ataxia 5, autosomal recessive MIM#614487;Spinocerebellar ataxia 28 MIM#610246			Ataxia;HP:0001251	20725928		False	3	100;0;0	2.7	True		ENSG00000141385	ENSG00000141385	HGNC:315													
AGTPBP1	gene	AGTPBP1	Expert Review;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650			Ataxia;HP:0001251	30420557, 28600779, 30976113, 38153683, 28325758		False	3	100;0;0	2.7	True		ENSG00000135049	ENSG00000135049	HGNC:17258													
AHI1	gene	AHI1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 3			Ataxia;HP:0001251	25616960		False	3	100;0;0	2.7	True		ENSG00000135541	ENSG00000135541	HGNC:21575													
ALDH5A1	gene	ALDH5A1	Expert Review Green;NHS GMS;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinic semialdehyde dehydrogenase deficiency, MIM# 271980			Ataxia;HP:0001251	14635103		False	3	100;0;0	2.7	True		ENSG00000112294	ENSG00000112294	HGNC:408													
ANO10	gene	ANO10	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 10 MIM#613728			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000160746	ENSG00000160746	HGNC:25519													
AP1S2	gene	AP1S2	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Pettigrew syndrome, MIM# 304340			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000182287	ENSG00000182287	HGNC:560													
APTX	gene	APTX	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminaemia MIM#208920			Ataxia;HP:0001251	30986824;26256098;11586299		False	3	100;0;0	2.7	True		ENSG00000137074	ENSG00000137074	HGNC:15984													
ARL13B	gene	ARL13B	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 8, MIM#	612291"			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000169379	ENSG00000169379	HGNC:25419													
ARSA	gene	ARSA	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic Leukodystrophy, 250100;Metachromatic leukodystrophy (#250100)			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ATCAY	gene	ATCAY	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, cerebellar, Cayman type, MIM# 601238;MONDO:0011025			Ataxia;HP:0001251	14556008;29449188;23226316;26343454		False	3	50;50;0	2.7	True		ENSG00000167654	ENSG00000167654	HGNC:779													
ATG7	gene	ATG7	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, SCAR31, MIM#619422			Ataxia;HP:0001251	34161705		False	3	100;0;0	2.7	True		ENSG00000197548	ENSG00000197548	HGNC:16935													
ATM	gene	ATM	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-telangiectasia MIM#208900			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000149311	ENSG00000149311	HGNC:795													
ATP13A2	gene	ATP13A2	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome MIM#606693			Ataxia;HP:0001251	21362476;21696388;31588715;32559632;33033738;33091395;34405108		False	3	100;0;0	2.7	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP1A3	gene	ATP1A3	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002			Ataxia;HP:0001251	15260953, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	2.7	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP2B2	gene	ATP2B2	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related			Ataxia;HP:0001251	PMID: 37675773		False	3	100;0;0	2.7	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000157087	ENSG00000157087	HGNC:815													
ATP2B3	gene	ATP2B3	Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Spinocerebellar ataxia, X-linked 1			Ataxia;HP:0001251	37821930;36207321;31680123;28807751;28720891;27653636;25953895		False	3	50;50;0	2.7	True		ENSG00000067842	ENSG00000067842	HGNC:816													
ATP6V0A1	gene	ATP6V0A1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971			Ataxia;HP:0001251	PMID:34909687		False	3	50;50;0	2.7	True		ENSG00000033627	ENSG00000033627	HGNC:865													
ATP8A2	gene	ATP8A2	Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268			Ataxia;HP:0001251	22892528;31612321		False	3	100;0;0	2.7	True		ENSG00000132932	ENSG00000132932	HGNC:13533													
BBS1	gene	BBS1	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 1, 209900			Ataxia;HP:0001251	15637713		False	3	100;0;0	2.7	True		ENSG00000174483	ENSG00000174483	HGNC:966													
BCKDHB	gene	BCKDHB	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Episodic ataxia during metabolic crises;paroxysmal nonkinesigenic dyskinesia			Ataxia;HP:0001251	PMID 32151765		False	3	0;0;0	2.7	True		ENSG00000083123	ENSG00000083123	HGNC:987													
BRAT1	gene	BRAT1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056			Ataxia;HP:0001251	26483087;26494257;27282546		False	3	100;0;0	2.7	True		ENSG00000106009	ENSG00000106009	HGNC:21701													
CA8	gene	CA8	Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3;Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3, 613227			Ataxia;HP:0001251	21937992;19461874		False	3	100;0;0	2.7	True		ENSG00000178538	ENSG00000178538	HGNC:1382													
CACNA1A	gene	CACNA1A	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 2 MIM#108500			Ataxia;HP:0001251			False	3	50;50;0	2.7	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1G	gene	CACNA1G	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits MIM#618087			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000006283	ENSG00000006283	HGNC:1394													
CACNA2D2	gene	CACNA2D2	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar atrophy with seizures and variable developmental delay MIM#618501			Ataxia;HP:0001251	23339110;24358150;30410802;29997391;31402629		False	3	100;0;0	2.7	True		ENSG00000007402	ENSG00000007402	HGNC:1400													
CAD	gene	CAD	Expert list;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 50;OMIM # 616457			Ataxia;HP:0001251	PMID: 32820246		False	3	100;0;0	2.7	True		ENSG00000084774	ENSG00000084774	HGNC:1424													
CAMTA1	gene	CAMTA1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cerebellarataxia, nonprogressive, with mental retardation, 614756;Cerebellar ataxia with mental retardation, 614756			Ataxia;HP:0001251	32157189;22693284		False	3	100;0;0	2.7	True		ENSG00000171735	ENSG00000171735	HGNC:18806													
CAPRIN1	gene	CAPRIN1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy			Ataxia;HP:0001251	39878554		False	3	100;0;0	2.7	True		ENSG00000135387	ENSG00000135387	HGNC:6743													
CASK	gene	CASK	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	FG syndrome 4, 300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000147044	ENSG00000147044	HGNC:1497													
CBY1	gene	CBY1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	intellectual disability;cerebellar ataxia;molar tooth sign;polydactyly;Joubert syndrome			Ataxia;HP:0001251	33131181;25103236;25220153		False	3	100;0;0	2.7	True		ENSG00000100211	ENSG00000100211	HGNC:1307													
CC2D2A	gene	CC2D2A	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 9, MIM#612285			Ataxia;HP:0001251	18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408		False	3	100;0;0	2.7	True		ENSG00000048342	ENSG00000048342	HGNC:29253													
CD99L2	gene	CD99L2	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder, MONDO:0700092;CD99L2-related			Ataxia;HP:0001251	41690933		False	3	100;0;0	2.7	True		ENSG00000102181	ENSG00000102181	HGNC:18237													
CEP290	gene	CEP290	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 5, MIM# 610188			Ataxia;HP:0001251	18327255;20690115;16682973;16682970;17564967;16909394;17564974		False	3	100;0;0	2.7	True		ENSG00000198707	ENSG00000198707	HGNC:29021													
CEP41	gene	CEP41	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 15, MIM# 614464			Ataxia;HP:0001251	22246503		False	3	100;0;0	2.7	True		ENSG00000106477	ENSG00000106477	HGNC:12370													
CLCN2	gene	CLCN2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with ataxia, MIM# 615651			Ataxia;HP:0001251	29403011;29403012;23707145		False	3	100;0;0	2.7	True		ENSG00000114859	ENSG00000114859	HGNC:2020													
CLN5	gene	CLN5	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis neuronal 5, MIM# 256731			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000102805	ENSG00000102805	HGNC:2076													
CLN6	gene	CLN6	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300			Ataxia;HP:0001251	11791207;11727201;21549341;30561534		False	3	100;0;0	2.7	True		ENSG00000128973	ENSG00000128973	HGNC:2077													
CLPP	gene	CLPP	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 3, MIM# 614129			Ataxia;HP:0001251	25254289		False	3	100;0;0	2.7	True		ENSG00000125656	ENSG00000125656	HGNC:2084													
COA7	gene	COA7	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000162377	ENSG00000162377	HGNC:25716													
COQ4	gene	COQ4	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Childhood-onset ataxia			Ataxia;HP:0001251	30225196;33704555;30847826		False	3	100;0;0	2.7	True		ENSG00000167113	ENSG00000167113	HGNC:19693													
COQ5	gene	COQ5	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 9 MIM#619028			Ataxia;HP:0001251	29044765;37599337;21937992;41199775;36266294		False	3	33;0;67	2.7	True		ENSG00000110871	ENSG00000110871	HGNC:28722													
COQ8A	gene	COQ8A	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 4 MIM#612016			Ataxia;HP:0001251	32337771		False	3	100;0;0	2.7	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
COX20	gene	COX20	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, 220110;Mitochondrial complex IV deficiency			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000203667	ENSG00000203667	HGNC:26970													
CP	gene	CP	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290			Ataxia;HP:0001251	20301666		False	3	100;0;0	2.7	False		ENSG00000047457	ENSG00000047457	HGNC:2295													
CPLANE1	gene	CPLANE1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 17, MIM#	614615"			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000197603	ENSG00000197603	HGNC:25801													
CSF1R	gene	CSF1R	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia			Ataxia;HP:0001251	24198292;25563800;25935893		False	3	100;0;0	2.7	False		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSNK2B	gene	CSNK2B	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732			Ataxia;HP:0001251	PMID: 34041744		False	3	100;0;0	2.7	True		ENSG00000204435	ENSG00000204435	HGNC:2460													
CSTB	gene	CSTB	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM#254800			Ataxia;HP:0001251	9012407;9054946		False	3	50;50;0	2.7	True		ENSG00000160213	ENSG00000160213	HGNC:2482													
CTBP1	gene	CTBP1	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, MIM#617915			Ataxia;HP:0001251	27094857;28955726;31041561		False	3	100;0;0	2.7	True		ENSG00000159692	ENSG00000159692	HGNC:2494													
CWF19L1	gene	CWF19L1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 17, 616127;Autosomal recessive spinocerebellar ataxia type 17, 616127			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000095485	ENSG00000095485	HGNC:25613													
CYP27A1	gene	CYP27A1	Expert Review Green;NHS GMS;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, 213700			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000135929	ENSG00000135929	HGNC:2605													
DAGLA	gene	DAGLA	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuroocular syndrome 2, paroxysmal type, MIM# 168885			Ataxia;HP:0001251	35737950		False	3	100;0;0	2.7	True		ENSG00000134780	ENSG00000134780	HGNC:1165													
DARS2	gene	DARS2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation;Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000117593	ENSG00000117593	HGNC:25538													
DDHD2	gene	DDHD2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive paraplegia 54 (#615033). Complex form of disease ataxia reported amongst the phenotypic features in Citterio et al. (2014), Journal of Neurology, 261, pp.373-381 and Doi et al. (2014), Scientific Reports, 4, 7132.;Spastic paraplegia 54			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000085788	ENSG00000085788	HGNC:29106													
DHDDS	gene	DHDDS	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay and seizures with or without movement abnormalities, OMIM:617836			Ataxia;HP:0001251	29100083;33798445;34182312;34382076		False	3	100;0;0	2.7	True		ENSG00000117682	ENSG00000117682	HGNC:20603													
DNAJC19	gene	DNAJC19	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type V 610198;dilated cardiomyopathy with ataxia (DCMA) syndrome;3-methylglutaconic aciduria type V, 610198			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000205981	ENSG00000205981	HGNC:30528													
DNAJC3	gene	DNAJC3	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile-onset diabetes mellitus-central and peripheral neurodegeneration syndrome, MONDO:0014523			Ataxia;HP:0001251	34654017;34630333;33486469;32738013;28940199		False	3	100;0;0	2.7	True		ENSG00000102580	ENSG00000102580	HGNC:9439													
DNAJC5	gene	DNAJC5	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNMT1	gene	DNMT1	ClinGen;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584			Ataxia;HP:0001251	22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424		False	3	100;0;0	2.7	False		ENSG00000130816	ENSG00000130816	HGNC:2976													
DOCK3	gene	DOCK3	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000088538	ENSG00000088538	HGNC:2989													
EBF3	gene	EBF3	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypotonia, ataxia and delayed development syndrome, 617330			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000108001	ENSG00000108001	HGNC:19087													
EEFSEC	gene	EEFSEC	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102			Ataxia;HP:0001251	39753114		False	3	100;0;0	2.7	True		ENSG00000132394	ENSG00000132394	HGNC:24614													
EIF2B1	gene	EIF2B1	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000111361	ENSG00000111361	HGNC:3257													
EIF2B2	gene	EIF2B2	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000119718	ENSG00000119718	HGNC:3258													
EIF2B3	gene	EIF2B3	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000070785	ENSG00000070785	HGNC:3259													
EIF2B4	gene	EIF2B4	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000115211	ENSG00000115211	HGNC:3260													
EIF2B5	gene	EIF2B5	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000145191	ENSG00000145191	HGNC:3261													
ELFN1	gene	ELFN1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dursun-Ozgul neurodevelopmental syndrome, MIM# 621344			Ataxia;HP:0001251	PMID:40576023		False	3	100;0;0	2.7	True		ENSG00000225968	ENSG00000225968	HGNC:33154													
ELOVL4	gene	ELOVL4	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000118402	ENSG00000118402	HGNC:14415													
ELOVL5	gene	ELOVL5	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 38, MIM#615957			Ataxia;HP:0001251	25065913		False	3	100;0;0	2.7	False		ENSG00000012660	ENSG00000012660	HGNC:21308													
EPM2A	gene	EPM2A	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive myoclonic epilepsy 2A, Lafora, 254780;Epilepsy, progressive myoclonic 2A (Lafora) 254780			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000112425	ENSG00000112425	HGNC:3413													
ERCC4	gene	ERCC4	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM#	278760"			Ataxia;HP:0001251	29403087;28431612;29892709		False	3	100;0;0	2.7	False		ENSG00000175595	ENSG00000175595	HGNC:3436													
ESRRG	gene	ESRRG	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Movement disorder, congenital nonprogressive, with ataxia and eye movement abnormalities, MIM# 621639			Ataxia;HP:0001251	41265451		False	3	100;0;0	2.7	True		ENSG00000196482	ENSG00000196482	HGNC:3474													
EXOSC5	gene	EXOSC5	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, brain abnormalities, and cardiac conduction defects, MIM# 619576;Short stature;Motor developmental delays;Cerebellar hypoplasia;Ataxia			Ataxia;HP:0001251	32504085;29302074		False	3	100;0;0	2.7	True		ENSG00000077348	ENSG00000077348	HGNC:24662													
FA2H	gene	FA2H	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 35, autosomal recessive	MIM#612319"			Ataxia;HP:0001251	31135052		False	3	100;0;0	2.7	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FAT2	gene	FAT2	Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 45, MIM#617769			Ataxia;HP:0001251	29053796;33884300		False	3	50;50;0	2.7	False		ENSG00000086570	ENSG00000086570	HGNC:3596													
FBXL4	gene	FBXL4	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type), MIM# 615471			Ataxia;HP:0001251	28383868		False	3	100;0;0	2.7	True		ENSG00000112234	ENSG00000112234	HGNC:13601													
FDXR	gene	FDXR	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887			Ataxia;HP:0001251	30250212;28965846;29040572;33348459;37046037;37481223		False	3	100;0;0	2.7	True		ENSG00000161513	ENSG00000161513	HGNC:3642													
FGF14	gene	FGF14	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 27 MIM#609307			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000102466	ENSG00000102466	HGNC:3671													
FLVCR1	gene	FLVCR1	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, posterior column, with retinitis pigmentosa MIM#609033			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000162769	ENSG00000162769	HGNC:24682													
FOLR1	gene	FOLR1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration due to cerebral folate transport deficiency, 613068;Neurodegeneration due to cerebral folate transport deficiency			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000110195	ENSG00000110195	HGNC:3791													
FRMD5	gene	FRMD5	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094			Ataxia;HP:0001251	36206744		False	3	100;0;0	2.7	True		ENSG00000171877	ENSG00000171877	HGNC:28214													
FXN	gene	FXN	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000165060	ENSG00000165060	HGNC:3951													
GBA2	gene	GBA2	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 46, autosomal recessive, MIM# 614409;MONDO:0013737			Ataxia;HP:0001251	23332916;23332917;29524657		False	3	100;0;0	2.7	True		ENSG00000070610	ENSG00000070610	HGNC:18986													
GDAP2	gene	GDAP2	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000196505	ENSG00000196505	HGNC:18010													
GEMIN5	gene	GEMIN5	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, OMIM # 619333			Ataxia;HP:0001251	34569062;33963192		False	3	100;0;0	2.7	True		ENSG00000082516	ENSG00000082516	HGNC:20043													
GFAP	gene	GFAP	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000131095	ENSG00000131095	HGNC:4235													
GJC2	gene	GJC2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelinating leukodystrophy 2, 608804;Leukodystrophy, hypomyelinating, 2;Autosomal Recessive Ataxia;Spastic paraplegia 44, 613206			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000198835	ENSG00000198835	HGNC:17494													
GOSR2	gene	GOSR2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 6, 614018;Progressive myoclonic epilepsy 6, 614018			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000108433	ENSG00000108433	HGNC:4431													
GPAA1	gene	GPAA1	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 15, 617810			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000197858	ENSG00000197858	HGNC:4446													
GRID2	gene	GRID2	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 18, 616204			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000152208	ENSG00000152208	HGNC:4576													
GRM1	gene	GRM1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 13;Spinocerebellar ataxia 44, 617691, autosomal recessive spinocerebellar ataxia type 13, 614831			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000152822	ENSG00000152822	HGNC:4593													
GSS	gene	GSS	Expert Review Green;NHS GMS;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Gluthathione synthetase deficiency, MIM# 266130			Ataxia;HP:0001251	15717202		False	3	100;0;0	2.7	True		ENSG00000100983	ENSG00000100983	HGNC:4624													
HEXA	gene	HEXA	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, several forms, 272800;Tay-Sachs disease, 272800			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000213614	ENSG00000213614	HGNC:4878													
HEXB	gene	HEXB	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sandhoff disease, infantile, juvenile, and adult forms, 268800;Sandhoff disease, 268800			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000049860	ENSG00000049860	HGNC:4879													
INPP5E	gene	INPP5E	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 1			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000148384	ENSG00000148384	HGNC:21474													
IRF2BPL	gene	IRF2BPL	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with regression, abnormal movement, loss of speech and seizures, 618088			Ataxia;HP:0001251	30057031		False	3	100;0;0	2.7	True		ENSG00000119669	ENSG00000119669	HGNC:14282													
ITM2B	gene	ITM2B	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia			Ataxia;HP:0001251	10391242;10781099;33814452		False	3	100;0;0	2.7	False		ENSG00000136156	ENSG00000136156	HGNC:6174													
ITPR1	gene	ITPR1	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 15 MIM#606658;Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000150995	ENSG00000150995	HGNC:6180													
KCNA1	gene	KCNA1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	EPISODIC ATAXIA, TYPE 1;myokymia with periodic ataxia;Episodic ataxia/myokymia syndrome, 160120;Episodic ataxia/myokymia syndrome			Ataxia;HP:0001251	11026449		False	3	100;0;0	2.7	True	Other	ENSG00000111262	ENSG00000111262	HGNC:6218													
KCNA2	gene	KCNA2	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early infantile encephalopathy 32, 616366			Ataxia;HP:0001251	29050392		False	3	100;0;0	2.7	True		ENSG00000177301	ENSG00000177301	HGNC:6220													
KCNC3	gene	KCNC3	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 13 MIM#605259			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000131398	ENSG00000131398	HGNC:6235													
KCND3	gene	KCND3	Expert Review;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 19, MIM#	607346"			Ataxia;HP:0001251	32823520		False	3	100;0;0	2.7	True		ENSG00000171385	ENSG00000171385	HGNC:6239													
KCNJ10	gene	KCNJ10	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seizures, Sensorineural Deafness, Ataxia, Mental Retardation, and Electrolyte Imbalance Syndrome;SESAME syndrome, 612780			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000177807	ENSG00000177807	HGNC:6256													
KCNN2	gene	KCNN2	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725			Ataxia;HP:0001251	33242881		False	3	100;0;0	2.7	True		ENSG00000080709	ENSG00000080709	HGNC:6291													
KIF1C	gene	KIF1C	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 2, autosomal recessive MIM#611302			Ataxia;HP:0001251	24482476;24319291;31413903;29544888		False	3	100;0;0	2.7	True		ENSG00000129250	ENSG00000129250	HGNC:6317													
KIF7	gene	KIF7	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Koubert syndrome 12;Acrocallosal syndrome, Schinzel type			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000166813	ENSG00000166813	HGNC:30497													
LAMA1	gene	LAMA1	Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Poretti-Boltshauser syndrome;Cerebellar ataxia, intellectual disability, oculomotor apraxia, cerebellar cysts syndrome			Ataxia;HP:0001251	26932191;25105227		False	3	100;0;0	2.7	True		ENSG00000101680	ENSG00000101680	HGNC:6481													
LARS2	gene	LARS2	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021;Leukodystrophy			Ataxia;HP:0001251	29205794;32423379;30737337		False	3	100;0;0	2.7	True		ENSG00000011376	ENSG00000011376	HGNC:17095													
LETM1	gene	LETM1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089			Ataxia;HP:0001251	36055214		False	3	100;0;0	2.7	True		ENSG00000168924	ENSG00000168924	HGNC:6556													
LMNB1	gene	LMNB1	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, adult-onset, autosomal dominant MIM#169500			Ataxia;HP:0001251	31695592		False	3	100;0;0	2.7	False		ENSG00000113368	ENSG00000113368	HGNC:6637													
MAG	gene	MAG	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 75, autosomal recessive, MIM#	616680;Cerebellar ataxia;Oculomotor apraxia"			Ataxia;HP:0001251	32629324;32340215;32629324		False	3	100;0;0	2.7	True		ENSG00000105695	ENSG00000105695	HGNC:6783													
MARS2	gene	MARS2	Australian Genomics Health Alliance Mitochondrial Flagship;Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 3, autosomal recessive MIM#611390			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000247626	ENSG00000247626	HGNC:25133													
MKS1	gene	MKS1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 28			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000011143	ENSG00000011143	HGNC:7121													
MMACHC	gene	MMACHC	Expert Review Green;NHS GMS;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria and homocystinuria cblC type, 277400;Methylmalonic aciduria and homocystinuria, cblC type, 277400;Ataxia and hypogonadism			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000132763	ENSG00000132763	HGNC:24525													
MORC2	gene	MORC2	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Axonal type CMT disease type 2Z, 616688;Cerebellar ataxia			Ataxia;HP:0001251	28402445		False	3	50;0;50	2.7	True		ENSG00000133422	ENSG00000133422	HGNC:23573													
MRE11	gene	MRE11	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-Telangiectasia-Like Disorder;Ataxia-telangiectasia-like disorder 1, 604391			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000020922	ENSG00000020922	HGNC:7230													
MSTO1	gene	MSTO1	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Myopathy, mitochondrial, and ataxia MIM#617675			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000125459	ENSG00000125459	HGNC:29678													
MT-ATP6	gene	MT-ATP6	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related			Ataxia;HP:0001251	40112238		False	3	100;0;0	2.7	True		ENSG00000198899	ENSG00000198899	HGNC:7414													
MTCL1	gene	MTCL1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	slowly progressive cerebellar ataxia, mild intellectual disability, seizures in childhood and episodic pain in the lower limbs			Ataxia;HP:0001251	30548255;28283581		False	3	100;0;0	2.7	True		ENSG00000168502	ENSG00000168502	HGNC:29121													
MT-CO1	gene	MT-CO1	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related			Ataxia;HP:0001251	30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519		False	3	100;0;0	2.7	True		ENSG00000198804	ENSG00000198804	HGNC:7419													
MT-CO2	gene	MT-CO2	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related			Ataxia;HP:0001251	34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519		False	3	100;0;0	2.7	True		ENSG00000198712	ENSG00000198712	HGNC:7421													
MT-CYB	gene	MT-CYB	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related			Ataxia;HP:0001251	39858655;34804306;26937408		False	3	100;0;0	2.7	True		ENSG00000198727	ENSG00000198727	HGNC:7427													
MTFMT	gene	MTFMT	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 15 MIM#614947;Mitochondrial complex I deficiency, nuclear type 27 MIM#618248			Ataxia;HP:0001251	26060307;24461907		False	3	100;0;0	2.7	True		ENSG00000103707	ENSG00000103707	HGNC:29666													
MT-ND4	gene	MT-ND4	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4-related			Ataxia;HP:0001251	12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231		False	3	100;0;0	2.7	True		ENSG00000198886	ENSG00000198886	HGNC:7459													
MT-TE	gene	MT-TE	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TE-related			Ataxia;HP:0001251	8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256		False	3	100;0;0	2.7	True		ENSG00000210194	ENSG00000210194	HGNC:7479													
MT-TG	gene	MT-TG	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TG-related			Ataxia;HP:0001251	8079988;9199564;11971101;16120360;32337339;35432167;10090480		False	3	100;0;0	2.7	True		ENSG00000210164	ENSG00000210164	HGNC:7486													
MT-TH	gene	MT-TH	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TH-related			Ataxia;HP:0001251	12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194		False	3	100;0;0	2.7	True		ENSG00000210176	ENSG00000210176	HGNC:7487													
MTTP	gene	MTTP	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Abetalipoproteinemia, 200100;Abetalipoproteinemia			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000138823	ENSG00000138823	HGNC:7467													
MT-TS2	gene	MT-TS2	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS2-related			Ataxia;HP:0001251	9792552;10090882;16950817;21257182;22369973;22378285		False	3	100;0;0	2.7	True		ENSG00000210184	ENSG00000210184	HGNC:7498													
MT-TV	gene	MT-TV	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related			Ataxia;HP:0001251	9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	2.7	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TW	gene	MT-TW	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related			Ataxia;HP:0001251	7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	2.7	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
MT-TY	gene	MT-TY	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TY-related			Ataxia;HP:0001251	11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411		False	3	100;0;0	2.7	True		ENSG00000210144	ENSG00000210144	HGNC:7502													
MVK	gene	MVK	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mevalonic aciduria 610377			Ataxia;HP:0001251	12563048;10401001;28095071		False	3	100;0;0	2.7	True		ENSG00000110921	ENSG00000110921	HGNC:7530													
NHLRC1	gene	NHLRC1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive myoclonic epilepsy 2B, Lafora, 254780;Epilepsy, progressive myoclonic 2B (Lafora) 254780			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000187566	ENSG00000187566	HGNC:21576													
NKX2-1	gene	NKX2-1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Choreoathetosis, hypothyroidism, and neonatal respiratory distress 610978;Choreoathetosis, hypothyroidism and neonatal respiratory distress, 610978;Chorea, hereditary benign 118700;Hereditary bening chorea, 118700			Ataxia;HP:0001251	10931427;27066577;26839702;26103969		False	3	100;0;0	2.7	True		ENSG00000136352	ENSG00000136352	HGNC:11825													
NKX6-2	gene	NKX6-2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spastic ataxia 8 with hypomyelinating leukodystrophy, 617560;Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000148826	ENSG00000148826	HGNC:19321													
NOVA2	gene	NOVA2	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, OMIM #618859			Ataxia;HP:0001251	PMID: 32197073		False	3	100;0;0	2.7	True		ENSG00000104967	ENSG00000104967	HGNC:7887													
NPC1	gene	NPC1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease type C1, 257220;Niemann-Pick disease types C1 and D (#257220)			Ataxia;HP:0001251	10480349;17003072;25497598;33228797		False	3	100;0;0	2.7	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC2	gene	NPC2	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease type C2, 607625;Niemann-Pick disease type C2 (#607625)			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPHP1	gene	NPHP1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 4			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000144061	ENSG00000144061	HGNC:7905													
NPTX1	gene	NPTX1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	cerebellar ataxia MONDO#0000437, NPTX1-related			Ataxia;HP:0001251	34788392;35288776;35285082;35560436		False	3	100;0;0	2.7	False		ENSG00000171246	ENSG00000171246	HGNC:7952													
NUBPL	gene	NUBPL	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 21, OMIM # 618242			Ataxia;HP:0001251	23553477;32518176		False	3	100;0;0	2.7	True		ENSG00000151413	ENSG00000151413	HGNC:20278													
NUS1	gene	NUS1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Epilepsy, myoclonus, ataxia and scoliosis;Mental retardation, autosomal dominant 55, with seizures, 617831			Ataxia;HP:0001251	PMID: 31656175;29100083		False	3	100;0;0	2.7	True		ENSG00000153989	ENSG00000153989	HGNC:21042													
OFD1	gene	OFD1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 10			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000046651	ENSG00000046651	HGNC:2567													
OPA1	gene	OPA1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	OPA1-related optic atrophy with or without extraocular features, MONDO:0800181			Ataxia;HP:0001251	30165240;28494813		False	3	100;0;0	2.7	True		ENSG00000198836	ENSG00000198836	HGNC:8140													
OPA3	gene	OPA3	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type III, 258501;Optic atrophy 3 with cataract, 165300;3-methylglutaconic aciduria type III, 258501;Costeff syndrome			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000125741	ENSG00000125741	HGNC:8142													
OPHN1	gene	OPHN1	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	X-linked mental retardation with cerebellar hypoplasia and distinctive facial appearance, 300486;Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000079482	ENSG00000079482	HGNC:8148													
PDE1B	gene	PDE1B	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related			Ataxia;HP:0001251	40492975		False	3	100;0;0	2.7	True		ENSG00000123360	ENSG00000123360	HGNC:8775													
PDYN	gene	PDYN	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000101327	ENSG00000101327	HGNC:8820													
PEX16	gene	PEX16	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Zellweger syndrome (614876);Peroxisome biogenesis disorder 8B (#614877)  infantile progressive ataxia and spastic paresis;Peroxisome biogenesis disorder 8A, 614876;Peroxisome biogenesis disorder 8B, 614877			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000121680	ENSG00000121680	HGNC:8857													
PEX7	gene	PEX7	Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Refsum disease;Peroxisome biogenesis disorder 9B, MIM#614879			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000112357	ENSG00000112357	HGNC:8860													
PHYH	gene	PHYH	Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Refsum disease, MIM#	266500"			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000107537	ENSG00000107537	HGNC:8940													
PIGS	gene	PIGS	Expert Review;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 95, OMIM # 618143			Ataxia;HP:0001251	30269814;33410539		False	3	100;0;0	2.7	True		ENSG00000087111	ENSG00000087111	HGNC:14937													
PITRM1	gene	PITRM1	Expert list;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis			Ataxia;HP:0001251	26697887;29764912		False	3	100;0;0	2.7	True		ENSG00000107959	ENSG00000107959	HGNC:17663													
PLA2G6	gene	PLA2G6	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive Parkinson disease 14, 612953;Parkinson disease 14 (#612953);Infantile neuroaxonal dystrophy 1 (#256600);Infantile neuroaxonal dystrophy 1, 256600;Neurodegeneration with brain iron accumulation 2B (#610217);Neurodegeneration with brain iron accumulation 2B, 610217			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PMPCA	gene	PMPCA	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200			Ataxia;HP:0001251	25808372;26657514;33272776;30617178		False	3	100;0;0	2.7	True		ENSG00000165688	ENSG00000165688	HGNC:18667													
PMPCB	gene	PMPCB	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 6, 617954			Ataxia;HP:0001251	29576218		False	3	100;0;0	2.7	True		ENSG00000105819	ENSG00000105819	HGNC:9119													
PNKD	gene	PNKD	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Paroxysmal nonkinesigenic dyskinesia 1, 118800			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000127838	ENSG00000127838	HGNC:9153													
PNKP	gene	PNKP	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, seizures and developmental delay, 613402;Ataxia-oculomotor apraxia 4, 616267;Ataxia with oculomotor apraxia 4 (#616267)			Ataxia;HP:0001251	31436889;31707899		False	3	100;0;0	2.7	True		ENSG00000039650	ENSG00000039650	HGNC:9154													
PNPLA6	gene	PNPLA6	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Boucher-Neuhauser syndrome MIM#215470;Laurence-Moon syndrome MIM#245800;Oliver-McFarlane syndrome MIM#275400;Spastic paraplegia 39, autosomal recessive MIM#612020			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000032444	ENSG00000032444	HGNC:16268													
PNPT1	gene	PNPT1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 25, MIM#	608703"			Ataxia;HP:0001251	35411967;37935417;39729134;39899068;39924761;40757543		False	3	60;40;0	2.7	False		ENSG00000138035	ENSG00000138035	HGNC:23166													
POLG	gene	POLG	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLR3A	gene	POLR3A	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3B	gene	POLR3B	Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#614381			Ataxia;HP:0001251	22036171;22036172		False	3	100;0;0	2.7	True		ENSG00000013503	ENSG00000013503	HGNC:30348													
POU4F1	gene	POU4F1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ataxia;intention tremor;hypotonia			Ataxia;HP:0001251	33783914;8876243		False	3	100;0;0	2.7	True		ENSG00000152192	ENSG00000152192	HGNC:9218													
PRDX3	gene	PRDX3	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia MONDO:0000437, PRDX3-related			Ataxia;HP:0001251	33889951		False	3	100;0;0	2.7	True		ENSG00000165672	ENSG00000165672	HGNC:9354													
PRNP	gene	PRNP	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease			Ataxia;HP:0001251	2564168;34324063;20301407		False	3	100;0;0	2.7	False		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRRT2	gene	PRRT2	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	PRRT2-associated paroxysmal movement disorder MONDO:0100556			Ataxia;HP:0001251	26598494;31193310;30501978;30713971		False	3	100;0;0	2.7	True		ENSG00000167371	ENSG00000167371	HGNC:30500													
PTRH2	gene	PTRH2	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile multi-system neurologic, endocrine, and pancreatic disease, 616263			Ataxia;HP:0001251	25558065;25574476;31057140;27129381		False	3	100;0;0	2.7	True		ENSG00000141378	ENSG00000141378	HGNC:24265													
PUM1	gene	PUM1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 47, 617931			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000134644	ENSG00000134644	HGNC:14957													
RAB3A	gene	RAB3A	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 52, MIM# 621535			Ataxia;HP:0001251	40166812		False	3	100;0;0	2.7	True		ENSG00000105649	ENSG00000105649	HGNC:9777													
RFC1	gene	RFC1	Expert list;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575			Ataxia;HP:0001251	30926972;33103729;35883251;36478048;36289003		False	3	67;33;0	2.7	False		ENSG00000035928	ENSG00000035928	HGNC:9969													
RNF170	gene	RNF170	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ataxia, sensory, 1, autosomal dominant, MIM# 608984			Ataxia;HP:0001251	32943585;21115467		False	3	100;0;0	2.7	False		ENSG00000120925	ENSG00000120925	HGNC:25358													
RNF216	gene	RNF216	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000011275	ENSG00000011275	HGNC:21698													
RNF220	gene	RNF220	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum			Ataxia;HP:0001251	33964137;10881263		False	3	100;0;0	2.7	True		ENSG00000187147	ENSG00000187147	HGNC:25552													
RORA	gene	RORA	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, 618060			Ataxia;HP:0001251	29656859		False	3	100;0;0	2.7	True		ENSG00000069667	ENSG00000069667	HGNC:10258													
RPGRIP1L	gene	RPGRIP1L	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 7, MIM#	611560"			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000103494	ENSG00000103494	HGNC:29168													
RUBCN	gene	RUBCN	Expert Review Green;Royal Melbourne Hospital;Royal Melbourne Hospital Clinical Genetics Department;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 15, MIM#615705			Ataxia;HP:0001251	20826435;23728897		False	3	100;0;0	2.7	True		ENSG00000145016	ENSG00000145016	HGNC:28991													
SACS	gene	SACS	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia, Charlevoix-Saguenay type MIM#270550			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000151835	ENSG00000151835	HGNC:10519													
SAMD9L	gene	SAMD9L	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550			Ataxia;HP:0001251	35310830;33884299;28570036		False	3	100;0;0	2.7	False		ENSG00000177409	ENSG00000177409	HGNC:1349													
SCN1A	gene	SCN1A	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 6 (Dravet syndrome), MIM# 607208			Ataxia;HP:0001251	27264139;27817982;28732259		False	3	67;33;0	2.7	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN2A	gene	SCN2A	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Early infantile epileptic encephalopathy 11, MIM# 613721			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000136531	ENSG00000136531	HGNC:10588													
SCN8A	gene	SCN8A	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy 13, 614558;Cognitive impairment with or without cerebellar ataxia, 614306			Ataxia;HP:0001251	31904124;31887642;31675620		False	3	100;0;0	2.7	True		ENSG00000196876	ENSG00000196876	HGNC:10596													
SCYL1	gene	SCYL1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 21, 616719;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy			Ataxia;HP:0001251	29419818;17571074;26581903;30531813		False	3	100;0;0	2.7	True		ENSG00000142186	ENSG00000142186	HGNC:14372													
SETX	gene	SETX	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000107290	ENSG00000107290	HGNC:445													
SIL1	gene	SIL1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Marinesco-Sjogren syndrome, 248800			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000120725	ENSG00000120725	HGNC:24624													
SKOR2	gene	SKOR2	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Valence-Farazi cerebellar ataxia syndrome, MIM# 621386			Ataxia;HP:0001251	40890458;29997391;21937600		False	3	100;0;0	2.7	True		ENSG00000215474	ENSG00000215474	HGNC:32695													
SLC13A3	gene	SLC13A3	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384)			Ataxia;HP:0001251	https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID)		False	3	100;0;0	2.7	True		ENSG00000158296	ENSG00000158296	HGNC:14430													
SLC17A5	gene	SLC17A5	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Salla disease;Sialic acid storage disease, severe infantile type, MIM# 269920			Ataxia;HP:0001251	26171070		False	3	100;0;0	2.7	True		ENSG00000119899	ENSG00000119899	HGNC:10933													
SLC1A3	gene	SLC1A3	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Episodic ataxia, type 6;Episodic ataxia type 6, 612656			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000079215	ENSG00000079215	HGNC:10941													
SLC25A46	gene	SLC25A46	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary motor and sensory neuropathy type VIB, MIM#616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303			Ataxia;HP:0001251	30178502;26168012;27543974;27430653;27390132;28934388;28558379		False	3	100;0;0	2.7	True		ENSG00000164209	ENSG00000164209	HGNC:25198													
SLC2A1	gene	SLC2A1	Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	dystonia 9;GLUT1 deficiency syndrome 2, 612126;GLUT1 DEFICIENCY SYNDROME 1;paroxysmal exertion-induced dyskinesia with or without epilepsy and/or hemolytic anemia;GLUT1 deficiency syndrome 1, 606777;Dystonia 9, 601042;EPILEPSY, IDIOPATHIC GENERALIZED			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC44A1	gene	SLC44A1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset neurodegeneration;progressive ataxia tremor cognitive decline dysphagia optic atrophy dysarthria			Ataxia;HP:0001251	31855247		False	3	100;0;0	2.7	True		ENSG00000070214	ENSG00000070214	HGNC:18798													
SLC52A2	gene	SLC52A2	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bwon-Vialetto-Van Laere syndrome 2, 614707			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000185803	ENSG00000185803	HGNC:30224													
SLC9A1	gene	SLC9A1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lichtenstein-Knorr Syndrome, MIM#	616291"			Ataxia;HP:0001251	25205112;30018422;25760855		False	3	50;50;0	2.7	True		ENSG00000090020	ENSG00000090020	HGNC:11071													
SLC9A6	gene	SLC9A6	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mental retardation, X-linked syndromic, Christianson type, 300243			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000198689	ENSG00000198689	HGNC:11079													
SNAP25	gene	SNAP25	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Myasthenic syndrome, congenital, 18, 616330;cerebellar ataxia and seizures			Ataxia;HP:0001251	29491473;25381298;17283335		False	3	100;0;0	2.7	True		ENSG00000132639	ENSG00000132639	HGNC:11132													
SNX14	gene	SNX14	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia 20, 616354;Autosomal recessive spinocerebellar ataxia (#616354)			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000135317	ENSG00000135317	HGNC:14977													
SPG7	gene	SPG7	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPR	gene	SPR	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dopa-responsive dystonia due to sepiaterin reductase deficiency, 612716;Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPTAN1	gene	SPTAN1	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia MONDO:0957813			Ataxia;HP:0001251	36331550		False	3	100;0;0	2.7	True	Other	ENSG00000197694	ENSG00000197694	HGNC:11273													
SPTBN2	gene	SPTBN2	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 14, MIM#	615386;Spinocerebellar ataxia 5, MIM#	600224"			Ataxia;HP:0001251	23236289;23838597;22781464;31617442;31066025		False	3	100;0;0	2.7	True		ENSG00000173898	ENSG00000173898	HGNC:11276													
SQSTM1	gene	SQSTM1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145			Ataxia;HP:0001251	27545679		False	3	100;0;0	2.7	True		ENSG00000161011	ENSG00000161011	HGNC:11280													
SRD5A3	gene	SRD5A3	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kahrizi syndrome, 612713;Congenital disorder of glycosylation, type Iq, 612379;Congenital disorder of glycosylation type Iq, 612379			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000128039	ENSG00000128039	HGNC:25812													
STUB1	gene	STUB1	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 16, MIM#	615768"			Ataxia;HP:0001251	25258038;24742043		False	3	100;0;0	2.7	True		ENSG00000103266	ENSG00000103266	HGNC:11427													
SUFU	gene	SUFU	Expert Review Green;Literature;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Joubert syndrome 32, MIM#617757;Neurodevelopmental disorder, MONDO:0700092, SUFU-related			Ataxia;HP:0001251	33024317		False	3	100;0;0	2.7	True		ENSG00000107882	ENSG00000107882	HGNC:16466													
SVBP	gene	SVBP	Expert list;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, 618569			Ataxia;HP:0001251	31363758;30607023		False	3	100;0;0	2.7	True		ENSG00000177868	ENSG00000177868	HGNC:29204													
SYNE1	gene	SYNE1	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 8, MIM#	610743"			Ataxia;HP:0001251	23325900;27086870		False	3	100;0;0	2.7	True		ENSG00000131018	ENSG00000131018	HGNC:17089													
TBC1D23	gene	TBC1D23	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 11, 617695			Ataxia;HP:0001251	28823707;28823706		False	3	100;0;0	2.7	True		ENSG00000036054	ENSG00000036054	HGNC:25622													
TBCE	gene	TBCE	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, with amyotrophy and optic atrophy, OMIM #617207			Ataxia;HP:0001251	PubMed: 27666369		False	3	100;0;0	2.7	True		-	ENSG00000284770	HGNC:11582													
TCTN1	gene	TCTN1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 13, MIM#	614173"			Ataxia;HP:0001251	31302911;28631893;21725307;26477546;26489806		False	3	100;0;0	2.7	True		ENSG00000204852	ENSG00000204852	HGNC:26113													
TCTN2	gene	TCTN2	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 24, MIM#	616654"			Ataxia;HP:0001251	25118024;21565611		False	3	100;0;0	2.7	True		ENSG00000168778	ENSG00000168778	HGNC:25774													
TCTN3	gene	TCTN3	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 18, MIM# 614815;Orofaciodigital syndrome IV, MIM# 258860			Ataxia;HP:0001251	22883145;25118024		False	3	100;0;0	2.7	True		ENSG00000119977	ENSG00000119977	HGNC:24519													
TDP2	gene	TDP2	Expert list;Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 23			Ataxia;HP:0001251	31410782;30109272;24658003		False	3	100;0;0	2.7	True		ENSG00000111802	ENSG00000111802	HGNC:17768													
TINF2	gene	TINF2	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant dyskeratosis congenita 3, 613990;Revesz syndrome, 268130			Ataxia;HP:0001251	18252230;21477109;18979121		False	3	100;0;0	2.7	True		ENSG00000092330	ENSG00000092330	HGNC:11824													
TMEM106B	gene	TMEM106B	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypomyelinating leukodystrophy 16, 617964			Ataxia;HP:0001251	29186371;29444210		False	3	100;0;0	2.7	True		ENSG00000106460	ENSG00000106460	HGNC:22407													
TMEM216	gene	TMEM216	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 2, MIM#	608091"			Ataxia;HP:0001251	20036350;20512146		False	3	100;0;0	2.7	True		ENSG00000187049	ENSG00000187049	HGNC:25018													
TMEM237	gene	TMEM237	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 14, MIM#	614424"			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000155755	ENSG00000155755	HGNC:14432													
TMEM240	gene	TMEM240	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 21, MIM#	607454"			Ataxia;HP:0001251	25070513		False	3	100;0;0	2.7	True		ENSG00000205090	ENSG00000205090	HGNC:25186													
TMEM67	gene	TMEM67	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 6, MIM#	610688"			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000164953	ENSG00000164953	HGNC:28396													
TPP1	gene	TPP1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia 7, 609270;Neuronal ceroid lipofuscinosis, 204500;Spinocerebellar ataxia, autosomal recessive 7, 609270;Ceroid lipofuscinosis, neuronal, 2, 204500			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000166340	ENSG00000166340	HGNC:2073													
TSFM	gene	TSFM	Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 3			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000123297	ENSG00000123297	HGNC:12367													
TTBK2	gene	TTBK2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11			Ataxia;HP:0001251			False	3	50;50;0	2.7	False		ENSG00000128881	ENSG00000128881	HGNC:19141													
TTC19	gene	TTC19	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency nuclear type II, 615157;Mitochondrial complex III deficiency, nuclear type 2, 615157			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000011295	ENSG00000011295	HGNC:26006													
TTI1	gene	TTI1	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445			Ataxia;HP:0001251	26539891;30315573;36724785		False	3	50;25;25	2.7	True		ENSG00000101407	ENSG00000101407	HGNC:29029													
TTPA	gene	TTPA	Expert list;Expert Review Green;NHS GMS	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ataxia with isolated vitamin E deficiency, MIM#	277460"			Ataxia;HP:0001251			False	3	100;0;0	2.7	True		ENSG00000137561	ENSG00000137561	HGNC:12404													
TUBA4A	gene	TUBA4A	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic ataxia 11, autosomal dominant, MIM# 621226			Ataxia;HP:0001251	38884572;37418012		False	3	100;0;0	2.7	True	Other	ENSG00000127824	ENSG00000127824	HGNC:12407													
TUBB4A	gene	TUBB4A	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukodystrophy, hypomyelinating, 6, 612438;Dystonia 4, 128101, Hypomyelinating leukodystrophy 6, 612438;Dystonia 4, torsion, autosomal dominant, 128101			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000104833	ENSG00000104833	HGNC:20774													
TWNK	gene	TWNK	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 7, 271245;Ataxia Neuropathy Spectrum Disorders, Dominant;Progressive external ophthalmoplegia with mitochondrial DNA deletions, 609286;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, 609286;Perrault syndrome 5, 616138;Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), 271245;Spinocerebellar Ataxia, Recessive			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000107815	ENSG00000107815	HGNC:1160													
UBTF	gene	UBTF	Expert list;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701			Ataxia;HP:0001251	29300972		False	3	100;0;0	2.7	True		ENSG00000108312	ENSG00000108312	HGNC:12511													
UCHL1	gene	UCHL1	Expert list;Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 79, autosomal recessive, MIM#615491;Neurodegenerative disease, MONDO:0005559, UCHL1-related			Ataxia;HP:0001251	28007905;23359680;11555633;35986737		False	3	100;0;0	2.7	True		ENSG00000154277	ENSG00000154277	HGNC:12513													
UNC13A	gene	UNC13A	Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456			Ataxia;HP:0001251	27648472;28192369;41125872		False	3	100;0;0	2.7	True	Other	ENSG00000130477	ENSG00000130477	HGNC:23150													
VLDLR	gene	VLDLR	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, mental retardation and dysequilibirum syndrome 1, 224050;Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, 224050			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000147852	ENSG00000147852	HGNC:12698													
VPS13D	gene	VPS13D	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 4, MIM#	607317"			Ataxia;HP:0001251	29604224;29518281		False	3	100;0;0	2.7	True		ENSG00000048707	ENSG00000048707	HGNC:23595													
VPS41	gene	VPS41	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay			Ataxia;HP:0001251	32808683;33764426		False	3	100;0;0	2.7	True		ENSG00000006715	ENSG00000006715	HGNC:12713													
VWA3B	gene	VWA3B	Expert Review Green;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 22 MIM#616948			Ataxia;HP:0001251	26157035		False	3	50;0;50	2.7	True		ENSG00000168658	ENSG00000168658	HGNC:28385													
WARS2	gene	WARS2	Expert Review;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710			Ataxia;HP:0001251	29120065;31970218;34890876;28236339;28650581;28905505;30920170		False	3	100;0;0	2.7	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WDR73	gene	WDR73	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway Mowat syndrome, when patients are ambulant ataxia is a recognisednfeature;Galloway-Mowat Syndrome 1, 251300			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000177082	ENSG00000177082	HGNC:25928													
WDR81	gene	WDR81	Expert list;Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital hydrocephalus 3 with brain anomalies, 617967;Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Cerebellar ataxia, mental retardation and dysequilibrium syndrome 2, 610185			Ataxia;HP:0001251	21885617;28556411;28969387		False	3	33;0;67	2.7	True		ENSG00000167716	ENSG00000167716	HGNC:26600													
WFS1	gene	WFS1	Expert Review Green;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wolfram syndrome 1, 222300			Ataxia;HP:0001251	25211237		False	3	100;0;0	2.7	True		ENSG00000109501	ENSG00000109501	HGNC:12762													
WWOX	gene	WWOX	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia 12, 6143232;Early infantile epileptic encephalopathy 28, 616211;Autosomal recessive spinocerebellar ataxia 12, 614322			Ataxia;HP:0001251			False	3	100;0;0	2.7	False		ENSG00000186153	ENSG00000186153	HGNC:12799													
XRCC1	gene	XRCC1	Expert list;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 26 MIM#617633			Ataxia;HP:0001251	28002403;29472272		False	3	100;0;0	2.7	True		ENSG00000073050	ENSG00000073050	HGNC:12828													
ACBD5	gene	ACBD5	Expert list;Expert Review Amber;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy;syndromic cleft palate;ataxia;retinal dystrophy			Ataxia;HP:0001251	27799409;23105016		False	2	50;50;0	2.7	True		ENSG00000107897	ENSG00000107897	HGNC:23338													
ATG5	gene	ATG5	Expert Review Amber;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Spinocerebellar ataxia, autosomal recessive 25			Ataxia;HP:0001251	16625204;26812546		False	2	0;100;0	2.7	True		ENSG00000057663	ENSG00000057663	HGNC:589													
CAPN1	gene	CAPN1	Expert list;Expert Review Amber;Expert Review Green	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 76, autosomal recessive, 616907;MONDO:0014827			Ataxia;HP:0001251	27320912;29678961;30572172;31023339;31104286		False	2	50;50;0	2.7	False		ENSG00000014216	ENSG00000014216	HGNC:1476													
CCDC88C	gene	CCDC88C	Expert Review Amber;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	autosomal dominant spinocerebellar ataxia;?Spinocerebellar ataxia 40, 616053			Ataxia;HP:0001251	25062847;30398676		False	2	33;67;0	2.7	False		ENSG00000015133	ENSG00000015133	HGNC:19967													
CHP1	gene	CHP1	Expert Review Amber;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 9, autosomal recessive, OMIM #618438			Ataxia;HP:0001251	29379881;32787936		False	2	50;50;0	2.7	True		ENSG00000187446	ENSG00000187446	HGNC:17433													
HARS1	gene	HARS1	Expert Review Amber;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	multisystem ataxic syndrome			Ataxia;HP:0001251	32333447		False	2	33;67;0	2.7	True		ENSG00000170445	ENSG00000170445	HGNC:4816													
KCNQ2	gene	KCNQ2	Expert list;Expert Review Amber;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early infantile encephalopathy 7, 613720;Myokymia, 121200			Ataxia;HP:0001251	22169383;20962009;10575255		False	2	33;67;0	2.7	True		ENSG00000075043	ENSG00000075043	HGNC:6296													
MAPK8IP3	gene	MAPK8IP3	Expert Review Amber;Literature;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431			Ataxia;HP:0001251	30612693;30945334		False	2	0;100;0	2.7	True		ENSG00000138834	ENSG00000138834	HGNC:6884													
MKKS	gene	MKKS	Expert list;Expert Review Amber;Expert Review Green;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 6, 605231			Ataxia;HP:0001251	15637713		False	2	67;33;0	2.7	True		ENSG00000125863	ENSG00000125863	HGNC:7108													
MTNAP1	gene	MTNAP1	Expert Review Amber;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970			Ataxia;HP:0001251	41720819		False	2	0;100;0	2.7	True		ENSG00000141219	ENSG00000141219	HGNC:29601													
MTPAP	gene	MTPAP	Expert Review Amber;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Ataxia, spastic, 4,;Autosomal recessive spastic ataxia 4, 613672			Ataxia;HP:0001251	20970105;26319014;25008111		False	2	50;50;0	2.7	True		ENSG00000107951	ENSG00000107951	HGNC:25532													
MT-TC	gene	MT-TC	Expert list;Expert Review Amber	Ataxia		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TC-related			Ataxia;HP:0001251	8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363		False	2	0;100;0	2.7	True		ENSG00000210140	ENSG00000210140	HGNC:7477													
OGDH	gene	OGDH	Expert Review Amber;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary ataxia MONDO:0100309			Ataxia;HP:0001251	42266417		False	2	0;100;0	2.7	True	Other	ENSG00000105953	ENSG00000105953	HGNC:8124													
PCNA	gene	PCNA	ClinGen;Expert Review Amber	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary ataxia MONDO:0100309			Ataxia;HP:0001251	24911150, 33426167, 36990216		False	2	0;100;0	2.7	True		ENSG00000132646	ENSG00000132646	HGNC:8729													
PLD3	gene	PLD3	Expert Review Amber;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Spinocerebellar ataxia 46			Ataxia;HP:0001251	29053796;30312375;30312384;38059248		False	2	0;100;0	2.7	False		ENSG00000105223	ENSG00000105223	HGNC:17158													
PRKCG	gene	PRKCG	Expert Review;Expert Review Amber	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 14, MIM# 605361			Ataxia;HP:0001251	34292398		False	2	0;100;0	2.7	True		ENSG00000126583	ENSG00000126583	HGNC:9402													
PRPS1	gene	PRPS1	Expert Review Amber;Literature	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy			Ataxia;HP:0001251	33898739;28967191		False	2	0;100;0	2.7	False		ENSG00000147224	ENSG00000147224	HGNC:9462													
RFXANK	gene	RFXANK	Expert Review Amber;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive Ataxia and Neurologic Regression;MHC class II deficiency, complementation group B MIM#209920			Ataxia;HP:0001251	PMID: 33855173;23314770;28676232		False	2	50;50;0	2.7	True		ENSG00000064490	ENSG00000064490	HGNC:9987													
SDHA	gene	SDHA	Expert list;Expert Review Amber	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259			Ataxia;HP:0001251	10976639;27683074		False	2	0;100;0	2.7	False		ENSG00000073578	ENSG00000073578	HGNC:10680													
SIDT2	gene	SIDT2	Expert Review Amber;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysosomal storage disease, MONDO:0002561, SIDT2-related			Ataxia;HP:0001251	PMID: 40541391		False	2	0;100;0	2.7	True		ENSG00000149577	ENSG00000149577	HGNC:24272													
SYNGAP1	gene	SYNGAP1	Expert Review Amber;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant mental retardation 5, 612621			Ataxia;HP:0001251	26989088		False	2	0;100;0	2.7	True		ENSG00000197283	ENSG00000197283	HGNC:11497													
TDP1	gene	TDP1	Expert Review Amber;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250			Ataxia;HP:0001251	31182267;12244316;39576382		False	2	0;100;0	2.7	True		ENSG00000042088	ENSG00000042088	HGNC:18884													
THG1L	gene	THG1L	Expert Review Amber;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 28, MIM# 618800			Ataxia;HP:0001251	27307223;30214071;31168944		False	2	0;100;0	2.7	True		ENSG00000113272	ENSG00000113272	HGNC:26053													
TMEM138	gene	TMEM138	Expert Review Amber;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 16, MIM#	614465"			Ataxia;HP:0001251			False	2	0;100;0	2.7	True		ENSG00000149483	ENSG00000149483	HGNC:26944													
TMEM231	gene	TMEM231	Expert Review Amber;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 20, MIM# 614970;Meckel syndrome 11 615397			Ataxia;HP:0001251			False	2	0;100;0	2.7	True		ENSG00000205084	ENSG00000205084	HGNC:37234													
TRPC3	gene	TRPC3	Expert Review Amber;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown				Ataxia;HP:0001251	25477146;26112884		False	2	0;100;0	2.7	False		ENSG00000138741	ENSG00000138741	HGNC:12335													
UBA5	gene	UBA5	Expert Review Amber;GeneReviews;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Autosomal recessive spinocerebellar ataxia 24, 617133;Early infantile epileptic encephalopathy 44, 617132			Ataxia;HP:0001251	26872069;29902590		False	2	0;100;0	2.7	True		ENSG00000081307	ENSG00000081307	HGNC:23230													
UBR4	gene	UBR4	Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Episodic ataxia;Episodic ataxia type 8, 616055			Ataxia;HP:0001251	29062094;23982692;28600779		False	2	0;100;0	2.7	True		ENSG00000127481	ENSG00000127481	HGNC:30313													
VAMP1	gene	VAMP1	Expert Review Amber;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Autosomal dominant spastic ataxia 1, 108600;Spastic ataxia 1, autosomal dominant, 108600			Ataxia;HP:0001251	22958904		False	2	0;100;0	2.7	False		ENSG00000139190	ENSG00000139190	HGNC:12642													
VRK1	gene	VRK1	Expert list;Expert Review Amber	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 1A, 607596			Ataxia;HP:0001251	19646678;21937992;25609612;24126608;27281532		False	2	0;100;0	2.7	True		ENSG00000100749	ENSG00000100749	HGNC:12718													
ZFYVE26	gene	ZFYVE26	Expert Review Amber;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spastic paraplegia 15, 270700			Ataxia;HP:0001251	24367272;18394578		False	2	0;100;0	2.7	False		ENSG00000072121	ENSG00000072121	HGNC:20761													
AMPD2	gene	AMPD2	Expert Review Green;Expert Review Red;Other;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 9, 615809			Ataxia;HP:0001251			False	1	0;0;100	2.7	True		ENSG00000116337	ENSG00000116337	HGNC:469													
ARL6	gene	ARL6	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 3, 600151			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000113966	ENSG00000113966	HGNC:13210													
ARMC9	gene	ARMC9	Expert list;Expert Review Red;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 30, MIM#617622			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000135931	ENSG00000135931	HGNC:20730													
ATP1A2	gene	ATP1A2	Expert Review Red;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alternating hemiplegia of childhood 1, 104290;Familial hemiplegic migraine 2, 602481			Ataxia;HP:0001251			False	1	0;0;100	2.7	False		ENSG00000018625	ENSG00000018625	HGNC:800													
ATP7B	gene	ATP7B	Expert Review Red;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease 277900;Wilson disease, 277900			Ataxia;HP:0001251			False	1	0;0;100	2.7	False		ENSG00000123191	ENSG00000123191	HGNC:870													
BBS10	gene	BBS10	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 10, 615987			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000179941	ENSG00000179941	HGNC:26291													
BBS12	gene	BBS12	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 12, 615989			Ataxia;HP:0001251			False	1	100;0;0	2.7	True		ENSG00000181004	ENSG00000181004	HGNC:26648													
BBS2	gene	BBS2	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 2, 615981			Ataxia;HP:0001251	15637713		False	1	50;0;50	2.7	True		ENSG00000125124	ENSG00000125124	HGNC:967													
BBS4	gene	BBS4	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 4, 615982			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000140463	ENSG00000140463	HGNC:969													
BBS5	gene	BBS5	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 5, 615983			Ataxia;HP:0001251	15637713		False	1	50;0;50	2.7	True		ENSG00000163093	ENSG00000163093	HGNC:970													
BBS7	gene	BBS7	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 7, 615984			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000138686	ENSG00000138686	HGNC:18758													
BBS9	gene	BBS9	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 9, 615986			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000122507	ENSG00000122507	HGNC:30000													
CACNB4	gene	CACNB4	Expert list;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia type 5, 613855			Ataxia;HP:0001251	10762541;27003325;9628818		False	1	0;50;50	2.7	False		ENSG00000182389	ENSG00000182389	HGNC:1404													
CCDC28B	gene	CCDC28B	Expert list;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	Other	{Bardet-Biedl syndrome 1, modifier of}, 209900			Ataxia;HP:0001251			False	1	0;33;67	2.7	True		ENSG00000160050	ENSG00000160050	HGNC:28163													
CHCHD10	gene	CHCHD10	Expert Review Red;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532			Ataxia;HP:0001251	24934289		False	1	0;0;100	2.7	False		ENSG00000250479	ENSG00000250479	HGNC:15559													
CHMP1A	gene	CHMP1A	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 8, 614961			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000131165	ENSG00000131165	HGNC:8740													
CYP2U1	gene	CYP2U1	Expert list;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 56, autosomal recessive, 615030			Ataxia;HP:0001251			False	1	0;0;100	2.7	True		ENSG00000155016	ENSG00000155016	HGNC:20582													
DAB1	gene	DAB1	Expert list;Expert Review Red	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DAB1-related			Ataxia;HP:0001251	PMID: 33928188		False	1	33;33;33	2.7	True		ENSG00000173406	ENSG00000173406	HGNC:2661													
EEF2	gene	EEF2	Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Spinocerebellar ataxia 26			Ataxia;HP:0001251	15732118;23001565		False	1	0;0;0	2.7	False		ENSG00000167658	ENSG00000167658	HGNC:3214													
ELOVL1	gene	ELOVL1	Expert list;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, 618527			Ataxia;HP:0001251			False	1	0;33;67	2.7	True		ENSG00000066322	ENSG00000066322	HGNC:14418													
EXOSC3	gene	EXOSC3	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 1B, 614678			Ataxia;HP:0001251			False	1	100;0;0	2.7	True		ENSG00000107371	ENSG00000107371	HGNC:17944													
HARS2	gene	HARS2	Expert Review Red;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Perrault syndrome 2, MIM#	614926"			Ataxia;HP:0001251	31827252		False	1	0;0;100	2.7	True		ENSG00000112855	ENSG00000112855	HGNC:4817													
IFRD1	gene	IFRD1	Expert Review;Expert Review Red;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hereditary spastic paraplegia MONDO:0019064, IFRD1-related			Ataxia;HP:0001251	29362493;28601596;19409521		False	1	0;0;100	2.7	False		ENSG00000006652	ENSG00000006652	HGNC:5456													
MME	gene	MME	Expert Review Green;Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	?Spinocerebellar ataxia type 43, 617018			Ataxia;HP:0001251	27583304		False	1	0;0;100	2.7	False		ENSG00000196549	ENSG00000196549	HGNC:7154													
NEFM	gene	NEFM	Expert Review Red;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, MONDO:0000437			Ataxia;HP:0001251	41913087		False	1	0;0;100	2.7	True		ENSG00000104722	ENSG00000104722	HGNC:7734													
NOL3	gene	NOL3	Expert Review Red;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myoclonus, familial cortical			Ataxia;HP:0001251	22926851		False	1	0;0;100	2.7	False		ENSG00000140939	ENSG00000140939	HGNC:7869													
PAX6	gene	PAX6	Expert Review Red;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aniridia, 106210;Aniridia, Cerebellar Ataxia, And Mental Retardation			Ataxia;HP:0001251			False	1	50;0;50	2.7	False		ENSG00000007372	ENSG00000007372	HGNC:8620													
PCDH12	gene	PCDH12	Expert Review Green;Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	cerebellar ataxia, dystonia, retinopathy, and dysmorphism			Ataxia;HP:0001251	30459466		False	1	50;0;50	2.7	True		ENSG00000113555	ENSG00000113555	HGNC:8657													
PCYT2	gene	PCYT2	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy			Ataxia;HP:0001251	31637422		False	1	50;0;50	2.7	True		ENSG00000185813	ENSG00000185813	HGNC:8756													
PIK3R5	gene	PIK3R5	Expert Review Red;Literature;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-oculomotor apraxia 3, OMIM #615217			Ataxia;HP:0001251	PubMed: 22065524		False	1	0;0;100	2.7	True		ENSG00000141506	ENSG00000141506	HGNC:30035													
PRICKLE1	gene	PRICKLE1	Expert Review Red;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive myoclonic epilepsy 1B, 612437;Progressive Myoclonus Epilepsy with Ataxia			Ataxia;HP:0001251	20301774		False	1	0;0;100	2.7	True		ENSG00000139174	ENSG00000139174	HGNC:17019													
RARS2	gene	RARS2	Expert list;Expert Review Red	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 6, 611523;early onset cerebellar ataxia			Ataxia;HP:0001251	31429931;17847012;25809939;20635367		False	1	0;0;100	2.7	True		ENSG00000146282	ENSG00000146282	HGNC:21406													
SAR1B	gene	SAR1B	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chylomicron retention disease, 246700			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000152700	ENSG00000152700	HGNC:10535													
SEPSECS	gene	SEPSECS	Expert list;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2D, 613811;cerebellar ataxia and cognitive impairment			Ataxia;HP:0001251	29464431		False	1	0;0;100	2.7	False		ENSG00000109618	ENSG00000109618	HGNC:30605													
SLC27A3	gene	SLC27A3	Expert Review Red;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Inherited neurodegenerative disorder, MONDO:0024237, SLC27A3-related			Ataxia;HP:0001251	PMID: 41054338		False	1	0;0;100	2.7	True		ENSG00000143554	ENSG00000143554	HGNC:10997													
SYT14	gene	SYT14	Expert Review Red;GeneReviews;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Spinocerebellarataxia,autosomalrecessive11,614229			Ataxia;HP:0001251	21835308		False	1	0;0;100	2.7	False		ENSG00000143469	ENSG00000143469	HGNC:23143													
TGM6	gene	TGM6	Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 35, 613908;Spinocerebellar ataxia 35			Ataxia;HP:0001251	25253745;21106500;28934387;22554020;30670339;29053796;23206699		False	1	0;0;100	2.7	False		ENSG00000166948	ENSG00000166948	HGNC:16255													
TPR	gene	TPR	Expert Review Red;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 79, MIM# 620393			Ataxia;HP:0001251	34494102		False	1	0;0;100	2.7	True		ENSG00000047410	ENSG00000047410	HGNC:12017													
TRIM32	gene	TRIM32	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, autosomal recessive 8, 254110;?Bardet-Biedl syndrome 11, 615988			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000119401	ENSG00000119401	HGNC:16380													
TSEN2	gene	TSEN2	Expert list;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2B, 612389			Ataxia;HP:0001251			False	1	0;0;100	2.7	True		ENSG00000154743	ENSG00000154743	HGNC:28422													
TSEN34	gene	TSEN34	Expert list;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Pontocerebellar hypoplasia type 2C, 612390			Ataxia;HP:0001251			False	1	0;0;100	2.7	True		ENSG00000170892	ENSG00000170892	HGNC:15506													
TSEN54	gene	TSEN54	Expert list;Expert Review Red	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	adult-onset cerebellar ataxia			Ataxia;HP:0001251	24938831		False	1	0;0;100	2.7	False		ENSG00000182173	ENSG00000182173	HGNC:27561													
TTC8	gene	TTC8	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 8, 615985			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000165533	ENSG00000165533	HGNC:20087													
TUBA1A	gene	TUBA1A	Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lissencephaly 3, 611603			Ataxia;HP:0001251	21403111		False	1	67;0;33	2.7	True		ENSG00000167552	ENSG00000167552	HGNC:20766													
TUBB2A	gene	TUBB2A	Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	?progressive spastic ataxia syndrome resembling sacsinopathy;Complex cortical dysplasia with other brain malformations 5, 615763			Ataxia;HP:0001251	29547997;32203252		False	1	50;0;50	2.7	True		ENSG00000137267	ENSG00000137267	HGNC:12412													
WDPCP	gene	WDPCP	Expert list;Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Bardet-Biedl syndrome 15, 615992;?Congenital heart defects, hamartomas of tongue, and polysyndactyly, 217085			Ataxia;HP:0001251			False	1	50;0;50	2.7	True		ENSG00000143951	ENSG00000143951	HGNC:28027													
ZNF423	gene	ZNF423	Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Nephronophthisis 14			Ataxia;HP:0001251			False	1	0;33;67	2.7	True		ENSG00000102935	ENSG00000102935	HGNC:16762													
ZNF592	gene	ZNF592	Expert Review Red;Royal Melbourne Hospital	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 5;Galloway-Mowat Syndrome 1, 251300			Ataxia;HP:0001251	20531441;26123727		False	1	0;0;100	2.7	True		ENSG00000166716	ENSG00000166716	HGNC:28986													
ATN1_DRPLA_CAG	str	ATN1	Expert Review Green;Expert List	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370			Ataxia;HP:0001251	29325606;20301664		False	3	100;0;0	2.7	True		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
ATXN10_SCA10_ATTCT	str	ATXN10	Expert Review Green;Expert List	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 10 MIM#603516			Ataxia;HP:0001251	20301354		False	3	100;0;0	2.7	True		ENSG00000130638	ENSG00000130638	HGNC:10549	22	46191235	46191304	45795355	45795424	ATTCT	32	800					
ATXN1_SCA1_CAG	str	ATXN1	Expert Review Green;Expert List	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 1 MIM#164400			Ataxia;HP:0001251	29325606;20301363		False	3	100;0;0	2.7	True		ENSG00000124788	ENSG00000124788	HGNC:10548	6	16327918	16327953	16327687	16327722	CAG	35	39					
ATXN2_SCA2_CAG	str	ATXN2	Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia type 2 MONDO:0008458			Ataxia;HP:0001251	40741828		False	3	100;0;0	2.7	True		ENSG00000204842	ENSG00000204842	HGNC:10555	12	112036755	112036823	111598951	111599019	CAG	31	35					
ATXN3_SCA3_CAG	str	ATXN3	Expert Review Green;Expert List	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3			Ataxia;HP:0001251	20301375;29325606		False	3	100;0;0	2.7	True		ENSG00000066427	ENSG00000066427	HGNC:7106	14	92537355	92537396	92071011	92071052	CAG	44	60					
ATXN7_SCA7_CAG	str	ATXN7	Expert Review Green;Expert List	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 7 MIM#164500			Ataxia;HP:0001251	29325606;20301433		False	3	100;0;0	2.7	True		ENSG00000163635	ENSG00000163635	HGNC:10560	3	63898362	63898391	63912686	63912715	CAG	27	37					
ATXN8OS_SCA8_CTG	str	ATXN8OS	Expert Review Green;Expert List	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 8 MIM#608768			Ataxia;HP:0001251	20301445		False	3	100;0;0	2.7	True		ENSG00000230223	ENSG00000230223	HGNC:10561	13	70713486	70713560	70139354	70139422	CTG	50	80					
BEAN1_SCA31_TGGAA	str	BEAN1	Expert Review Green;Expert List	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 31 MIM#117210			Ataxia;HP:0001251	19878914;31755042		False	3	100;0;0	2.7	True		ENSG00000166546	ENSG00000166546	HGNC:24160	16	66524300	66524369	66490397	66490466	TGGAA	22	80					
CACNA1A_SCA6_CAG	str	CACNA1A	Expert Review Green;Expert List	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500			Ataxia;HP:0001251	20301319;29325606		False	3	100;0;0	2.7	True		ENSG00000141837	ENSG00000141837	HGNC:1388	19	13318673	13318691	13207859	13207897	CAG	18	20					
CSTB_EPM1_CCCCGCCCCGCG	str	CSTB	Literature;Expert Review Green;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800			Ataxia;HP:0001251	29325606;20301321		False	3	100;0;0	2.7	False		ENSG00000160213	ENSG00000160213	HGNC:2482	21	45196325	45196360	43776444	43776479	CCCCGCCCCGCG	3	30					
DAB1_SCA37_ATTTC	str	DAB1	Literature;Expert Review Green;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 37 MIM#615945			Ataxia;HP:0001251	28686858;31145571		False	3	100;0;0	2.7	False		ENSG00000173406	ENSG00000173406	HGNC:2661	1	57832716	57832797	57367044	57367121	ATTTC	0	31					
FGF14_SCA27B_GAA	str	FGF14	Literature;Expert Review Green;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs)			Ataxia;HP:0001251	37165652;36516086;36493768		False	3	100;0;0	2.7	False		ENSG00000102466	ENSG00000102466	HGNC:3671	13	102813926	102814076	102161576	102161726	GAA	249	300					
FMR1_FXTAS_CGG	str	FMR1	Expert list;Expert Review Green;Expert Review Green;Expert list	Ataxia		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Fragile X tremor/ataxia syndrome MIM#300623			Ataxia;HP:0001251	23765048;25227148		False	3	100;0;0	2.7	False		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	55					
FXN_FRDA_GAA	str	FXN	Expert list;Expert Review Green;Expert Review Green;Expert list	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300			Ataxia;HP:0001251	20301458		False	3	100;0;0	2.7	False		ENSG00000165060	ENSG00000165060	HGNC:3951	9	71652203	71652220	69037287	69037304	GAA	33	66					
NOP56_SCA36_GGCCTG	str	NOP56	Expert list;Expert Review Green;Expert Review Green;Expert list	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 36 MIM#614153			Ataxia;HP:0001251	21683323		False	3	100;0;0	2.7	False		ENSG00000101361	ENSG00000101361	HGNC:15911	20	2633380	2633403	2652734	2652757	GGCCTG	14	650					
PPP2R2B_SCA12_CAG	str	PPP2R2B	Expert list;Expert Review Green;Expert Review Green;Expert list	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 12 MIM#604326			Ataxia;HP:0001251	27864267;33811808		False	3	100;0;0	2.7	False		ENSG00000156475	ENSG00000156475	HGNC:9305	5	146258292	146258321	146878729	146878758	CAG	32	51					
PRNP_CJD_octapeptide	str	PRNP	Literature;Expert Review Green;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440			Ataxia;HP:0001251	2159587;20301407		False	3	100;0;0	2.7	False		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699424	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
RFC1_CANVAS_ANNGN	str	RFC1	Expert list;Expert Review Green;Expert Review Green;Expert list	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575			Ataxia;HP:0001251	30926972		False	3	100;0;0	2.7	False		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	ANNGN	0	400					
TBP_SCA17_CAG	str	TBP	Expert list;Expert Review Green;Expert Review Green;Expert list	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136			Ataxia;HP:0001251	20301611;29325606		False	3	100;0;0	2.7	False		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
ZFHX3_SCA4_GGC	str	ZFHX3	Literature;Expert Review Green;Expert Review Green;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	spinocerebellar ataxia type 4 MONDO:0010847			Ataxia;HP:0001251	38035881;38197134		False	3	100;0;0	2.7	False		ENSG00000140836	ENSG00000140836	HGNC:777	16	72821594	72821657	72787695	72787758	GGC	30	48					
THAP11_SCA51_CAG	str	THAP11	Literature;Expert Review Amber;Expert Review Amber;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 51 MONDO:0975800			Ataxia;HP:0001251	15368101;24677642;34165550;38113319;40459937;39651830;37148549		False	2	0;100;0	2.7	False		ENSG00000168286	ENSG00000168286	HGNC:23194	16	67876766	67876853	67842863	67842950	CAG	39	47					
ISCA-37404-Loss	region		Expert Review Green;Expert list;Expert list	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Angelman syndrome, MIM#	105830;Prader-Willi syndrome, MIM#	176270"			Ataxia;HP:0001251	20301323;20301505		False	3	100;0;0	2.7	True					15			22782170	28134729				3		80	cnv_loss	Angelman and Prader-Willi syndromes
ISCA-37405-Loss	region	NPHP1	Expert Review Green;Expert list;Expert list	Ataxia		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Nephronophthisis 1, juvenile, MIM#	256100;Joubert syndrome 4, MIM#	609583;Senior-Loken syndrome 1, MIM#	266900"			Ataxia;HP:0001251	29146700		False	3	100;0;0	2.7	True		ENSG00000144061	ENSG00000144061	HGNC:7905	2			110122329	110205017				3		80	cnv_loss	NPHP1 deletion
LMNB1 upstream region	region		Expert Review Green;Literature;Literature	Ataxia		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Adult-onset autosomal dominant demyelinating leukodystrophy, MONDO:0008215			Ataxia;HP:0001251	PMID: 30842973;30697589;25701871		False	3	100;0;0	2.7	False					5			126522203	126689287						80	cnv_loss	LMNB1 upstream region
