Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name ACBD6 gene ACBD6 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 Dystonia;HP:0001332; Chorea;HP:0002072 37951597 False 3 100;0;0 0.346 True ENSG00000230124 ENSG00000230124 HGNC:23339 ACTB gene ACTB Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Baraitser-Winter syndrome 1, 243310;Dystonia, juvenile-onset, 607371 Dystonia;HP:0001332; Chorea;HP:0002072 29788902;28487785 False 3 100;0;0 0.346 True Other ENSG00000075624 ENSG00000075624 HGNC:132 ADAR gene ADAR Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dystonia;Aicardi-Goutieres syndrome 6, 615010 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 False ENSG00000160710 ENSG00000160710 HGNC:225 ADCY5 gene ADCY5 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651 Dystonia;HP:0001332; Chorea;HP:0002072 22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617 False 3 100;0;0 0.346 False ENSG00000173175 ENSG00000173175 HGNC:236 ANO3 gene ANO3 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 24, 615034;familial form of cranio-cervical dystonia Dystonia;HP:0001332; Chorea;HP:0002072 33388357 False 3 100;0;0 0.346 False ENSG00000134343 ENSG00000134343 HGNC:14004 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-oculomotor apraxia type 1;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 15876520 False 3 100;0;0 0.346 True ENSG00000137074 ENSG00000137074 HGNC:15984 ARSA gene ARSA Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM#250100 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 True ENSG00000100299 ENSG00000100299 HGNC:713 ARX gene ARX Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Partington syndrome, MIM# 309510;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 11889467;15200506 False 3 100;0;0 0.346 True Other ENSG00000004848 ENSG00000004848 HGNC:18060 ATM gene ATM Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia telangiectasia;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 False ENSG00000149311 ENSG00000149311 HGNC:795 ATP13A2 gene ATP13A2 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 Dystonia;HP:0001332; Chorea;HP:0002072 21094623;20853184;20310007 False 3 100;0;0 0.346 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP1A3 gene ATP1A3 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 Dystonia;HP:0001332; Chorea;HP:0002072 15260953;17282997;19351654, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 0.346 False ENSG00000105409 ENSG00000105409 HGNC:801 ATP2B2 gene ATP2B2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 37675773 False 3 100;0;0 0.346 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157087 ENSG00000157087 HGNC:815 ATP5A1 gene ATP5A1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD Dystonia;HP:0001332; Chorea;HP:0002072 34483339;34954817;40859057 False 3 100;0;0 0.346 True ENSG00000152234 ENSG00000152234 HGNC:823 ATP5G3 gene ATP5G3 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Dystonia, early-onset, and/or spastic paraplegia, MIM# 619681" Dystonia;HP:0001332; Chorea;HP:0002072 34636445;34954817 False 3 100;0;0 0.346 True ENSG00000154518 ENSG00000154518 HGNC:843 ATP7B gene ATP7B Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease, MIM# 277900;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 32662046 False 3 100;0;0 0.346 True ENSG00000123191 ENSG00000123191 HGNC:870 AUH gene AUH Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-Methylglutaconic aciduria type 1;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 True ENSG00000148090 ENSG00000148090 HGNC:890 BCAP31 gene BCAP31 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Deafness, dystonia and cerebellar hypomyelination, MIM#300475 Dystonia;HP:0001332; Chorea;HP:0002072 24011989;28332767;30713915;31330203;32652807 False 3 100;0;0 0.346 True ENSG00000185825 ENSG00000185825 HGNC:16695 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal neurodegeneration with brain iron accumulation 4 MONDO:0013674 Dystonia;HP:0001332; Chorea;HP:0002072 21981780;22508347 False 3 100;0;0 0.346 True ENSG00000131943 ENSG00000131943 HGNC:25443 C9orf3 gene C9orf3 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Dystonia 31, MIM# 619565" Dystonia;HP:0001332; Chorea;HP:0002072 34596301 False 3 100;0;0 0.346 False ENSG00000148120 ENSG00000148120 HGNC:1361 CACNA1A gene CACNA1A Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500;Spinocerebellar ataxia 6 MIM#183086 Dystonia;HP:0001332; Chorea;HP:0002072 25468264;23441182;19232643;18758887;11344116 False 3 100;0;0 0.346 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1G gene CACNA1G Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM# 618087" Dystonia;HP:0001332; Chorea;HP:0002072 29878067 False 3 100;0;0 0.346 True ENSG00000006283 ENSG00000006283 HGNC:1394 CAMK4 gene CAMK4 Expert Review;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;Autism;Behavioral abnormality;Abnormality of movement;Dystonia;Ataxia;Chorea;Myoclonus Dystonia;HP:0001332; Chorea;HP:0002072 30262571;33098801;33211350 False 3 100;0;0 0.346 True ENSG00000152495 ENSG00000152495 HGNC:1464 CLN3 gene CLN3 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ceroid lipofuscinosis, neuronal, 3 204200" Dystonia;HP:0001332; Chorea;HP:0002072 19353721 False 3 100;0;0 0.346 True ENSG00000188603 ENSG00000188603 HGNC:2074 COASY gene COASY Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodegeneration with brain iron accumulation 6, MONDO:0014290;Neurodegeneration with brain iron accumulation 6 615643 Dystonia;HP:0001332; Chorea;HP:0002072 23447832;24360804;27021474 False 3 100;0;0 0.346 True ENSG00000068120 ENSG00000068120 HGNC:29932 COQ8A gene COQ8A Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Coenzyme Q10 deficiency, primary, 4, MIM# 612016" Dystonia;HP:0001332; Chorea;HP:0002072 32337771 False 3 100;0;0 0.346 True ENSG00000163050 ENSG00000163050 HGNC:16812 CP gene CP Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminaemia, MIM#604290 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 True ENSG00000047457 ENSG00000047457 HGNC:2295 CYP27A1 gene CYP27A1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, MIM# 213700;Cholestanol storage disease;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 19373932;21531161;25424010 False 3 100;0;0 0.346 True ENSG00000135929 ENSG00000135929 HGNC:2605 DCAF17 gene DCAF17 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Woodhouse-Sakati syndrome MONDO:0009419;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 18175354;36185913;17167799 False 3 100;0;0 0.346 True ENSG00000115827 ENSG00000115827 HGNC:25784 DDC gene DDC Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aromatic L-amino acid decarboxylase deficiency, 608643;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 20505134 False 3 100;0;0 0.346 True ENSG00000132437 ENSG00000132437 HGNC:2719 DLAT gene DLAT Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase E2 deficiency 245348;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 39007626;20022530;16049940 False 3 100;0;0 0.346 True ENSG00000150768 ENSG00000150768 HGNC:2896 DNAJC12 gene DNAJC12 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, mild, non-BH4-deficient, 617384 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 True ENSG00000108176 ENSG00000108176 HGNC:28908 DRD2 gene DRD2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Combined dystonia, MONDO:0020065, DRD2-related;dystonia;chorea;anxiety;ataxia;orofacial dyskinesia;tremor;memory problems Dystonia;HP:0001332; Chorea;HP:0002072 33200438 False 3 100;0;0 0.346 True Other ENSG00000149295 ENSG00000149295 HGNC:3023 ECHS1 gene ECHS1 Expert Review;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277" Dystonia;HP:0001332; Chorea;HP:0002072 32677093;32858208 False 3 100;0;0 0.346 True ENSG00000127884 ENSG00000127884 HGNC:3151 EIF2AK2 gene EIF2AK2 Expert Review;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness;early onset dystonia Dystonia;HP:0001332; Chorea;HP:0002072 33236446;33866603 False 3 100;0;0 0.346 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF4A2 gene EIF4A2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455 Dystonia;HP:0001332; Chorea;HP:0002072 37485550 False 3 100;0;0 0.346 True ENSG00000156976 ENSG00000156976 HGNC:3284 EPG5 gene EPG5 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506 Dystonia;HP:0001332; Chorea;HP:0002072 41053928;36410285;40192014 False 3 100;0;0 0.346 True ENSG00000152223 ENSG00000152223 HGNC:29331 FA2H gene FA2H Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia;Spastic paraplegia 35, autosomal recessive 612319;fatty acid hydroxylase-associated neurodegeneration Dystonia;HP:0001332; Chorea;HP:0002072 19068277;20104589;20853438;31135052 False 3 100;0;0 0.346 True ENSG00000103089 ENSG00000103089 HGNC:21197 FBXO28 gene FBXO28 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 100, MIM# 619777 Dystonia;HP:0001332; Chorea;HP:0002072 33280099 False 3 100;0;0 0.346 True ENSG00000143756 ENSG00000143756 HGNC:29046 FBXO7 gene FBXO7 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile parkinsonism;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000100225 ENSG00000100225 HGNC:13586 FITM2 gene FITM2 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Siddiqi syndrome MIM#618635;dystonia;deafness Dystonia;HP:0001332; Chorea;HP:0002072 28067622;30214770;30288795 False 3 100;0;0 0.346 True ENSG00000197296 ENSG00000197296 HGNC:16135 FOXG1 gene FOXG1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Rett syndrome, congenital variant;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 27029630 False 3 100;0;0 0.346 True ENSG00000176165 ENSG00000176165 HGNC:3811 FTL gene FTL Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodegeneration with brain iron accumulation 3, MIM# 606159 Dystonia;HP:0001332; Chorea;HP:0002072 11438811;15099026;12746423;18413574 False 3 100;0;0 0.346 True ENSG00000087086 ENSG00000087086 HGNC:3999 FUCA1 gene FUCA1 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fucosidosis, MIM#230000 Dystonia;HP:0001332; Chorea;HP:0002072 31064022 False 3 100;0;0 0.346 True ENSG00000179163 ENSG00000179163 HGNC:4006 GABRB2 gene GABRB2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631 Dystonia;HP:0001332; Chorea;HP:0002072 38996765 False 3 100;0;0 0.346 True Other ENSG00000145864 ENSG00000145864 HGNC:4082 GABRB3 gene GABRB3 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 43 MIM#617113 Dystonia;HP:0001332; Chorea;HP:0002072 37647766 False 3 100;0;0 0.346 False Other ENSG00000166206 ENSG00000166206 HGNC:4083 GALT gene GALT Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Galactosemia, MIM#230400" Dystonia;HP:0001332; Chorea;HP:0002072 30718057 False 3 100;0;0 0.346 True ENSG00000213930 ENSG00000213930 HGNC:4135 GAMT gene GAMT Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral creatine deficiency syndrome 2 MIM#612736 Dystonia;HP:0001332; Chorea;HP:0002072 19027335;33996490;12557293;19288536;16855203 False 3 50;0;50 0.346 True ENSG00000130005 ENSG00000130005 HGNC:4136 GBA gene GBA Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Gaucher disease, type III, MIM# 231000" Dystonia;HP:0001332; Chorea;HP:0002072 27789132 False 3 100;0;0 0.346 True ENSG00000177628 ENSG00000177628 HGNC:4177 GCDH gene GCDH Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal glutaryl-CoA dehydrogenase deficiency MONDO:0009281 Dystonia;HP:0001332; Chorea;HP:0002072 32777384;21912879;31536184 False 3 100;0;0 0.346 True ENSG00000105607 ENSG00000105607 HGNC:4189 GCH1 gene GCH1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230 Dystonia;HP:0001332; Chorea;HP:0002072 7874165;11113234;15753436 False 3 100;0;0 0.346 False ENSG00000131979 ENSG00000131979 HGNC:4193 GJC2 gene GJC2 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 2, MIM# 608804" Dystonia;HP:0001332; Chorea;HP:0002072 15192806;18094336 False 3 100;0;0 0.346 True ENSG00000198835 ENSG00000198835 HGNC:17494 GLB1 gene GLB1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1 gangliosidosis type 3 MONDO:0009262 Dystonia;HP:0001332; Chorea;HP:0002072 24156116;35937492;34514040;1353343 False 3 100;0;0 0.346 True ENSG00000170266 ENSG00000170266 HGNC:4298 GM2A gene GM2A Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, AB variant, MIM#272750 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 True ENSG00000196743 ENSG00000196743 HGNC:4367 GNAL gene GNAL Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 25, MIM# 615073;MONDO:0014033 Dystonia;HP:0001332; Chorea;HP:0002072 23222958;33175450;32180288 False 3 100;0;0 0.346 False ENSG00000141404 ENSG00000141404 HGNC:4388 GNAO1 gene GNAO1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with involuntary movements, 617493 Dystonia;HP:0001332; Chorea;HP:0002072 28747448;30682224 False 3 100;0;0 0.346 True Other ENSG00000087258 ENSG00000087258 HGNC:4389 GNB1 gene GNB1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 42, MIM# 616973;Myoclonus dystonia Dystonia;HP:0001332; Chorea;HP:0002072 30194818;27108799;27668284;31034681 False 3 100;0;0 0.346 True ENSG00000078369 ENSG00000078369 HGNC:4396 GRIN1 gene GRIN1 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 Dystonia;HP:0001332; Chorea;HP:0002072 29365063;27164704;27164704;28051072 False 3 100;0;0 0.346 True ENSG00000176884 ENSG00000176884 HGNC:4584 GRN gene GRN Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM#607485" Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 True ENSG00000030582 ENSG00000030582 HGNC:4601 GSX2 gene GSX2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Diencephalic-mesencephalic junction dysplasia syndrome 2 618646;Intellectual disability;Dystonia;Spastic tetra paresis" Dystonia;HP:0001332; Chorea;HP:0002072 31412107;39119454 False 3 100;0;0 0.346 True ENSG00000180613 ENSG00000180613 HGNC:24959 GTPBP2 gene GTPBP2 Expert Review;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Jaberi-Elahi syndrome, MIM#617988 Dystonia;HP:0001332; Chorea;HP:0002072 26675814;29449720;30790272 False 3 100;0;0 0.346 True ENSG00000172432 ENSG00000172432 HGNC:4670 HIBCH gene HIBCH Expert Review;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620" Dystonia;HP:0001332; Chorea;HP:0002072 26026795;25251209;24299452;32677093 False 3 100;0;0 0.346 True ENSG00000198130 ENSG00000198130 HGNC:4908 HPCA gene HPCA Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 2, torsion, autosomal recessive, 224500;MONDO:0009141;childhood-onset generalized dystonia;adolescence-onset segmental dystonia;generalized dystonia with additional neurological features Dystonia;HP:0001332; Chorea;HP:0002072 25799108;30991467;30145809 False 3 100;0;0 0.346 False ENSG00000121905 ENSG00000121905 HGNC:5144 HPRT1 gene HPRT1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Lesch-Nyhan syndrome;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 20301328 False 3 100;0;0 0.346 True ENSG00000165704 ENSG00000165704 HGNC:5157 HTRA2 gene HTRA2 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria type 8 MONDO:0044723 Dystonia;HP:0001332; Chorea;HP:0002072 27208207;27696117;30114719 False 3 50;50;0 0.346 True ENSG00000115317 ENSG00000115317 HGNC:14348 IMPDH2 gene IMPDH2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dystonia Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 33098801 False 3 100;0;0 0.346 True ENSG00000178035 ENSG00000178035 HGNC:6053 IRF2BPL gene IRF2BPL Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures 618088 Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 30057031;30166628 False 3 100;0;0 0.346 True ENSG00000119669 ENSG00000119669 HGNC:14282 KCNMA1 gene KCNMA1 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy MIM#609446 Dystonia;HP:0001332; Chorea;HP:0002072 26195193;15937479;29356177 False 3 100;0;0 0.346 False Other ENSG00000156113 ENSG00000156113 HGNC:6284 KCNN2 gene KCNN2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 34, myoclonic, MIM#619724;Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 Dystonia;HP:0001332; Chorea;HP:0002072 32212350;33242881 False 3 100;0;0 0.346 False ENSG00000080709 ENSG00000080709 HGNC:6291 KCTD17 gene KCTD17 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Dystonia 26, myoclonic MIM#616398 Dystonia;HP:0001332; Chorea;HP:0002072 25983243;30642807;30579817 False 3 100;0;0 0.346 False ENSG00000100379 ENSG00000100379 HGNC:25705 KIF1A gene KIF1A Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia;spastic paraplegia;intellectual disability Dystonia;HP:0001332; Chorea;HP:0002072 32096284;32935419 False 3 100;0;0 0.346 False ENSG00000130294 ENSG00000130294 HGNC:888 KMT2B gene KMT2B Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted early-onset dystonia;Dystonia 28, childhood-onset 617284;MONDO:0015004 Dystonia;HP:0001332; Chorea;HP:0002072 27839873;27992417 False 3 100;0;0 0.346 False ENSG00000272333 ENSG00000272333 HGNC:15840 L2HGDH gene L2HGDH Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal L-2-hydroxyglutaric aciduria MIM#236792 Dystonia;HP:0001332; Chorea;HP:0002072 24753671;18780161;15824270;10399870 False 3 100;0;0 0.346 True ENSG00000087299 ENSG00000087299 HGNC:20499 MARS2 gene MARS2 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 Dystonia;HP:0001332; Chorea;HP:0002072 16672289;22448145 False 3 100;0;0 0.346 True ENSG00000247626 ENSG00000247626 HGNC:25133 MECR gene MECR Expert Review;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities, MIM# 617282;MONDO:0015003 Dystonia;HP:0001332; Chorea;HP:0002072 27817865;33401012;31137067;31070877 False 3 100;0;0 0.346 True ENSG00000116353 ENSG00000116353 HGNC:19691 MED27 gene MED27 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual disability;cerebellar hypoplasia;dystonia Dystonia;HP:0001332; Chorea;HP:0002072 33443317 False 3 100;0;0 0.346 False ENSG00000160563 ENSG00000160563 HGNC:2377 MT-ND3 gene MT-ND3 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND3-related Dystonia;HP:0001332; Chorea;HP:0002072 1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403 False 3 100;0;0 0.346 False ENSG00000198840 ENSG00000198840 HGNC:7458 MT-TV gene MT-TV Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related Dystonia;HP:0001332; Chorea;HP:0002072 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 0.346 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TW gene MT-TW Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related Dystonia;HP:0001332; Chorea;HP:0002072 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 0.346 True ENSG00000210117 ENSG00000210117 HGNC:7501 NAA15 gene NAA15 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787 Dystonia;HP:0001332; Chorea;HP:0002072 38380600;36221186;35730864 False 3 100;0;0 0.346 True ENSG00000164134 ENSG00000164134 HGNC:30782 NACC1 gene NACC1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted chorea;dystonia;epilepsy;microcephaly;cataracts;dysautonomia;iron deficiency anemia;stereotypies Dystonia;HP:0001332; Chorea;HP:0002072 38698576 False 3 100;0;0 0.346 True ENSG00000160877 ENSG00000160877 HGNC:20967 NIT1 gene NIT1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brain small vessel disease 4, MIM# 621313 Dystonia;HP:0001332; Chorea;HP:0002072 38430071 False 3 100;0;0 0.346 False ENSG00000158793 ENSG00000158793 HGNC:7828 NKX2-1 gene NKX2-1 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chorea, hereditary benign MIM#118700;Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978 Dystonia;HP:0001332; Chorea;HP:0002072 24714694;30186310 False 3 100;0;0 0.346 True ENSG00000136352 ENSG00000136352 HGNC:11825 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy MIM#617560 Dystonia;HP:0001332; Chorea;HP:0002072 30285346;28575651;28969374 False 3 100;0;0 0.346 True ENSG00000148826 ENSG00000148826 HGNC:19321 NPC1 gene NPC1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 MONDO:0009757 Dystonia;HP:0001332; Chorea;HP:0002072 12555942;20301473 False 3 100;0;0 0.346 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC2 gene NPC2 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C2 MONDO:0011873;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 34993563;17470133 False 3 100;0;0 0.346 True ENSG00000119655 ENSG00000119655 HGNC:14537 NR4A2 gene NR4A2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 Dystonia;HP:0001332; Chorea;HP:0002072 31922365 False 3 100;0;0 0.346 True ENSG00000153234 ENSG00000153234 HGNC:7981 OPA3 gene OPA3 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, MIM# 258501;developmental delay, hypotonia;dystonia and chorea;ataxia, optic atrophy;spastic paraplegia Dystonia;HP:0001332; Chorea;HP:0002072 20301646;7510656;2494568;11668429 False 3 100;0;0 0.346 True ENSG00000125741 ENSG00000125741 HGNC:8142 PAH gene PAH Expert Review;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phenylketonuria MIM#261600 Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 25614310, PMID: 15390012, PMID: 30369906 False 3 100;0;0 0.346 True ENSG00000171759 ENSG00000171759 HGNC:8582 PANK2 gene PANK2 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pantothenate kinase-associated neurodegeneration MONDO:0009319;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 15911822 False 3 100;0;0 0.346 True ENSG00000125779 ENSG00000125779 HGNC:15894 PARK7 gene PARK7 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Parkinson disease 7, autosomal recessive early-onset MIM#606324" Dystonia;HP:0001332; Chorea;HP:0002072 29644727 False 3 100;0;0 0.346 False ENSG00000116288 ENSG00000116288 HGNC:16369 PCCA gene PCCA Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Propionicacidemia, MIM# 606054" Dystonia;HP:0001332; Chorea;HP:0002072 30879957 False 3 100;0;0 0.346 True ENSG00000175198 ENSG00000175198 HGNC:8653 PCCB gene PCCB Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Propionicacidemia, MIM# 606054" Dystonia;HP:0001332; Chorea;HP:0002072 30879957 False 3 100;0;0 0.346 True ENSG00000114054 ENSG00000114054 HGNC:8654 PDE10A gene PDE10A Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Early onset chorea without epilepsy;infantile onset limb and orofacial dyskinesia (OMIM 616921) Dystonia;HP:0001332; Chorea;HP:0002072 PMID 27058447 False 3 100;0;0 0.346 False ENSG00000112541 ENSG00000112541 HGNC:8772 PDE1B gene PDE1B Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related Dystonia;HP:0001332; Chorea;HP:0002072 40492975 False 3 100;0;0 0.346 True ENSG00000123360 ENSG00000123360 HGNC:8775 PDGFB gene PDGFB Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5 615483 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 False ENSG00000100311 ENSG00000100311 HGNC:8800 PDHA1 gene PDHA1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Pyruvate dehydrogenase E1-alpha deficiency MIM#312170 Dystonia;HP:0001332; Chorea;HP:0002072 20002125 False 3 100;0;0 0.346 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDHX gene PDHX Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lacticacidemia due to PDX1 deficiency MIM#245349" Dystonia;HP:0001332; Chorea;HP:0002072 20002125;16566017;17152059 False 3 100;0;0 0.346 True ENSG00000110435 ENSG00000110435 HGNC:21350 PINK1 gene PINK1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 6, early onset;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000158828 ENSG00000158828 HGNC:14581 PLA2G6 gene PLA2G6 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 14, autosomal recessive 612953;PLA2G6-associated neurodegeneration;Neurodegeneration with brain iron accumulation 2B 610217;Infantile neuroaxonal dystrophy 1 256600 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000184381 ENSG00000184381 HGNC:9039 PNKD gene PNKD Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800;MONDO:0007326 Dystonia;HP:0001332; Chorea;HP:0002072 15262732;15496428;15824259;19124534;21487022 False 3 100;0;0 0.346 False ENSG00000127838 ENSG00000127838 HGNC:9153 PNKP gene PNKP Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia-oculomotor apraxia 4, MIM# 616267" Dystonia;HP:0001332; Chorea;HP:0002072 28552035;25728773 False 3 100;0;0 0.346 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNPLA8 gene PNPLA8 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 39082157 False 3 100;0;0 0.346 True ENSG00000135241 ENSG00000135241 HGNC:28900 POLR3A gene POLR3A Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 Dystonia;HP:0001332; Chorea;HP:0002072 32600288;32373668;31940116;31932101;29618326 False 3 100;0;0 0.346 True ENSG00000148606 ENSG00000148606 HGNC:30074 PRKN gene PRKN Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile parkinsonism/dystonia;Parkinson disease, juvenile, type 2;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000185345 ENSG00000185345 HGNC:8607 PRKRA gene PRKRA Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 16, MIM# 612067;MONDO:0012789 Dystonia;HP:0001332; Chorea;HP:0002072 18243799;25142429;29279192 False 3 100;0;0 0.346 False ENSG00000180228 ENSG00000180228 HGNC:9438 PRMT1 gene PRMT1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder, MONDO:0700092, PRMT1-related Dystonia;HP:0001332; Chorea;HP:0002072 39937650 False 3 100;0;0 0.346 True ENSG00000126457 ENSG00000126457 HGNC:5187 PRNP gene PRNP Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 1 MONDO:0011299 Dystonia;HP:0001332; Chorea;HP:0002072 30713928;27400454 False 3 100;0;0 0.346 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRRT2 gene PRRT2 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic kinesigenic dyskinesia 1, MIM# 128200;MONDO:0007494 Dystonia;HP:0001332; Chorea;HP:0002072 22101681;22120146;22744660;22399141 False 3 100;0;0 0.346 False ENSG00000167371 ENSG00000167371 HGNC:30500 PSEN1 gene PSEN1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Frontotemporal dementia, MIM# 600274;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 28664294;12810495;15159497;29316780 False 3 100;0;0 0.346 True ENSG00000080815 ENSG00000080815 HGNC:9508 PTS gene PTS Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, A, 261640;6-Pyruvoyltetrahydropterin Synthase Deficiency;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000150787 ENSG00000150787 HGNC:9689 QDPR gene QDPR Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, 261630;Dihydropteridine reductase deficiency;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000151552 ENSG00000151552 HGNC:9752 RHOBTB2 gene RHOBTB2 Expert Review Green;Other Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 64, MIM# 618004;Dystonia, hypertonia, movement disorder;truncal hypotonia;hemiparesis;developmental and epileptic encephalopathy" Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 29276004 False 3 0;0;0 0.346 True ENSG00000008853 ENSG00000008853 HGNC:18756 RNASEH2B gene RNASEH2B Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 2 MIM#610181 Dystonia;HP:0001332; Chorea;HP:0002072 20131292;26860721 False 3 100;0;0 0.346 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNASEH2C gene RNASEH2C Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 3 MIM#610329 Dystonia;HP:0001332; Chorea;HP:0002072 20131292;23322642 False 3 100;0;0 0.346 True ENSG00000172922 ENSG00000172922 HGNC:24116 RNU7-1 gene RNU7-1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 9, MIM# 619487 Dystonia;HP:0001332; Chorea;HP:0002072 33230297 False 3 100;0;0 0.346 True ENSG00000238923 ENSG00000238923 HGNC:34033 SERAC1 gene SERAC1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-MEthylGlutaconic aciduria, Dystonia-Deafness, Hepatopathy, Encephalopathy, Leigh-like syndrome;3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, 614739;Lesions in the basal ganglia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000122335 ENSG00000122335 HGNC:21061 SETX gene SETX Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2, MIM# 606002" Dystonia;HP:0001332; Chorea;HP:0002072 19696032 False 3 100;0;0 0.346 True ENSG00000107290 ENSG00000107290 HGNC:445 SGCE gene SGCE Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Dystonia-11, myoclonic, MIM# 159900;MONDO:0008044 Dystonia;HP:0001332; Chorea;HP:0002072 11528394;12821748;16227522 False 3 100;0;0 0.346 False ENSG00000127990 ENSG00000127990 HGNC:10808 SHQ1 gene SHQ1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 35, childhood-onset , MIM# 619921;Neurodevelopmental disorder with dystonia and seizures, MIM# 619922 Dystonia;HP:0001332; Chorea;HP:0002072 34542157;29178645;36847845;37475611 False 3 100;0;0 0.346 True ENSG00000144736 ENSG00000144736 HGNC:25543 SLC16A2 gene SLC16A2 Expert Review;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, MIM# 300523 Dystonia;HP:0001332; Chorea;HP:0002072 15980113;31410843;20301789 False 3 100;0;0 0.346 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC18A2 gene SLC18A2 Expert Review;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Parkinsonism-dystonia, infantile, 2, MIM# 618049" Dystonia;HP:0001332; Chorea;HP:0002072 23363473;31240161;26497564 False 3 100;0;0 0.346 True ENSG00000165646 ENSG00000165646 HGNC:10935 SLC19A3 gene SLC19A3 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2) 607483;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000135917 ENSG00000135917 HGNC:16266 SLC20A2 gene SLC20A2 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 1 213600;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 22327515;23334463;24411498 False 3 100;0;0 0.346 True ENSG00000168575 ENSG00000168575 HGNC:10947 SLC2A1 gene SLC2A1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 9, MIM# 601042;MONDO:0010983 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 False ENSG00000117394 ENSG00000117394 HGNC:11005 SLC30A10 gene SLC30A10 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia/Parkinsonism, Hypermanganesemia, Polycythemia, and Chronic Liver Disease;Hypermanganesemia with dystonia, polycythemia, and cirrhosis, 613280 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000196660 ENSG00000196660 HGNC:25355 SLC30A9 gene SLC30A9 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Birk-Landau-Perez syndrome (MIM#617595)" Dystonia;HP:0001332; Chorea;HP:0002072 37041080 False 3 100;0;0 0.346 True ENSG00000014824 ENSG00000014824 HGNC:1329 SLC39A14 gene SLC39A14 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermanganesemia with dystonia 2 617013 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000104635 ENSG00000104635 HGNC:20858 SLC6A3 gene SLC6A3 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dopamine transporter deficiency;Parkinsonism-dystonia, infantile, 613135 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000142319 ENSG00000142319 HGNC:11049 SNORD118 gene SNORD118 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, brain calcifications, and cysts MIM#614561 Dystonia;HP:0001332; Chorea;HP:0002072 27571260 False 3 100;0;0 0.346 True ENSG00000200463 ENSG00000200463 HGNC:32952 SPATA5L1 gene SPATA5L1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616 Dystonia;HP:0001332; Chorea;HP:0002072 34626583 False 3 100;0;0 0.346 True ENSG00000171763 ENSG00000171763 HGNC:28762 SPR gene SPR Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716;MONDO:0012994 Dystonia;HP:0001332; Chorea;HP:0002072 11443547;18502672;22522443;16532389;31777525;29147684;28189489 False 3 100;0;0 0.346 False ENSG00000116096 ENSG00000116096 HGNC:11257 SQSTM1 gene SQSTM1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 27545679 False 3 100;0;0 0.346 True ENSG00000161011 ENSG00000161011 HGNC:11280 SUCLA2 gene SUCLA2 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria);Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000136143 ENSG00000136143 HGNC:11448 SUOX gene SUOX Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sulfite oxidase deficiency MIM#272300 Dystonia;HP:0001332; Chorea;HP:0002072 9600976;28933809;16140720 False 3 100;0;0 0.346 True ENSG00000139531 ENSG00000139531 HGNC:11460 SURF1 gene SURF1 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leigh syndrome, due to COX IV deficiency, MIM# 256000" Dystonia;HP:0001332; Chorea;HP:0002072 19780766 False 3 100;0;0 0.346 True ENSG00000148290 ENSG00000148290 HGNC:11474 SYNJ1 gene SYNJ1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile Parkinsonism;Parkinson disease 20, early-onset Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000159082 ENSG00000159082 HGNC:11503 SYT1 gene SYT1 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Baker-Gordon syndrome MIM#618218 Dystonia;HP:0001332; Chorea;HP:0002072 30107533 False 3 100;0;0 0.346 True ENSG00000067715 ENSG00000067715 HGNC:11509 TH gene TH Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Segawa syndrome, recessive, MIM# 605407;MONDO:0011551 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 100;0;0 0.346 False ENSG00000180176 ENSG00000180176 HGNC:11782 THAP1 gene THAP1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Dystonia 6, torsion, 602629;Dystonia;MONDO:0011264 Dystonia;HP:0001332; Chorea;HP:0002072 21793105;22377579;36205328;21425335;20211909 False 3 100;0;0 0.346 False ENSG00000131931 ENSG00000131931 HGNC:20856 TIMM8A gene TIMM8A Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Deafness-Dystonia-Optic Neuronopathy Syndrome;Mohr-Tranebjaerg syndrome, MIM# 304700 Dystonia;HP:0001332; Chorea;HP:0002072 11803487;11405816;32820032 False 3 100;0;0 0.346 True ENSG00000126953 ENSG00000126953 HGNC:11817 TNPO2 gene TNPO2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM# 619556" Dystonia;HP:0001332; Chorea;HP:0002072 34314705 False 3 100;0;0 0.346 True ENSG00000105576 ENSG00000105576 HGNC:19998 TOR1A gene TOR1A Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant or sporadic dystonia (DYT1);Early-Onset Primary Dystonia;Dystonia-1, torsion, 128100 Dystonia;HP:0001332; Chorea;HP:0002072 9288096;19955557;18477710;32243914;31583275;31347572 False 3 100;0;0 0.346 False ENSG00000136827 ENSG00000136827 HGNC:3098 TPK1 gene TPK1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type);Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000196511 ENSG00000196511 HGNC:17358 TREX1 gene TREX1 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 1, dominant and recessive MIM#225750 Dystonia;HP:0001332; Chorea;HP:0002072 20131292 False 3 100;0;0 0.346 True ENSG00000213689 ENSG00000213689 HGNC:12269 TRPM3 gene TRPM3 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224 Dystonia;HP:0001332; Chorea;HP:0002072 31278393;35146895 False 3 100;0;0 0.346 True ENSG00000083067 ENSG00000083067 HGNC:17992 TSPOAP1 gene TSPOAP1 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 22, MIM# 620453 Dystonia;HP:0001332; Chorea;HP:0002072 33539324 False 3 100;0;0 0.346 True ENSG00000005379 ENSG00000005379 HGNC:16831 TUBB4A gene TUBB4A Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted hereditary whispering dysphonia;Dystonia 4, torsion, autosomal dominant, 128101;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 23424103;23595291;33084096;32943487 False 3 100;0;0 0.346 False ENSG00000104833 ENSG00000104833 HGNC:20774 UBTF gene UBTF Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701 Dystonia;HP:0001332; Chorea;HP:0002072 28777933;29300972 False 3 100;0;0 0.346 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000108312 ENSG00000108312 HGNC:12511 VAC14 gene VAC14 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Striatonigral degeneration, childhood-onset 617054 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000103043 ENSG00000103043 HGNC:25507 VAMP2 gene VAMP2 Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760;Dystonia;Cortical visual impairment;Seizures;Stereotypic behaviour;Generalized hypotonia;Intellectual disability Dystonia;HP:0001332; Chorea;HP:0002072 30929742 False 3 100;0;0 0.346 True ENSG00000220205 ENSG00000220205 HGNC:12643 VPS13A gene VPS13A Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex parkinsonism;Choreoacanthocytosis 200150 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13D gene VPS13D Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317" Dystonia;HP:0001332; Chorea;HP:0002072 29604224;29518281 False 3 100;0;0 0.346 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS16 gene VPS16 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 30, MIM#619291 Dystonia;HP:0001332; Chorea;HP:0002072 32808683 False 3 100;0;0 0.346 True ENSG00000215305 ENSG00000215305 HGNC:14584 VPS41 gene VPS41 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay Dystonia;HP:0001332; Chorea;HP:0002072 32808683;33764426 False 3 100;0;0 0.346 True ENSG00000006715 ENSG00000006715 HGNC:12713 VPS4A gene VPS4A Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CIMDAG syndrome MIM# 619273 Dystonia;HP:0001332; Chorea;HP:0002072 33186543;33186545 False 3 100;0;0 0.346 True Other ENSG00000132612 ENSG00000132612 HGNC:13488 WARS2 gene WARS2 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 Dystonia;HP:0001332; Chorea;HP:0002072 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 0.346 True ENSG00000116874 ENSG00000116874 HGNC:12730 WDR45 gene WDR45 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegeneration with brain iron accumulation 5 300894;beta-propeller protein-associated neurodegeneration;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000196998 ENSG00000196998 HGNC:28912 WDR73 gene WDR73 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 1, 251300 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000177082 ENSG00000177082 HGNC:25928 XK gene XK Expert list;Expert Review Green Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) McLeod syndrome with or without chronic granulomatous disease MIM#300842 Dystonia;HP:0001332; Chorea;HP:0002072 11761473 False 3 100;0;0 0.346 True ENSG00000047597 ENSG00000047597 HGNC:12811 YIF1B gene YIF1B Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement Dystonia;HP:0001332; Chorea;HP:0002072 32006098;26077767 False 3 100;0;0 0.346 True ENSG00000167645 ENSG00000167645 HGNC:30511 YY1 gene YY1 Expert Review Green;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Gabriele-de Vries syndrome 617557 Dystonia;HP:0001332; Chorea;HP:0002072 False 3 0;0;0 0.346 False ENSG00000100811 ENSG00000100811 HGNC:12856 ZNF526 gene ZNF526 Expert Review Green;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dentici-Novelli neurodevelopmental syndrome, MIM# 619877 Dystonia;HP:0001332; Chorea;HP:0002072 21937992;25558065;33397746 False 3 100;0;0 0.346 True ENSG00000167625 ENSG00000167625 HGNC:29415 AFG3L2 gene AFG3L2 Expert list;Expert Review Amber Dystonia and Chorea Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive MIM#614487;Early-onset dystonia Dystonia;HP:0001332; Chorea;HP:0002072 22964162;16541453;32219868;36110148 False 2 33;0;67 0.346 True ENSG00000141385 ENSG00000141385 HGNC:315 ALK gene ALK Expert Review Amber;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic-dystonic diplegia Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 32989326 False 2 0;100;0 0.346 True ENSG00000171094 ENSG00000171094 HGNC:427 ARFGEF3 gene ARFGEF3 Expert Review Amber;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, MONDO:0044807, ARFGEF3-related Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 33098801 False 2 50;50;0 0.346 False ENSG00000112379 ENSG00000112379 HGNC:21213 ATP5B gene ATP5B Expert Review Amber;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Dystonia 38, susceptibility to, MIM# 621502 Dystonia;HP:0001332; Chorea;HP:0002072 36860166;40276935 False 2 50;50;0 0.346 True ENSG00000110955 ENSG00000110955 HGNC:830 CHD8 gene CHD8 Expert Review Amber;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, CHD8-related, MIM#615032;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 34415117 False 2 0;100;0 0.346 True ENSG00000100888 ENSG00000100888 HGNC:20153 CIZ1 gene CIZ1 Expert Review Amber;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Dystonia 23, 614860 Dystonia;HP:0001332; Chorea;HP:0002072 27163549;29154038;22447717 False 2 0;100;0 0.346 False ENSG00000148337 ENSG00000148337 HGNC:16744 COL6A3 gene COL6A3 Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 27, MIM#616411 Dystonia;HP:0001332; Chorea;HP:0002072 26004199;32037012;26872670;32037012 False 2 50;50;0 0.346 False ENSG00000163359 ENSG00000163359 HGNC:2213 FBXL4 gene FBXL4 Expert list;Expert Review Amber Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) MIM#615471 Dystonia;HP:0001332; Chorea;HP:0002072 False 2 0;100;0 0.346 True ENSG00000112234 ENSG00000112234 HGNC:13601 HACE1 gene HACE1 Expert list;Expert Review Amber Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia and psychomotor retardation with or without seizures MIM#616756 Dystonia;HP:0001332; Chorea;HP:0002072 26424145;26437029 False 2 0;100;0 0.346 True ENSG00000085382 ENSG00000085382 HGNC:21033 KCNQ2 gene KCNQ2 Expert list;Expert Review Amber Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 7 MIM#613720 Dystonia;HP:0001332; Chorea;HP:0002072 12742592;32585800 False 2 0;100;0 0.346 True ENSG00000075043 ENSG00000075043 HGNC:6296 KIF1C gene KIF1C Expert list;Expert Review Amber Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic ataxia 2, autosomal recessive, MIM# 611302" Dystonia;HP:0001332; Chorea;HP:0002072 31413903 False 2 0;100;0 0.346 True ENSG00000129250 ENSG00000129250 HGNC:6317 MAPT gene MAPT Expert list;Expert Review Amber Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dementia, frontotemporal, with or without parkinsonism MIM#600274 Dystonia;HP:0001332; Chorea;HP:0002072 17319286;15883319 False 2 0;100;0 0.346 True ENSG00000186868 ENSG00000186868 HGNC:6893 MRPS36 gene MRPS36 Expert Review Amber;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related Dystonia;HP:0001332; Chorea;HP:0002072 PMID: 41018056;38685873 False 2 0;100;0 0.346 True ENSG00000134056 ENSG00000134056 HGNC:16631 MT-TC gene MT-TC Expert list;Expert Review Amber Dystonia and Chorea Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TC-related Dystonia;HP:0001332; Chorea;HP:0002072 8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363 False 2 0;100;0 0.346 True ENSG00000210140 ENSG00000210140 HGNC:7477 NUP54 gene NUP54 Expert Review Amber;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 37, early-onset, with striatal lesions, MIM# 620427;Early onset dystonia;progressive neurological deterioration;ataxia;dysarthria;dysphagia;hypotonia Dystonia;HP:0001332; Chorea;HP:0002072 36333996 False 2 0;100;0 0.346 True ENSG00000138750 ENSG00000138750 HGNC:17359 SAMHD1 gene SAMHD1 Expert list;Expert Review Amber Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 5 MIM#612952 Dystonia;HP:0001332; Chorea;HP:0002072 20131292 False 2 0;100;0 0.346 True ENSG00000101347 ENSG00000101347 HGNC:15925 VAMP1 gene VAMP1 Expert list;Expert Review Amber Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic ataxia 1, autosomal dominant, MIM# 108600" Dystonia;HP:0001332; Chorea;HP:0002072 22958904 False 2 0;100;0 0.346 True ENSG00000139190 ENSG00000139190 HGNC:12642 CACNA1B gene CACNA1B Expert Review Red;Other Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myoclonus-dystonia syndrome MONDO:0000903 Dystonia;HP:0001332; Chorea;HP:0002072 25296916;26157024;35698023;33051750;35041927 False 1 0;0;100 0.346 False ENSG00000148408 ENSG00000148408 HGNC:1389 CHMP2B gene CHMP2B Expert Review Red;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown familial frontotemporal lobar degeneration (ALS17);Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Dystonia Dystonia;HP:0001332; Chorea;HP:0002072 20301378 False 1 0;0;100 0.346 True ENSG00000083937 ENSG00000083937 HGNC:24537 DCTN1 gene DCTN1 Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome MIM#168605 Dystonia;HP:0001332; Chorea;HP:0002072 24343258 False 1 0;0;100 0.346 True ENSG00000204843 ENSG00000204843 HGNC:2711 EARS2 gene EARS2 Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 12 MIM#614924 Dystonia;HP:0001332; Chorea;HP:0002072 22492562 False 1 0;0;100 0.346 True ENSG00000103356 ENSG00000103356 HGNC:29419 GPR88 gene GPR88 Expert Review Red;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal chorea, childhood-onset, with psychomotor retardation MONDO:0014839 Dystonia;HP:0001332; Chorea;HP:0002072 27123486 False 1 0;0;100 0.346 True ENSG00000181656 ENSG00000181656 HGNC:4539 MAT1A gene MAT1A Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850 Dystonia;HP:0001332; Chorea;HP:0002072 8770875 False 1 0;0;100 0.346 True ENSG00000151224 ENSG00000151224 HGNC:6903 MMADHC gene MMADHC Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Homocystinuria, cblD type, variant 1 MIM#277410 Dystonia;HP:0001332; Chorea;HP:0002072 15292234;18385497 False 1 0;0;100 0.346 True ENSG00000168288 ENSG00000168288 HGNC:25221 MOGS gene MOGS Expert Review;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIb, MIM# 606056 Dystonia;HP:0001332; Chorea;HP:0002072 33058492 False 1 0;0;100 0.346 True ENSG00000115275 ENSG00000115275 HGNC:24862 MPV17 gene MPV17 Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) MIM#256810 Dystonia;HP:0001332; Chorea;HP:0002072 29282788 False 1 0;0;100 0.346 True ENSG00000115204 ENSG00000115204 HGNC:7224 PDGFRB gene PDGFRB Expert Review Red;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 4, MIM# 615007 Dystonia;HP:0001332; Chorea;HP:0002072 24518837 False 1 0;0;100 0.346 True ENSG00000113721 ENSG00000113721 HGNC:8804 PLP1 gene PLP1 Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Pelizaeus-Merzbacher disease MIM#312080 Dystonia;HP:0001332; Chorea;HP:0002072 30046645;19396823 False 1 0;0;100 0.346 True ENSG00000123560 ENSG00000123560 HGNC:9086 PODXL gene PODXL Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile-onset Parkinson disease Dystonia;HP:0001332; Chorea;HP:0002072 26864383 False 1 0;0;100 0.346 False ENSG00000128567 ENSG00000128567 HGNC:9171 RELN gene RELN Expert Review Red;Other Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myoclonus-dystonia syndrome MONDO:0000903 Dystonia;HP:0001332; Chorea;HP:0002072 32334381;25648840 False 1 0;0;100 0.346 False ENSG00000189056 ENSG00000189056 HGNC:9957 RNASEH2A gene RNASEH2A Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 4 MIM#610333 Dystonia;HP:0001332; Chorea;HP:0002072 20131292 False 1 0;0;100 0.346 True ENSG00000104889 ENSG00000104889 HGNC:18518 TOR1AIP1 gene TOR1AIP1 Expert Review Red;Royal Melbourne Hospital Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, cerebellar atrophy, and cardiomyopathy Dystonia;HP:0001332; Chorea;HP:0002072 25425325 False 1 0;0;100 0.346 True ENSG00000143337 ENSG00000143337 HGNC:29456 UNC80 gene UNC80 Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypotonia, infantile, with psychomotor retardation and characteristic facies 2, MIM# 616801;MONDO:0014777 Dystonia;HP:0001332; Chorea;HP:0002072 26545877 False 1 0;0;100 0.346 True ENSG00000144406 ENSG00000144406 HGNC:26582 VPS11 gene VPS11 Expert Review Red;Literature Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 32, MIM# 619637;Dystonia, adult-onset Dystonia;HP:0001332; Chorea;HP:0002072 33452836 False 1 0;0;100 0.346 False ENSG00000160695 ENSG00000160695 HGNC:14583 VPS37A gene VPS37A Expert list;Expert Review Red Dystonia and Chorea Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 53, autosomal recessive MIM#614898 Dystonia;HP:0001332; Chorea;HP:0002072 22717650 False 1 0;0;100 0.346 True ENSG00000155975 ENSG00000155975 HGNC:24928 ARX_EIEE1_GCN1 str ARX Expert Review Green;Expert Review Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 Dystonia;HP:0001332; Chorea;HP:0002072 11889467;33811808 False 3 100;0;0 0.346 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031767 25031814 25013650 25013697 GCN 16 23 ARX_EIEE1_GCN2 str ARX Expert Review Green;Expert list Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 Dystonia;HP:0001332; Chorea;HP:0002072 11889467;33811808 False 3 100;0;0 0.346 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031647 25031682 25013530 25013565 GCN 12 20 ATN1_DRPLA_CAG str ATN1 Expert list;Expert Review Green;Expert Review Green;Expert list Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 Dystonia;HP:0001332; Chorea;HP:0002072 8136840;8136826;29325606;20301664 False 3 100;0;0 0.346 False ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Dystonia;HP:0001332; Chorea;HP:0002072 26166205;24363131;26187722;25577942;21944779;21944778 False 3 100;0;0 0.346 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 HTT_HD_CAG str HTT Expert list;Expert Review Green;Expert Review Green;Expert list Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease MIM#143100 Dystonia;HP:0001332; Chorea;HP:0002072 8458085;20301482;29325606 False 3 100;0;0 0.346 False ENSG00000197386 ENSG00000197386 HGNC:4851 4 3076604 3076666 3074877 3074939 CAG 26 40 JPH3_HDL2_CTG str JPH3 Expert list;Expert Review Green;Expert Review Green;Expert list Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 Dystonia;HP:0001332; Chorea;HP:0002072 11558794;20301701 False 3 100;0;0 0.346 False ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 PRNP_CJD_octapeptide str PRNP Expert list;Expert Review Green;Expert Review Green;Expert list Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 Dystonia;HP:0001332; Chorea;HP:0002072 2159587;20301407 False 3 100;0;0 0.346 False ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 TAF1_XDP_CCCTCT str TAF1 Expert list;Expert Review Green;Expert Review Green;Expert list Dystonia and Chorea Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Dystonia-Parkinsonism, X-linked MIM#314250 Dystonia;HP:0001332; Chorea;HP:0002072 17273961;29229810 False 3 100;0;0 0.346 False ENSG00000147133 ENSG00000147133 HGNC:11535 X 70672905 70672979 71453055 71453129 CCCTCT 13 30 TBP_SCA17_CAG str TBP Expert list;Expert Review Green;Expert Review Green;Expert list Dystonia and Chorea Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 Dystonia;HP:0001332; Chorea;HP:0002072 10484774;20301611;29325606 False 3 100;0;0 0.346 False ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49