Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
ACBD6	gene	ACBD6	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785			Dystonia;HP:0001332; Chorea;HP:0002072	37951597		False	3	100;0;0	0.346	True		ENSG00000230124	ENSG00000230124	HGNC:23339													
ACTB	gene	ACTB	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Baraitser-Winter syndrome 1, 243310;Dystonia, juvenile-onset, 607371			Dystonia;HP:0001332; Chorea;HP:0002072	29788902;28487785		False	3	100;0;0	0.346	True	Other	ENSG00000075624	ENSG00000075624	HGNC:132													
ADAR	gene	ADAR	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	dystonia;Aicardi-Goutieres syndrome 6, 615010			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	False		ENSG00000160710	ENSG00000160710	HGNC:225													
ADCY5	gene	ADCY5	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651			Dystonia;HP:0001332; Chorea;HP:0002072	22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617		False	3	100;0;0	0.346	False		ENSG00000173175	ENSG00000173175	HGNC:236													
ANO3	gene	ANO3	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 24, 615034;familial form of cranio-cervical dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	33388357		False	3	100;0;0	0.346	False		ENSG00000134343	ENSG00000134343	HGNC:14004													
APTX	gene	APTX	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-oculomotor apraxia type 1;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	15876520		False	3	100;0;0	0.346	True		ENSG00000137074	ENSG00000137074	HGNC:15984													
ARSA	gene	ARSA	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy, MIM#250100			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARX	gene	ARX	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Partington syndrome, MIM# 309510;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	11889467;15200506		False	3	100;0;0	0.346	True	Other	ENSG00000004848	ENSG00000004848	HGNC:18060													
ATM	gene	ATM	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia telangiectasia;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	False		ENSG00000149311	ENSG00000149311	HGNC:795													
ATP13A2	gene	ATP13A2	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome MIM#606693			Dystonia;HP:0001332; Chorea;HP:0002072	21094623;20853184;20310007		False	3	100;0;0	0.346	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP1A3	gene	ATP1A3	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002			Dystonia;HP:0001332; Chorea;HP:0002072	15260953;17282997;19351654, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	0.346	False		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP2B2	gene	ATP2B2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related			Dystonia;HP:0001332; Chorea;HP:0002072	PMID: 37675773		False	3	100;0;0	0.346	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000157087	ENSG00000157087	HGNC:815													
ATP5A1	gene	ATP5A1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD			Dystonia;HP:0001332; Chorea;HP:0002072	34483339;34954817;40859057		False	3	100;0;0	0.346	True		ENSG00000152234	ENSG00000152234	HGNC:823													
ATP5G3	gene	ATP5G3	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Dystonia, early-onset, and/or spastic paraplegia, MIM#	619681"			Dystonia;HP:0001332; Chorea;HP:0002072	34636445;34954817		False	3	100;0;0	0.346	True		ENSG00000154518	ENSG00000154518	HGNC:843													
ATP7B	gene	ATP7B	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease, MIM# 277900;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	32662046		False	3	100;0;0	0.346	True		ENSG00000123191	ENSG00000123191	HGNC:870													
AUH	gene	AUH	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-Methylglutaconic aciduria type 1;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	True		ENSG00000148090	ENSG00000148090	HGNC:890													
BCAP31	gene	BCAP31	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Deafness, dystonia and cerebellar hypomyelination, MIM#300475			Dystonia;HP:0001332; Chorea;HP:0002072	24011989;28332767;30713915;31330203;32652807		False	3	100;0;0	0.346	True		ENSG00000185825	ENSG00000185825	HGNC:16695													
C19orf12	gene	C19orf12	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	neurodegeneration with brain iron accumulation 4 MONDO:0013674			Dystonia;HP:0001332; Chorea;HP:0002072	21981780;22508347		False	3	100;0;0	0.346	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
C9orf3	gene	C9orf3	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Dystonia 31, MIM#	619565"			Dystonia;HP:0001332; Chorea;HP:0002072	34596301		False	3	100;0;0	0.346	False		ENSG00000148120	ENSG00000148120	HGNC:1361													
CACNA1A	gene	CACNA1A	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 2 MIM#108500;Spinocerebellar ataxia 6 MIM#183086			Dystonia;HP:0001332; Chorea;HP:0002072	25468264;23441182;19232643;18758887;11344116		False	3	100;0;0	0.346	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1G	gene	CACNA1G	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM#	618087"			Dystonia;HP:0001332; Chorea;HP:0002072	29878067		False	3	100;0;0	0.346	True		ENSG00000006283	ENSG00000006283	HGNC:1394													
CAMK4	gene	CAMK4	Expert Review;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Autism;Behavioral abnormality;Abnormality of movement;Dystonia;Ataxia;Chorea;Myoclonus			Dystonia;HP:0001332; Chorea;HP:0002072	30262571;33098801;33211350		False	3	100;0;0	0.346	True		ENSG00000152495	ENSG00000152495	HGNC:1464													
CLN3	gene	CLN3	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ceroid lipofuscinosis, neuronal, 3	204200"			Dystonia;HP:0001332; Chorea;HP:0002072	19353721		False	3	100;0;0	0.346	True		ENSG00000188603	ENSG00000188603	HGNC:2074													
COASY	gene	COASY	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodegeneration with brain iron accumulation 6, MONDO:0014290;Neurodegeneration with brain iron accumulation 6 615643			Dystonia;HP:0001332; Chorea;HP:0002072	23447832;24360804;27021474		False	3	100;0;0	0.346	True		ENSG00000068120	ENSG00000068120	HGNC:29932													
COQ8A	gene	COQ8A	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Coenzyme Q10 deficiency, primary, 4, MIM#	612016"			Dystonia;HP:0001332; Chorea;HP:0002072	32337771		False	3	100;0;0	0.346	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
CP	gene	CP	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminaemia, MIM#604290			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	True		ENSG00000047457	ENSG00000047457	HGNC:2295													
CYP27A1	gene	CYP27A1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, MIM# 213700;Cholestanol storage disease;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	19373932;21531161;25424010		False	3	100;0;0	0.346	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
DCAF17	gene	DCAF17	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Woodhouse-Sakati syndrome MONDO:0009419;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	18175354;36185913;17167799		False	3	100;0;0	0.346	True		ENSG00000115827	ENSG00000115827	HGNC:25784													
DDC	gene	DDC	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aromatic L-amino acid decarboxylase deficiency, 608643;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	20505134		False	3	100;0;0	0.346	True		ENSG00000132437	ENSG00000132437	HGNC:2719													
DLAT	gene	DLAT	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase E2 deficiency 245348;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	39007626;20022530;16049940		False	3	100;0;0	0.346	True		ENSG00000150768	ENSG00000150768	HGNC:2896													
DNAJC12	gene	DNAJC12	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, mild, non-BH4-deficient, 617384			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	True		ENSG00000108176	ENSG00000108176	HGNC:28908													
DRD2	gene	DRD2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Combined dystonia, MONDO:0020065, DRD2-related;dystonia;chorea;anxiety;ataxia;orofacial dyskinesia;tremor;memory problems			Dystonia;HP:0001332; Chorea;HP:0002072	33200438		False	3	100;0;0	0.346	True	Other	ENSG00000149295	ENSG00000149295	HGNC:3023													
ECHS1	gene	ECHS1	Expert Review;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM#	616277"			Dystonia;HP:0001332; Chorea;HP:0002072	32677093;32858208		False	3	100;0;0	0.346	True		ENSG00000127884	ENSG00000127884	HGNC:3151													
EIF2AK2	gene	EIF2AK2	Expert Review;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness;early onset dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	33236446;33866603		False	3	100;0;0	0.346	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
EIF4A2	gene	EIF4A2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455			Dystonia;HP:0001332; Chorea;HP:0002072	37485550		False	3	100;0;0	0.346	True		ENSG00000156976	ENSG00000156976	HGNC:3284													
EPG5	gene	EPG5	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506			Dystonia;HP:0001332; Chorea;HP:0002072	41053928;36410285;40192014		False	3	100;0;0	0.346	True		ENSG00000152223	ENSG00000152223	HGNC:29331													
FA2H	gene	FA2H	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia;Spastic paraplegia 35, autosomal recessive 612319;fatty acid hydroxylase-associated neurodegeneration			Dystonia;HP:0001332; Chorea;HP:0002072	19068277;20104589;20853438;31135052		False	3	100;0;0	0.346	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FBXO28	gene	FBXO28	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 100, MIM# 619777			Dystonia;HP:0001332; Chorea;HP:0002072	33280099		False	3	100;0;0	0.346	True		ENSG00000143756	ENSG00000143756	HGNC:29046													
FBXO7	gene	FBXO7	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile parkinsonism;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000100225	ENSG00000100225	HGNC:13586													
FITM2	gene	FITM2	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Siddiqi syndrome MIM#618635;dystonia;deafness			Dystonia;HP:0001332; Chorea;HP:0002072	28067622;30214770;30288795		False	3	100;0;0	0.346	True		ENSG00000197296	ENSG00000197296	HGNC:16135													
FOXG1	gene	FOXG1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Rett syndrome, congenital variant;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	27029630		False	3	100;0;0	0.346	True		ENSG00000176165	ENSG00000176165	HGNC:3811													
FTL	gene	FTL	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodegeneration with brain iron accumulation 3, MIM# 606159			Dystonia;HP:0001332; Chorea;HP:0002072	11438811;15099026;12746423;18413574		False	3	100;0;0	0.346	True		ENSG00000087086	ENSG00000087086	HGNC:3999													
FUCA1	gene	FUCA1	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fucosidosis, MIM#230000			Dystonia;HP:0001332; Chorea;HP:0002072	31064022		False	3	100;0;0	0.346	True		ENSG00000179163	ENSG00000179163	HGNC:4006													
GABRB2	gene	GABRB2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631			Dystonia;HP:0001332; Chorea;HP:0002072	38996765		False	3	100;0;0	0.346	True	Other	ENSG00000145864	ENSG00000145864	HGNC:4082													
GABRB3	gene	GABRB3	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 43 MIM#617113			Dystonia;HP:0001332; Chorea;HP:0002072	37647766		False	3	100;0;0	0.346	False	Other	ENSG00000166206	ENSG00000166206	HGNC:4083													
GALT	gene	GALT	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Galactosemia,	MIM#230400"			Dystonia;HP:0001332; Chorea;HP:0002072	30718057		False	3	100;0;0	0.346	True		ENSG00000213930	ENSG00000213930	HGNC:4135													
GAMT	gene	GAMT	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral creatine deficiency syndrome 2 MIM#612736			Dystonia;HP:0001332; Chorea;HP:0002072	19027335;33996490;12557293;19288536;16855203		False	3	50;0;50	0.346	True		ENSG00000130005	ENSG00000130005	HGNC:4136													
GBA	gene	GBA	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Gaucher disease, type III, MIM#	231000"			Dystonia;HP:0001332; Chorea;HP:0002072	27789132		False	3	100;0;0	0.346	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GCDH	gene	GCDH	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	glutaryl-CoA dehydrogenase deficiency MONDO:0009281			Dystonia;HP:0001332; Chorea;HP:0002072	32777384;21912879;31536184		False	3	100;0;0	0.346	True		ENSG00000105607	ENSG00000105607	HGNC:4189													
GCH1	gene	GCH1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230			Dystonia;HP:0001332; Chorea;HP:0002072	7874165;11113234;15753436		False	3	100;0;0	0.346	False		ENSG00000131979	ENSG00000131979	HGNC:4193													
GJC2	gene	GJC2	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 2, MIM#	608804"			Dystonia;HP:0001332; Chorea;HP:0002072	15192806;18094336		False	3	100;0;0	0.346	True		ENSG00000198835	ENSG00000198835	HGNC:17494													
GLB1	gene	GLB1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1 gangliosidosis type 3 MONDO:0009262			Dystonia;HP:0001332; Chorea;HP:0002072	24156116;35937492;34514040;1353343		False	3	100;0;0	0.346	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GM2A	gene	GM2A	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, AB variant, MIM#272750			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	True		ENSG00000196743	ENSG00000196743	HGNC:4367													
GNAL	gene	GNAL	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 25, MIM# 615073;MONDO:0014033			Dystonia;HP:0001332; Chorea;HP:0002072	23222958;33175450;32180288		False	3	100;0;0	0.346	False		ENSG00000141404	ENSG00000141404	HGNC:4388													
GNAO1	gene	GNAO1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with involuntary movements, 617493			Dystonia;HP:0001332; Chorea;HP:0002072	28747448;30682224		False	3	100;0;0	0.346	True	Other	ENSG00000087258	ENSG00000087258	HGNC:4389													
GNB1	gene	GNB1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 42, MIM# 616973;Myoclonus dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	30194818;27108799;27668284;31034681		False	3	100;0;0	0.346	True		ENSG00000078369	ENSG00000078369	HGNC:4396													
GRIN1	gene	GRIN1	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820			Dystonia;HP:0001332; Chorea;HP:0002072	29365063;27164704;27164704;28051072		False	3	100;0;0	0.346	True		ENSG00000176884	ENSG00000176884	HGNC:4584													
GRN	gene	GRN	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Frontotemporal lobar degeneration with ubiquitin-positive inclusions,	MIM#607485"			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	True		ENSG00000030582	ENSG00000030582	HGNC:4601													
GSX2	gene	GSX2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Diencephalic-mesencephalic junction dysplasia syndrome 2	618646;Intellectual disability;Dystonia;Spastic tetra paresis"			Dystonia;HP:0001332; Chorea;HP:0002072	31412107;39119454		False	3	100;0;0	0.346	True		ENSG00000180613	ENSG00000180613	HGNC:24959													
GTPBP2	gene	GTPBP2	Expert Review;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Jaberi-Elahi syndrome, MIM#617988			Dystonia;HP:0001332; Chorea;HP:0002072	26675814;29449720;30790272		False	3	100;0;0	0.346	True		ENSG00000172432	ENSG00000172432	HGNC:4670													
HIBCH	gene	HIBCH	Expert Review;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"3-hydroxyisobutryl-CoA hydrolase deficiency, MIM#	250620"			Dystonia;HP:0001332; Chorea;HP:0002072	26026795;25251209;24299452;32677093		False	3	100;0;0	0.346	True		ENSG00000198130	ENSG00000198130	HGNC:4908													
HPCA	gene	HPCA	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 2, torsion, autosomal recessive, 224500;MONDO:0009141;childhood-onset generalized dystonia;adolescence-onset segmental dystonia;generalized dystonia with additional neurological features			Dystonia;HP:0001332; Chorea;HP:0002072	25799108;30991467;30145809		False	3	100;0;0	0.346	False		ENSG00000121905	ENSG00000121905	HGNC:5144													
HPRT1	gene	HPRT1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Lesch-Nyhan syndrome;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	20301328		False	3	100;0;0	0.346	True		ENSG00000165704	ENSG00000165704	HGNC:5157													
HTRA2	gene	HTRA2	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria type 8 MONDO:0044723			Dystonia;HP:0001332; Chorea;HP:0002072	27208207;27696117;30114719		False	3	50;50;0	0.346	True		ENSG00000115317	ENSG00000115317	HGNC:14348													
IMPDH2	gene	IMPDH2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	PMID: 33098801		False	3	100;0;0	0.346	True		ENSG00000178035	ENSG00000178035	HGNC:6053													
IRF2BPL	gene	IRF2BPL	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures 618088			Dystonia;HP:0001332; Chorea;HP:0002072	PMID: 30057031;30166628		False	3	100;0;0	0.346	True		ENSG00000119669	ENSG00000119669	HGNC:14282													
KCNMA1	gene	KCNMA1	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy MIM#609446			Dystonia;HP:0001332; Chorea;HP:0002072	26195193;15937479;29356177		False	3	100;0;0	0.346	False	Other	ENSG00000156113	ENSG00000156113	HGNC:6284													
KCNN2	gene	KCNN2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 34, myoclonic, MIM#619724;Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725			Dystonia;HP:0001332; Chorea;HP:0002072	32212350;33242881		False	3	100;0;0	0.346	False		ENSG00000080709	ENSG00000080709	HGNC:6291													
KCTD17	gene	KCTD17	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Dystonia 26, myoclonic MIM#616398			Dystonia;HP:0001332; Chorea;HP:0002072	25983243;30642807;30579817		False	3	100;0;0	0.346	False		ENSG00000100379	ENSG00000100379	HGNC:25705													
KIF1A	gene	KIF1A	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia;spastic paraplegia;intellectual disability			Dystonia;HP:0001332; Chorea;HP:0002072	32096284;32935419		False	3	100;0;0	0.346	False		ENSG00000130294	ENSG00000130294	HGNC:888													
KMT2B	gene	KMT2B	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset dystonia;Dystonia 28, childhood-onset 617284;MONDO:0015004			Dystonia;HP:0001332; Chorea;HP:0002072	27839873;27992417		False	3	100;0;0	0.346	False		ENSG00000272333	ENSG00000272333	HGNC:15840													
L2HGDH	gene	L2HGDH	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L-2-hydroxyglutaric aciduria MIM#236792			Dystonia;HP:0001332; Chorea;HP:0002072	24753671;18780161;15824270;10399870		False	3	100;0;0	0.346	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
MARS2	gene	MARS2	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 3, autosomal recessive MIM#611390			Dystonia;HP:0001332; Chorea;HP:0002072	16672289;22448145		False	3	100;0;0	0.346	True		ENSG00000247626	ENSG00000247626	HGNC:25133													
MECR	gene	MECR	Expert Review;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities, MIM# 617282;MONDO:0015003			Dystonia;HP:0001332; Chorea;HP:0002072	27817865;33401012;31137067;31070877		False	3	100;0;0	0.346	True		ENSG00000116353	ENSG00000116353	HGNC:19691													
MED27	gene	MED27	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;cerebellar hypoplasia;dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	33443317		False	3	100;0;0	0.346	False		ENSG00000160563	ENSG00000160563	HGNC:2377													
MT-ND3	gene	MT-ND3	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND3-related			Dystonia;HP:0001332; Chorea;HP:0002072	1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403		False	3	100;0;0	0.346	False		ENSG00000198840	ENSG00000198840	HGNC:7458													
MT-TV	gene	MT-TV	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related			Dystonia;HP:0001332; Chorea;HP:0002072	9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	0.346	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TW	gene	MT-TW	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related			Dystonia;HP:0001332; Chorea;HP:0002072	7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	0.346	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
NAA15	gene	NAA15	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787			Dystonia;HP:0001332; Chorea;HP:0002072	38380600;36221186;35730864		False	3	100;0;0	0.346	True		ENSG00000164134	ENSG00000164134	HGNC:30782													
NACC1	gene	NACC1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	chorea;dystonia;epilepsy;microcephaly;cataracts;dysautonomia;iron deficiency anemia;stereotypies			Dystonia;HP:0001332; Chorea;HP:0002072	38698576		False	3	100;0;0	0.346	True		ENSG00000160877	ENSG00000160877	HGNC:20967													
NIT1	gene	NIT1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain small vessel disease 4, MIM# 621313			Dystonia;HP:0001332; Chorea;HP:0002072	38430071		False	3	100;0;0	0.346	False		ENSG00000158793	ENSG00000158793	HGNC:7828													
NKX2-1	gene	NKX2-1	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chorea, hereditary benign MIM#118700;Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978			Dystonia;HP:0001332; Chorea;HP:0002072	24714694;30186310		False	3	100;0;0	0.346	True		ENSG00000136352	ENSG00000136352	HGNC:11825													
NKX6-2	gene	NKX6-2	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy MIM#617560			Dystonia;HP:0001332; Chorea;HP:0002072	30285346;28575651;28969374		False	3	100;0;0	0.346	True		ENSG00000148826	ENSG00000148826	HGNC:19321													
NPC1	gene	NPC1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C1 MONDO:0009757			Dystonia;HP:0001332; Chorea;HP:0002072	12555942;20301473		False	3	100;0;0	0.346	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC2	gene	NPC2	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C2 MONDO:0011873;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	34993563;17470133		False	3	100;0;0	0.346	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NR4A2	gene	NR4A2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911			Dystonia;HP:0001332; Chorea;HP:0002072	31922365		False	3	100;0;0	0.346	True		ENSG00000153234	ENSG00000153234	HGNC:7981													
OPA3	gene	OPA3	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type III, MIM# 258501;developmental delay, hypotonia;dystonia and chorea;ataxia, optic atrophy;spastic paraplegia			Dystonia;HP:0001332; Chorea;HP:0002072	20301646;7510656;2494568;11668429		False	3	100;0;0	0.346	True		ENSG00000125741	ENSG00000125741	HGNC:8142													
PAH	gene	PAH	Expert Review;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phenylketonuria MIM#261600			Dystonia;HP:0001332; Chorea;HP:0002072	PMID: 25614310, PMID: 15390012, PMID: 30369906		False	3	100;0;0	0.346	True		ENSG00000171759	ENSG00000171759	HGNC:8582													
PANK2	gene	PANK2	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	pantothenate kinase-associated neurodegeneration MONDO:0009319;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	15911822		False	3	100;0;0	0.346	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PARK7	gene	PARK7	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Parkinson disease 7, autosomal recessive early-onset	MIM#606324"			Dystonia;HP:0001332; Chorea;HP:0002072	29644727		False	3	100;0;0	0.346	False		ENSG00000116288	ENSG00000116288	HGNC:16369													
PCCA	gene	PCCA	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Propionicacidemia, MIM#	606054"			Dystonia;HP:0001332; Chorea;HP:0002072	30879957		False	3	100;0;0	0.346	True		ENSG00000175198	ENSG00000175198	HGNC:8653													
PCCB	gene	PCCB	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Propionicacidemia, MIM#	606054"			Dystonia;HP:0001332; Chorea;HP:0002072	30879957		False	3	100;0;0	0.346	True		ENSG00000114054	ENSG00000114054	HGNC:8654													
PDE10A	gene	PDE10A	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Early onset chorea without epilepsy;infantile onset limb and orofacial dyskinesia (OMIM 616921)			Dystonia;HP:0001332; Chorea;HP:0002072	PMID 27058447		False	3	100;0;0	0.346	False		ENSG00000112541	ENSG00000112541	HGNC:8772													
PDE1B	gene	PDE1B	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related			Dystonia;HP:0001332; Chorea;HP:0002072	40492975		False	3	100;0;0	0.346	True		ENSG00000123360	ENSG00000123360	HGNC:8775													
PDGFB	gene	PDGFB	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 5 615483			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	False		ENSG00000100311	ENSG00000100311	HGNC:8800													
PDHA1	gene	PDHA1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Pyruvate dehydrogenase E1-alpha deficiency MIM#312170			Dystonia;HP:0001332; Chorea;HP:0002072	20002125		False	3	100;0;0	0.346	True		ENSG00000131828	ENSG00000131828	HGNC:8806													
PDHX	gene	PDHX	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lacticacidemia due to PDX1 deficiency	MIM#245349"			Dystonia;HP:0001332; Chorea;HP:0002072	20002125;16566017;17152059		False	3	100;0;0	0.346	True		ENSG00000110435	ENSG00000110435	HGNC:21350													
PINK1	gene	PINK1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 6, early onset;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000158828	ENSG00000158828	HGNC:14581													
PLA2G6	gene	PLA2G6	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 14, autosomal recessive 612953;PLA2G6-associated neurodegeneration;Neurodegeneration with brain iron accumulation 2B 610217;Infantile neuroaxonal dystrophy 1 256600			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000184381	ENSG00000184381	HGNC:9039													
PNKD	gene	PNKD	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800;MONDO:0007326			Dystonia;HP:0001332; Chorea;HP:0002072	15262732;15496428;15824259;19124534;21487022		False	3	100;0;0	0.346	False		ENSG00000127838	ENSG00000127838	HGNC:9153													
PNKP	gene	PNKP	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ataxia-oculomotor apraxia 4, MIM#	616267"			Dystonia;HP:0001332; Chorea;HP:0002072	28552035;25728773		False	3	100;0;0	0.346	True		ENSG00000039650	ENSG00000039650	HGNC:9154													
PNPLA8	gene	PNPLA8	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related			Dystonia;HP:0001332; Chorea;HP:0002072	PMID: 39082157		False	3	100;0;0	0.346	True		ENSG00000135241	ENSG00000135241	HGNC:28900													
POLR3A	gene	POLR3A	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276			Dystonia;HP:0001332; Chorea;HP:0002072	32600288;32373668;31940116;31932101;29618326		False	3	100;0;0	0.346	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
PRKN	gene	PRKN	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile parkinsonism/dystonia;Parkinson disease, juvenile, type 2;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRKRA	gene	PRKRA	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 16, MIM# 612067;MONDO:0012789			Dystonia;HP:0001332; Chorea;HP:0002072	18243799;25142429;29279192		False	3	100;0;0	0.346	False		ENSG00000180228	ENSG00000180228	HGNC:9438													
PRMT1	gene	PRMT1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, PRMT1-related			Dystonia;HP:0001332; Chorea;HP:0002072	39937650		False	3	100;0;0	0.346	True		ENSG00000126457	ENSG00000126457	HGNC:5187													
PRNP	gene	PRNP	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 1 MONDO:0011299			Dystonia;HP:0001332; Chorea;HP:0002072	30713928;27400454		False	3	100;0;0	0.346	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRRT2	gene	PRRT2	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic kinesigenic dyskinesia 1, MIM# 128200;MONDO:0007494			Dystonia;HP:0001332; Chorea;HP:0002072	22101681;22120146;22744660;22399141		False	3	100;0;0	0.346	False		ENSG00000167371	ENSG00000167371	HGNC:30500													
PSEN1	gene	PSEN1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Frontotemporal dementia, MIM# 600274;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	28664294;12810495;15159497;29316780		False	3	100;0;0	0.346	True		ENSG00000080815	ENSG00000080815	HGNC:9508													
PTS	gene	PTS	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, A, 261640;6-Pyruvoyltetrahydropterin Synthase Deficiency;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000150787	ENSG00000150787	HGNC:9689													
QDPR	gene	QDPR	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, C, 261630;Dihydropteridine reductase deficiency;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000151552	ENSG00000151552	HGNC:9752													
RHOBTB2	gene	RHOBTB2	Expert Review Green;Other	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 64, MIM#	618004;Dystonia, hypertonia, movement disorder;truncal hypotonia;hemiparesis;developmental and epileptic encephalopathy"			Dystonia;HP:0001332; Chorea;HP:0002072	PMID: 29276004		False	3	0;0;0	0.346	True		ENSG00000008853	ENSG00000008853	HGNC:18756													
RNASEH2B	gene	RNASEH2B	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 2 MIM#610181			Dystonia;HP:0001332; Chorea;HP:0002072	20131292;26860721		False	3	100;0;0	0.346	True		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2C	gene	RNASEH2C	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 3 MIM#610329			Dystonia;HP:0001332; Chorea;HP:0002072	20131292;23322642		False	3	100;0;0	0.346	True		ENSG00000172922	ENSG00000172922	HGNC:24116													
RNU7-1	gene	RNU7-1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 9, MIM# 619487			Dystonia;HP:0001332; Chorea;HP:0002072	33230297		False	3	100;0;0	0.346	True		ENSG00000238923	ENSG00000238923	HGNC:34033													
SERAC1	gene	SERAC1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-MEthylGlutaconic aciduria, Dystonia-Deafness, Hepatopathy, Encephalopathy, Leigh-like syndrome;3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, 614739;Lesions in the basal ganglia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000122335	ENSG00000122335	HGNC:21061													
SETX	gene	SETX	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2, MIM#	606002"			Dystonia;HP:0001332; Chorea;HP:0002072	19696032		False	3	100;0;0	0.346	True		ENSG00000107290	ENSG00000107290	HGNC:445													
SGCE	gene	SGCE	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	Dystonia-11, myoclonic, MIM# 159900;MONDO:0008044			Dystonia;HP:0001332; Chorea;HP:0002072	11528394;12821748;16227522		False	3	100;0;0	0.346	False		ENSG00000127990	ENSG00000127990	HGNC:10808													
SHQ1	gene	SHQ1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 35, childhood-onset , MIM# 619921;Neurodevelopmental disorder with dystonia and seizures, MIM# 619922			Dystonia;HP:0001332; Chorea;HP:0002072	34542157;29178645;36847845;37475611		False	3	100;0;0	0.346	True		ENSG00000144736	ENSG00000144736	HGNC:25543													
SLC16A2	gene	SLC16A2	Expert Review;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Allan-Herndon-Dudley syndrome, MIM# 300523			Dystonia;HP:0001332; Chorea;HP:0002072	15980113;31410843;20301789		False	3	100;0;0	0.346	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC18A2	gene	SLC18A2	Expert Review;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Parkinsonism-dystonia, infantile, 2, MIM#	618049"			Dystonia;HP:0001332; Chorea;HP:0002072	23363473;31240161;26497564		False	3	100;0;0	0.346	True		ENSG00000165646	ENSG00000165646	HGNC:10935													
SLC19A3	gene	SLC19A3	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2) 607483;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000135917	ENSG00000135917	HGNC:16266													
SLC20A2	gene	SLC20A2	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 1 213600;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	22327515;23334463;24411498		False	3	100;0;0	0.346	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC2A1	gene	SLC2A1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 9, MIM# 601042;MONDO:0010983			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	False		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC30A10	gene	SLC30A10	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia/Parkinsonism, Hypermanganesemia, Polycythemia, and Chronic Liver Disease;Hypermanganesemia with dystonia, polycythemia, and cirrhosis, 613280			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000196660	ENSG00000196660	HGNC:25355													
SLC30A9	gene	SLC30A9	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Birk-Landau-Perez syndrome	(MIM#617595)"			Dystonia;HP:0001332; Chorea;HP:0002072	37041080		False	3	100;0;0	0.346	True		ENSG00000014824	ENSG00000014824	HGNC:1329													
SLC39A14	gene	SLC39A14	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermanganesemia with dystonia 2 617013			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000104635	ENSG00000104635	HGNC:20858													
SLC6A3	gene	SLC6A3	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dopamine transporter deficiency;Parkinsonism-dystonia, infantile, 613135			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000142319	ENSG00000142319	HGNC:11049													
SNORD118	gene	SNORD118	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, brain calcifications, and cysts MIM#614561			Dystonia;HP:0001332; Chorea;HP:0002072	27571260		False	3	100;0;0	0.346	True		ENSG00000200463	ENSG00000200463	HGNC:32952													
SPATA5L1	gene	SPATA5L1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616			Dystonia;HP:0001332; Chorea;HP:0002072	34626583		False	3	100;0;0	0.346	True		ENSG00000171763	ENSG00000171763	HGNC:28762													
SPR	gene	SPR	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716;MONDO:0012994			Dystonia;HP:0001332; Chorea;HP:0002072	11443547;18502672;22522443;16532389;31777525;29147684;28189489		False	3	100;0;0	0.346	False		ENSG00000116096	ENSG00000116096	HGNC:11257													
SQSTM1	gene	SQSTM1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145			Dystonia;HP:0001332; Chorea;HP:0002072	PMID: 27545679		False	3	100;0;0	0.346	True		ENSG00000161011	ENSG00000161011	HGNC:11280													
SUCLA2	gene	SUCLA2	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria);Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUOX	gene	SUOX	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sulfite oxidase deficiency MIM#272300			Dystonia;HP:0001332; Chorea;HP:0002072	9600976;28933809;16140720		False	3	100;0;0	0.346	True		ENSG00000139531	ENSG00000139531	HGNC:11460													
SURF1	gene	SURF1	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leigh syndrome, due to COX IV deficiency, MIM#	256000"			Dystonia;HP:0001332; Chorea;HP:0002072	19780766		False	3	100;0;0	0.346	True		ENSG00000148290	ENSG00000148290	HGNC:11474													
SYNJ1	gene	SYNJ1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile Parkinsonism;Parkinson disease 20, early-onset			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000159082	ENSG00000159082	HGNC:11503													
SYT1	gene	SYT1	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Baker-Gordon syndrome MIM#618218			Dystonia;HP:0001332; Chorea;HP:0002072	30107533		False	3	100;0;0	0.346	True		ENSG00000067715	ENSG00000067715	HGNC:11509													
TH	gene	TH	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Segawa syndrome, recessive, MIM# 605407;MONDO:0011551			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	100;0;0	0.346	False		ENSG00000180176	ENSG00000180176	HGNC:11782													
THAP1	gene	THAP1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Dystonia 6, torsion, 602629;Dystonia;MONDO:0011264			Dystonia;HP:0001332; Chorea;HP:0002072	21793105;22377579;36205328;21425335;20211909		False	3	100;0;0	0.346	False		ENSG00000131931	ENSG00000131931	HGNC:20856													
TIMM8A	gene	TIMM8A	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Deafness-Dystonia-Optic Neuronopathy Syndrome;Mohr-Tranebjaerg syndrome, MIM# 304700			Dystonia;HP:0001332; Chorea;HP:0002072	11803487;11405816;32820032		False	3	100;0;0	0.346	True		ENSG00000126953	ENSG00000126953	HGNC:11817													
TNPO2	gene	TNPO2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM#	619556"			Dystonia;HP:0001332; Chorea;HP:0002072	34314705		False	3	100;0;0	0.346	True		ENSG00000105576	ENSG00000105576	HGNC:19998													
TOR1A	gene	TOR1A	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant or sporadic dystonia (DYT1);Early-Onset Primary Dystonia;Dystonia-1, torsion, 128100			Dystonia;HP:0001332; Chorea;HP:0002072	9288096;19955557;18477710;32243914;31583275;31347572		False	3	100;0;0	0.346	False		ENSG00000136827	ENSG00000136827	HGNC:3098													
TPK1	gene	TPK1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type);Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000196511	ENSG00000196511	HGNC:17358													
TREX1	gene	TREX1	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 1, dominant and recessive MIM#225750			Dystonia;HP:0001332; Chorea;HP:0002072	20131292		False	3	100;0;0	0.346	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TRPM3	gene	TRPM3	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224			Dystonia;HP:0001332; Chorea;HP:0002072	31278393;35146895		False	3	100;0;0	0.346	True		ENSG00000083067	ENSG00000083067	HGNC:17992													
TSPOAP1	gene	TSPOAP1	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 22, MIM# 620453			Dystonia;HP:0001332; Chorea;HP:0002072	33539324		False	3	100;0;0	0.346	True		ENSG00000005379	ENSG00000005379	HGNC:16831													
TUBB4A	gene	TUBB4A	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	hereditary whispering dysphonia;Dystonia 4, torsion, autosomal dominant, 128101;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072	23424103;23595291;33084096;32943487		False	3	100;0;0	0.346	False		ENSG00000104833	ENSG00000104833	HGNC:20774													
UBTF	gene	UBTF	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701			Dystonia;HP:0001332; Chorea;HP:0002072	28777933;29300972		False	3	100;0;0	0.346	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000108312	ENSG00000108312	HGNC:12511													
VAC14	gene	VAC14	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Striatonigral degeneration, childhood-onset 617054			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000103043	ENSG00000103043	HGNC:25507													
VAMP2	gene	VAMP2	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760;Dystonia;Cortical visual impairment;Seizures;Stereotypic behaviour;Generalized hypotonia;Intellectual disability			Dystonia;HP:0001332; Chorea;HP:0002072	30929742		False	3	100;0;0	0.346	True		ENSG00000220205	ENSG00000220205	HGNC:12643													
VPS13A	gene	VPS13A	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex parkinsonism;Choreoacanthocytosis 200150			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13D	gene	VPS13D	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 4, MIM#	607317"			Dystonia;HP:0001332; Chorea;HP:0002072	29604224;29518281		False	3	100;0;0	0.346	True		ENSG00000048707	ENSG00000048707	HGNC:23595													
VPS16	gene	VPS16	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 30, MIM#619291			Dystonia;HP:0001332; Chorea;HP:0002072	32808683		False	3	100;0;0	0.346	True		ENSG00000215305	ENSG00000215305	HGNC:14584													
VPS41	gene	VPS41	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay			Dystonia;HP:0001332; Chorea;HP:0002072	32808683;33764426		False	3	100;0;0	0.346	True		ENSG00000006715	ENSG00000006715	HGNC:12713													
VPS4A	gene	VPS4A	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CIMDAG syndrome MIM# 619273			Dystonia;HP:0001332; Chorea;HP:0002072	33186543;33186545		False	3	100;0;0	0.346	True	Other	ENSG00000132612	ENSG00000132612	HGNC:13488													
WARS2	gene	WARS2	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710			Dystonia;HP:0001332; Chorea;HP:0002072	29120065;31970218;34890876;28236339;28650581;28905505;30920170		False	3	100;0;0	0.346	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WDR45	gene	WDR45	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegeneration with brain iron accumulation 5 300894;beta-propeller protein-associated neurodegeneration;Dystonia			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR73	gene	WDR73	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway-Mowat syndrome 1, 251300			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000177082	ENSG00000177082	HGNC:25928													
XK	gene	XK	Expert list;Expert Review Green	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	McLeod syndrome with or without chronic granulomatous disease MIM#300842			Dystonia;HP:0001332; Chorea;HP:0002072	11761473		False	3	100;0;0	0.346	True		ENSG00000047597	ENSG00000047597	HGNC:12811													
YIF1B	gene	YIF1B	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement			Dystonia;HP:0001332; Chorea;HP:0002072	32006098;26077767		False	3	100;0;0	0.346	True		ENSG00000167645	ENSG00000167645	HGNC:30511													
YY1	gene	YY1	Expert Review Green;Royal Melbourne Hospital	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Gabriele-de Vries syndrome 617557			Dystonia;HP:0001332; Chorea;HP:0002072			False	3	0;0;0	0.346	False		ENSG00000100811	ENSG00000100811	HGNC:12856													
ZNF526	gene	ZNF526	Expert Review Green;Literature	Dystonia and Chorea		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dentici-Novelli neurodevelopmental syndrome, MIM# 619877			Dystonia;HP:0001332; Chorea;HP:0002072	21937992;25558065;33397746		False	3	100;0;0	0.346	True		ENSG00000167625	ENSG00000167625	HGNC:29415													
ARX_EIEE1_GCN1	str	ARX	Expert Review Green;Expert Review	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510			Dystonia;HP:0001332; Chorea;HP:0002072	11889467;33811808		False	3	100;0;0	0.346	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031767	25031814	25013650	25013697	GCN	16	23					
ARX_EIEE1_GCN2	str	ARX	Expert Review Green;Expert list	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510			Dystonia;HP:0001332; Chorea;HP:0002072	11889467;33811808		False	3	100;0;0	0.346	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031647	25031682	25013530	25013565	GCN	12	20					
ATN1_DRPLA_CAG	str	ATN1	Expert list;Expert Review Green;Expert Review Green;Expert list	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370			Dystonia;HP:0001332; Chorea;HP:0002072	8136840;8136826;29325606;20301664		False	3	100;0;0	0.346	False		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Expert list	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550			Dystonia;HP:0001332; Chorea;HP:0002072	26166205;24363131;26187722;25577942;21944779;21944778		False	3	100;0;0	0.346	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
HTT_HD_CAG	str	HTT	Expert list;Expert Review Green;Expert Review Green;Expert list	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease MIM#143100			Dystonia;HP:0001332; Chorea;HP:0002072	8458085;20301482;29325606		False	3	100;0;0	0.346	False		ENSG00000197386	ENSG00000197386	HGNC:4851	4	3076604	3076666	3074877	3074939	CAG	26	40					
JPH3_HDL2_CTG	str	JPH3	Expert list;Expert Review Green;Expert Review Green;Expert list	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438			Dystonia;HP:0001332; Chorea;HP:0002072	11558794;20301701		False	3	100;0;0	0.346	False		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
PRNP_CJD_octapeptide	str	PRNP	Expert list;Expert Review Green;Expert Review Green;Expert list	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440			Dystonia;HP:0001332; Chorea;HP:0002072	2159587;20301407		False	3	100;0;0	0.346	False		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
TAF1_XDP_CCCTCT	str	TAF1	Expert list;Expert Review Green;Expert Review Green;Expert list	Dystonia and Chorea		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Dystonia-Parkinsonism, X-linked MIM#314250			Dystonia;HP:0001332; Chorea;HP:0002072	17273961;29229810		False	3	100;0;0	0.346	False		ENSG00000147133	ENSG00000147133	HGNC:11535	X	70672905	70672979	71453055	71453129	CCCTCT	13	30					
TBP_SCA17_CAG	str	TBP	Expert list;Expert Review Green;Expert Review Green;Expert list	Dystonia and Chorea		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136			Dystonia;HP:0001332; Chorea;HP:0002072	10484774;20301611;29325606		False	3	100;0;0	0.346	False		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
