Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
AARS1	gene	AARS1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 29, MIM#616339			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28493438;25817015		False	3	100;0;0	1.10	True		ENSG00000090861	ENSG00000090861	HGNC:20													
AARS2	gene	AARS2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, progressive, with ovarian failure, 615889			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000124608	ENSG00000124608	HGNC:21022													
ABCD1	gene	ABCD1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Adrenoleukodystrophy, MIM#	300100"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000101986	ENSG00000101986	HGNC:61													
ABHD16A	gene	ABHD16A	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID: 34587489		False	3	100;0;0	1.10	True		ENSG00000204427	ENSG00000204427	HGNC:13921													
ACBD5	gene	ACBD5	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive leukodystrophy;syndromic cleft palate;ataxia;retinal dystrophy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	23105016;27799409		False	3	100;0;0	1.10	False		ENSG00000107897	ENSG00000107897	HGNC:23338													
ACER3	gene	ACER3	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, progressive, early childhood-onset, OMIM:617762			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	32816236;26792856;34281620		False	3	50;50;0	1.10	True		ENSG00000078124	ENSG00000078124	HGNC:16066													
ACOX1	gene	ACOX1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470;Mitchell syndrome, MIM# 618960			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	True		ENSG00000161533	ENSG00000161533	HGNC:119													
ACTA2	gene	ACTA2	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	multisystemic smooth muscle dysfunction syndrome MONDO:0013452			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29300374		False	3	100;0;0	1.10	True	Other	ENSG00000107796	ENSG00000107796	HGNC:130													
ADAR	gene	ADAR	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 6, MIM#	615010"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000160710	ENSG00000160710	HGNC:225													
AIFM1	gene	AIFM1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, MIM# 300232			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28842795;27102849		False	3	100;0;0	1.10	True		ENSG00000156709	ENSG00000156709	HGNC:8768													
AIMP1	gene	AIMP1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 3 260600			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000164022	ENSG00000164022	HGNC:10648													
ALDH3A2	gene	ALDH3A2	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Sjogren-Larsson syndrome, MIM#	270200"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000072210	ENSG00000072210	HGNC:403													
AP4B1	gene	AP4B1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 47, autosomal recessive	MIM#614066"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29193663		False	3	100;0;0	1.10	True		ENSG00000134262	ENSG00000134262	HGNC:572													
APP	gene	APP	Expert Review Green;Other	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset autosomal dominant Alzheimer disease MONDO:0015140			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36845656		False	3	100;0;0	1.10	False		ENSG00000142192	ENSG00000142192	HGNC:620													
ARSA	gene	ARSA	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Metachromatic leukodystrophy, MIM#	250100"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ASPA	gene	ASPA	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Canavan disease, MIM#	271900"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000108381	ENSG00000108381	HGNC:756													
ATP11A	gene	ATP11A	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, hypomyelinating, 24 , MIM# 619851			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	34403372;39432785		False	3	33;67;0	1.10	True	Other	ENSG00000068650	ENSG00000068650	HGNC:13552													
ATP7A	gene	ATP7A	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Menkes disease, 309400			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	26937406;21924848;29789304		False	3	100;0;0	1.10	True		ENSG00000165240	ENSG00000165240	HGNC:869													
AUH	gene	AUH	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type I, MIM# 250950			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000148090	ENSG00000148090	HGNC:890													
BCAP31	gene	BCAP31	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Deafness, dystonia, and cerebral hypomyelination, 300475			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000185825	ENSG00000185825	HGNC:16695													
BCS1L	gene	BCS1L	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III disorders;Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000074582	ENSG00000074582	HGNC:1020													
BLOC1S1	gene	BLOC1S1	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), BLOC1S1-related			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	33875846;41887224		False	3	100;0;0	1.10	True		ENSG00000135441	ENSG00000135441	HGNC:4200													
BOLA3	gene	BOLA3	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia, MIM#614299			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30302924;29654549;30302924		False	3	100;0;0	1.10	True		ENSG00000163170	ENSG00000163170	HGNC:24415													
BORCS8	gene	BORCS8	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	38128568		False	3	100;0;0	1.10	True		ENSG00000254901	ENSG00000254901	HGNC:37247													
C1R	gene	C1R	Expert Review Green;Literature;Other	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ehlers-Danlos syndrome, periodontal type, 1 (MIM# 130080);Leukodystrophy - adult onset			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	8958339;30535813		False	3	50;50;0	1.10	False	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000159403	ENSG00000159403	HGNC:1246													
C2orf69	gene	C2orf69	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	34038740;33945503		False	3	100;0;0	1.10	True		ENSG00000178074	ENSG00000178074	HGNC:26799													
CIC	gene	CIC	Expert list;Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Mental retardation, autosomal dominant 45 617600			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000079432	ENSG00000079432	HGNC:14214													
CLCN2	gene	CLCN2	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with ataxia, MIM#	615651"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	23707145		False	3	100;0;0	1.10	True		ENSG00000114859	ENSG00000114859	HGNC:2020													
CLDN11	gene	CLDN11	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypomyelinating leukodystrophy-22, MIM#619328			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	33313762		False	3	100;0;0	1.10	True		ENSG00000013297	ENSG00000013297	HGNC:8514													
CLPP	gene	CLPP	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 3, MIM#614129			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27899912		False	3	100;0;0	1.10	True		ENSG00000125656	ENSG00000125656	HGNC:2084													
CNP	gene	CNP	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 20, MIM# 619071			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	32128616;12590258;40396300		False	3	50;50;0	1.10	True		ENSG00000173786	ENSG00000173786	HGNC:2158													
CNTNAP1	gene	CNTNAP1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelinating neuropathy, congenital, 3, MIM# 618186;Lethal congenital contracture syndrome 7, MIM# 616286			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28374019;29882456		False	3	100;0;0	1.10	True		ENSG00000108797	ENSG00000108797	HGNC:8011													
COA7	gene	COA7	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27683825;29718187		False	3	100;0;0	1.10	True		ENSG00000162377	ENSG00000162377	HGNC:25716													
COA8	gene	COA8	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, MIM# 220110			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25175347		False	3	100;0;0	1.10	True		ENSG00000256053	ENSG00000256053	HGNC:20492													
COL4A1	gene	COL4A1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, 611773;Brain small vessel disease with or without ocular anomalies, 175780			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000187498	ENSG00000187498	HGNC:2202													
COLGALT1	gene	COLGALT1	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain small vessel disease 3 MIM#618360			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30412317;33709034;31759980		False	3	100;0;0	1.10	True		ENSG00000130309	ENSG00000130309	HGNC:26182													
COQ2	gene	COQ2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy;General Leukodystrophy & Mitochondrial Leukoencephalopathy;Coenzyme Q10 deficiency, primary, 1			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000173085	ENSG00000173085	HGNC:25223													
COX10	gene	COX10	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy;General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial complex IV disorder			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000006695	ENSG00000006695	HGNC:2260													
COX15	gene	COX15	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy;Mitochondrial complex IV disorders			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000014919	ENSG00000014919	HGNC:2263													
CSF1R	gene	CSF1R	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukoencephalopathy, diffuse hereditary, with spheroids, 221820			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSMD1	gene	CSMD1	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID 38816421		False	3	100;0;0	1.10	True		ENSG00000183117	ENSG00000183117	HGNC:14026													
CST3	gene	CST3	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	38489591		False	3	100;0;0	1.10	False		ENSG00000101439	ENSG00000101439	HGNC:2475													
CTC1	gene	CTC1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebroretinal microangiopathy with calcifications and cysts, MIM#	612199"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	22267198;22387016		False	3	100;0;0	1.10	True		ENSG00000178971	ENSG00000178971	HGNC:26169													
CTSA	gene	CTSA	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Brain small vessel disease 6 with leukoencephalopathy, MIM# 621394			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31177426		False	3	100;0;0	1.10	False		ENSG00000064601	ENSG00000064601	HGNC:9251													
CYP27A1	gene	CYP27A1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, 213700			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP7B1	gene	CYP7B1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 5A, autosomal recessive, MIM#	270800"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	24117163;19439420;19187859		False	3	100;0;0	1.10	True		ENSG00000172817	ENSG00000172817	HGNC:2652													
D2HGDH	gene	D2HGDH	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L2-Hydroxyglutaric aciduria			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000180902	ENSG00000180902	HGNC:28358													
DARS1	gene	DARS1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM#	615281"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	23643384		False	3	100;0;0	1.10	True		ENSG00000115866	ENSG00000115866	HGNC:2678													
DARS2	gene	DARS2	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM#	611105"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	17384640;15002045;16788019		False	3	100;0;0	1.10	True		ENSG00000117593	ENSG00000117593	HGNC:25538													
DCAF17	gene	DCAF17	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Woodhouse-Sakati syndrome, MIM#	241080"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	19026396;20507343		False	3	100;0;0	1.10	True		ENSG00000115827	ENSG00000115827	HGNC:25784													
DEGS1	gene	DEGS1	Expert list;Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 18 618404			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000143753	ENSG00000143753	HGNC:13709													
DENND5B	gene	DENND5B	Expert Review Green;Other	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with white matter anomalies, MONDO:0700092, DENND5B-related			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID: 38387458		False	3	100;0;0	1.10	True		ENSG00000170456	ENSG00000170456	HGNC:28338													
DGUOK	gene	DGUOK	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial Leukoencephalopathy;Mitochondrial DNA depletion syndrome 3			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000114956	ENSG00000114956	HGNC:2858													
DPYD	gene	DPYD	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dihydropyrimidine dehydrogenase deficiency 274270;5-fluorouracil toxicity 274270			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000188641	ENSG00000188641	HGNC:3012													
EARS2	gene	EARS2	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Combined oxidative phosphorylation deficiency 12, MIM#	614924;Leukoencephalopathy with thalamus and brainstem involvement and high lactate"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	22492562;23008233;25854774;26619324;26893310		False	3	100;0;0	1.10	True		ENSG00000103356	ENSG00000103356	HGNC:29419													
EIF2AK2	gene	EIF2AK2	Expert Review;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	32197074		False	3	100;0;0	1.10	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
EIF2B1	gene	EIF2B1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000111361	ENSG00000111361	HGNC:3257													
EIF2B2	gene	EIF2B2	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000119718	ENSG00000119718	HGNC:3258													
EIF2B3	gene	EIF2B3	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000070785	ENSG00000070785	HGNC:3259													
EIF2B4	gene	EIF2B4	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000115211	ENSG00000115211	HGNC:3260													
EIF2B5	gene	EIF2B5	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000145191	ENSG00000145191	HGNC:3261													
ELOVL1	gene	ELOVL1	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, MIM# 618527			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29496980;32123819;30487246		False	3	100;0;0	1.10	False		ENSG00000066322	ENSG00000066322	HGNC:14418													
ENTPD1	gene	ENTPD1	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 64, autosomal recessive, MIM# 615683			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	35471564		False	3	100;0;0	1.10	True		ENSG00000138185	ENSG00000138185	HGNC:3363													
EPRS1	gene	EPRS1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 15, MIM#	617951"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29576217		False	3	100;0;0	1.10	True		ENSG00000136628	ENSG00000136628	HGNC:3418													
ERCC6	gene	ERCC6	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne syndrome;UV-sensitive syndrome;General Leukodystrophy & Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000225830	ENSG00000225830	HGNC:3438													
ERCC8	gene	ERCC8	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne Syndrome;UV-sensitive syndrome;General Leukodystrophy & Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000049167	ENSG00000049167	HGNC:3439													
ETFDH	gene	ETFDH	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy;Glutaric Acidemia IIC			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000171503	ENSG00000171503	HGNC:3483													
FA2H	gene	FA2H	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 35, autosomal recessive, MIM#612319			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31837835;30446360;22965561;21592092		False	3	100;0;0	1.10	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FIG4	gene	FIG4	Expert list;Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4J 611228;Yunis-Varon syndrome 216340;leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30740813;29688489		False	3	100;0;0	1.10	False		ENSG00000112367	ENSG00000112367	HGNC:16873													
FOLR1	gene	FOLR1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration due to cerebral folate transport deficiency 613068			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000110195	ENSG00000110195	HGNC:3791													
FUCA1	gene	FUCA1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fucosidosis;General Leukodystrophy & Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000179163	ENSG00000179163	HGNC:4006													
GALC	gene	GALC	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Krabbe disease, MIM#	245200"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000054983	ENSG00000054983	HGNC:4115													
GBE1	gene	GBE1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyglucosan body disease, adult form, 263570			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000114480	ENSG00000114480	HGNC:4180													
GFAP	gene	GFAP	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Alexander disease, MIM#	203450"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000131095	ENSG00000131095	HGNC:4235													
GFM1	gene	GFM1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 1;Mitochondrial Leukoencephalopathy;General Leukodystrophy & Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000168827	ENSG00000168827	HGNC:13780													
GJA1	gene	GJA1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31023660		False	3	100;0;0	1.10	False		ENSG00000152661	ENSG00000152661	HGNC:4274													
GJB1	gene	GJB1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800;Reversible posterior leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31842800		False	3	100;0;0	1.10	False		ENSG00000169562	ENSG00000169562	HGNC:4283													
GJC2	gene	GJC2	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 2, MIM#	608804"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	22669416;24374284;15192806		False	3	100;0;0	1.10	True		ENSG00000198835	ENSG00000198835	HGNC:17494													
GLA	gene	GLA	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Fabry disease, Fabry disease, cardiac variant,  301500			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000102393	ENSG00000102393	HGNC:4296													
GLB1	gene	GLB1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"GM1-gangliosidosis, type I, MIM#	230500;GM1-gangliosidosis, type II, MIM#	230600"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25691190		False	3	100;0;0	1.10	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GLRX5	gene	GLRX5	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spasticity, childhood-onset, with hyperglycinemia 616859			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID: 24334290;30770271		False	3	100;0;0	1.10	True		ENSG00000182512	ENSG00000182512	HGNC:20134													
GPRC5B	gene	GPRC5B	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephalic leukoencephalopathy with subcortical cysts 3 MIM#620447			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	37143309		False	3	100;0;0	1.10	True		ENSG00000167191	ENSG00000167191	HGNC:13308													
GRN	gene	GRN	Expert Review Green;Other	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	GRN-related frontotemporal lobar degeneration with Tdp43 inclusions MONDO:0011842			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36970046;36632182		False	3	100;0;0	1.10	False		ENSG00000030582	ENSG00000030582	HGNC:4601													
HEPACAM	gene	HEPACAM	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	"Megalencephalic leukoencephalopathy with subcortical cysts 2A, MIM#	613925;Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, MIM#	613926"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	21419380;21419380		False	3	100;0;0	1.10	True		ENSG00000165478	ENSG00000165478	HGNC:26361													
HEXA	gene	HEXA	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Tay-Sachs disease, MIM#	272800"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
HIKESHI	gene	HIKESHI	Expert list;Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 13, MIM#616881			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000149196	ENSG00000149196	HGNC:26938													
HMBS	gene	HMBS	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, porphyria-related, MIM# 620711			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27558376;34089223		False	3	50;50;0	1.10	True		ENSG00000256269	ENSG00000256269	HGNC:4982													
HMGCL	gene	HMGCL	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMG-CoA lyase deficiency, 246450			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	11461194		False	3	100;0;0	1.10	True		ENSG00000117305	ENSG00000117305	HGNC:5005													
HPDL	gene	HPDL	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	32707086		False	3	100;0;0	1.10	True		ENSG00000186603	ENSG00000186603	HGNC:28242													
HSD17B4	gene	HSD17B4	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy;Peroxisome-Associated Disorders & Zellweger Syndrome;D-bifunctional protein deficiency			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000133835	ENSG00000133835	HGNC:5213													
HSPD1	gene	HSPD1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 13, autosomal dominant, 605280;Leukodystrophy, hypomyelinating, 4, 612233			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	18571143;27405012;32532876;28377887;27405012		False	3	100;0;0	1.10	True		ENSG00000144381	ENSG00000144381	HGNC:5261													
HTRA1	gene	HTRA1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, 616779;CARASIL syndrome, 600142			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000166033	ENSG00000166033	HGNC:9476													
HYCC1	gene	HYCC1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelination and Congenital Cataract;Leukodystrophy, hypomyelinating, 5, 610532			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000122591	ENSG00000122591	HGNC:24587													
IBA57	gene	IBA57	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 3, MIM#615330			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	23462291;25971455;27785568;28671726;28913435		False	3	100;0;0	1.10	True		ENSG00000181873	ENSG00000181873	HGNC:27302													
IFIH1	gene	IFIH1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Aicardi-Goutieres syndrome 7 MIM#615846			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000115267	ENSG00000115267	HGNC:18873													
ISCA1	gene	ISCA1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 5 MIM#617613			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28356563;32092383;31016283;30113620;30105122		False	3	100;0;0	1.10	True		ENSG00000135070	ENSG00000135070	HGNC:28660													
ISCA2	gene	ISCA2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 4, 616370			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25539947;29297947;29122497;29359243		False	3	100;0;0	1.10	True		ENSG00000165898	ENSG00000165898	HGNC:19857													
KARS1	gene	KARS1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with or without deafness (LEPID), MIM#619147			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30737337;31116475;30715177		False	3	100;0;0	1.10	True		ENSG00000065427	ENSG00000065427	HGNC:6215													
KIF5A	gene	KIF5A	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myoclonus, intractable, neonatal, MIM#617235			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27463701;27414745		False	3	100;0;0	1.10	True		ENSG00000155980	ENSG00000155980	HGNC:6323													
L2HGDH	gene	L2HGDH	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"L-2-hydroxyglutaric aciduria, MIM#	236792"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
LAMB1	gene	LAMB1	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cystic leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29888467;25925986;34606115		False	3	50;50;0	1.10	True		ENSG00000091136	ENSG00000091136	HGNC:6486													
LARS2	gene	LARS2	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	32442335;30737337		False	3	100;0;0	1.10	False		ENSG00000011376	ENSG00000011376	HGNC:17095													
LIG3	gene	LIG3	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	33855352		False	3	100;0;0	1.10	True		ENSG00000005156	ENSG00000005156	HGNC:6600													
LMNB1	gene	LMNB1	Australian Genomcis Health Alliance Leukodystrophy Flagship;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500;Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	16951681;30842973		False	3	100;0;0	1.10	False		ENSG00000113368	ENSG00000113368	HGNC:6637													
LYRM7	gene	LYRM7	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	615838;Mitochondrial complex III deficiency, nuclear type 8;leukoencephalopathy and complex III deficiency;severe encephalopathy, lactic acidosis and profound, isolated cIII deficiency in skeletal muscle			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000186687	ENSG00000186687	HGNC:28072													
MAN2B1	gene	MAN2B1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mannosidosis, alpha-, types I and II, MIM#248500			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000104774	ENSG00000104774	HGNC:6826													
MAPT	gene	MAPT	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"semantic dementia	MONDO:0010857"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	33802612;36970046		False	3	100;0;0	1.10	False	Other	ENSG00000186868	ENSG00000186868	HGNC:6893													
MCOLN1	gene	MCOLN1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mucolipidosis IV, MIM#	252650"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	10973263;11030752		False	3	100;0;0	1.10	True		ENSG00000090674	ENSG00000090674	HGNC:13356													
MEF2C	gene	MEF2C	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, MIM#	613443"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27255693;20333642		False	3	100;0;0	1.10	True		ENSG00000081189	ENSG00000081189	HGNC:6996													
MLC1	gene	MLC1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Megalencephalic leukoencephalopathy with subcortical cysts, MIM#	604004"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	11254442;21419380;21624973		False	3	100;0;0	1.10	True		ENSG00000100427	ENSG00000100427	HGNC:17082													
MTFMT	gene	MTFMT	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 15;22499348;23499752;614947			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000103707	ENSG00000103707	HGNC:29666													
MTHFR	gene	MTHFR	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria due to MTHFR deficiency, 236250			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29391032		False	3	100;0;0	1.10	False		ENSG00000177000	ENSG00000177000	HGNC:7436													
MT-ND4	gene	MT-ND4	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4-related			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231		False	3	100;0;0	1.10	True		ENSG00000198886	ENSG00000198886	HGNC:7459													
NAXD	gene	NAXD	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 2, 618321			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30576410;31755961;32462209		False	3	100;0;0	1.10	True		ENSG00000213995	ENSG00000213995	HGNC:25576													
NAXE	gene	NAXE	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, MIM#617186			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27122014;27616477;31758406		False	3	100;0;0	1.10	True		ENSG00000163382	ENSG00000163382	HGNC:18453													
NDUFAF1	gene	NDUFAF1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000137806	ENSG00000137806	HGNC:18828													
NDUFAF3	gene	NDUFAF3	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency 252010			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000178057	ENSG00000178057	HGNC:29918													
NDUFS1	gene	NDUFS1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency;General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial complex I disorders;MITOCHONDRIAL RESPIRATORY CHAIN COMPLEX I DEFICIENCY;Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000023228	ENSG00000023228	HGNC:7707													
NDUFS2	gene	NDUFS2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I disorders;Leigh syndrome;Mitochondrial Leukoencephalopathy;Leigh syndrome associated with mitochondrial complex I deficiency			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000158864	ENSG00000158864	HGNC:7708													
NDUFS4	gene	NDUFS4	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency;Mitochondrial complex I disorders;MITOCHONDRIAL RESPIRATORY CHAIN COMPLEX I DEFICIENCY;Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000164258	ENSG00000164258	HGNC:7711													
NDUFS7	gene	NDUFS7	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial respiratory chain complex I deficiency;Leigh syndrome;Genetic leukoencephalopathies: mitochondrial disorders;Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000115286	ENSG00000115286	HGNC:7714													
NDUFS8	gene	NDUFS8	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I disorders;Leigh syndrome due to mitochondrial complex I deficiency;Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000110717	ENSG00000110717	HGNC:7715													
NDUFV1	gene	NDUFV1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000167792	ENSG00000167792	HGNC:7716													
NDUFV2	gene	NDUFV2	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial complex I deficiency, nuclear type 7	(MIM#618229)"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	33811136		False	3	100;0;0	1.10	True		ENSG00000178127	ENSG00000178127	HGNC:7717													
NFE2L2	gene	NFE2L2	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Immunodeficiency, developmental delay, and hypohomocysteinemia MONDO:0060591;Disorders of glutathione metabolism			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29018201		False	3	100;0;0	1.10	True	Other	ENSG00000116044	ENSG00000116044	HGNC:7782													
NFU1	gene	NFU1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 1, MIM#605711			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29441221;21944046;22077971;32747156		False	3	100;0;0	1.10	True		ENSG00000169599	ENSG00000169599	HGNC:16287													
NKX6-2	gene	NKX6-2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000148826	ENSG00000148826	HGNC:19321													
NOTCH1	gene	NOTCH1	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	35947102		False	3	100;0;0	1.10	True	Other	ENSG00000148400	ENSG00000148400	HGNC:7881													
NOTCH3	gene	NOTCH3	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, NOTCH3-related;Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000074181	ENSG00000074181	HGNC:7883													
NPC1	gene	NPC1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Niemann-Pick disease, type C1/D, MIM#	257220"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	26910362;29406968		False	3	100;0;0	1.10	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NUBPL	gene	NUBPL	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency;Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000151413	ENSG00000151413	HGNC:20278													
PAFAH1B1	gene	PAFAH1B1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Lissencephaly 1, MIM#	607432;Subcortical laminar heterotopia, MIM#	607432;MONDO:0011830"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31370080;30568308;20301752		False	3	100;0;0	1.10	True		ENSG00000007168	ENSG00000007168	HGNC:8574													
PAH	gene	PAH	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phenylketonuria, [Hyperphenylalaninemia, non-PKU mild], 261600			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31636599;32141105		False	3	100;0;0	1.10	False		ENSG00000171759	ENSG00000171759	HGNC:8582													
PC	gene	PC	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate carboxylase deficiency, MIM#266150			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000173599	ENSG00000173599	HGNC:8636													
PEX1	gene	PEX1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 1B (NALD/IRD), 601539			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000127980	ENSG00000127980	HGNC:8850													
PEX10	gene	PEX10	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 6B, 614871			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000157911	ENSG00000157911	HGNC:8851													
PEX11B	gene	PEX11B	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Peroxisome biogenesis disorder 14B, 614920			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000131779	ENSG00000131779	HGNC:8853													
PEX12	gene	PEX12	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 3A, 614859;Peroxisome biogenesis disorder 3B, 266510			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000108733	ENSG00000108733	HGNC:8854													
PEX13	gene	PEX13	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 11B, 614885;Peroxisome biogenesis disorder 11A (Zellweger), 614883			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000162928	ENSG00000162928	HGNC:8855													
PEX14	gene	PEX14	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 13A (Zellweger), 614887			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000142655	ENSG00000142655	HGNC:8856													
PEX16	gene	PEX16	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 8A (Zellweger), 614876;Peroxisome biogenesis disorder 8B, 614877			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000121680	ENSG00000121680	HGNC:8857													
PEX19	gene	PEX19	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 12A (Zellweger), 614886			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000162735	ENSG00000162735	HGNC:9713													
PEX2	gene	PEX2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 5B, 614867;Peroxisome biogenesis disorder 5A (Zellweger) 614866			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000164751	ENSG00000164751	HGNC:9717													
PEX26	gene	PEX26	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 7A (Zellweger), 614872;Peroxisome biogenesis disorder 7B, 614873			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000215193	ENSG00000215193	HGNC:22965													
PEX3	gene	PEX3	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 10A (Zellweger), 614882;?Peroxisome biogenesis disorder 10B, 617370			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000034693	ENSG00000034693	HGNC:8858													
PEX5	gene	PEX5	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 2A (Zellweger), 214110;Peroxisome biogenesis disorder 2B, 202370			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000139197	ENSG00000139197	HGNC:9719													
PEX6	gene	PEX6	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 4A (Zellweger), MIM# 614862			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	20301621, 19877282		False	3	100;0;0	1.10	True		ENSG00000124587	ENSG00000124587	HGNC:8859													
PEX7	gene	PEX7	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 9B, 614879			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000112357	ENSG00000112357	HGNC:8860													
PI4KA	gene	PI4KA	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental syndrome with hypomyelinating leukodystrophy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID: 34415322		False	3	100;0;0	1.10	True		ENSG00000241973	ENSG00000241973	HGNC:8983													
PLP1	gene	PLP1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Pelizaeus-Merzbacher disease, MIM#	312080"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000123560	ENSG00000123560	HGNC:9086													
POLG	gene	POLG	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM# 613662			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLR1C	gene	POLR1C	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 11, MIM#	616494"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	26151409;32042905		False	3	100;0;0	1.10	True		ENSG00000171453	ENSG00000171453	HGNC:20194													
POLR3A	gene	POLR3A	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	21855841		False	3	100;0;0	1.10	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3B	gene	POLR3B	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#	614381"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27512013;22036171;22036172		False	3	100;0;0	1.10	True		ENSG00000013503	ENSG00000013503	HGNC:30348													
POLR3K	gene	POLR3K	Expert Review;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3-related leukodystrophy MONDO:0700282			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30584594;33659930;https://doi.org/10.1155/2024/8807171		False	3	50;50;0	1.10	True		ENSG00000161980	ENSG00000161980	HGNC:14121													
PPP1R21	gene	PPP1R21	Expert Review;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, facial dysmorphism, and brain abnormalities, MIM# 619383;Hypotonia;intellectual disability;white matter abnormalities			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30520571		False	3	100;0;0	1.10	True		ENSG00000162869	ENSG00000162869	HGNC:30595													
PRNP	gene	PRNP	Expert Review Green;Other	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	fatal familial insomnia MONDO:0010808			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25220284;24252267		False	3	100;0;0	1.10	False	Other	ENSG00000171867	ENSG00000171867	HGNC:9449													
PSAP	gene	PSAP	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Metachromatic leukodystrophy due to SAP-b deficiency, MIM#	249900"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000197746	ENSG00000197746	HGNC:9498													
PSEN1	gene	PSEN1	Expert Review Green;Other	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset autosomal dominant Alzheimer disease MONDO:0015140			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36845656		False	3	100;0;0	1.10	False	Other	ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN2	gene	PSEN2	Expert Review Green;Other	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset autosomal dominant Alzheimer disease MONDO:0015140			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36845656		False	3	100;0;0	1.10	False	Other	ENSG00000143801	ENSG00000143801	HGNC:9509													
PTEN	gene	PTEN	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cowden syndrome 1, MIM# 158350			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29720545;29152901;30664625		False	3	100;0;0	1.10	True		ENSG00000171862	ENSG00000171862	HGNC:9588													
PYCR2	gene	PYCR2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 10, MIM# 616420			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25865492;27130255		False	3	100;0;0	1.10	True		ENSG00000143811	ENSG00000143811	HGNC:30262													
RAB11B	gene	RAB11B	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29106825		False	3	100;0;0	1.10	False		ENSG00000185236	ENSG00000185236	HGNC:9761													
RARS1	gene	RARS1	Australian Genomcis Health Alliance Leukodystrophy Flagship;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 9 616140			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000113643	ENSG00000113643	HGNC:9870													
RNASEH2A	gene	RNASEH2A	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 4, MIM#	610333"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	16845400;23592335;17846997		False	3	100;0;0	1.10	True		ENSG00000104889	ENSG00000104889	HGNC:18518													
RNASEH2B	gene	RNASEH2B	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 2, MIM#	610181"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	16845400		False	3	100;0;0	1.10	True		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2C	gene	RNASEH2C	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 3, MIM#	610329"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	16845400;23322642		False	3	100;0;0	1.10	True		ENSG00000172922	ENSG00000172922	HGNC:24116													
RNASET2	gene	RNASET2	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy, cystic, without megalencephaly, MIM#	612951"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	19525954		False	3	100;0;0	1.10	True		ENSG00000026297	ENSG00000026297	HGNC:21686													
RNF220	gene	RNF220	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	33964137;10881263		False	3	100;0;0	1.10	True		ENSG00000187147	ENSG00000187147	HGNC:25552													
RPIA	gene	RPIA	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ribose 5-phosphate isomerase deficiency, MIM#	608611"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31247379;14988808;31056085		False	3	100;0;0	1.10	True		ENSG00000153574	ENSG00000153574	HGNC:10297													
RRM2B	gene	RRM2B	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000048392	ENSG00000048392	HGNC:17296													
SAMHD1	gene	SAMHD1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 5, MIM#	612952"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	19525956		False	3	100;0;0	1.10	True		ENSG00000101347	ENSG00000101347	HGNC:15925													
SCO1	gene	SCO1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency 220110			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000133028	ENSG00000133028	HGNC:10603													
SCO2	gene	SCO2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1 604377			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		-	ENSG00000284194	HGNC:10604													
SDHA	gene	SDHA	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial respiratory chain complex II deficiency, MIM#252011			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000073578	ENSG00000073578	HGNC:10680													
SDHAF1	gene	SDHAF1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex II deficiency 252011			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000205138	ENSG00000205138	HGNC:33867													
SDHB	gene	SDHB	Australian Genomcis Health Alliance Leukodystrophy Flagship;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinate dehydrogenase-deficient leukoencephalopathy;Mitochondrial complex II deficiency, nuclear type 4, MIM# 619224;Complex II deficiency;mitochondrial leucoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	22972948;26925370;27604842		False	3	100;0;0	1.10	True		ENSG00000117118	ENSG00000117118	HGNC:10681													
SLC13A3	gene	SLC13A3	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384)			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30635937;35527102;https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID)		False	3	100;0;0	1.10	True		ENSG00000158296	ENSG00000158296	HGNC:14430													
SLC16A2	gene	SLC16A2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Allan-Herndon-Dudley syndrome, MIM# 300523;Hypomyelination			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	15980113;31410843;20301789		False	3	100;0;0	1.10	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC17A5	gene	SLC17A5	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Salla disease	604369;Sialic acid storage disorder, infantile	269920"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	16417876		False	3	100;0;0	1.10	True		ENSG00000119899	ENSG00000119899	HGNC:10933													
SLC25A12	gene	SLC25A12	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelination, global cerebral 612949			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000115840	ENSG00000115840	HGNC:10982													
SLC25A4	gene	SLC25A4	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000151729	ENSG00000151729	HGNC:10990													
SNORD118	gene	SNORD118	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy, brain calcifications, and cysts	614561"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27571260		False	3	100;0;0	1.10	True		ENSG00000200463	ENSG00000200463	HGNC:32952													
SOX10	gene	SOX10	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy;PERIPHERAL DEMYELINATING NEUROPATHY, CENTRAL DYSMYELINATING LEUKODYSTROPHY, WAARDENBURG SYNDROME, AND HIRSCHSPRUNG DISEASE;General Leukodystrophy & Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000100146	ENSG00000100146	HGNC:11190													
SPART	gene	SPART	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Troyer syndrome 275900			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28875386;15372254		False	3	100;0;0	1.10	False		ENSG00000133104	ENSG00000133104	HGNC:18514													
SPG11	gene	SPG11	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 11, autosomal recessive, MIM#	604360"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	18067136		False	3	100;0;0	1.10	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG21	gene	SPG21	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mast syndrome 248900			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	14564668		False	3	100;0;0	1.10	False		ENSG00000090487	ENSG00000090487	HGNC:20373													
SUCLA2	gene	SUCLA2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5;Mitochondrial Leukoencephalopathy;Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria)			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUMF1	gene	SUMF1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy;Multiple sulfatase deficiency			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000144455	ENSG00000144455	HGNC:20376													
SUPV3L1	gene	SUPV3L1	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, SUPV3L1-related			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	39596606;35023579;42466401;10.21203/rs.3.rs-4356120;36344539;34946966		False	3	100;0;0	1.10	True		ENSG00000156502	ENSG00000156502	HGNC:11471													
SURF1	gene	SURF1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome, due to COX IV deficiency;Mitochondrial Leukoencephalopathy;Mitochondrial complex IV disorder			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000148290	ENSG00000148290	HGNC:11474													
TACO1	gene	TACO1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000136463	ENSG00000136463	HGNC:24316													
TMEM106B	gene	TMEM106B	Australian Genomcis Health Alliance Leukodystrophy Flagship;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, hypomyelinating 16, MIM#617964			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000106460	ENSG00000106460	HGNC:22407													
TMEM163	gene	TMEM163	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hypomyelinating leukodystrophy, MONDO:0019046			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID: 35953447		False	3	100;0;0	1.10	True		ENSG00000152128	ENSG00000152128	HGNC:25380													
TMEM63A	gene	TMEM63A	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukodystrophy, hypomyelinating, 19, transient infantile 618688			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31587869		False	3	100;0;0	1.10	False		ENSG00000196187	ENSG00000196187	HGNC:29118													
TPP2	gene	TPP2	Expert Review;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25414442		False	3	100;0;0	1.10	False		ENSG00000134900	ENSG00000134900	HGNC:12016													
TREM2	gene	TREM2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, 618193			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	12080485;15883308		False	3	100;0;0	1.10	False		ENSG00000095970	ENSG00000095970	HGNC:17761													
TREX1	gene	TREX1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 1, dominant and recessive, MIM#	225750"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TUBB4A	gene	TUBB4A	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Leukodystrophy, hypomyelinating, 6, MIM#	612438"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	24850488;23582646		False	3	100;0;0	1.10	True		ENSG00000104833	ENSG00000104833	HGNC:20774													
TUFM	gene	TUFM	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 4, MIM# 610678;Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28132884;26741492;17160893		False	3	100;0;0	1.10	True		ENSG00000178952	ENSG00000178952	HGNC:12420													
TYMP	gene	TYMP	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 1 (MNGIE type);Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	0;0;0	1.10	False		ENSG00000025708	ENSG00000025708	HGNC:3148													
TYROBP	gene	TYROBP	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, 221770			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	1.10	False		ENSG00000011600	ENSG00000011600	HGNC:12449													
UFM1	gene	UFM1	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 14 617899			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29868776		False	3	100;0;0	1.10	True		ENSG00000120686	ENSG00000120686	HGNC:20597													
VPS11	gene	VPS11	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 12, MIM#616683			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27120463;26307567;27473128		False	3	100;0;0	1.10	True		ENSG00000160695	ENSG00000160695	HGNC:14583													
WARS1	gene	WARS1	Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities,MIM# 620317			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID: 35815345 PMID: 35790048		False	3	100;0;0	1.10	True		ENSG00000140105	ENSG00000140105	HGNC:12729													
WARS2	gene	WARS2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM#617710			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31282308;28650581;30920170		False	3	100;0;0	1.10	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
ZFYVE26	gene	ZFYVE26	Expert list;Expert Review Green	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 15, autosomal recessive, MIM# 270700			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	19084844		False	3	100;0;0	1.10	True		ENSG00000072121	ENSG00000072121	HGNC:20761													
ABCC9	gene	ABCC9	Expert Review Amber;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability and myopathy syndrome, MIM# 619719			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31575858		False	2	0;100;0	1.10	True		ENSG00000069431	ENSG00000069431	HGNC:60													
ANXA11	gene	ANXA11	Expert Review;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy and brain white matter abnormalities, MIM# 619733			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	34048612		False	2	0;100;0	1.10	False		ENSG00000122359	ENSG00000122359	HGNC:535													
AQP4	gene	AQP4	Expert Review Amber;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Megalencephalic leukoencephalopathy with subcortical cysts 4, remitting MIM#620448			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	37143309		False	2	0;100;0	1.10	True		ENSG00000171885	ENSG00000171885	HGNC:637													
ATP7B	gene	ATP7B	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease, 277900			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	16966556;12020274		False	2	0;100;0	1.10	False		ENSG00000123191	ENSG00000123191	HGNC:870													
COL4A2	gene	COL4A2	Expert Review Amber;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain small vessel disease 2B, autosomal recessive, MONDO:0980747			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30413629;27624120;24390199		False	2	0;50;50	1.10	True		ENSG00000134871	ENSG00000134871	HGNC:2203													
CYP2U1	gene	CYP2U1	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 56, autosomal recessive 615030			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27292318		False	2	0;100;0	1.10	False		ENSG00000155016	ENSG00000155016	HGNC:20582													
ERCC2	gene	ERCC2	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trichothiodystrophy 1, photosensitive 601675			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29451896		False	2	0;100;0	1.10	False		ENSG00000104884	ENSG00000104884	HGNC:3434													
FBP2	gene	FBP2	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Leukodystrophy, childhood-onset, remitting, MIM# 	619864"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	33977262		False	2	0;100;0	1.10	True		ENSG00000130957	ENSG00000130957	HGNC:3607													
FDX2	gene	FDX2	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy MIM#251900			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30010796		False	2	0;100;0	1.10	True		ENSG00000267673	ENSG00000267673	HGNC:30546													
GCDH	gene	GCDH	Expert Review Amber;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric aciduria, type I, MIM#231670			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	2	0;100;0	1.10	False		ENSG00000105607	ENSG00000105607	HGNC:4189													
GFPT1	gene	GFPT1	Expert list;Expert Review Amber;Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenia, congenital, 12, with tubular aggregates 610542;Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	30635494		False	2	50;50;0	1.10	False		ENSG00000198380	ENSG00000198380	HGNC:4241													
ITM2B	gene	ITM2B	Expert Review Amber;Other	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ABri amyloidosis MONDO:0008306			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	10775542		False	2	0;100;0	1.10	False	Other	ENSG00000136156	ENSG00000136156	HGNC:6174													
LSM7	gene	LSM7	Expert Review Amber;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy and cerebellar atrophy, MIM# 621191			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	https://doi.org/10.1016/j.xhgg.2021.100034;39420558		False	2	0;50;50	1.10	True		ENSG00000130332	ENSG00000130332	HGNC:20470													
MAL	gene	MAL	Expert Review Amber;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 28, MIM#  620978			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	35217805		False	2	0;100;0	1.10	True		ENSG00000172005	ENSG00000172005	HGNC:6817													
NDUFA2	gene	NDUFA2	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 13 618235;leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28857146;32154054;18513682		False	2	0;100;0	1.10	True		ENSG00000131495	ENSG00000131495	HGNC:7685													
NPC2	gene	NPC2	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-pick disease, type C2 607625			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25396745		False	2	0;100;0	1.10	False		ENSG00000119655	ENSG00000119655	HGNC:14537													
PLD3	gene	PLD3	Expert Review Amber;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID: 34267643		False	2	0;100;0	1.10	False		ENSG00000105223	ENSG00000105223	HGNC:17158													
PLEKHG2	gene	PLEKHG2	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy and acquired microcephaly with or without dystonia 616763			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	26573021		False	2	0;100;0	1.10	False		ENSG00000090924	ENSG00000090924	HGNC:29515													
POLG2	gene	POLG2	Expert Review Amber;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4 610131			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25655951		False	2	0;100;0	1.10	False		ENSG00000256525	ENSG00000256525	HGNC:9180													
POLR1A	gene	POLR1A	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 27, MIM# 620675			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28051070;36917474		False	2	0;67;33	1.10	True		ENSG00000068654	ENSG00000068654	HGNC:17264													
PPT1	gene	PPT1	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 1 256730			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	5706364;8576553		False	2	0;100;0	1.10	False		ENSG00000131238	ENSG00000131238	HGNC:9325													
RNF216	gene	RNF216	Expert Review Amber;Royal Melbourne Hospital	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and hypogonadotropic hypogonadism, 212840			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28334938;26250479		False	2	0;100;0	1.10	False		ENSG00000011275	ENSG00000011275	HGNC:21698													
SLC13A5	gene	SLC13A5	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 25 615905			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27913086		False	2	0;100;0	1.10	False		ENSG00000141485	ENSG00000141485	HGNC:23089													
SLC35B2	gene	SLC35B2	Expert Review Amber;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, MONDO:0019046, SLC35B2-related			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	35325049		False	2	0;100;0	1.10	True		ENSG00000157593	ENSG00000157593	HGNC:16872													
SLC7A2	gene	SLC7A2	Expert Review Amber;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, MONDO:0019046, SLC7A2-related			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	41015522		False	2	0;100;0	1.10	True		ENSG00000003989	ENSG00000003989	HGNC:11060													
SPAST	gene	SPAST	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spastic paraplegia 4, autosomal dominant 182601			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	23968121		False	2	0;100;0	1.10	False		ENSG00000021574	ENSG00000021574	HGNC:11233													
SPG7	gene	SPG7	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 7, autosomal recessive 607259			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	20108356;17646629		False	2	0;100;0	1.10	False		ENSG00000197912	ENSG00000197912	HGNC:11237													
TBCB	gene	TBCB	Expert Review Amber;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID: 40856104		False	2	0;100;0	1.10	True		ENSG00000105254	ENSG00000105254	HGNC:1989													
TOMM70	gene	TOMM70	Expert Review Amber;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, MONDO:0019046, TOMM70-related			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	32356556		False	2	0;100;0	1.10	True		ENSG00000154174	ENSG00000154174	HGNC:11985													
TWNK	gene	TWNK	Expert list;Expert Review Amber	Leukodystrophy		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), MIM# 271245			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31455269;19353676		False	2	0;100;0	1.10	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
C9orf72_FTDALS_GGGGCC	str	C9orf72	Literature;Expert Review Green;Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MONDO:0007105			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36970046;36632182		False	3	100;0;0	1.10	False		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Literature;Expert Review Green;Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	1.10	False		-	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
PRNP_CJD_octapeptide	str	PRNP	Literature;Expert Review Green;Expert Review Green;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	2159587;20301407		False	3	100;0;0	1.10	False		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
NAXE_NME_GGGCC	str	NAXE	Expert Review Amber;Literature;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 1 MONDO:0020781			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	39455596		False	2	0;100;0	1.10	True		ENSG00000163382	ENSG00000163382	HGNC:18453	1	156561557	156561575	156591765	156591783	GGGCC	7	200					
LMNB1 upstream region	region		Expert Review Green;Literature;Literature	Leukodystrophy		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Adult-onset autosomal dominant demyelinating leukodystrophy, MONDO:0008215			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	PMID: 30842973;30697589;25701871		False	3	100;0;0	1.10	False					5			126522203	126689287						80	cnv_loss	LMNB1 upstream region
