Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name AARS2 gene AARS2 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, progressive, with ovarian failure, 615889 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000124608 ENSG00000124608 HGNC:21022 ABCD1 gene ABCD1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Adrenoleukodystrophy, Adrenomyeloneuropathy, adult, 300100 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000101986 ENSG00000101986 HGNC:61 ACTA2 gene ACTA2 Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted multisystemic smooth muscle dysfunction syndrome MONDO:0013452 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 29300374 False 3 100;0;0 0.155 True Other ENSG00000107796 ENSG00000107796 HGNC:130 ADAR gene ADAR Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6, 615010 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000160710 ENSG00000160710 HGNC:225 ALDH3A2 gene ALDH3A2 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sjogren-Larsson syndrome, 270200 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000072210 ENSG00000072210 HGNC:403 APP gene APP Expert Review Green;Other Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted early-onset autosomal dominant Alzheimer disease MONDO:0015140 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 36845656 False 3 100;0;0 0.155 True ENSG00000142192 ENSG00000142192 HGNC:620 ARSA gene ARSA Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, 250100 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000100299 ENSG00000100299 HGNC:713 ASPA gene ASPA Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal General Leukodystrophy & Mitochondrial Leukoencephalopathy;Canavan disease, MIM# 271900 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 25655951 False 3 100;0;0 0.155 True ENSG00000108381 ENSG00000108381 HGNC:756 AUH gene AUH Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type I, MIM#250950 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 20855850 False 3 100;0;0 0.155 True ENSG00000148090 ENSG00000148090 HGNC:890 C1R gene C1R Expert Review Green;Literature;Other Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ehlers-Danlos syndrome, periodontal type, 1 (MIM# 130080);Leukodystrophy - adult onset Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 8958339;30535813 False 3 50;50;0 0.155 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000159403 ENSG00000159403 HGNC:1246 CLCN2 gene CLCN2 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with ataxia, 615651 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 23707145 False 3 100;0;0 0.155 True ENSG00000114859 ENSG00000114859 HGNC:2020 COL4A1 gene COL4A1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, 611773;Brain small vessel disease with or without ocular anomalies, 175780 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000187498 ENSG00000187498 HGNC:2202 CSF1R gene CSF1R Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukoencephalopathy, diffuse hereditary, with spheroids, 221820 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000182578 ENSG00000182578 HGNC:2433 CST3 gene CST3 Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 38489591 False 3 100;0;0 0.155 True ENSG00000101439 ENSG00000101439 HGNC:2475 CTSA gene CTSA Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Brain small vessel disease 6 with leukoencephalopathy, MIM# 621394 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31177426 False 3 100;0;0 0.155 True ENSG00000064601 ENSG00000064601 HGNC:9251 CYP27A1 gene CYP27A1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP7B1 gene CYP7B1 Expert list;Expert Review Green Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 5A, autosomal recessive 270800 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 24117163;19439420;19187859 False 3 100;0;0 0.155 True ENSG00000172817 ENSG00000172817 HGNC:2652 DARS gene DARS Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelination with brainstem and spinal cord involvement and leg spasticity, 615281 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 25527264;23643384 False 3 100;0;0 0.155 True ENSG00000115866 ENSG00000115866 HGNC:2678 DARS2 gene DARS2 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 17384640;15002045;16788019 False 3 100;0;0 0.155 True ENSG00000117593 ENSG00000117593 HGNC:25538 DCAF17 gene DCAF17 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Woodhouse-Sakati syndrome, MIM#241080 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31347785 False 3 100;0;0 0.155 True ENSG00000115827 ENSG00000115827 HGNC:25784 EIF2B1 gene EIF2B1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 20301435 False 3 100;0;0 0.155 True ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B2 gene EIF2B2 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MONDO:0011380 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 20301435 False 3 100;0;0 0.155 True ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B3 gene EIF2B3 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, MIM#603896, MONDO:0011380 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 20301435 False 3 100;0;0 0.155 True ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B4 gene EIF2B4 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, MIM#603896, MONDO:0011380 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 20301435 False 3 100;0;0 0.155 True ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B5 gene EIF2B5 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, 603896 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 20301435 False 3 100;0;0 0.155 True ENSG00000145191 ENSG00000145191 HGNC:3261 EPRS gene EPRS Expert list;Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 15, MIM#617951 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 29576217 False 3 100;0;0 0.155 True ENSG00000136628 ENSG00000136628 HGNC:3418 GALC gene GALC Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe disease, 245200 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000054983 ENSG00000054983 HGNC:4115 GBE1 gene GBE1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form, 263570 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000114480 ENSG00000114480 HGNC:4180 GFAP gene GFAP Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Alexander disease, 203450 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000131095 ENSG00000131095 HGNC:4235 GJA1 gene GJA1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31023660 False 3 100;0;0 0.155 True ENSG00000152661 ENSG00000152661 HGNC:4274 GJB1 gene GJB1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800;Reversible posterior leukoencephalopathy Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31842800 False 3 100;0;0 0.155 True ENSG00000169562 ENSG00000169562 HGNC:4283 GJC2 gene GJC2 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 2, 608804, Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000198835 ENSG00000198835 HGNC:17494 GLA gene GLA Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Fabry disease, Fabry disease, cardiac variant, 301500 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000102393 ENSG00000102393 HGNC:4296 GLB1 gene GLB1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1-gangliosidosis, type III, MIM#230650;white matter abnormality Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000170266 ENSG00000170266 HGNC:4298 GRN gene GRN Expert Review Green;Other Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted GRN-related frontotemporal lobar degeneration with Tdp43 inclusions MONDO:0011842 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 36970046;36632182 False 3 100;0;0 0.155 True ENSG00000030582 ENSG00000030582 HGNC:4601 HEPACAM gene HEPACAM Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Megalencephalic leukoencephalopathy with subcortical cysts 2A, 613925;Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, 613926 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 21419380;21419380 False 3 100;0;0 0.155 True ENSG00000165478 ENSG00000165478 HGNC:26361 HEXA gene HEXA Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms, Tay-Sachs disease, [Hex A pseudodeficiency], 272800 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000213614 ENSG00000213614 HGNC:4878 HTRA1 gene HTRA1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, 616779;CARASIL syndrome, 600142 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000166033 ENSG00000166033 HGNC:9476 L2HGDH gene L2HGDH Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal L-2-hydroxyglutaric aciduria, 236792 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 10399870 False 3 100;0;0 0.155 True ENSG00000087299 ENSG00000087299 HGNC:20499 LAMB1 gene LAMB1 Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Leukoencephalopathy, adult-onset, MIM# 621424" Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 32548278 False 3 33;0;67 0.155 True ENSG00000091136 ENSG00000091136 HGNC:6486 LARS2 gene LARS2 Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 32442335;30737337 False 3 100;0;0 0.155 True ENSG00000011376 ENSG00000011376 HGNC:17095 LIG3 gene LIG3 Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 33855352 False 3 100;0;0 0.155 True ENSG00000005156 ENSG00000005156 HGNC:6600 LMNB1 gene LMNB1 Australian Genomcis Health Alliance Leukodystrophy Flagship;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500;Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 16951681;30842973 False 3 100;0;0 0.155 True ENSG00000113368 ENSG00000113368 HGNC:6637 MAN2B1 gene MAN2B1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mannosidosis, alpha-, types I and II, MIM#248500 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000104774 ENSG00000104774 HGNC:6826 MAPT gene MAPT Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "semantic dementia MONDO:0010857" Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 33802612;36970046 False 3 100;0;0 0.155 True Other ENSG00000186868 ENSG00000186868 HGNC:6893 MTHFR gene MTHFR Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Homocystinuria due to MTHFR deficiency, 236250 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 29391032 False 3 100;0;0 0.155 True ENSG00000177000 ENSG00000177000 HGNC:7436 NOTCH1 gene NOTCH1 Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 35947102 False 3 100;0;0 0.155 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NOTCH3 gene NOTCH3 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal neurodevelopmental disorder MONDO:0700092, NOTCH3-related;Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000074181 ENSG00000074181 HGNC:7883 NPC1 gene NPC1 Expert list;Expert Review Green Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1/D 257220 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 26910362;29406968 False 3 100;0;0 0.155 True ENSG00000141458 ENSG00000141458 HGNC:7897 PAH gene PAH Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phenylketonuria, [Hyperphenylalaninemia, non-PKU mild], 261600 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31636599;32141105 False 3 100;0;0 0.155 True ENSG00000171759 ENSG00000171759 HGNC:8582 PLP1 gene PLP1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Pelizaeus-Merzbacher disease, 312080 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 16130097 False 3 100;0;0 0.155 True ENSG00000123560 ENSG00000123560 HGNC:9086 POLG gene POLG Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4B (MNGIE type) 613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000140521 ENSG00000140521 HGNC:9179 POLR1C gene POLR1C Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 11, MIM# 616494 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 26151409;32042905;33190326;34484918 False 3 0;100;0 0.155 True ENSG00000171453 ENSG00000171453 HGNC:20194 POLR3A gene POLR3A Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, 607694 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31306222 False 3 100;0;0 0.155 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3B gene POLR3B Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, 614381 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 25339210 False 3 100;0;0 0.155 True ENSG00000013503 ENSG00000013503 HGNC:30348 PRNP gene PRNP Expert Review Green;Other Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted fatal familial insomnia MONDO:0010808 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 25220284;24252267 False 3 100;0;0 0.155 True Other ENSG00000171867 ENSG00000171867 HGNC:9449 PSAP gene PSAP Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy due to SAP-b deficiency, 249900;Krabbe disease, atypical, 611722 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 26462614 False 3 100;0;0 0.155 True ENSG00000197746 ENSG00000197746 HGNC:9498 PSEN1 gene PSEN1 Expert Review Green;Other Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted early-onset autosomal dominant Alzheimer disease MONDO:0015140 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 36845656 False 3 100;0;0 0.155 True Other ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN2 gene PSEN2 Expert Review Green;Other Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted early-onset autosomal dominant Alzheimer disease MONDO:0015140 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 36845656 False 3 100;0;0 0.155 True Other ENSG00000143801 ENSG00000143801 HGNC:9509 PTEN gene PTEN Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cowden syndrome 1, MIM# 158350 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 29720545;29152901;30664625 False 3 100;0;0 0.155 True ENSG00000171862 ENSG00000171862 HGNC:9588 RNASEH2A gene RNASEH2A Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 4, 610333 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000104889 ENSG00000104889 HGNC:18518 RNASEH2B gene RNASEH2B Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 2, 610181 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000136104 ENSG00000136104 HGNC:25671 RNASEH2C gene RNASEH2C Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 3, 610329 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000172922 ENSG00000172922 HGNC:24116 RPIA gene RPIA Expert Review Green;Literature;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ribose 5-phosphate isomerase deficiency, MIM#608611 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31247379;14988808;31056085 False 3 100;0;0 0.155 True ENSG00000153574 ENSG00000153574 HGNC:10297 SAMHD1 gene SAMHD1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 5, 612952 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 19525956 False 3 100;0;0 0.155 True ENSG00000101347 ENSG00000101347 HGNC:15925 SLC17A5 gene SLC17A5 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal General Leukodystrophy & Mitochondrial Leukoencephalopathy Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 False ENSG00000119899 ENSG00000119899 HGNC:10933 SNORD118 gene SNORD118 Australian Genomcis Health Alliance Leukodystrophy Flagship;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 614561;Leukoencephalopathy, brain calcifications and cysts, 614561 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 27571260 False 3 100;0;0 0.155 True ENSG00000200463 ENSG00000200463 HGNC:32952 SPG11 gene SPG11 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2X, 616668;Spastic paraplegia 11, autosomal recessive, MIM#604360 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 18067136 False 3 100;0;0 0.155 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG21 gene SPG21 Expert list;Expert Review Green Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome 248900 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 14564668 False 3 100;0;0 0.155 True ENSG00000090487 ENSG00000090487 HGNC:20373 TPP2 gene TPP2 Expert Review;Expert Review Green Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 25414442 False 3 100;0;0 0.155 True ENSG00000134900 ENSG00000134900 HGNC:12016 TREM2 gene TREM2 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, 618193 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 12080485;15883308 False 3 100;0;0 0.155 True ENSG00000095970 ENSG00000095970 HGNC:17761 TREX1 gene TREX1 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 1, dominant and recessive, 225750;Vasculopathy, retinal, with cerebral leukodystrophy, 192315 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000213689 ENSG00000213689 HGNC:12269 TUBB4A gene TUBB4A Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukodystrophy, hypomyelinating, 6, MIM#612438 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 28791129 False 3 100;0;0 0.155 True ENSG00000104833 ENSG00000104833 HGNC:20774 TYMP gene TYMP Expert list;Expert Review Green Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM# 603041" Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 9924029;10852545 False 3 100;0;0 0.155 True ENSG00000025708 ENSG00000025708 HGNC:3148 TYROBP gene TYROBP Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, 221770 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000011600 ENSG00000011600 HGNC:12449 ZFYVE26 gene ZFYVE26 Expert Review Green;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 15, autosomal recessive, 270700 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 3 100;0;0 0.155 True ENSG00000072121 ENSG00000072121 HGNC:20761 AARS gene AARS Expert list;Expert Review Amber Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukoencephalopathy, hereditary diffuse, with spheroids 2, MIM# 619661 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31775912 False 2 0;100;0 0.155 True ENSG00000090861 ENSG00000090861 HGNC:20 ANXA11 gene ANXA11 Expert Review;Expert Review Amber Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy and brain white matter abnormalities, MIM# 619733 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 34048612 False 2 0;100;0 0.155 True ENSG00000122359 ENSG00000122359 HGNC:535 ATP7B gene ATP7B Expert list;Expert Review Amber Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease, 277900 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 16966556;12020274 False 2 0;100;0 0.155 True ENSG00000123191 ENSG00000123191 HGNC:870 CTC1 gene CTC1 Expert Review Amber;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebroretinal microangiopathy with calcifications and cysts, 612199 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 22267198;22387016;22532422 False 2 0;100;0 0.155 True ENSG00000178971 ENSG00000178971 HGNC:26169 GCDH gene GCDH Expert Review Amber;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric aciduria, type I, MIM#231670 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 2 0;100;0 0.155 True ENSG00000105607 ENSG00000105607 HGNC:4189 ITM2B gene ITM2B Expert Review Amber;Other Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ABri amyloidosis MONDO:0008306 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 10775542 False 2 0;100;0 0.155 True Other ENSG00000136156 ENSG00000136156 HGNC:6174 MCOLN1 gene MCOLN1 Expert Review Amber;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucolipidosis IV, 252650 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 False 2 0;100;0 0.155 True ENSG00000090674 ENSG00000090674 HGNC:13356 MLC1 gene MLC1 Expert Review Amber;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Megalencephalic leukoencephalopathy with subcortical cysts (MLC);General Leukodystrophy & Mitochondrial Leukoencephalopathy Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 11254442;21419380;21624973 False 2 0;100;0 0.155 True ENSG00000100427 ENSG00000100427 HGNC:17082 NPC2 gene NPC2 Expert list;Expert Review Amber Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-pick disease, type C2 607625 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 25396745 False 2 0;100;0 0.155 True ENSG00000119655 ENSG00000119655 HGNC:14537 PLD3 gene PLD3 Expert Review Amber;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 PMID: 34267643 False 2 0;100;0 0.155 False ENSG00000105223 ENSG00000105223 HGNC:17158 POLG2 gene POLG2 Expert Review Amber;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4 610131 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 25655951 False 2 0;100;0 0.155 True ENSG00000256525 ENSG00000256525 HGNC:9180 RNASET2 gene RNASET2 Expert Review Amber;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, cystic, without megalencephaly, 612951 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 19525954 False 2 0;100;0 0.155 True ENSG00000026297 ENSG00000026297 HGNC:21686 RNF216 gene RNF216 Expert Review Amber;Royal Melbourne Hospital Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism, 212840 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 28334938;26250479 False 2 0;100;0 0.155 True ENSG00000011275 ENSG00000011275 HGNC:21698 SPAST gene SPAST Expert list;Expert Review Amber Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 4, autosomal dominant 182601 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 23968121 False 2 0;100;0 0.155 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPG7 gene SPG7 Expert list;Expert Review Amber Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive 607259 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 20108356;17646629 False 2 0;100;0 0.155 True ENSG00000197912 ENSG00000197912 HGNC:11237 TWNK gene TWNK Expert list;Expert Review Amber Leukodystrophy - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 7 (hepatocerebral type) 271245;Perrault syndrome 5 616138;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 609286 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31455269;19353676 False 2 0;100;0 0.155 True ENSG00000107815 ENSG00000107815 HGNC:1160 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MONDO:0007105 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 36970046;36632182 False 3 100;0;0 0.155 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 0.155 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 PRNP_CJD_octapeptide str PRNP Expert Review Green;Literature Leukodystrophy - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500 2159587;20301407 False 3 100;0;0 0.155 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5