Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
AARS2	gene	AARS2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, progressive, with ovarian failure, 615889			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000124608	ENSG00000124608	HGNC:21022													
ABCD1	gene	ABCD1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Adrenoleukodystrophy, Adrenomyeloneuropathy, adult, 300100			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000101986	ENSG00000101986	HGNC:61													
ACTA2	gene	ACTA2	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	multisystemic smooth muscle dysfunction syndrome MONDO:0013452			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29300374		False	3	100;0;0	0.155	True	Other	ENSG00000107796	ENSG00000107796	HGNC:130													
ADAR	gene	ADAR	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 6, 615010			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000160710	ENSG00000160710	HGNC:225													
ALDH3A2	gene	ALDH3A2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sjogren-Larsson syndrome, 270200			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000072210	ENSG00000072210	HGNC:403													
APP	gene	APP	Expert Review Green;Other	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset autosomal dominant Alzheimer disease MONDO:0015140			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36845656		False	3	100;0;0	0.155	True		ENSG00000142192	ENSG00000142192	HGNC:620													
ARSA	gene	ARSA	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy, 250100			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ASPA	gene	ASPA	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy;Canavan disease, MIM# 271900			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25655951		False	3	100;0;0	0.155	True		ENSG00000108381	ENSG00000108381	HGNC:756													
AUH	gene	AUH	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type I, MIM#250950			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	20855850		False	3	100;0;0	0.155	True		ENSG00000148090	ENSG00000148090	HGNC:890													
C1R	gene	C1R	Expert Review Green;Literature;Other	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ehlers-Danlos syndrome, periodontal type, 1 (MIM# 130080);Leukodystrophy - adult onset			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	8958339;30535813		False	3	50;50;0	0.155	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000159403	ENSG00000159403	HGNC:1246													
CLCN2	gene	CLCN2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with ataxia, 615651			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	23707145		False	3	100;0;0	0.155	True		ENSG00000114859	ENSG00000114859	HGNC:2020													
COL4A1	gene	COL4A1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, 611773;Brain small vessel disease with or without ocular anomalies, 175780			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000187498	ENSG00000187498	HGNC:2202													
CSF1R	gene	CSF1R	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukoencephalopathy, diffuse hereditary, with spheroids, 221820			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000182578	ENSG00000182578	HGNC:2433													
CST3	gene	CST3	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	38489591		False	3	100;0;0	0.155	True		ENSG00000101439	ENSG00000101439	HGNC:2475													
CTSA	gene	CTSA	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Brain small vessel disease 6 with leukoencephalopathy, MIM# 621394			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31177426		False	3	100;0;0	0.155	True		ENSG00000064601	ENSG00000064601	HGNC:9251													
CYP27A1	gene	CYP27A1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, 213700			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP7B1	gene	CYP7B1	Expert list;Expert Review Green	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 5A, autosomal recessive 270800			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	24117163;19439420;19187859		False	3	100;0;0	0.155	True		ENSG00000172817	ENSG00000172817	HGNC:2652													
DARS	gene	DARS	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelination with brainstem and spinal cord involvement and leg spasticity, 615281			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25527264;23643384		False	3	100;0;0	0.155	True		ENSG00000115866	ENSG00000115866	HGNC:2678													
DARS2	gene	DARS2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	17384640;15002045;16788019		False	3	100;0;0	0.155	True		ENSG00000117593	ENSG00000117593	HGNC:25538													
DCAF17	gene	DCAF17	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Woodhouse-Sakati syndrome, MIM#241080			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31347785		False	3	100;0;0	0.155	True		ENSG00000115827	ENSG00000115827	HGNC:25784													
EIF2B1	gene	EIF2B1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, 603896			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	20301435		False	3	100;0;0	0.155	True		ENSG00000111361	ENSG00000111361	HGNC:3257													
EIF2B2	gene	EIF2B2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MONDO:0011380			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	20301435		False	3	100;0;0	0.155	True		ENSG00000119718	ENSG00000119718	HGNC:3258													
EIF2B3	gene	EIF2B3	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, MIM#603896, MONDO:0011380			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	20301435		False	3	100;0;0	0.155	True		ENSG00000070785	ENSG00000070785	HGNC:3259													
EIF2B4	gene	EIF2B4	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, MIM#603896, MONDO:0011380			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	20301435		False	3	100;0;0	0.155	True		ENSG00000115211	ENSG00000115211	HGNC:3260													
EIF2B5	gene	EIF2B5	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, 603896			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	20301435		False	3	100;0;0	0.155	True		ENSG00000145191	ENSG00000145191	HGNC:3261													
EPRS	gene	EPRS	Expert list;Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 15, MIM#617951			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29576217		False	3	100;0;0	0.155	True		ENSG00000136628	ENSG00000136628	HGNC:3418													
GALC	gene	GALC	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Krabbe disease, 245200			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000054983	ENSG00000054983	HGNC:4115													
GBE1	gene	GBE1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyglucosan body disease, adult form, 263570			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000114480	ENSG00000114480	HGNC:4180													
GFAP	gene	GFAP	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Alexander disease, 203450			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000131095	ENSG00000131095	HGNC:4235													
GJA1	gene	GJA1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31023660		False	3	100;0;0	0.155	True		ENSG00000152661	ENSG00000152661	HGNC:4274													
GJB1	gene	GJB1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800;Reversible posterior leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31842800		False	3	100;0;0	0.155	True		ENSG00000169562	ENSG00000169562	HGNC:4283													
GJC2	gene	GJC2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 2, 608804,			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000198835	ENSG00000198835	HGNC:17494													
GLA	gene	GLA	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Fabry disease, Fabry disease, cardiac variant,  301500			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000102393	ENSG00000102393	HGNC:4296													
GLB1	gene	GLB1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1-gangliosidosis, type III, MIM#230650;white matter abnormality			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000170266	ENSG00000170266	HGNC:4298													
GRN	gene	GRN	Expert Review Green;Other	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	GRN-related frontotemporal lobar degeneration with Tdp43 inclusions MONDO:0011842			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36970046;36632182		False	3	100;0;0	0.155	True		ENSG00000030582	ENSG00000030582	HGNC:4601													
HEPACAM	gene	HEPACAM	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Megalencephalic leukoencephalopathy with subcortical cysts 2A, 613925;Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, 613926			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	21419380;21419380		False	3	100;0;0	0.155	True		ENSG00000165478	ENSG00000165478	HGNC:26361													
HEXA	gene	HEXA	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, several forms, Tay-Sachs disease, [Hex A pseudodeficiency], 272800			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
HTRA1	gene	HTRA1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, 616779;CARASIL syndrome, 600142			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000166033	ENSG00000166033	HGNC:9476													
L2HGDH	gene	L2HGDH	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L-2-hydroxyglutaric aciduria, 236792			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	10399870		False	3	100;0;0	0.155	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
LAMB1	gene	LAMB1	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Leukoencephalopathy, adult-onset, MIM#	621424"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	32548278		False	3	33;0;67	0.155	True		ENSG00000091136	ENSG00000091136	HGNC:6486													
LARS2	gene	LARS2	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	32442335;30737337		False	3	100;0;0	0.155	True		ENSG00000011376	ENSG00000011376	HGNC:17095													
LIG3	gene	LIG3	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	33855352		False	3	100;0;0	0.155	True		ENSG00000005156	ENSG00000005156	HGNC:6600													
LMNB1	gene	LMNB1	Australian Genomcis Health Alliance Leukodystrophy Flagship;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500;Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	16951681;30842973		False	3	100;0;0	0.155	True		ENSG00000113368	ENSG00000113368	HGNC:6637													
MAN2B1	gene	MAN2B1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mannosidosis, alpha-, types I and II, MIM#248500			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000104774	ENSG00000104774	HGNC:6826													
MAPT	gene	MAPT	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"semantic dementia	MONDO:0010857"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	33802612;36970046		False	3	100;0;0	0.155	True	Other	ENSG00000186868	ENSG00000186868	HGNC:6893													
MTHFR	gene	MTHFR	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria due to MTHFR deficiency, 236250			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29391032		False	3	100;0;0	0.155	True		ENSG00000177000	ENSG00000177000	HGNC:7436													
NOTCH1	gene	NOTCH1	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	35947102		False	3	100;0;0	0.155	True	Other	ENSG00000148400	ENSG00000148400	HGNC:7881													
NOTCH3	gene	NOTCH3	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, NOTCH3-related;Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000074181	ENSG00000074181	HGNC:7883													
NPC1	gene	NPC1	Expert list;Expert Review Green	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C1/D 257220			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	26910362;29406968		False	3	100;0;0	0.155	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
PAH	gene	PAH	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phenylketonuria, [Hyperphenylalaninemia, non-PKU mild], 261600			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31636599;32141105		False	3	100;0;0	0.155	True		ENSG00000171759	ENSG00000171759	HGNC:8582													
PLP1	gene	PLP1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Pelizaeus-Merzbacher disease, 312080			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	16130097		False	3	100;0;0	0.155	True		ENSG00000123560	ENSG00000123560	HGNC:9086													
POLG	gene	POLG	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4B (MNGIE type)        613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE)        607459			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLR1C	gene	POLR1C	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 11, MIM# 616494			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	26151409;32042905;33190326;34484918		False	3	0;100;0	0.155	True		ENSG00000171453	ENSG00000171453	HGNC:20194													
POLR3A	gene	POLR3A	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism, 607694			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31306222		False	3	100;0;0	0.155	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3B	gene	POLR3B	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, 614381			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25339210		False	3	100;0;0	0.155	True		ENSG00000013503	ENSG00000013503	HGNC:30348													
PRNP	gene	PRNP	Expert Review Green;Other	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	fatal familial insomnia MONDO:0010808			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25220284;24252267		False	3	100;0;0	0.155	True	Other	ENSG00000171867	ENSG00000171867	HGNC:9449													
PSAP	gene	PSAP	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy due to SAP-b deficiency, 249900;Krabbe disease, atypical, 611722			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	26462614		False	3	100;0;0	0.155	True		ENSG00000197746	ENSG00000197746	HGNC:9498													
PSEN1	gene	PSEN1	Expert Review Green;Other	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset autosomal dominant Alzheimer disease MONDO:0015140			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36845656		False	3	100;0;0	0.155	True	Other	ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN2	gene	PSEN2	Expert Review Green;Other	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset autosomal dominant Alzheimer disease MONDO:0015140			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36845656		False	3	100;0;0	0.155	True	Other	ENSG00000143801	ENSG00000143801	HGNC:9509													
PTEN	gene	PTEN	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cowden syndrome 1, MIM# 158350			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	29720545;29152901;30664625		False	3	100;0;0	0.155	True		ENSG00000171862	ENSG00000171862	HGNC:9588													
RNASEH2A	gene	RNASEH2A	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 4, 610333			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000104889	ENSG00000104889	HGNC:18518													
RNASEH2B	gene	RNASEH2B	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 2, 610181			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2C	gene	RNASEH2C	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 3, 610329			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000172922	ENSG00000172922	HGNC:24116													
RPIA	gene	RPIA	Expert Review Green;Literature;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ribose 5-phosphate isomerase deficiency, MIM#608611			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31247379;14988808;31056085		False	3	100;0;0	0.155	True		ENSG00000153574	ENSG00000153574	HGNC:10297													
SAMHD1	gene	SAMHD1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 5, 612952			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	19525956		False	3	100;0;0	0.155	True		ENSG00000101347	ENSG00000101347	HGNC:15925													
SLC17A5	gene	SLC17A5	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	False		ENSG00000119899	ENSG00000119899	HGNC:10933													
SNORD118	gene	SNORD118	Australian Genomcis Health Alliance Leukodystrophy Flagship;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	614561;Leukoencephalopathy, brain calcifications and cysts, 614561			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	27571260		False	3	100;0;0	0.155	True		ENSG00000200463	ENSG00000200463	HGNC:32952													
SPG11	gene	SPG11	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2X, 616668;Spastic paraplegia 11, autosomal recessive, MIM#604360			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	18067136		False	3	100;0;0	0.155	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG21	gene	SPG21	Expert list;Expert Review Green	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mast syndrome 248900			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	14564668		False	3	100;0;0	0.155	True		ENSG00000090487	ENSG00000090487	HGNC:20373													
TPP2	gene	TPP2	Expert Review;Expert Review Green	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	25414442		False	3	100;0;0	0.155	True		ENSG00000134900	ENSG00000134900	HGNC:12016													
TREM2	gene	TREM2	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, 618193			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	12080485;15883308		False	3	100;0;0	0.155	True		ENSG00000095970	ENSG00000095970	HGNC:17761													
TREX1	gene	TREX1	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 1, dominant and recessive, 225750;Vasculopathy, retinal, with cerebral leukodystrophy, 192315			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TUBB4A	gene	TUBB4A	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukodystrophy, hypomyelinating, 6, MIM#612438			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	28791129		False	3	100;0;0	0.155	True		ENSG00000104833	ENSG00000104833	HGNC:20774													
TYMP	gene	TYMP	Expert list;Expert Review Green	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM#	603041"			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	9924029;10852545		False	3	100;0;0	0.155	True		ENSG00000025708	ENSG00000025708	HGNC:3148													
TYROBP	gene	TYROBP	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, 221770			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000011600	ENSG00000011600	HGNC:12449													
ZFYVE26	gene	ZFYVE26	Expert Review Green;Royal Melbourne Hospital	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 15, autosomal recessive, 270700			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500			False	3	100;0;0	0.155	True		ENSG00000072121	ENSG00000072121	HGNC:20761													
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MONDO:0007105			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	36970046;36632182		False	3	100;0;0	0.155	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	0.155	True		ENSG00000286219	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
PRNP_CJD_octapeptide	str	PRNP	Expert Review Green;Literature	Leukodystrophy - adult onset		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440			Leukodystrophy;HP:0002415; Abnormal cerebral white matter morphology;HP:0002500	2159587;20301407		False	3	100;0;0	0.155	True		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
