Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name AAAS gene AAAS Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Achalasia-addisonianism-alacrimia syndrome MIM#231550 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000094914 ENSG00000094914 HGNC:13666 ABCB7 gene ABCB7 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Anaemia, sideroblastic, with ataxia, MIM# 301310 Neurodegeneration;HP:0002180 10196363;10196363;33157103;31772327;31511561;26242992 False 3 100;0;0 6.225 True ENSG00000131269 ENSG00000131269 HGNC:48 ABCD1 gene ABCD1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Adrenoleukodystrophy, MIM# 300100" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Royal Melbourne Hospital;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenoleukodystrophy MIM# 300100, XLR Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000101986 ENSG00000101986 HGNC:61 ABHD12 gene ABHD12 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000100997 ENSG00000100997 HGNC:15868 ABHD16A gene ABHD16A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities Neurodegeneration;HP:0002180 PMID: 34587489 False 3 100;0;0 6.225 True ENSG00000204427 ENSG00000204427 HGNC:13921 ACBD6 gene ACBD6 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 Neurodegeneration;HP:0002180 37951597 False 3 100;0;0 6.225 True ENSG00000230124 ENSG00000230124 HGNC:23339 ACO2 gene ACO2 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile cerebellar-retinal degeneration, MIM#614559 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000100412 ENSG00000100412 HGNC:118 ADAR gene ADAR Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6;neuroinflammatory disorder with cerebral calcification;progressive loss of cognition;spasticity;dystonia;parkinsonism;OMIM 615010 Neurodegeneration;HP:0002180 PMID: 32911246 False 3 100;0;0 6.225 True ENSG00000160710 ENSG00000160710 HGNC:225 ADAR gene ADAR Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6, 615010 autosomal recessive Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000160710 ENSG00000160710 HGNC:225 ADGRG1 gene ADGRG1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polymicrogyria, Frontoparietal, 606854;Polymicrogyria, perisylvian type, 615752 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000205336 ENSG00000205336 HGNC:4512 ADPRHL2 gene ADPRHL2 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced with variable ataxia and seizures, 618170 Neurodegeneration;HP:0002180 30100084;30401461 False 3 100;0;0 6.225 True ENSG00000116863 ENSG00000116863 HGNC:21304 AFG3L2 gene AFG3L2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive MIM#614487;Spinocerebellar ataxia 28 MIM#610246 Neurodegeneration;HP:0002180 20725928 False 3 100;0;0 6.225 True ENSG00000141385 ENSG00000141385 HGNC:315 AFG3L2 gene AFG3L2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive, MIM# 614487;Spinocerebellar ataxia 28, MIM# 610246 Neurodegeneration;HP:0002180 22022284;20208537;20725928;33075064;32248051;30910913 False 3 100;0;0 6.225 True Other ENSG00000141385 ENSG00000141385 HGNC:315 AGTPBP1 gene AGTPBP1 Expert Review Green;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650 Neurodegeneration;HP:0002180 30420557, 28600779, 30976113, 38153683, 28325758 False 3 100;0;0 6.225 True ENSG00000135049 ENSG00000135049 HGNC:17258 AHI1 gene AHI1 Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 3 Neurodegeneration;HP:0002180 25616960 False 3 100;0;0 6.225 True ENSG00000135541 ENSG00000135541 HGNC:21575 AIMP1 gene AIMP1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 3, MIM#260600 Neurodegeneration;HP:0002180 21092922;24958424;33402283;32531460;30486714;30477741 False 3 100;0;0 6.225 True ENSG00000164022 ENSG00000164022 HGNC:10648 ALDH18A1 gene ALDH18A1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spastic paraplegia 9B, autosomal recessive, MIM# 616586;Spastic paraplegia 9A, autosomal dominant, MIM# 601162" Neurodegeneration;HP:0002180 26026163;29915212 False 3 100;0;0 6.225 True ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH3A2 gene ALDH3A2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sj gren-Larsson syndrome Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000072210 ENSG00000072210 HGNC:403 ALDH5A1 gene ALDH5A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 Neurodegeneration;HP:0002180 14635103 False 3 100;0;0 6.225 True ENSG00000112294 ENSG00000112294 HGNC:408 ALS2 gene ALS2 ClinGen;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ALS2-related motor neuron disease, MONDO:0100227 Neurodegeneration;HP:0002180 30128655, 33409823, 11586298, 16240357, 23282280, 24562058, 33155358 False 3 100;0;0 6.225 True ENSG00000003393 ENSG00000003393 HGNC:443 ALS2 gene ALS2 ClinGen;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ALS2-related motor neuron disease, MONDO:0100227 Neurodegeneration;HP:0002180 30128655, 33409823, 11586298, 16240357, 23282280, 24562058, 33155358 False 3 100;0;0 6.225 True ENSG00000003393 ENSG00000003393 HGNC:443 AMFR gene AMFR Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 89, autosomal recessive, MIM# 620379 Neurodegeneration;HP:0002180 37119330 False 3 100;0;0 6.225 True ENSG00000159461 ENSG00000159461 HGNC:463 ANO10 gene ANO10 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 10 MIM#613728 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000160746 ENSG00000160746 HGNC:25519 ANXA11 gene ANXA11 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis type 23 MONDO:0027694 Neurodegeneration;HP:0002180 36458208;39755715;38896345;38896262 False 3 100;0;0 6.225 True Other ENSG00000122359 ENSG00000122359 HGNC:535 ANXA11 gene ANXA11 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amytrophic lateral sclerosis 23 MIM#617839 Neurodegeneration;HP:0002180 28469040;29845112;30109997 False 3 100;0;0 6.225 False ENSG00000122359 ENSG00000122359 HGNC:535 AP1S2 gene AP1S2 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Pettigrew syndrome, MIM# 304340 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000182287 ENSG00000182287 HGNC:560 AP4B1 gene AP4B1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 47, autosomal recessive, 614066 Neurodegeneration;HP:0002180 21620353;22290197;24700674;24781758;32979048;32171285;32166732;31525725;31525725 False 3 100;0;0 6.225 True ENSG00000134262 ENSG00000134262 HGNC:572 AP4E1 gene AP4E1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 51, autosomal recessive, 613744 Neurodegeneration;HP:0002180 20972249;21620353;21937992;32979048;23472171 False 3 100;0;0 6.225 True ENSG00000081014 ENSG00000081014 HGNC:573 AP4M1 gene AP4M1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 50, autosomal recessive, 612936 Neurodegeneration;HP:0002180 19559397;21937992;21937992;32979048;31915823;29096665;28464862;25496299 False 3 100;0;0 6.225 True ENSG00000221838 ENSG00000221838 HGNC:574 AP4S1 gene AP4S1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal developmental delay;Spastic paraplegia 52, autosomal recessive, 614067;seizures Neurodegeneration;HP:0002180 21620353;25552650;32979048;32216065;31915823;30283821;27444738 False 3 100;0;0 6.225 True ENSG00000100478 ENSG00000100478 HGNC:575 AP5Z1 gene AP5Z1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 48, autosomal recessive, MIM# 613647" Neurodegeneration;HP:0002180 26085577 False 3 50;50;0 6.225 True ENSG00000242802 ENSG00000242802 HGNC:22197 APP gene APP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease MONDO:0007088 Neurodegeneration;HP:0002180 20301340;1671712;1678058;1908231;1302033 False 3 100;0;0 6.225 True Other ENSG00000142192 ENSG00000142192 HGNC:620 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminaemia MIM#208920 Neurodegeneration;HP:0002180 30986824;26256098;11586299 False 3 100;0;0 6.225 True ENSG00000137074 ENSG00000137074 HGNC:15984 ARG1 gene ARG1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive spastic tetraplegia;Argininaemia, 207800 Neurodegeneration;HP:0002180 29726057 False 3 100;0;0 6.225 True ENSG00000118520 ENSG00000118520 HGNC:663 ARL13B gene ARL13B Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 8, MIM# 612291" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000169379 ENSG00000169379 HGNC:25419 ARL6IP1 gene ARL6IP1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 61, autosomal recessive, MIM#615685 Neurodegeneration;HP:0002180 24482476;31272422;30980493;28471035 False 3 100;0;0 6.225 True ENSG00000170540 ENSG00000170540 HGNC:697 ARSA gene ARSA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM# 250100, adult-onset Neurodegeneration;HP:0002180 29486463;26890752;15710861 False 3 100;0;0 6.225 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSA gene ARSA Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic Leukodystrophy, 250100;Metachromatic leukodystrophy (#250100) Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000100299 ENSG00000100299 HGNC:713 ASCC1 gene ASCC1 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spinal muscular atrophy with congenital bone fractures 2 (MONDO:0014807;MIM#616867) Neurodegeneration;HP:0002180 26924529;28218388 False 3 100;0;0 6.225 True ENSG00000138303 ENSG00000138303 HGNC:24268 ATAD3A gene ATAD3A Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Harel-Yoon syndrome, MIM# 617183 Neurodegeneration;HP:0002180 28158749;27640307 False 3 100;0;0 6.225 True ENSG00000197785 ENSG00000197785 HGNC:25567 ATCAY gene ATCAY Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, cerebellar, Cayman type, MIM# 601238;MONDO:0011025 Neurodegeneration;HP:0002180 14556008;29449188;23226316;26343454 False 3 50;50;0 6.225 True ENSG00000167654 ENSG00000167654 HGNC:779 ATG7 gene ATG7 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, SCAR31, MIM#619422 Neurodegeneration;HP:0002180 34161705 False 3 100;0;0 6.225 True ENSG00000197548 ENSG00000197548 HGNC:16935 ATL1 gene ATL1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 3A, autosomal dominant MIM#182600 Neurodegeneration;HP:0002180 16765570 False 3 100;0;0 6.225 False ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hereditary sensory neuropathy type ID, MIM 613708;Spastic paraplegia 3A, MIM 182600;Hereditary spastic paraplegia, AR Neurodegeneration;HP:0002180 16401858;16537571;17657515;28396731;24473461;26888483 False 3 100;0;0 6.225 True ENSG00000198513 ENSG00000198513 HGNC:11231 ATM gene ATM Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia MIM#208900 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000149311 ENSG00000149311 HGNC:795 ATP13A2 gene ATP13A2 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 Neurodegeneration;HP:0002180 21362476;21696388;31588715;32559632;33033738;33091395;34405108 False 3 100;0;0 6.225 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal parkinsonism due to ATP13A2 deficiency MONDO:0017809 Neurodegeneration;HP:0002180 25900096;20301402 False 3 100;0;0 6.225 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 78, autosomal recessive, 617225;Kufor-Rakeb syndrome, 606693 AR;complicated hereditary spastic paraplegia;Adult-onset lower-limb predominant spastic paraparesis Neurodegeneration;HP:0002180 27217339;28137957 False 3 100;0;0 6.225 False ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome, MIM# 606693 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP1A3 gene ATP1A3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder MONDO:0700002 Neurodegeneration;HP:0002180 20301294;17282997;15260953;17595045;17516473;22534615 False 3 100;0;0 6.225 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 Neurodegeneration;HP:0002180 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 6.225 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP2B2 gene ATP2B2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related Neurodegeneration;HP:0002180 PMID: 37675773 False 3 100;0;0 6.225 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157087 ENSG00000157087 HGNC:815 ATP2B3 gene ATP2B3 Expert Review Green;Expert list;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Spinocerebellar ataxia, X-linked 1 Neurodegeneration;HP:0002180 37821930;36207321;31680123;28807751;28720891;27653636;25953895 False 3 50;50;0 6.225 True ENSG00000067842 ENSG00000067842 HGNC:816 ATP5G3 gene ATP5G3 Expert Review Green;Literature;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, early-onset, and/or spastic paraplegia, MIM#619681 Neurodegeneration;HP:0002180 34636445;34954817 False 3 100;0;0 6.225 True ENSG00000154518 ENSG00000154518 HGNC:843 ATP6AP2 gene ATP6AP2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Parkinsonism with spasticity, X-linked, MIM# 300911" Neurodegeneration;HP:0002180 30985297;23595882 False 3 100;0;0 6.225 True ENSG00000182220 ENSG00000182220 HGNC:18305 ATP6V0A1 gene ATP6V0A1 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971 Neurodegeneration;HP:0002180 PMID:34909687 False 3 50;50;0 6.225 True ENSG00000033627 ENSG00000033627 HGNC:865 ATP7B gene ATP7B Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease MIM#277900 Neurodegeneration;HP:0002180 17435591 False 3 50;50;0 6.225 True ENSG00000123191 ENSG00000123191 HGNC:870 ATP8A2 gene ATP8A2 Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268 Neurodegeneration;HP:0002180 22892528;31612321 False 3 100;0;0 6.225 True ENSG00000132932 ENSG00000132932 HGNC:13533 B4GALNT1 gene B4GALNT1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 26, autosomal recessive MIM#609195 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000135454 ENSG00000135454 HGNC:4117 BBS1 gene BBS1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 1, 209900 Neurodegeneration;HP:0002180 15637713 False 3 100;0;0 6.225 True ENSG00000174483 ENSG00000174483 HGNC:966 BCAS3 gene BCAS3 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hengel-Maroofian-Schols syndrome, MIM# 619641 Neurodegeneration;HP:0002180 34022130 False 3 100;0;0 6.225 True ENSG00000141376 ENSG00000141376 HGNC:14347 BCKDHB gene BCKDHB Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Episodic ataxia during metabolic crises;paroxysmal nonkinesigenic dyskinesia Neurodegeneration;HP:0002180 PMID 32151765 False 3 0;0;0 6.225 True ENSG00000083123 ENSG00000083123 HGNC:987 BRAT1 gene BRAT1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056 Neurodegeneration;HP:0002180 26483087;26494257;27282546 False 3 100;0;0 6.225 True ENSG00000106009 ENSG00000106009 HGNC:21701 BSCL2 gene BSCL2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Silver spastic paraplegia syndrome MIM#270685;Neuropathy, distal hereditary motor, type VA MIM#600794 Neurodegeneration;HP:0002180 16765570 False 3 100;0;0 6.225 False ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Silver spastic paraplegia syndrome MIM#270685;Encephalopathy, progressive, with or without lipodystrophy MIM#615924" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000168000 ENSG00000168000 HGNC:15832 C12orf65 gene C12orf65 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 55, autosomal recessive, 615035;optic atrophy and spasticity, tibial muscle weakness and atrophy, peripheral neuropathy;Combined oxidative phosphorylation deficiency 7, 613559 Neurodegeneration;HP:0002180 23188110;24080142;24198383 False 3 100;0;0 6.225 True ENSG00000130921 ENSG00000130921 HGNC:26784 C19orf12 gene C19orf12 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodegeneration with brain iron accumulation 4 MONDO:0013674 Neurodegeneration;HP:0002180 21981780;23278385;23447832 False 3 100;0;0 6.225 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 4, MIM# 614298 Neurodegeneration;HP:0002180 23278385;21981780;23269600 False 3 100;0;0 6.225 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 4, 614298;Spastic paraplegia 43, autosomal recessive, 615043 Neurodegeneration;HP:0002180 33688131;21981780;22508347;23269600;31804703;30088953;20039086 False 3 100;0;0 6.225 True ENSG00000131943 ENSG00000131943 HGNC:25443 C5orf42 gene C5orf42 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 17, MIM# 614615" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000197603 ENSG00000197603 HGNC:25801 C9orf3 gene C9orf3 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 31, MIM# 619565;Childhood/Adolescence onset generalised dystonia;Dystonia parkinsonism;Zech-Boesch Syndrome Neurodegeneration;HP:0002180 PMID: 35306330 False 3 100;0;0 6.225 True ENSG00000148120 ENSG00000148120 HGNC:1361 CA8 gene CA8 Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3;Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3, 613227 Neurodegeneration;HP:0002180 21937992;19461874 False 3 100;0;0 6.225 True ENSG00000178538 ENSG00000178538 HGNC:1382 CACNA1A gene CACNA1A Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500 Neurodegeneration;HP:0002180 False 3 50;50;0 6.225 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1G gene CACNA1G Expert Review Green;Expert list;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits MIM#618087 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA2D2 gene CACNA2D2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar atrophy with seizures and variable developmental delay MIM#618501 Neurodegeneration;HP:0002180 23339110;24358150;30410802;29997391;31402629 False 3 100;0;0 6.225 True ENSG00000007402 ENSG00000007402 HGNC:1400 CAD gene CAD Expert Review Green;Literature;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 50;OMIM # 616457 Neurodegeneration;HP:0002180 PMID: 32820246 False 3 100;0;0 6.225 True ENSG00000084774 ENSG00000084774 HGNC:1424 CAMTA1 gene CAMTA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellarataxia, nonprogressive, with mental retardation, 614756;Cerebellar ataxia with mental retardation, 614756 Neurodegeneration;HP:0002180 32157189;22693284 False 3 100;0;0 6.225 True ENSG00000171735 ENSG00000171735 HGNC:18806 CAPN1 gene CAPN1 Expert list;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76 autosomal recessive, 616907;MONDO:0014827 Neurodegeneration;HP:0002180 27153400 False 3 100;0;0 6.225 False ENSG00000014216 ENSG00000014216 HGNC:1476 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy Neurodegeneration;HP:0002180 39878554 False 3 100;0;0 6.225 True ENSG00000135387 ENSG00000135387 HGNC:6743 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy Neurodegeneration;HP:0002180 39878554 False 3 100;0;0 6.225 True ENSG00000135387 ENSG00000135387 HGNC:6743 CASK gene CASK Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) FG syndrome 4, 300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000147044 ENSG00000147044 HGNC:1497 CBY1 gene CBY1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal intellectual disability;cerebellar ataxia;molar tooth sign;polydactyly;Joubert syndrome Neurodegeneration;HP:0002180 33131181;25103236;25220153 False 3 100;0;0 6.225 True ENSG00000100211 ENSG00000100211 HGNC:1307 CC2D2A gene CC2D2A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 9, MIM#612285 Neurodegeneration;HP:0002180 18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408 False 3 100;0;0 6.225 True ENSG00000048342 ENSG00000048342 HGNC:29253 CCDC82 gene CCDC82 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, CCDC82-related Neurodegeneration;HP:0002180 35373332;35118659;27457812 False 3 100;0;0 6.225 True ENSG00000149231 ENSG00000149231 HGNC:26282 CD99L2 gene CD99L2 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodevelopmental disorder, MONDO:0700092;CD99L2-related Neurodegeneration;HP:0002180 41690933 False 3 100;0;0 6.225 True ENSG00000102181 ENSG00000102181 HGNC:18237 CD99L2 gene CD99L2 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodevelopmental disorder, MONDO:0700092;CD99L2-related Neurodegeneration;HP:0002180 41690933 False 3 100;0;0 6.225 True ENSG00000102181 ENSG00000102181 HGNC:18237 CEP290 gene CEP290 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 5, MIM# 610188 Neurodegeneration;HP:0002180 18327255;20690115;16682973;16682970;17564967;16909394;17564974 False 3 100;0;0 6.225 True ENSG00000198707 ENSG00000198707 HGNC:29021 CEP41 gene CEP41 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 15, MIM# 614464 Neurodegeneration;HP:0002180 22246503 False 3 100;0;0 6.225 True ENSG00000106477 ENSG00000106477 HGNC:12370 CHCHD10 gene CHCHD10 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911 Neurodegeneration;HP:0002180 24934289;31690696;30877432;32369233;28069311 False 3 100;0;0 6.225 True ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD2 gene CHCHD2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 22, autosomal dominant MIM#616710 Neurodegeneration;HP:0002180 32068847;25662902;31600778;26705026 False 3 100;0;0 6.225 False ENSG00000106153 ENSG00000106153 HGNC:21645 CHMP2B gene CHMP2B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795;MONDO:0010936) Neurodegeneration;HP:0002180 20301378;16041373 False 3 100;0;0 6.225 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000083937 ENSG00000083937 HGNC:24537 CHMP2B gene CHMP2B Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795, MONDO:0010936) Neurodegeneration;HP:0002180 20301378;16041373 False 3 100;0;0 6.225 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000083937 ENSG00000083937 HGNC:24537 CLCN2 gene CLCN2 Expert Review Green;Victorian Clinical Genetics Services;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with ataxia, MIM# 615651 Neurodegeneration;HP:0002180 29403011;29403012;23707145 False 3 100;0;0 6.225 True ENSG00000114859 ENSG00000114859 HGNC:2020 CLN3 gene CLN3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 3 MIM#204200 Neurodegeneration;HP:0002180 19489875;11342698 False 3 100;0;0 6.225 True ENSG00000188603 ENSG00000188603 HGNC:2074 CLN5 gene CLN5 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis neuronal 5, MIM# 256731 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000102805 ENSG00000102805 HGNC:2076 CLN6 gene CLN6 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300 Neurodegeneration;HP:0002180 11791207;11727201;21549341;30561534 False 3 100;0;0 6.225 True ENSG00000128973 ENSG00000128973 HGNC:2077 CLN6 gene CLN6 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, Kufs type, adult onset MIM#204300 Neurodegeneration;HP:0002180 30561534 False 3 100;0;0 6.225 True ENSG00000128973 ENSG00000128973 HGNC:2077 CLPP gene CLPP Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 3, MIM# 614129 Neurodegeneration;HP:0002180 25254289 False 3 100;0;0 6.225 True ENSG00000125656 ENSG00000125656 HGNC:2084 COA7 gene COA7 Expert Review Green;Expert list;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000162377 ENSG00000162377 HGNC:25716 COL4A1 gene COL4A1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Brain small vessel disease 1 with or without ocular anomalies MONDO:0008289;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MONDO:0032814" Neurodegeneration;HP:0002180 35699195;37272523;36300346;30413629 False 3 100;0;0 6.225 True ENSG00000187498 ENSG00000187498 HGNC:2202 COQ4 gene COQ4 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Childhood-onset ataxia Neurodegeneration;HP:0002180 30225196;33704555;30847826 False 3 100;0;0 6.225 True ENSG00000167113 ENSG00000167113 HGNC:19693 COQ5 gene COQ5 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 9 MIM#619028 Neurodegeneration;HP:0002180 29044765;37599337;21937992;41199775;36266294 False 3 33;0;67 6.225 True ENSG00000110871 ENSG00000110871 HGNC:28722 COQ7 gene COQ7 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, COQ7-related (MONDO#0019064) Neurodegeneration;HP:0002180 PMID: 33215859 False 3 50;0;50 6.225 False ENSG00000167186 ENSG00000167186 HGNC:2244 COQ8A gene COQ8A Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 Neurodegeneration;HP:0002180 32337771 False 3 100;0;0 6.225 True ENSG00000163050 ENSG00000163050 HGNC:16812 COX20 gene COX20 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, 220110;Mitochondrial complex IV deficiency Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000203667 ENSG00000203667 HGNC:26970 CP gene CP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminaemia, MIM#604290 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hemosiderosis, systemic, due to aceruloplasminemia MIM#604290 Neurodegeneration;HP:0002180 7539672;https://doi.org/10.1093/qjmed/89.5.355;28874056;28012953 False 3 100;0;0 6.225 False ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP Victorian Clinical Genetics Services;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290 Neurodegeneration;HP:0002180 20301666 False 3 100;0;0 6.225 False ENSG00000047457 ENSG00000047457 HGNC:2295 CSF1R gene CSF1R Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted leukoencephalopathy, diffuse hereditary, with spheroids 1 MONDO:0800027 Neurodegeneration;HP:0002180 25935893;22934315;22934315 False 3 100;0;0 6.225 True ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Literature;Expert Review Green;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia Neurodegeneration;HP:0002180 24198292;25563800;25935893 False 3 100;0;0 6.225 False ENSG00000182578 ENSG00000182578 HGNC:2433 CSNK2B gene CSNK2B Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732 Neurodegeneration;HP:0002180 PMID: 34041744 False 3 100;0;0 6.225 True ENSG00000204435 ENSG00000204435 HGNC:2460 CST3 gene CST3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral amyloid angiopathy MIM#105150;Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214 Neurodegeneration;HP:0002180 22435454;8866434;2602413;8108423;38489591 False 3 50;50;0 6.225 True Other ENSG00000101439 ENSG00000101439 HGNC:2475 CSTB gene CSTB Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM#254800 Neurodegeneration;HP:0002180 9012407;9054946 False 3 50;50;0 6.225 True ENSG00000160213 ENSG00000160213 HGNC:2482 CTBP1 gene CTBP1 Expert Review Green;Expert list;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, MIM#617915 Neurodegeneration;HP:0002180 27094857;28955726;31041561 False 3 100;0;0 6.225 True ENSG00000159692 ENSG00000159692 HGNC:2494 CTSF gene CTSF Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ceroid lipofuscinosis, neuronal, 13, Kufs type 615362" Neurodegeneration;HP:0002180 PMID: 28749476;27668283;27524508 False 3 100;0;0 6.225 True ENSG00000174080 ENSG00000174080 HGNC:2531 CWF19L1 gene CWF19L1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 17, 616127;Autosomal recessive spinocerebellar ataxia type 17, 616127 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000095485 ENSG00000095485 HGNC:25613 CYP27A1 gene CYP27A1 NHS GMS;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700;MONDO:0008948;progressive lower extremity spasticity,often disproportionate to any degree of weakness Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebrotendinous xanthomatosis, MIM# 213700;Cerebrotendinous xanthomatosis, infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas;Epilepsy;Parkinsonism;Ataxia;Peripheral neuropathy" Neurodegeneration;HP:0002180 PMID: 30054180 False 3 100;0;0 6.225 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, MIM# 213700 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP2U1 gene CYP2U1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 56, autosomal recessive, 615030 Neurodegeneration;HP:0002180 23176821;32006740;29034544 False 3 100;0;0 6.225 True ENSG00000155016 ENSG00000155016 HGNC:20582 CYP7B1 gene CYP7B1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 5A, autosomal recessive, MIM# 270800" Neurodegeneration;HP:0002180 19439420;18252231 False 3 100;0;0 6.225 True ENSG00000172817 ENSG00000172817 HGNC:2652 DAGLA gene DAGLA Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuroocular syndrome 2, paroxysmal type, MIM# 168885 Neurodegeneration;HP:0002180 35737950 False 3 100;0;0 6.225 True ENSG00000134780 ENSG00000134780 HGNC:1165 DAGLB gene DAGLB Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease, MONDO:0005180, DALGB-related Neurodegeneration;HP:0002180 35715418;40244389 False 3 100;0;0 6.225 True ENSG00000164535 ENSG00000164535 HGNC:28923 DARS gene DARS Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281 Neurodegeneration;HP:0002180 25527264;23643384 False 3 100;0;0 6.225 True ENSG00000115866 ENSG00000115866 HGNC:2678 DARS2 gene DARS2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation;Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000117593 ENSG00000117593 HGNC:25538 DCTN1 gene DCTN1 Expert list;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MONDO:0008201 Neurodegeneration;HP:0002180 20945553, 19136952, 24343258 False 3 100;0;0 6.225 True ENSG00000204843 ENSG00000204843 HGNC:2711 DCTN1 gene DCTN1 Literature;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MONDO:0008201 Neurodegeneration;HP:0002180 20945553, 19136952, 24343258 False 3 100;0;0 6.225 True ENSG00000204843 ENSG00000204843 HGNC:2711 DCTN1 gene DCTN1 Literature;Expert Review Green;Expert Review Amber;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MONDO:0008201 Neurodegeneration;HP:0002180 20945553, 19136952, 24343258 False 3 100;0;0 6.225 False ENSG00000204843 ENSG00000204843 HGNC:2711 DDHD1 gene DDHD1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia 28, MONDO:0012256 Neurodegeneration;HP:0002180 15786464, 23176821, 24989667, 27216551, 26944165, 28818478, 29980238, 27999540, 33600578 False 3 100;0;0 6.225 True ENSG00000100523 ENSG00000100523 HGNC:19714 DDHD2 gene DDHD2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive paraplegia 54 (#615033). Complex form of disease ataxia reported amongst the phenotypic features in Citterio et al. (2014), Journal of Neurology, 261, pp.373-381 and Doi et al. (2014), Scientific Reports, 4, 7132.;Spastic paraplegia 54 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000085788 ENSG00000085788 HGNC:29106 DDHD2 gene DDHD2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 54, autosomal recessive, MIM# 615033;MONDO:0014018" Neurodegeneration;HP:0002180 23486545;24482476;23176823 False 3 100;0;0 6.225 True ENSG00000085788 ENSG00000085788 HGNC:29106 DHDDS gene DHDDS Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay and seizures with or without movement abnormalities, OMIM:617836 Neurodegeneration;HP:0002180 29100083;33798445;34182312;34382076 False 3 100;0;0 6.225 True ENSG00000117682 ENSG00000117682 HGNC:20603 DNAJB2 gene DNAJB2 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881) Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000135924 ENSG00000135924 HGNC:5228 DNAJC12 gene DNAJC12 Expert Review Green;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000108176 ENSG00000108176 HGNC:28908 DNAJC19 gene DNAJC19 Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type V 610198;dilated cardiomyopathy with ataxia (DCMA) syndrome;3-methylglutaconic aciduria type V, 610198 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000205981 ENSG00000205981 HGNC:30528 DNAJC3 gene DNAJC3 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile-onset diabetes mellitus-central and peripheral neurodegeneration syndrome, MONDO:0014523 Neurodegeneration;HP:0002180 34654017;34630333;33486469;32738013;28940199 False 3 100;0;0 6.225 True ENSG00000102580 ENSG00000102580 HGNC:9439 DNAJC5 gene DNAJC5 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC5 gene DNAJC5 Expert list;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 Neurodegeneration;HP:0002180 22978711;21820099;22235333;31919451;26659577 False 3 100;0;0 6.225 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC5 gene DNAJC5 Expert list;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 Neurodegeneration;HP:0002180 22978711;21820099;22235333 False 3 100;0;0 6.225 True ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC6 gene DNAJC6 Expert list;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 19a, juvenile-onset - MIM#615528;Parkinson disease 19b, early-onset - MIM#615528 Neurodegeneration;HP:0002180 22563501, 23211418, 26528954, 33983693 False 3 100;0;0 6.225 True ENSG00000116675 ENSG00000116675 HGNC:15469 DNMT1 gene DNMT1 ClinGen;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 Neurodegeneration;HP:0002180 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 False 3 0;100;0 6.225 False ENSG00000130816 ENSG00000130816 HGNC:2976 DNMT1 gene DNMT1 Expert Review Green;ClinGen;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 Neurodegeneration;HP:0002180 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 False 3 100;0;0 6.225 False ENSG00000130816 ENSG00000130816 HGNC:2976 DOCK3 gene DOCK3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000088538 ENSG00000088538 HGNC:2989 EBF3 gene EBF3 Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia and delayed development syndrome, 617330 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000108001 ENSG00000108001 HGNC:19087 EEFSEC gene EEFSEC Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102 Neurodegeneration;HP:0002180 39753114 False 3 100;0;0 6.225 True ENSG00000132394 ENSG00000132394 HGNC:24614 EIF2AK2 gene EIF2AK2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877;Neurodevelopmental Syndrome;Developmental delays;Ataxia;Parkinsonism;White matter alterations Neurodegeneration;HP:0002180 PMID: 32197074 False 3 100;0;0 6.225 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2B1 gene EIF2B1 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B2 gene EIF2B2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B3 gene EIF2B3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B4 gene EIF2B4 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B5 gene EIF2B5 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000145191 ENSG00000145191 HGNC:3261 ELFN1 gene ELFN1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dursun-Ozgul neurodevelopmental syndrome, MIM# 621344 Neurodegeneration;HP:0002180 PMID:40576023 False 3 100;0;0 6.225 True ENSG00000225968 ENSG00000225968 HGNC:33154 ELOVL1 gene ELOVL1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, MIM# 618527" Neurodegeneration;HP:0002180 29496980;32123819;30487246 False 3 100;0;0 6.225 True ENSG00000066322 ENSG00000066322 HGNC:14418 ELOVL4 gene ELOVL4 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000118402 ENSG00000118402 HGNC:14415 ELOVL5 gene ELOVL5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 38, MIM#615957 Neurodegeneration;HP:0002180 25065913 False 3 100;0;0 6.225 False ENSG00000012660 ENSG00000012660 HGNC:21308 ENTPD1 gene ENTPD1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 64, autosomal recessive MIM#615683 Neurodegeneration;HP:0002180 24482476;30652007;35471564 False 3 100;0;0 6.225 True ENSG00000138185 ENSG00000138185 HGNC:3363 EPM2A gene EPM2A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780 Neurodegeneration;HP:0002180 12019207 False 3 100;0;0 6.225 True ENSG00000112425 ENSG00000112425 HGNC:3413 EPM2A gene EPM2A Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2A, Lafora, 254780;Epilepsy, progressive myoclonic 2A (Lafora) 254780 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000112425 ENSG00000112425 HGNC:3413 ERBB4 gene ERBB4 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 19 MIM#615515 Neurodegeneration;HP:0002180 24119685;28889094 False 3 100;0;0 6.225 True ENSG00000178568 ENSG00000178568 HGNC:3432 ERCC4 gene ERCC4 Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM# 278760" Neurodegeneration;HP:0002180 29403087;28431612;29892709 False 3 100;0;0 6.225 False ENSG00000175595 ENSG00000175595 HGNC:3436 ERLIN1 gene ERLIN1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 62, 615681;Hereditary spastic paraplegia Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000107566 ENSG00000107566 HGNC:16947 ERLIN2 gene ERLIN2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 18, autosomal recessive, MIM# 611225;Spastic paraplegia 18A, autosomal dominant, MIM# 620512 Neurodegeneration;HP:0002180 23109145;21330303;32094424;29528531 False 3 100;0;0 6.225 True ENSG00000147475 ENSG00000147475 HGNC:1356 ERLIN2 gene ERLIN2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal hereditary spastic paraplegia 18 MONDO:0012639 Neurodegeneration;HP:0002180 38607533;38427163;34734492;32042907 False 3 100;0;0 6.225 True ENSG00000147475 ENSG00000147475 HGNC:1356 ESRRG gene ESRRG Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Movement disorder, MONDO:0005395, ESRRG-related Neurodegeneration;HP:0002180 41265451 False 3 100;0;0 6.225 True ENSG00000196482 ENSG00000196482 HGNC:3474 EXOSC5 gene EXOSC5 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, brain abnormalities, and cardiac conduction defects, MIM# 619576;Short stature;Motor developmental delays;Cerebellar hypoplasia;Ataxia Neurodegeneration;HP:0002180 32504085;29302074 False 3 100;0;0 6.225 True ENSG00000077348 ENSG00000077348 HGNC:24662 FA2H gene FA2H Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 35, autosomal recessive MIM#612319" Neurodegeneration;HP:0002180 31135052 False 3 100;0;0 6.225 True ENSG00000103089 ENSG00000103089 HGNC:21197 FA2H gene FA2H Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 35, autosomal recessive, MIM# 612319" Neurodegeneration;HP:0002180 20104589;23745665;19068277;20853438;22146942 False 3 100;0;0 6.225 True ENSG00000103089 ENSG00000103089 HGNC:21197 FAR1 gene FAR1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Cataracts, spastic paraparesis, and speech delay, MIM#619338;Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM# 616154" Neurodegeneration;HP:0002180 PMID: 33239752 False 3 100;0;0 6.225 True ENSG00000197601 ENSG00000197601 HGNC:26222 FARS2 gene FARS2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 77, autosomal recessive, 617046 Neurodegeneration;HP:0002180 26553276;25851414;29126765 False 3 100;0;0 6.225 True ENSG00000145982 ENSG00000145982 HGNC:21062 FAT2 gene FAT2 GeneReviews;Royal Melbourne Hospital;Expert list;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 45, MIM#617769 Neurodegeneration;HP:0002180 29053796;33884300 False 3 50;50;0 6.225 False ENSG00000086570 ENSG00000086570 HGNC:3596 FBXL4 gene FBXL4 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type), MIM# 615471 Neurodegeneration;HP:0002180 28383868 False 3 100;0;0 6.225 True ENSG00000112234 ENSG00000112234 HGNC:13601 FBXO7 gene FBXO7 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 15, autosomal recessive MIM#260300 Neurodegeneration;HP:0002180 18513678;19038853 False 3 100;0;0 6.225 False ENSG00000100225 ENSG00000100225 HGNC:13586 FBXO7 gene FBXO7 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal parkinsonian-pyramidal syndrome MONDO:0009830 Neurodegeneration;HP:0002180 20301402 False 3 100;0;0 6.225 True ENSG00000100225 ENSG00000100225 HGNC:13586 FDXR gene FDXR Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 Neurodegeneration;HP:0002180 30250212;28965846;29040572;33348459;37046037;37481223 False 3 100;0;0 6.225 True ENSG00000161513 ENSG00000161513 HGNC:3642 FGF14 gene FGF14 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 27 MIM#609307 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000102466 ENSG00000102466 HGNC:3671 FICD gene FICD Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 92, autosomal recessive, MIM# 620911 Neurodegeneration;HP:0002180 36136088 False 3 100;0;0 6.225 True ENSG00000198855 ENSG00000198855 HGNC:18416 FLVCR1 gene FLVCR1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, posterior column, with retinitis pigmentosa MIM#609033 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000162769 ENSG00000162769 HGNC:24682 FOLR1 gene FOLR1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration due to cerebral folate transport deficiency, 613068;Neurodegeneration due to cerebral folate transport deficiency Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000110195 ENSG00000110195 HGNC:3791 FOXG1 gene FOXG1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Rett syndrome, congenital variant, MIM# 613454;Developmental and Epileptic Encephalopathy;Dystonia,;Athetosis;Parkinsonism;Stereotypies" Neurodegeneration;HP:0002180 PMID: 21953941 False 3 100;0;0 6.225 True ENSG00000176165 ENSG00000176165 HGNC:3811 FRMD5 gene FRMD5 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094 Neurodegeneration;HP:0002180 36206744 False 3 100;0;0 6.225 True ENSG00000171877 ENSG00000171877 HGNC:28214 FRRS1L gene FRRS1L Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 37, MIM# 616981;Seizures;Chorea;Parkinsonism;Developmental delay Neurodegeneration;HP:0002180 PMID: 29086067 False 3 100;0;0 6.225 True ENSG00000260230 ENSG00000260230 HGNC:1362 FTL gene FTL Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 23447832;20301320 False 3 100;0;0 6.225 False ENSG00000087086 ENSG00000087086 HGNC:3999 FTL gene FTL Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration with brain iron accumulation 3, MIM# 606159 Neurodegeneration;HP:0002180 11438811;18854324;15099026;15173247 False 3 100;0;0 6.225 True ENSG00000087086 ENSG00000087086 HGNC:3999 FUS gene FUS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia (MIM#608030) Neurodegeneration;HP:0002180 19251628;19251627 False 3 100;0;0 6.225 True ENSG00000089280 ENSG00000089280 HGNC:4010 FUS gene FUS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030 Neurodegeneration;HP:0002180 32941707;32770214 False 3 100;0;0 6.225 True ENSG00000089280 ENSG00000089280 HGNC:4010 FXN gene FXN Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000165060 ENSG00000165060 HGNC:3951 FXN gene FXN Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia, 229300 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000165060 ENSG00000165060 HGNC:3951 GALC gene GALC Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe disease MIM#245200 Neurodegeneration;HP:0002180 9272171;11971051;22959700;26396125;26915362;28547031;31185936;32064984 False 3 100;0;0 6.225 False ENSG00000054983 ENSG00000054983 HGNC:4115 GAN gene GAN Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Giant axonal neuropathy-1, MIM# 256850" Neurodegeneration;HP:0002180 26381321;11062483 False 3 100;0;0 6.225 True ENSG00000261609 ENSG00000261609 HGNC:4137 GBA gene GBA Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson's disease, MONDO:0005180, GBA-related Neurodegeneration;HP:0002180 PMID: 12809640;35639160 False 3 100;0;0 6.225 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA2 gene GBA2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 46, autosomal recessive, MIM# 614409" Neurodegeneration;HP:0002180 23332916;23332917 False 3 100;0;0 6.225 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBA2 gene GBA2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, MIM# 614409;MONDO:0013737 Neurodegeneration;HP:0002180 23332916;23332917;29524657 False 3 100;0;0 6.225 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBE1 gene GBE1 Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form MIM#263570 Neurodegeneration;HP:0002180 23034915 False 3 100;0;0 6.225 False ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Polyglucosan body disease, adult form MIM#263570" Neurodegeneration;HP:0002180 20301758;26194201 False 3 100;0;0 6.225 False ENSG00000114480 ENSG00000114480 HGNC:4180 GCH1 gene GCH1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230 Neurodegeneration;HP:0002180 32170445;32278297;32746945;30314816 False 3 100;0;0 6.225 True ENSG00000131979 ENSG00000131979 HGNC:4193 GCH1 gene GCH1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia MONDO:0019064, GCH1-related Neurodegeneration;HP:0002180 21935284;24509643;33713342 False 3 0;100;0 6.225 True ENSG00000131979 ENSG00000131979 HGNC:4193 GDAP2 gene GDAP2 Expert Review Green;Royal Melbourne Hospital;Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000196505 ENSG00000196505 HGNC:18010 GEMIN5 gene GEMIN5 Expert Review Green;Literature;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, OMIM # 619333 Neurodegeneration;HP:0002180 34569062;33963192 False 3 100;0;0 6.225 True ENSG00000082516 ENSG00000082516 HGNC:20043 GFAP gene GFAP Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000131095 ENSG00000131095 HGNC:4235 GFAP gene GFAP Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alexander disease MONDO:0008752 Neurodegeneration;HP:0002180 34146839 False 3 100;0;0 6.225 True ENSG00000131095 ENSG00000131095 HGNC:4235 GJA1 gene GJA1 Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 Neurodegeneration;HP:0002180 31023660 False 3 100;0;0 6.225 False ENSG00000152661 ENSG00000152661 HGNC:4274 GJC2 gene GJC2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating leukodystrophy 2, 608804;Leukodystrophy, hypomyelinating, 2;Autosomal Recessive Ataxia;Spastic paraplegia 44, 613206 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000198835 ENSG00000198835 HGNC:17494 GLA gene GLA Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Fabry disease MONDO:0010526" Neurodegeneration;HP:0002180 36927868;38254927;9213072;23949010;32510623 False 3 100;0;0 6.225 True ENSG00000102393 ENSG00000102393 HGNC:4296 GLB1 gene GLB1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1-gangliosidosis, type III , MIM#230650;Parkinsonism Neurodegeneration;HP:0002180 PMID: 34514040 False 3 100;0;0 6.225 True ENSG00000170266 ENSG00000170266 HGNC:4298 GLRX5 gene GLRX5 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spasticity, childhood-onset, with hyperglycinemia 616859" Neurodegeneration;HP:0002180 PMID: 24334290;30770271 False 3 50;50;0 6.225 True ENSG00000182512 ENSG00000182512 HGNC:20134 GOSR2 gene GOSR2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 6, 614018;Progressive myoclonic epilepsy 6, 614018 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000108433 ENSG00000108433 HGNC:4431 GPAA1 gene GPAA1 Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 15, 617810 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000197858 ENSG00000197858 HGNC:4446 GPT2 gene GPT2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281 Neurodegeneration;HP:0002180 29882329;31471722;27601654 False 3 100;0;0 6.225 True ENSG00000166123 ENSG00000166123 HGNC:18062 GRID2 gene GRID2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 18, 616204 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000152208 ENSG00000152208 HGNC:4576 GRM1 gene GRM1 Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 13;Spinocerebellar ataxia 44, 617691, autosomal recessive spinocerebellar ataxia type 13, 614831 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000152822 ENSG00000152822 HGNC:4593 GRN gene GRN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 Neurodegeneration;HP:0002180 20301545;17436289 False 3 100;0;0 6.225 True ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM# 607485 Neurodegeneration;HP:0002180 17923627;20301545 False 3 100;0;0 6.225 False ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Expert Review Green;ClinGen Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 Neurodegeneration;HP:0002180 18184915;23596077 False 3 100;0;0 6.225 True ENSG00000030582 ENSG00000030582 HGNC:4601 GSS gene GSS NHS GMS;Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gluthathione synthetase deficiency, MIM# 266130 Neurodegeneration;HP:0002180 15717202 False 3 100;0;0 6.225 True ENSG00000100983 ENSG00000100983 HGNC:4624 HACE1 gene HACE1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia and psychomotor retardation with or without seizures, 616756;MONDO:0014764;Spastic paraplegia;psychomotor retardation Neurodegeneration;HP:0002180 26424145;26437029;31321300 False 3 100;0;0 6.225 True ENSG00000085382 ENSG00000085382 HGNC:21033 HEXA gene HEXA Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms, 272800;Tay-Sachs disease, 272800 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000213614 ENSG00000213614 HGNC:4878 HEXA gene HEXA Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms or Tay-Sachs disease MIM#272800 Neurodegeneration;HP:0002180 31995250;31076878 False 3 100;0;0 6.225 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXB gene HEXB Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms MIM#268800 Neurodegeneration;HP:0002180 31995250;24263030 False 3 100;0;0 6.225 True ENSG00000049860 ENSG00000049860 HGNC:4879 HEXB gene HEXB Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms, 268800;Sandhoff disease, 268800 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000049860 ENSG00000049860 HGNC:4879 HNRNPA1 gene HNRNPA1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 20 MIM#615426 Neurodegeneration;HP:0002180 23455423;34291734 False 3 100;0;0 6.225 True ENSG00000135486 ENSG00000135486 HGNC:5031 HPDL gene HPDL Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome Neurodegeneration;HP:0002180 32707086 False 3 100;0;0 6.225 True ENSG00000186603 ENSG00000186603 HGNC:28242 HSPD1 gene HSPD1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 4, MIM# 612233;Spastic paraplegia 13, autosomal dominant, MIM# 605280" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000144381 ENSG00000144381 HGNC:5261 HTRA1 gene HTRA1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal CARASIL syndrome MIM#600142;Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2 MIM#616779 Neurodegeneration;HP:0002180 29895533;26063658;19387015 False 3 100;0;0 6.225 False ENSG00000166033 ENSG00000166033 HGNC:9476 IBA57 gene IBA57 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 74, autosomal recessive MIM#616451 Neurodegeneration;HP:0002180 25609768;30258207 False 3 100;0;0 6.225 True ENSG00000181873 ENSG00000181873 HGNC:27302 IFIH1 gene IFIH1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aicardi-Goutieres syndrome 7 MIM#615846 Neurodegeneration;HP:0002180 25243380;31427910;24686847;24995871 False 3 100;0;0 6.225 True ENSG00000115267 ENSG00000115267 HGNC:18873 INPP4A gene INPP4A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354 Neurodegeneration;HP:0002180 PMID: 39315527 False 3 100;0;0 6.225 True ENSG00000040933 ENSG00000040933 HGNC:6074 INPP5E gene INPP5E Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 1 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000148384 ENSG00000148384 HGNC:21474 IRF2BPL gene IRF2BPL Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with regression, abnormal movement, loss of speech and seizures, 618088 Neurodegeneration;HP:0002180 30057031 False 3 100;0;0 6.225 True ENSG00000119669 ENSG00000119669 HGNC:14282 ITM2B gene ITM2B Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia Neurodegeneration;HP:0002180 10391242;10781099;33814452 False 3 100;0;0 6.225 False ENSG00000136156 ENSG00000136156 HGNC:6174 ITM2B gene ITM2B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral amyloid angiopathy MONDO:0005620 Neurodegeneration;HP:0002180 10391242;10781099;20385796;33814452 False 3 100;0;0 6.225 True ENSG00000136156 ENSG00000136156 HGNC:6174 ITPR1 gene ITPR1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 15 MIM#606658;Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000150995 ENSG00000150995 HGNC:6180 KCNA1 gene KCNA1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown EPISODIC ATAXIA, TYPE 1;myokymia with periodic ataxia;Episodic ataxia/myokymia syndrome, 160120;Episodic ataxia/myokymia syndrome Neurodegeneration;HP:0002180 11026449 False 3 100;0;0 6.225 True Other ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA2 gene KCNA2 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 32, 616366 Neurodegeneration;HP:0002180 29050392 False 3 100;0;0 6.225 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNA2 gene KCNA2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia and ataxia Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000177301 ENSG00000177301 HGNC:6220 KCNC3 gene KCNC3 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 13 MIM#605259 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000131398 ENSG00000131398 HGNC:6235 KCND3 gene KCND3 Expert Review Green;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 19, MIM# 607346" Neurodegeneration;HP:0002180 32823520 False 3 100;0;0 6.225 True ENSG00000171385 ENSG00000171385 HGNC:6239 KCNJ10 gene KCNJ10 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Seizures, Sensorineural Deafness, Ataxia, Mental Retardation, and Electrolyte Imbalance Syndrome;SESAME syndrome, 612780 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000177807 ENSG00000177807 HGNC:6256 KCNN2 gene KCNN2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 Neurodegeneration;HP:0002180 33242881 False 3 100;0;0 6.225 True ENSG00000080709 ENSG00000080709 HGNC:6291 KDM5C gene KDM5C Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type MIM# 300534;MONDO:0010355 Neurodegeneration;HP:0002180 15586325;32279304 False 3 100;0;0 6.225 True ENSG00000126012 ENSG00000126012 HGNC:11114 KIAA1161 gene KIAA1161 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317;Primary familial brain calcification;Atypical parkinsonism;Supranuclear gaze palsy Neurodegeneration;HP:0002180 32211515;30656188;30649222;30460687;29910000;31951047 False 3 100;0;0 6.225 True ENSG00000164976 ENSG00000164976 HGNC:19918 KIDINS220 gene KIDINS220 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296;MONDO:0015007 Neurodegeneration;HP:0002180 27005418;29667355 False 3 100;0;0 6.225 True ENSG00000134313 ENSG00000134313 HGNC:29508 KIF1A gene KIF1A Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 30, autosomal dominant MIM# 610357;Spastic paraplegia 30, autosomal recessive 620607 Neurodegeneration;HP:0002180 26410750;21487076;22258533;32096284;31488895;29159194;25585697 False 3 100;0;0 6.225 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1C gene KIF1C Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive MIM#611302 Neurodegeneration;HP:0002180 24482476;24319291;31413903;29544888 False 3 100;0;0 6.225 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF1C gene KIF1C Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive, 611302;Spastic ataxia 2, autosomal recessive Neurodegeneration;HP:0002180 24482476;24319291;31413903;29544888 False 3 100;0;0 6.225 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF5A gene KIF5A Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 10, autosomal dominant, MIM# 604187" Neurodegeneration;HP:0002180 16489470;21623771;15452312;18853458;16476820 False 3 100;0;0 6.225 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Amyotrophic lateral sclerosis, susceptibility to, 25} MIM#617921 Neurodegeneration;HP:0002180 29342275;30301576;29566793 False 3 100;0;0 6.225 False ENSG00000155980 ENSG00000155980 HGNC:6323 KIF7 gene KIF7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Koubert syndrome 12;Acrocallosal syndrome, Schinzel type Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000166813 ENSG00000166813 HGNC:30497 KLC2 gene KLC2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia, optic atrophy, and neuropathy, MIM#609541 Neurodegeneration;HP:0002180 False 3 50;0;50 6.225 True ENSG00000174996 ENSG00000174996 HGNC:20716 KMT2B gene KMT2B Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 28, childhood-onset , MIM#617284 Neurodegeneration;HP:0002180 PMID: 33816656 False 3 100;0;0 6.225 True ENSG00000272333 ENSG00000272333 HGNC:15840 KPNA3 gene KPNA3 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia-88 (SPG88), MIM#620106 Neurodegeneration;HP:0002180 34564892 False 3 100;0;0 6.225 True ENSG00000102753 ENSG00000102753 HGNC:6396 L1CAM gene L1CAM Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Hereditary spastic paraplegia, 308840;MASA syndrome, 303350;X-linked hydrocephalus, 307000 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000198910 ENSG00000198910 HGNC:6470 LAMA1 gene LAMA1 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Poretti-Boltshauser syndrome;Cerebellar ataxia, intellectual disability, oculomotor apraxia, cerebellar cysts syndrome Neurodegeneration;HP:0002180 26932191;25105227 False 3 100;0;0 6.225 True ENSG00000101680 ENSG00000101680 HGNC:6481 LARS2 gene LARS2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021;Leukodystrophy Neurodegeneration;HP:0002180 29205794;32423379;30737337 False 3 100;0;0 6.225 True ENSG00000011376 ENSG00000011376 HGNC:17095 LETM1 gene LETM1 Expert Review Green;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089 Neurodegeneration;HP:0002180 36055214 False 3 100;0;0 6.225 True ENSG00000168924 ENSG00000168924 HGNC:6556 LMNB1 gene LMNB1 Victorian Clinical Genetics Services;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant MIM#169500 Neurodegeneration;HP:0002180 31695592 False 3 100;0;0 6.225 False ENSG00000113368 ENSG00000113368 HGNC:6637 LRRK2 gene LRRK2 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000188906 ENSG00000188906 HGNC:18618 LRRK2 gene LRRK2 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000188906 ENSG00000188906 HGNC:18618 LYST gene LYST Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chediak-Higashi syndrome MONDO:0008963 Neurodegeneration;HP:0002180 23436631;23521865;20301751 False 3 100;0;0 6.225 True ENSG00000143669 ENSG00000143669 HGNC:1968 MAG gene MAG Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 75, autosomal recessive, 616680;Cerebellar ataxia Neurodegeneration;HP:0002180 31402626;24482476;26179919;32629324 False 3 100;0;0 6.225 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAG gene MAG Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 75, autosomal recessive, MIM# 616680;Cerebellar ataxia;Oculomotor apraxia" Neurodegeneration;HP:0002180 32629324;32340215;32629324 False 3 100;0;0 6.225 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAPK8IP3 gene MAPK8IP3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Neurodevelopmental disorder with or without variable brain abnormalities 618443" Neurodegeneration;HP:0002180 PMID: 30612693;30945334 False 3 100;0;0 6.225 True ENSG00000138834 ENSG00000138834 HGNC:6884 MAPT gene MAPT Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Supranuclear palsy, progressive (MIM# 601104) AD;Supranuclear palsy, progressive atypical (MIM# 260540) AR Neurodegeneration;HP:0002180 20838030;11220749 False 3 100;0;0 6.225 True ENSG00000186868 ENSG00000186868 HGNC:6893 MAPT gene MAPT Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted late-onset Parkinson disease MONDO:0008199 Neurodegeneration;HP:0002180 20301678 False 3 100;0;0 6.225 True ENSG00000186868 ENSG00000186868 HGNC:6893 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 Neurodegeneration;HP:0002180 16672289;22448145 False 3 100;0;0 6.225 True ENSG00000247626 ENSG00000247626 HGNC:25133 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000247626 ENSG00000247626 HGNC:25133 MATR3 gene MATR3 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 19344878;24686783;35205163;34659085;34173818;26493020 False 3 100;0;0 6.225 False ENSG00000015479 ENSG00000015479 HGNC:6912 MECP2 gene MECP2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females MECP2-related disorders;Rett syndrome, MIM# 312750;Mental retardation, X-linked, syndromic 13, MIM# 300055 Neurodegeneration;HP:0002180 31970230;27050783 False 3 100;0;0 6.225 True ENSG00000169057 ENSG00000169057 HGNC:6990 MED27 gene MED27 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MIM# 619286 Neurodegeneration;HP:0002180 33443317 False 3 100;0;0 6.225 True ENSG00000160563 ENSG00000160563 HGNC:2377 MKS1 gene MKS1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 28 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000011143 ENSG00000011143 HGNC:7121 MMACHC gene MMACHC NHS GMS;Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria and homocystinuria cblC type, 277400;Methylmalonic aciduria and homocystinuria, cblC type, 277400;Ataxia and hypogonadism Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000132763 ENSG00000132763 HGNC:24525 MORC2 gene MORC2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Axonal type CMT disease type 2Z, 616688;Cerebellar ataxia Neurodegeneration;HP:0002180 28402445 False 3 50;0;50 6.225 True ENSG00000133422 ENSG00000133422 HGNC:23573 MRE11 gene MRE11 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-Telangiectasia-Like Disorder;Ataxia-telangiectasia-like disorder 1, 604391 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000020922 ENSG00000020922 HGNC:7230 MSTO1 gene MSTO1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy, mitochondrial, and ataxia MIM#617675 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000125459 ENSG00000125459 HGNC:29678 MT-ATP6 gene MT-ATP6 Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related Neurodegeneration;HP:0002180 40112238 False 3 100;0;0 6.225 True ENSG00000198899 ENSG00000198899 HGNC:7414 MTCL1 gene MTCL1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal slowly progressive cerebellar ataxia, mild intellectual disability, seizures in childhood and episodic pain in the lower limbs Neurodegeneration;HP:0002180 30548255;28283581 False 3 100;0;0 6.225 True ENSG00000168502 ENSG00000168502 HGNC:29121 MT-CO1 gene MT-CO1 Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related Neurodegeneration;HP:0002180 30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519 False 3 100;0;0 6.225 True ENSG00000198804 ENSG00000198804 HGNC:7419 MT-CO2 gene MT-CO2 Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related Neurodegeneration;HP:0002180 34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519 False 3 100;0;0 6.225 True ENSG00000198712 ENSG00000198712 HGNC:7421 MT-CYB gene MT-CYB Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related Neurodegeneration;HP:0002180 39858655;34804306;26937408 False 3 100;0;0 6.225 True ENSG00000198727 ENSG00000198727 HGNC:7427 MTFMT gene MTFMT Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 15 MIM#614947;Mitochondrial complex I deficiency, nuclear type 27 MIM#618248 Neurodegeneration;HP:0002180 26060307;24461907 False 3 100;0;0 6.225 True ENSG00000103707 ENSG00000103707 HGNC:29666 MT-ND4 gene MT-ND4 Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND4-related Neurodegeneration;HP:0002180 12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231 False 3 100;0;0 6.225 True ENSG00000198886 ENSG00000198886 HGNC:7459 MT-TE gene MT-TE Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TE-related Neurodegeneration;HP:0002180 8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256 False 3 100;0;0 6.225 True ENSG00000210194 ENSG00000210194 HGNC:7479 MT-TG gene MT-TG Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related Neurodegeneration;HP:0002180 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 6.225 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TH gene MT-TH Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TH-related Neurodegeneration;HP:0002180 12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194 False 3 100;0;0 6.225 True ENSG00000210176 ENSG00000210176 HGNC:7487 MTTP gene MTTP Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Abetalipoproteinemia, 200100;Abetalipoproteinemia Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000138823 ENSG00000138823 HGNC:7467 MT-TS2 gene MT-TS2 Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS2-related Neurodegeneration;HP:0002180 9792552;10090882;16950817;21257182;22369973;22378285 False 3 100;0;0 6.225 True ENSG00000210184 ENSG00000210184 HGNC:7498 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related Neurodegeneration;HP:0002180 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 6.225 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TW gene MT-TW Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related Neurodegeneration;HP:0002180 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 6.225 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TY gene MT-TY Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related Neurodegeneration;HP:0002180 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 6.225 True ENSG00000210144 ENSG00000210144 HGNC:7502 MVK gene MVK Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mevalonic aciduria 610377 Neurodegeneration;HP:0002180 12563048;10401001;28095071 False 3 100;0;0 6.225 True ENSG00000110921 ENSG00000110921 HGNC:7530 NEK1 gene NEK1 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis, susceptibility to, 24 MIM#617892 Neurodegeneration;HP:0002180 31768050;26945885;27455347;29929116 False 3 100;0;0 6.225 True ENSG00000137601 ENSG00000137601 HGNC:7744 NFU1 gene NFU1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 1 (MIM#605711);Spastic paraplegia 93, autosomal recessive, MIM# 620938 Neurodegeneration;HP:0002180 36256512 False 3 100;0;0 6.225 True ENSG00000169599 ENSG00000169599 HGNC:16287 NHLRC1 gene NHLRC1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2B, Lafora, 254780;Epilepsy, progressive myoclonic 2B (Lafora) 254780 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000187566 ENSG00000187566 HGNC:21576 NHLRC1 gene NHLRC1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780 Neurodegeneration;HP:0002180 28556688;34117373 False 3 100;0;0 6.225 True ENSG00000187566 ENSG00000187566 HGNC:21576 NIPA1 gene NIPA1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 6, autosomal dominant, MIM# 600363" Neurodegeneration;HP:0002180 14508710;15711826 False 3 100;0;0 6.225 True ENSG00000170113 ENSG00000170113 HGNC:17043 NKX2-1 gene NKX2-1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Choreoathetosis, hypothyroidism, and neonatal respiratory distress 610978;Choreoathetosis, hypothyroidism and neonatal respiratory distress, 610978;Chorea, hereditary benign 118700;Hereditary bening chorea, 118700 Neurodegeneration;HP:0002180 10931427;27066577;26839702;26103969 False 3 100;0;0 6.225 True ENSG00000136352 ENSG00000136352 HGNC:11825 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy, 617560;MONDO:0033043 Neurodegeneration;HP:0002180 28575651;15601927;32246862;32004679 False 3 100;0;0 6.225 True ENSG00000148826 ENSG00000148826 HGNC:19321 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic ataxia 8 with hypomyelinating leukodystrophy, 617560;Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000148826 ENSG00000148826 HGNC:19321 NOTCH1 gene NOTCH1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related Neurodegeneration;HP:0002180 35947102 False 3 100;0;0 6.225 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NOTCH3 gene NOTCH3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310 Neurodegeneration;HP:0002180 31960911 False 3 100;0;0 6.225 True ENSG00000074181 ENSG00000074181 HGNC:7883 NOVA2 gene NOVA2 Expert Review Green;Literature;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, OMIM #618859 Neurodegeneration;HP:0002180 PMID: 32197073 False 3 100;0;0 6.225 True ENSG00000104967 ENSG00000104967 HGNC:7887 NPC1 gene NPC1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 (MIM#257220;MONDO:0009757) Neurodegeneration;HP:0002180 20301473;11182931 False 3 0;100;0 6.225 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Niemann-Pick disease, MIM# 257220;Parkinsonism Neurodegeneration;HP:0002180 24035292;30369906 False 3 100;0;0 6.225 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C1, 257220;Niemann-Pick disease types C1 and D (#257220) Neurodegeneration;HP:0002180 10480349;17003072;25497598;33228797 False 3 100;0;0 6.225 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC2 gene NPC2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-pick disease, type C2 MIM#607625 Neurodegeneration;HP:0002180 27792009;20525256 False 3 100;0;0 6.225 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPC2 gene NPC2 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C2, 607625;Niemann-Pick disease type C2 (#607625) Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPC2 gene NPC2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann Pick C2, OMIM 607625;Parkinsonism Neurodegeneration;HP:0002180 PMID: 35695805 False 3 100;0;0 6.225 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPHP1 gene NPHP1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 4 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000144061 ENSG00000144061 HGNC:7905 NPTX1 gene NPTX1 Literature;Expert Review Green;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cerebellar ataxia MONDO#0000437, NPTX1-related Neurodegeneration;HP:0002180 34788392;35288776;35285082;35560436 False 3 100;0;0 6.225 False ENSG00000171246 ENSG00000171246 HGNC:7952 NR4A2 gene NR4A2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 Neurodegeneration;HP:0002180 31922365 False 3 100;0;0 6.225 True ENSG00000153234 ENSG00000153234 HGNC:7981 NT5C2 gene NT5C2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 45, autosomal recessive, MIM# 613162;MONDO:0013165 Neurodegeneration;HP:0002180 24482476;32153630;29123918;28884889;28327087 False 3 100;0;0 6.225 True ENSG00000076685 ENSG00000076685 HGNC:8022 NUBPL gene NUBPL Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 21, OMIM # 618242 Neurodegeneration;HP:0002180 23553477;32518176 False 3 100;0;0 6.225 True ENSG00000151413 ENSG00000151413 HGNC:20278 NUS1 gene NUS1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder, autosomal dominant 55, with seizures, MIM# 617831;Parkinsonism;Developmental delay;Intellectual disability;Ataxia;Myoclonus" Neurodegeneration;HP:0002180 PMID: 32485575;30348779 False 3 100;0;0 6.225 True ENSG00000153989 ENSG00000153989 HGNC:21042 NUS1 gene NUS1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Epilepsy, myoclonus, ataxia and scoliosis;Mental retardation, autosomal dominant 55, with seizures, 617831 Neurodegeneration;HP:0002180 PMID: 31656175;29100083 False 3 100;0;0 6.225 True ENSG00000153989 ENSG00000153989 HGNC:21042 OFD1 gene OFD1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 10 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000046651 ENSG00000046651 HGNC:2567 OPA1 gene OPA1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal OPA1-related optic atrophy with or without extraocular features, MONDO:0800181 Neurodegeneration;HP:0002180 30165240;28494813 False 3 100;0;0 6.225 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA3 gene OPA3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "3-methylglutaconic aciduria, type III, MIM# 258501" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, 258501;Optic atrophy 3 with cataract, 165300;3-methylglutaconic aciduria type III, 258501;Costeff syndrome Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000125741 ENSG00000125741 HGNC:8142 OPHN1 gene OPHN1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked mental retardation with cerebellar hypoplasia and distinctive facial appearance, 300486;Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000079482 ENSG00000079482 HGNC:8148 OPTN gene OPTN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435) Neurodegeneration;HP:0002180 31838784;20428114;20301623 False 3 100;0;0 6.225 True ENSG00000123240 ENSG00000123240 HGNC:17142 OPTN gene OPTN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MONDO: 0013264, MIM#613435) Neurodegeneration;HP:0002180 20428114;31838784;27493188 False 3 100;0;0 6.225 True ENSG00000123240 ENSG00000123240 HGNC:17142 PANK2 gene PANK2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pantothenate kinase-associated neurodegeneration MONDO:0009319 Neurodegeneration;HP:0002180 23447832;20301663 False 3 0;0;0 6.225 True ENSG00000125779 ENSG00000125779 HGNC:15894 PANK2 gene PANK2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 1 (MIM#234200) Neurodegeneration;HP:0002180 24600523;23447832;19480328 False 3 100;0;0 6.225 True ENSG00000125779 ENSG00000125779 HGNC:15894 PARK7 gene PARK7 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000116288 ENSG00000116288 HGNC:16369 PARK7 gene PARK7 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive early-onset Parkinson disease 7 MONDO:0011658 Neurodegeneration;HP:0002180 20301402 False 3 100;0;0 6.225 True ENSG00000116288 ENSG00000116288 HGNC:16369 PCYT2 gene PCYT2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy Neurodegeneration;HP:0002180 31637422 False 3 100;0;0 6.225 True ENSG00000185813 ENSG00000185813 HGNC:8756 PDE1B gene PDE1B Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related Neurodegeneration;HP:0002180 40492975 False 3 100;0;0 6.225 True ENSG00000123360 ENSG00000123360 HGNC:8775 PDE8B gene PDE8B Expert Review Green;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Striatal degeneration, autosomal dominant, MIM#609161 Neurodegeneration;HP:0002180 20085714;26769607;26475694 False 3 100;0;0 6.225 True ENSG00000113231 ENSG00000113231 HGNC:8794 PDGFB gene PDGFB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5, MIM# 615483 Neurodegeneration;HP:0002180 23913003 False 3 100;0;0 6.225 True ENSG00000100311 ENSG00000100311 HGNC:8800 PDGFRB gene PDGFRB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 4, MIM# 615007 Neurodegeneration;HP:0002180 23255827;30979360 False 3 100;0;0 6.225 True ENSG00000113721 ENSG00000113721 HGNC:8804 PDYN gene PDYN Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000101327 ENSG00000101327 HGNC:8820 PEX16 gene PEX16 Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Zellweger syndrome (614876);Peroxisome biogenesis disorder 8B (#614877) infantile progressive ataxia and spastic paresis;Peroxisome biogenesis disorder 8A, 614876;Peroxisome biogenesis disorder 8B, 614877 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000121680 ENSG00000121680 HGNC:8857 PEX7 gene PEX7 Expert Review Green;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum disease;Peroxisome biogenesis disorder 9B, MIM#614879 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000112357 ENSG00000112357 HGNC:8860 PFN1 gene PFN1 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 67;33;0 6.225 False ENSG00000108518 ENSG00000108518 HGNC:8881 PGBD5 gene PGBD5 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482" Neurodegeneration;HP:0002180 41533792 False 3 100;0;0 6.225 True ENSG00000177614 ENSG00000177614 HGNC:19405 PGK1 gene PGK1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Phosphoglycerate kinase 1 deficiency, MIM# 300653;Haemolytic anaemia;Rhabdomyolysis;Myopathy;Juvenile Parkinsonism;OMIM 300653 Neurodegeneration;HP:0002180 PMID: 30975619 False 3 100;0;0 6.225 True ENSG00000102144 ENSG00000102144 HGNC:8896 PHYH gene PHYH Expert Review Green;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Refsum disease, MIM# 266500" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000107537 ENSG00000107537 HGNC:8940 PI4KA gene PI4KA Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental syndrome with hypomyelinating leukodystrophy;Spastic paraplegia 84, autosomal recessive, MIM# 619621 Neurodegeneration;HP:0002180 PMID: 34415322 False 3 100;0;0 6.225 True ENSG00000241973 ENSG00000241973 HGNC:8983 PIGS gene PIGS Expert Review Green;Literature;Expert Review Green;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 95, OMIM # 618143 Neurodegeneration;HP:0002180 30269814;33410539 False 3 100;0;0 6.225 True ENSG00000087111 ENSG00000087111 HGNC:14937 PINK1 gene PINK1 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000158828 ENSG00000158828 HGNC:14581 PINK1 gene PINK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 6, early onset MIM#605909 Neurodegeneration;HP:0002180 28980524 False 3 100;0;0 6.225 True ENSG00000158828 ENSG00000158828 HGNC:14581 PITRM1 gene PITRM1 Expert Review Green;Literature;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis Neurodegeneration;HP:0002180 26697887;29764912 False 3 100;0;0 6.225 True ENSG00000107959 ENSG00000107959 HGNC:17663 PLA2G6 gene PLA2G6 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 14, autosomal recessive, MIM# 612953 Neurodegeneration;HP:0002180 25634434;26836416;22406380;20938027 False 3 0;100;0 6.225 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive Parkinson disease 14 MONDO:0013060 Neurodegeneration;HP:0002180 20301718 False 3 100;0;0 6.225 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive Parkinson disease 14, 612953;Parkinson disease 14 (#612953);Infantile neuroaxonal dystrophy 1 (#256600);Infantile neuroaxonal dystrophy 1, 256600;Neurodegeneration with brain iron accumulation 2B (#610217);Neurodegeneration with brain iron accumulation 2B, 610217 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLP1 gene PLP1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Spastic paraplegia 2, X-linked, MIM# 312920" Neurodegeneration;HP:0002180 15627202;8012387 False 3 100;0;0 6.225 True ENSG00000123560 ENSG00000123560 HGNC:9086 PMPCA gene PMPCA Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200 Neurodegeneration;HP:0002180 25808372;26657514;33272776;30617178 False 3 100;0;0 6.225 True ENSG00000165688 ENSG00000165688 HGNC:18667 PMPCB gene PMPCB Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 6, 617954 Neurodegeneration;HP:0002180 29576218 False 3 100;0;0 6.225 True ENSG00000105819 ENSG00000105819 HGNC:9119 PNKD gene PNKD Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Paroxysmal nonkinesigenic dyskinesia 1, 118800 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000127838 ENSG00000127838 HGNC:9153 PNKP gene PNKP Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, seizures and developmental delay, 613402;Ataxia-oculomotor apraxia 4, 616267;Ataxia with oculomotor apraxia 4 (#616267) Neurodegeneration;HP:0002180 31436889;31707899 False 3 100;0;0 6.225 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNPLA6 gene PNPLA6 Expert Review Green;Expert list;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Boucher-Neuhauser syndrome MIM#215470;Laurence-Moon syndrome MIM#245800;Oliver-McFarlane syndrome MIM#275400;Spastic paraplegia 39, autosomal recessive MIM#612020 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA8 gene PNPLA8 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related Neurodegeneration;HP:0002180 PMID: 39082157 False 3 100;0;0 6.225 True ENSG00000135241 ENSG00000135241 HGNC:28900 PNPT1 gene PNPT1 Literature;Expert Review Green;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 25, MIM# 608703" Neurodegeneration;HP:0002180 35411967;37935417;39729134;39899068;39924761;40757543 False 3 60;40;0 6.225 False ENSG00000138035 ENSG00000138035 HGNC:23166 POLG gene POLG Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant progressive external ophthalmoplegia MONDO:0008003 Neurodegeneration;HP:0002180 20301791;15351195 False 3 100;0;0 6.225 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLR3A gene POLR3A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 Neurodegeneration;HP:0002180 PMID: 33652360 False 3 100;0;0 6.225 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia Neurodegeneration;HP:0002180 31637490 False 3 100;0;0 6.225 False ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3B gene POLR3B Expert Review Green;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#614381 Neurodegeneration;HP:0002180 22036171;22036172 False 3 100;0;0 6.225 True ENSG00000013503 ENSG00000013503 HGNC:30348 POU4F1 gene POU4F1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia;intention tremor;hypotonia Neurodegeneration;HP:0002180 33783914;8876243 False 3 100;0;0 6.225 True ENSG00000152192 ENSG00000152192 HGNC:9218 PPP2R5D gene PPP2R5D Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early onset Parkinsonism;Houge-Janssens syndrome 1, MIM#616355 Neurodegeneration;HP:0002180 33338668;32743835 False 3 100;0;0 6.225 True ENSG00000112640 ENSG00000112640 HGNC:9312 PRDX3 gene PRDX3 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia MONDO:0000437, PRDX3-related Neurodegeneration;HP:0002180 33889951 False 3 100;0;0 6.225 True ENSG00000165672 ENSG00000165672 HGNC:9354 PRKCG gene PRKCG Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14, MIM# 605361;Myoclonus;Parkinsonism Neurodegeneration;HP:0002180 PMID: 29603387 False 3 100;0;0 6.225 True ENSG00000126583 ENSG00000126583 HGNC:9402 PRKN gene PRKN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive juvenile Parkinson disease 2 MONDO:0010820 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRKN gene PRKN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease, juvenile, type 2 MIM#600116 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRKRA gene PRKRA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dystonia 16 MONDO:0012789 Neurodegeneration;HP:0002180 33502045 False 3 100;0;0 6.225 True ENSG00000180228 ENSG00000180228 HGNC:9438 PRNP gene PRNP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted inherited Creutzfeldt-Jakob disease MONDO:0007403;Gerstmann-Straussler-Scheinker syndrome MONDO:0007656 Neurodegeneration;HP:0002180 20301407 False 3 100;0;0 6.225 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Prion Disease (MIM#176640);Creutzfeldt-Jakob disease (MIM#123400) Neurodegeneration;HP:0002180 27910931;19571725, 20301407;6351815 False 3 100;0;0 6.225 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease Neurodegeneration;HP:0002180 2564168;34324063;20301407 False 3 100;0;0 6.225 False ENSG00000171867 ENSG00000171867 HGNC:9449 PRRT2 gene PRRT2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal PRRT2-associated paroxysmal movement disorder MONDO:0100556 Neurodegeneration;HP:0002180 26598494;31193310;30501978;30713971 False 3 100;0;0 6.225 True ENSG00000167371 ENSG00000167371 HGNC:30500 PSAP gene PSAP Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491 Neurodegeneration;HP:0002180 32201884 False 3 100;0;0 6.225 True ENSG00000197746 ENSG00000197746 HGNC:9498 PSEN1 gene PSEN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, type 3 (MIM#607822;MONDO:0011913) Neurodegeneration;HP:0002180 22503161;20301340 False 3 100;0;0 6.225 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN1 gene PSEN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 3 MONDO:0011913 Neurodegeneration;HP:0002180 3548932;34843019;36825052 False 3 100;0;0 6.225 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN1 gene PSEN1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, type 3, with spastic paraparesis and apraxia, MIM# 607822 Neurodegeneration;HP:0002180 33274538 False 3 100;0;0 6.225 False ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN2 gene PSEN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease-4 (MIM#606889) Neurodegeneration;HP:0002180 22503161;20301340;25323700;35491795 False 3 100;0;0 6.225 True ENSG00000143801 ENSG00000143801 HGNC:9509 PSMF1 gene PSMF1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related Neurodegeneration;HP:0002180 https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 False 3 100;0;0 6.225 True ENSG00000125818 ENSG00000125818 HGNC:9571 PTRH2 gene PTRH2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile multi-system neurologic, endocrine, and pancreatic disease, 616263 Neurodegeneration;HP:0002180 25558065;25574476;31057140;27129381 False 3 100;0;0 6.225 True ENSG00000141378 ENSG00000141378 HGNC:24265 PTRHD1 gene PTRHD1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747 Neurodegeneration;HP:0002180 27753167;27134041;30398675;29143421 False 3 100;0;0 6.225 True ENSG00000184924 ENSG00000184924 HGNC:33782 PTS gene PTS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000150787 ENSG00000150787 HGNC:9689 PUM1 gene PUM1 Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 47, 617931 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000134644 ENSG00000134644 HGNC:14957 QDPR gene QDPR Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, MIM#261630;Dehydropteridin reductase deficiency, Infantile-onset dystonia;Parkinsonism;Epilepsy;Autonomic dysfunction;Hyperphenylalaninemia Neurodegeneration;HP:0002180 PMID: 28413401 False 3 100;0;0 6.225 True ENSG00000151552 ENSG00000151552 HGNC:9752 RAB1A gene RAB1A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, RAB1A-related Neurodegeneration;HP:0002180 37924809 False 3 100;0;0 6.225 False ENSG00000138069 ENSG00000138069 HGNC:9758 RAB32 gene RAB32 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Parkinson disease 26, autosomal dominant, susceptibility to}, MIM# 620923 Neurodegeneration;HP:0002180 38858457;38614108;38293014;40118982;40568674;41103171 False 3 33;33;33 6.225 True Other ENSG00000118508 ENSG00000118508 HGNC:9772 RAB39B gene RAB39B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Early-onset parkinsonism-intellectual disability syndrome MONDO:0010709 Neurodegeneration;HP:0002180 25434005;26399558;26739247 False 3 100;0;0 6.225 True ENSG00000155961 ENSG00000155961 HGNC:16499 RAB3A gene RAB3A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 52, MIM# 621535 Neurodegeneration;HP:0002180 40166812 False 3 100;0;0 6.225 True ENSG00000105649 ENSG00000105649 HGNC:9777 RAB3A gene RAB3A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092 Neurodegeneration;HP:0002180 40166812 False 3 100;0;0 6.225 True ENSG00000105649 ENSG00000105649 HGNC:9777 RAB3GAP2 gene RAB3GAP2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Martsolf syndrome 212720" Neurodegeneration;HP:0002180 PMID: 32376645 False 3 100;0;0 6.225 True ENSG00000118873 ENSG00000118873 HGNC:17168 REEP1 gene REEP1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 31, autosomal dominant, MIM# 610250" Neurodegeneration;HP:0002180 16826527;19034539 False 3 100;0;0 6.225 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP1 gene REEP1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 31, autosomal dominant MIM#610250 Neurodegeneration;HP:0002180 23108492;22703882 False 3 100;0;0 6.225 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP2 gene REEP2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 72, dominant and recessive, MIM# 615625;MONDO:0014282 Neurodegeneration;HP:0002180 33526816;28491902;24388663 False 3 100;0;0 6.225 True ENSG00000132563 ENSG00000132563 HGNC:17975 RFC1 gene RFC1 Literature;Expert list;Expert Review Green;Expert Review Green;Expert list;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Neurodegeneration;HP:0002180 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 6.225 False ENSG00000035928 ENSG00000035928 HGNC:9969 RINT1 gene RINT1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, MONDO:0019064, RINT1-related Neurodegeneration;HP:0002180 37463447;38990652 False 3 50;50;0 6.225 True ENSG00000135249 ENSG00000135249 HGNC:21876 RNASEH2B gene RNASEH2B Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi Goutieres syndrome 2, MIM# 610181 Neurodegeneration;HP:0002180 29691679;30223285;29239743;28762473 False 3 100;0;0 6.225 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNF170 gene RNF170 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 85, autosomal recessive, MIM# 619686 Neurodegeneration;HP:0002180 31636353 False 3 100;0;0 6.225 True ENSG00000120925 ENSG00000120925 HGNC:25358 RNF170 gene RNF170 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia, sensory, 1, autosomal dominant, MIM# 608984 Neurodegeneration;HP:0002180 32943585;21115467 False 3 100;0;0 6.225 False ENSG00000120925 ENSG00000120925 HGNC:25358 RNF216 gene RNF216 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000011275 ENSG00000011275 HGNC:21698 RNF216 gene RNF216 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 Neurodegeneration;HP:0002180 23656588;25841028;27995769 False 3 100;0;0 6.225 True ENSG00000011275 ENSG00000011275 HGNC:21698 RNF220 gene RNF220 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum Neurodegeneration;HP:0002180 33964137;10881263 False 3 100;0;0 6.225 True ENSG00000187147 ENSG00000187147 HGNC:25552 RNU7-1 gene RNU7-1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 9, MIM# 619487 Neurodegeneration;HP:0002180 33230297 False 3 100;0;0 6.225 True ENSG00000238923 ENSG00000238923 HGNC:34033 RORA gene RORA Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, 618060 Neurodegeneration;HP:0002180 29656859 False 3 100;0;0 6.225 True ENSG00000069667 ENSG00000069667 HGNC:10258 RPGRIP1L gene RPGRIP1L Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 7, MIM# 611560" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000103494 ENSG00000103494 HGNC:29168 RPS6KC1 gene RPS6KC1 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460 Neurodegeneration;HP:0002180 41130203 False 3 100;0;0 6.225 True ENSG00000136643 ENSG00000136643 HGNC:10439 RTN2 gene RTN2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 12, autosomal dominant, 604805;MONDO:0011489 Neurodegeneration;HP:0002180 22232211;27165006 False 3 100;0;0 6.225 True ENSG00000125744 ENSG00000125744 HGNC:10468 RUBCN gene RUBCN Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Royal Melbourne Hospital Clinical Genetics Department Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 15, MIM#615705 Neurodegeneration;HP:0002180 20826435;23728897 False 3 100;0;0 6.225 True ENSG00000145016 ENSG00000145016 HGNC:28991 SACS gene SACS Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type MIM#270550 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic ataxia, Charlevoix-Saguenay type, MIM@ 270550" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000151835 ENSG00000151835 HGNC:10519 SAMD9L gene SAMD9L Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550 Neurodegeneration;HP:0002180 35310830;33884299;28570036 False 3 100;0;0 6.225 False ENSG00000177409 ENSG00000177409 HGNC:1349 SAMHD1 gene SAMHD1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi Goutieres syndrome 5, MIM# 612952 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000101347 ENSG00000101347 HGNC:15925 SCN1A gene SCN1A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dravet syndrome, MIM# 607208;Epilepsy, Paekinsonism Neurodegeneration;HP:0002180 PMID: 28186331;24850485 False 3 100;0;0 6.225 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN1A gene SCN1A Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 6 (Dravet syndrome), MIM# 607208 Neurodegeneration;HP:0002180 27264139;27817982;28732259 False 3 67;33;0 6.225 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN2A gene SCN2A Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Early infantile epileptic encephalopathy 11, MIM# 613721 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000136531 ENSG00000136531 HGNC:10588 SCN8A gene SCN8A Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy 13, 614558;Cognitive impairment with or without cerebellar ataxia, 614306 Neurodegeneration;HP:0002180 31904124;31887642;31675620 False 3 100;0;0 6.225 True ENSG00000196876 ENSG00000196876 HGNC:10596 SCYL1 gene SCYL1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 21, 616719;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy Neurodegeneration;HP:0002180 29419818;17571074;26581903;30531813 False 3 100;0;0 6.225 True ENSG00000142186 ENSG00000142186 HGNC:14372 SEC31A gene SEC31A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with spastic quadriplegia, optic atrophy, seizures, and structural brain anomalies, MIM# 618651;congenital neurodevelopmental syndrome;spastic paraplegia;multiple contractures;profound developmental delay;epilepsy;failure to thrive" Neurodegeneration;HP:0002180 30464055;40508110;39725565 False 3 100;0;0 6.225 True ENSG00000138674 ENSG00000138674 HGNC:17052 SELENOI gene SELENOI Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 81, autosomal recessive 618768 Neurodegeneration;HP:0002180 28052917;29500230;39806532;33454747 False 3 100;0;0 6.225 True ENSG00000138018 ENSG00000138018 HGNC:29361 SERAC1 gene SERAC1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000122335 ENSG00000122335 HGNC:21061 SERAC1 gene SERAC1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739;Parkinsonism Neurodegeneration;HP:0002180 PMID: 29332177;16527507 False 3 100;0;0 6.225 True ENSG00000122335 ENSG00000122335 HGNC:21061 SETX gene SETX Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis 4, juvenile (MIM#602433) Neurodegeneration;HP:0002180 15106121;9497266 False 3 100;0;0 6.225 True ENSG00000107290 ENSG00000107290 HGNC:445 SHMT2 gene SHMT2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121;Congenital microcephaly;Infantile axial hypotonia;Spastic paraparesis;Global developmental delay;Intellectual disability;Abnormality of the corpus callosum;Abnormal cortical gyration;Hypertrophic cardiomyopathy;Abnormality of the face;Proximal placement of thumb;2-3 toe syndactyly Neurodegeneration;HP:0002180 33015733 False 3 100;0;0 6.225 True ENSG00000182199 ENSG00000182199 HGNC:10852 SIGMAR1 gene SIGMAR1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 67;33;0 6.225 False ENSG00000147955 ENSG00000147955 HGNC:8157 SIL1 gene SIL1 Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Marinesco-Sjogren syndrome, 248800 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000120725 ENSG00000120725 HGNC:24624 SKOR2 gene SKOR2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Valence-Farazi cerebellar ataxia syndrome, MIM# 621386 Neurodegeneration;HP:0002180 40890458;29997391;21937600 False 3 100;0;0 6.225 True ENSG00000215474 ENSG00000215474 HGNC:32695 SLC13A3 gene SLC13A3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384) Neurodegeneration;HP:0002180 https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID) False 3 100;0;0 6.225 True ENSG00000158296 ENSG00000158296 HGNC:14430 SLC16A2 gene SLC16A2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, 300523, XL Neurodegeneration;HP:0002180 15980113;31410843;20301789 False 3 100;0;0 6.225 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC17A5 gene SLC17A5 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Salla disease;Sialic acid storage disease, severe infantile type, MIM# 269920 Neurodegeneration;HP:0002180 26171070 False 3 100;0;0 6.225 True ENSG00000119899 ENSG00000119899 HGNC:10933 SLC18A2 gene SLC18A2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 2 , MIM# 618049;Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism Neurodegeneration;HP:0002180 33983693;23363473;31240161;26497564 False 3 100;0;0 6.225 True ENSG00000165646 ENSG00000165646 HGNC:10935 SLC19A3 gene SLC19A3 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483;Childhood onset Dystonia and Parkinsonism Neurodegeneration;HP:0002180 PMID: 24260777 False 3 100;0;0 6.225 True ENSG00000135917 ENSG00000135917 HGNC:16266 SLC1A3 gene SLC1A3 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Episodic ataxia, type 6;Episodic ataxia type 6, 612656 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000079215 ENSG00000079215 HGNC:10941 SLC1A4 gene SLC1A4 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, 616657;MONDO:0014725 Neurodegeneration;HP:0002180 25930971;26138499;26041762;27193218;29989513 False 3 100;0;0 6.225 True ENSG00000115902 ENSG00000115902 HGNC:10942 SLC20A2 gene SLC20A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 1, MIM# 213600 Neurodegeneration;HP:0002180 22327515;23334463 False 3 100;0;0 6.225 True ENSG00000168575 ENSG00000168575 HGNC:10947 SLC25A15 gene SLC25A15 Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome MIM#238970 Neurodegeneration;HP:0002180 16376511;22465082;28592010 False 3 100;0;0 6.225 False ENSG00000102743 ENSG00000102743 HGNC:10985 SLC25A46 gene SLC25A46 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary motor and sensory neuropathy type VIB, MIM#616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303 Neurodegeneration;HP:0002180 30178502;26168012;27543974;27430653;27390132;28934388;28558379 False 3 100;0;0 6.225 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC2A1 gene SLC2A1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal GLUT1 deficiency syndrome 1, infantile onset, severe, MIM# 606777;Developmental delay;autosomal dominant, complicated hereditary spastic paraplegia (HSP);paroxysmal choreoathetosis;spastic paraplegia;seizure Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal dystonia 9;GLUT1 deficiency syndrome 2, 612126;GLUT1 DEFICIENCY SYNDROME 1;paroxysmal exertion-induced dyskinesia with or without epilepsy and/or hemolytic anemia;GLUT1 deficiency syndrome 1, 606777;Dystonia 9, 601042;EPILEPSY, IDIOPATHIC GENERALIZED Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000117394 ENSG00000117394 HGNC:11005 SLC30A10 gene SLC30A10 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome MONDO:0013208 Neurodegeneration;HP:0002180 22341971;22341972 False 3 100;0;0 6.225 True ENSG00000196660 ENSG00000196660 HGNC:25355 SLC39A14 gene SLC39A14 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermanganesemia with dystonia 2 (MIM# 617013) Neurodegeneration;HP:0002180 27231142;32626807;29685658;30232769 False 3 100;0;0 6.225 True ENSG00000104635 ENSG00000104635 HGNC:20858 SLC44A1 gene SLC44A1 Expert Review Green;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration;progressive ataxia tremor cognitive decline dysphagia optic atrophy dysarthria Neurodegeneration;HP:0002180 31855247 False 3 100;0;0 6.225 True ENSG00000070214 ENSG00000070214 HGNC:18798 SLC52A2 gene SLC52A2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bwon-Vialetto-Van Laere syndrome 2, 614707 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A3 gene SLC52A3 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amytrophic Lateral Sclerosis (ALS);Brown-Vialetto-van Laere syndrome 1 (MIM# 211530) Neurodegeneration;HP:0002180 26072523 False 3 100;0;0 6.225 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC6A3 gene SLC6A3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 1, MIM# 613135 Neurodegeneration;HP:0002180 21112253 False 3 100;0;0 6.225 True ENSG00000142319 ENSG00000142319 HGNC:11049 SLC9A1 gene SLC9A1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lichtenstein-Knorr Syndrome, MIM# 616291" Neurodegeneration;HP:0002180 25205112;30018422;25760855 False 3 50;50;0 6.225 True ENSG00000090020 ENSG00000090020 HGNC:11071 SLC9A6 gene SLC9A6 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142 Neurodegeneration;HP:0002180 35198730;39810750;35198730;31192222 False 3 100;0;0 6.225 True ENSG00000198689 ENSG00000198689 HGNC:11079 SLC9A6 gene SLC9A6 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation, X-linked syndromic, Christianson type, 300243 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000198689 ENSG00000198689 HGNC:11079 SLC9A6 gene SLC9A6 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142" Neurodegeneration;HP:0002180 35198730;39810750;35198730;31192222 False 3 100;0;0 6.225 True ENSG00000198689 ENSG00000198689 HGNC:11079 SMN1 gene SMN1 Expert Review Green;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy-1, MIM# 253300 Neurodegeneration;HP:0002180 20301623 False 3 100;0;0 6.225 True ENSG00000172062 ENSG00000172062 HGNC:11117 SNAP25 gene SNAP25 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Myasthenic syndrome, congenital, 18, 616330;cerebellar ataxia and seizures Neurodegeneration;HP:0002180 29491473;25381298;17283335 False 3 100;0;0 6.225 True ENSG00000132639 ENSG00000132639 HGNC:11132 SNAPC4 gene SNAPC4 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with motor regression, progressive spastic paraplegia, and oromotor dysfunction, MIM# 620515 Neurodegeneration;HP:0002180 36965478 False 3 100;0;0 6.225 True ENSG00000165684 ENSG00000165684 HGNC:11137 SNCA gene SNCA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543) Neurodegeneration;HP:0002180 32849182;26858591;32740728 False 3 100;0;0 6.225 True ENSG00000145335 ENSG00000145335 HGNC:11138 SNCA gene SNCA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543) Neurodegeneration;HP:0002180 32849182;26858591;32740728 False 3 100;0;0 6.225 True ENSG00000145335 ENSG00000145335 HGNC:11138 SNX14 gene SNX14 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 20, 616354;Autosomal recessive spinocerebellar ataxia (#616354) Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000135317 ENSG00000135317 HGNC:14977 SOD1 gene SOD1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic tetraplegia and axial hypotonia, progressive, MIM#618598 Neurodegeneration;HP:0002180 PMID: 31314961;31332433;34788402 False 3 100;0;0 6.225 True ENSG00000142168 ENSG00000142168 HGNC:11179 SOD1 gene SOD1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 1 (105400 AD, AR);Spastic tetraplegia and axial hypotonia, progressive (618598 AR) Neurodegeneration;HP:0002180 8625408;21545237;16503123 False 3 100;0;0 6.225 True ENSG00000142168 ENSG00000142168 HGNC:11179 SOX6 gene SOX6 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Tolchin-Le Caignec syndrome, MIM# 618971;Developmental delay;ID;ASD;ADHD;Parkinsonism;Syringomyelia" Neurodegeneration;HP:0002180 24453155;25127144 False 3 100;0;0 6.225 True ENSG00000110693 ENSG00000110693 HGNC:16421 SPART gene SPART Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Troyer syndrome, MIM# 275900;SPG20;MONDO:0010156 Neurodegeneration;HP:0002180 12134148;20437587;26003402;27112432;31535723;31535723;28875386;28679690 False 3 100;0;0 6.225 True ENSG00000133104 ENSG00000133104 HGNC:18514 SPART gene SPART Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000133104 ENSG00000133104 HGNC:18514 SPAST gene SPAST Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration;HP:0002180 16765570;19364936 False 3 100;0;0 6.225 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPAST gene SPAST Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 4, autosomal dominant, MIM# 182601;Cerebral Palsy MONDO:0006497, SPAST-related, AR Neurodegeneration;HP:0002180 41000004 False 3 100;0;0 6.225 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPG11 gene SPG11 Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 5, juvenile, MIM# 602099 Neurodegeneration;HP:0002180 20110243 False 3 100;0;0 6.225 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 11, autosomal recessive, MIM# 604360" Neurodegeneration;HP:0002180 18067136 False 3 100;0;0 6.225 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary spastic paraplegia 11 MONDO:0011445 Neurodegeneration;HP:0002180 35036589;23121729;21381113;27217339 False 3 100;0;0 6.225 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 11, autosomal recessive MIM#604360;Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668;Amyotrophic lateral sclerosis 5, juvenile MIM#602099 Neurodegeneration;HP:0002180 27318863;28237315;18079167 False 3 100;0;0 6.225 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG21 gene SPG21 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome, MIM# 248900 Neurodegeneration;HP:0002180 14564668;24451228;28752238;26978163 False 3 100;0;0 6.225 True ENSG00000090487 ENSG00000090487 HGNC:20373 SPG21 gene SPG21 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome, 248900;Spastic Paraplegia, autosomal recessive Neurodegeneration;HP:0002180 14564668;24451228;28752238;26978163 False 3 100;0;0 6.225 False ENSG00000090487 ENSG00000090487 HGNC:20373 SPG7 gene SPG7 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 7, autosomal recessive, MIM# 607259;Ataxia;Progressive external opthalmoplegia;Parkinsonism" Neurodegeneration;HP:0002180 PMID: 31433872 False 3 100;0;0 6.225 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 7, autosomal recessive, MIM# 607259" Neurodegeneration;HP:0002180 22571692 False 3 100;0;0 6.225 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive MIM#607259 Neurodegeneration;HP:0002180 16765570;19364936 False 3 100;0;0 6.225 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPR gene SPR Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994 Neurodegeneration;HP:0002180 22522443;11920285;14663042;16443856;21782285;32813147 False 3 0;100;0 6.225 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPR gene SPR Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiaterin reductase deficiency, 612716;Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPTAN1 gene SPTAN1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic Paraplegia MONDO:0019064, SPTAN1-related;Autosomal dominant spastic paraplegia-91, with or without cerebellar ataxia (SPG91), MIM#620538 Neurodegeneration;HP:0002180 PMID: 35150594;34526651;31515523 False 3 100;0;0 6.225 True ENSG00000197694 ENSG00000197694 HGNC:11273 SPTAN1 gene SPTAN1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia MONDO:0957813 Neurodegeneration;HP:0002180 36331550 False 3 100;0;0 6.225 True Other ENSG00000197694 ENSG00000197694 HGNC:11273 SPTBN2 gene SPTBN2 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386;Spinocerebellar ataxia 5, MIM# 600224" Neurodegeneration;HP:0002180 23236289;23838597;22781464;31617442;31066025 False 3 100;0;0 6.225 True ENSG00000173898 ENSG00000173898 HGNC:11276 SPTLC1 gene SPTLC1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted juvenile amyotrophic lateral sclerosis MONDO:0017593 Neurodegeneration;HP:0002180 34059824;35900868;34459874 False 3 100;0;0 6.225 True Other ENSG00000090054 ENSG00000090054 HGNC:11277 SQSTM1 gene SQSTM1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 Neurodegeneration;HP:0002180 27545679 False 3 100;0;0 6.225 True ENSG00000161011 ENSG00000161011 HGNC:11280 SRD5A3 gene SRD5A3 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kahrizi syndrome, 612713;Congenital disorder of glycosylation, type Iq, 612379;Congenital disorder of glycosylation type Iq, 612379 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000128039 ENSG00000128039 HGNC:25812 STUB1 gene STUB1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar Ataxia 48, OMIM 618093;Parkinsonism Neurodegeneration;HP:0002180 30381368;32285148;32337344 False 3 100;0;0 6.225 True ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spinocerebellar ataxia 48 MIM#618093;cognitive impairment;Spinocerebellar ataxia, autosomal recessive 16 MIM#615768" Neurodegeneration;HP:0002180 32713943 False 3 100;0;0 6.225 False ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768" Neurodegeneration;HP:0002180 25258038;24742043 False 3 100;0;0 6.225 True ENSG00000103266 ENSG00000103266 HGNC:11427 STXBP1 gene STXBP1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 4, MIM# 612164;Juvenile onset Parkinsonism Neurodegeneration;HP:0002180 25418441;32643187;29929108 False 3 100;0;0 6.225 True ENSG00000136854 ENSG00000136854 HGNC:11444 SUFU gene SUFU Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Joubert syndrome 32, MIM#617757;Neurodevelopmental disorder, MONDO:0700092, SUFU-related Neurodegeneration;HP:0002180 33024317 False 3 100;0;0 6.225 True ENSG00000107882 ENSG00000107882 HGNC:16466 SVBP gene SVBP Expert Review Green;Expert list;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, 618569 Neurodegeneration;HP:0002180 31363758;30607023 False 3 100;0;0 6.225 True ENSG00000177868 ENSG00000177868 HGNC:29204 SYNE1 gene SYNE1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 8, MIM# 610743" Neurodegeneration;HP:0002180 23325900;27086870 False 3 100;0;0 6.225 True ENSG00000131018 ENSG00000131018 HGNC:17089 SYNJ1 gene SYNJ1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 20, early-onset, MIM# 615530 Neurodegeneration;HP:0002180 23804563;23804577;27496670;33841314 False 3 100;0;0 6.225 True ENSG00000159082 ENSG00000159082 HGNC:11503 TAF1C gene TAF1C Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder, TAF1C-related, MONDO:0100038 Neurodegeneration;HP:0002180 40371665;32779182 False 3 100;0;0 6.225 True ENSG00000103168 ENSG00000103168 HGNC:11534 TARDBP gene TARDBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069) Neurodegeneration;HP:0002180 20301761;21803454 False 3 100;0;0 6.225 True ENSG00000120948 ENSG00000120948 HGNC:11571 TARDBP gene TARDBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 10, with or without FTD;Frontotemporal lobar degeneration, TARDBP-related (MIM#612069;MONDO: 0012790) Neurodegeneration;HP:0002180 20301761;18309045;19609911 False 3 100;0;0 6.225 True ENSG00000120948 ENSG00000120948 HGNC:11571 TBC1D23 gene TBC1D23 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 11, 617695 Neurodegeneration;HP:0002180 28823707;28823706 False 3 100;0;0 6.225 True ENSG00000036054 ENSG00000036054 HGNC:25622 TBC1D24 gene TBC1D24 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 16, MIM# 615338;Intellectual disability;Parkinsonism;Seizures;Psychosis Neurodegeneration;HP:0002180 PMID: 28663785;21087195 False 3 100;0;0 6.225 True ENSG00000162065 ENSG00000162065 HGNC:29203 TBCE gene TBCE Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Encephalopathy, progressive, with amyotrophy and optic atrophy 617207" Neurodegeneration;HP:0002180 PMID: 27666369 False 3 100;0;0 6.225 True ENSG00000116957 ENSG00000116957 HGNC:11582 TBCE gene TBCE Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, with amyotrophy and optic atrophy, OMIM #617207 Neurodegeneration;HP:0002180 PubMed: 27666369 False 3 100;0;0 6.225 True ENSG00000116957 ENSG00000116957 HGNC:11582 TBK1 gene TBK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 4 (MIM#616439;MONDO:0011223) Neurodegeneration;HP:0002180 20301623;25803835 False 3 100;0;0 6.225 True ENSG00000183735 ENSG00000183735 HGNC:11584 TBK1 gene TBK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 4, MIM# 616439 Neurodegeneration;HP:0002180 20301623 False 3 100;0;0 6.225 True ENSG00000183735 ENSG00000183735 HGNC:11584 TCTN1 gene TCTN1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 13, MIM# 614173" Neurodegeneration;HP:0002180 31302911;28631893;21725307;26477546;26489806 False 3 100;0;0 6.225 True ENSG00000204852 ENSG00000204852 HGNC:26113 TCTN2 gene TCTN2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 24, MIM# 616654" Neurodegeneration;HP:0002180 25118024;21565611 False 3 100;0;0 6.225 True ENSG00000168778 ENSG00000168778 HGNC:25774 TCTN3 gene TCTN3 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 18, MIM# 614815;Orofaciodigital syndrome IV, MIM# 258860 Neurodegeneration;HP:0002180 22883145;25118024 False 3 100;0;0 6.225 True ENSG00000119977 ENSG00000119977 HGNC:24519 TDP2 gene TDP2 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 23 Neurodegeneration;HP:0002180 31410782;30109272;24658003 False 3 100;0;0 6.225 True ENSG00000111802 ENSG00000111802 HGNC:17768 TECPR2 gene TECPR2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 49, autosomal recessive, 615031;Autonomic-sensory neuropathy Neurodegeneration;HP:0002180 23176824;26542466 False 3 100;0;0 6.225 True ENSG00000196663 ENSG00000196663 HGNC:19957 TFG gene TFG Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 57, autosomal recessive, MIM# 615658 Neurodegeneration;HP:0002180 30467354;30157421;28124177;27601211;27492651;23479643 False 3 100;0;0 6.225 True ENSG00000114354 ENSG00000114354 HGNC:11758 TH gene TH Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Tyrosine hydroxylase deficiency MONDO:0100064 Neurodegeneration;HP:0002180 20301334;20301610 False 3 100;0;0 6.225 True ENSG00000180176 ENSG00000180176 HGNC:11782 TINF2 gene TINF2 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant dyskeratosis congenita 3, 613990;Revesz syndrome, 268130 Neurodegeneration;HP:0002180 18252230;21477109;18979121 False 3 100;0;0 6.225 True ENSG00000092330 ENSG00000092330 HGNC:11824 TMEM106B gene TMEM106B Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypomyelinating leukodystrophy 16, 617964 Neurodegeneration;HP:0002180 29186371;29444210 False 3 100;0;0 6.225 True ENSG00000106460 ENSG00000106460 HGNC:22407 TMEM216 gene TMEM216 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 2, MIM# 608091" Neurodegeneration;HP:0002180 20036350;20512146 False 3 100;0;0 6.225 True ENSG00000187049 ENSG00000187049 HGNC:25018 TMEM237 gene TMEM237 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 14, MIM# 614424" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000155755 ENSG00000155755 HGNC:14432 TMEM240 gene TMEM240 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 21, MIM# 607454" Neurodegeneration;HP:0002180 25070513 False 3 100;0;0 6.225 True ENSG00000205090 ENSG00000205090 HGNC:25186 TMEM63C gene TMEM63C Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 87, autosomal recessive, MIM# 619966 Neurodegeneration;HP:0002180 PMID: 35718349 False 3 100;0;0 6.225 True ENSG00000165548 ENSG00000165548 HGNC:23787 TMEM67 gene TMEM67 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 6, MIM# 610688" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000164953 ENSG00000164953 HGNC:28396 TPP1 gene TPP1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 7, 609270;Neuronal ceroid lipofuscinosis, 204500;Spinocerebellar ataxia, autosomal recessive 7, 609270;Ceroid lipofuscinosis, neuronal, 2, 204500 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000166340 ENSG00000166340 HGNC:2073 TPP1 gene TPP1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;Parkinsonism Neurodegeneration;HP:0002180 PMID: 21940688 False 3 100;0;0 6.225 True ENSG00000166340 ENSG00000166340 HGNC:2073 TREM2 gene TREM2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193;{Alzhieimer disease 17, susceptibility to}, MIM# 615080 Neurodegeneration;HP:0002180 12080485;15883308 False 3 100;0;0 6.225 True ENSG00000095970 ENSG00000095970 HGNC:17761 TREX1 gene TREX1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations MONDO:0008641" Neurodegeneration;HP:0002180 29380913;35699195;36586737;35307828 False 3 100;0;0 6.225 True ENSG00000213689 ENSG00000213689 HGNC:12269 TSFM gene TSFM Expert Review Green;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSPOAP1 gene TSPOAP1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, intellectual disability and cerebellar atrophy Neurodegeneration;HP:0002180 33539324 False 3 100;0;0 6.225 True ENSG00000005379 ENSG00000005379 HGNC:16831 TTBK2 gene TTBK2 Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11 Neurodegeneration;HP:0002180 False 3 50;50;0 6.225 False ENSG00000128881 ENSG00000128881 HGNC:19141 TTC19 gene TTC19 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency nuclear type II, 615157;Mitochondrial complex III deficiency, nuclear type 2, 615157 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000011295 ENSG00000011295 HGNC:26006 TTI1 gene TTI1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445 Neurodegeneration;HP:0002180 26539891;30315573;36724785 False 3 50;25;25 6.225 True ENSG00000101407 ENSG00000101407 HGNC:29029 TTPA gene TTPA NHS GMS;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia with isolated vitamin E deficiency, MIM# 277460" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000137561 ENSG00000137561 HGNC:12404 TTR gene TTR Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, hereditary, transthyretin-related, MIM# 105210 Neurodegeneration;HP:0002180 20301373 False 3 100;0;0 6.225 True ENSG00000118271 ENSG00000118271 HGNC:12405 TUBA4A gene TUBA4A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309, TUBA4A-related Neurodegeneration;HP:0002180 38884572;37418012 False 3 100;0;0 6.225 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic ataxia 11, autosomal dominant, MIM# 621226 Neurodegeneration;HP:0002180 38884572;37418012 False 3 100;0;0 6.225 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 Neurodegeneration;HP:0002180 25374358;28069311;35327632;34169147;38884572;33760283;26675813 False 3 50;50;0 6.225 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 Neurodegeneration;HP:0002180 25374358;25893256;28069311;38463699;38884572;26675813 False 3 50;50;0 6.225 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBB4A gene TUBB4A Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Leukodystrophy, hypomyelinating, 6, MIM# 612438" Neurodegeneration;HP:0002180 23582646;24850488 False 3 100;0;0 6.225 True ENSG00000104833 ENSG00000104833 HGNC:20774 TUBB4A gene TUBB4A Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukodystrophy, hypomyelinating, 6, 612438;Dystonia 4, 128101, Hypomyelinating leukodystrophy 6, 612438;Dystonia 4, torsion, autosomal dominant, 128101 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000104833 ENSG00000104833 HGNC:20774 TWNK gene TWNK Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286 Neurodegeneration;HP:0002180 24076137;22949510;22580846;19353676 False 3 100;0;0 6.225 True ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Royal Melbourne Hospital;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 7, 271245;Ataxia Neuropathy Spectrum Disorders, Dominant;Progressive external ophthalmoplegia with mitochondrial DNA deletions, 609286;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, 609286;Perrault syndrome 5, 616138;Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), 271245;Spinocerebellar Ataxia, Recessive Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000107815 ENSG00000107815 HGNC:1160 TYROBP gene TYROBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770) Neurodegeneration;HP:0002180 20301376 False 3 100;0;0 6.225 True ENSG00000011600 ENSG00000011600 HGNC:12449 UBAP1 gene UBAP1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Childhood-onset hereditary spastic paraplegia;Spastic paraplegia 80, autosomal dominant 618418" Neurodegeneration;HP:0002180 31696996 False 3 100;0;0 6.225 True Other ENSG00000165006 ENSG00000165006 HGNC:12461 UBQLN2 gene UBQLN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857) Neurodegeneration;HP:0002180 20301623;31319884;21857683;30348461 False 3 0;100;0 6.225 True ENSG00000188021 ENSG00000188021 HGNC:12509 UBQLN2 gene UBQLN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amyotrophic lateral sclerosis type 15 (MONDO:0010459;MIM#300857) Neurodegeneration;HP:0002180 20301623;21857683 False 3 100;0;0 6.225 True ENSG00000188021 ENSG00000188021 HGNC:12509 UBTF gene UBTF Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;Parkinsonism;Dystonia;Chorea;Brain atrophy Neurodegeneration;HP:0002180 PubMed: 28777933;29300972 False 3 100;0;0 6.225 True ENSG00000108312 ENSG00000108312 HGNC:12511 UBTF gene UBTF Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701 Neurodegeneration;HP:0002180 29300972 False 3 100;0;0 6.225 True ENSG00000108312 ENSG00000108312 HGNC:12511 UCHL1 gene UCHL1 Expert Review Green;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 79, autosomal recessive, MIM#615491;Neurodegenerative disease, MONDO:0005559, UCHL1-related Neurodegeneration;HP:0002180 28007905;23359680;11555633;35986737 False 3 100;0;0 6.225 True ENSG00000154277 ENSG00000154277 HGNC:12513 UCHL1 gene UCHL1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 79A, autosomal dominant, MIM# 620221;Spastic paraplegia 79, autosomal recessive, 615491;MONDO:0014209;Neurodegenerative disease, MONDO:0005559, UCHL1-related Neurodegeneration;HP:0002180 23359680;3340629;28007905;32656641;29735986;28007905;35986737 False 3 100;0;0 6.225 True ENSG00000154277 ENSG00000154277 HGNC:12513 UNC13A gene UNC13A Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456 Neurodegeneration;HP:0002180 27648472;28192369;41125872 False 3 100;0;0 6.225 True Other ENSG00000130477 ENSG00000130477 HGNC:23150 VAC14 gene VAC14 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Striatonigral degeneration, childhood-onset, MIM# 617054;Dystonia;Parkinsonism Neurodegeneration;HP:0002180 PMID: 31392254;28502045 False 3 100;0;0 6.225 True ENSG00000103043 ENSG00000103043 HGNC:25507 VAPB gene VAPB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, late-onset, Finkel type (MIM# 182980);Amyotrophic lateral sclerosis 8 Neurodegeneration;HP:0002180 20301623;15372378 False 3 100;0;0 6.225 True ENSG00000124164 ENSG00000124164 HGNC:12649 VCP gene VCP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320);Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954) Neurodegeneration;HP:0002180 15034582;30103325;21145000 False 3 100;0;0 6.225 True ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507 Neurodegeneration;HP:0002180 38283104;38145206 False 3 100;0;0 6.225 True Other ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (ALS) (MIM#613954) Neurodegeneration;HP:0002180 20301649;20301623;21145000 False 3 100;0;0 6.225 True ENSG00000165280 ENSG00000165280 HGNC:12666 VLDLR gene VLDLR Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation and dysequilibirum syndrome 1, 224050;Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, 224050 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000147852 ENSG00000147852 HGNC:12698 VPS13A gene VPS13A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal chorea-acanthocytosis MONDO:0008695 Neurodegeneration;HP:0002180 20301561;37636221 False 3 100;0;0 6.225 True ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13A gene VPS13A Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Choreoacanthocytosis MIM#200150 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13C gene VPS13C Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 23, autosomal recessive, early onset MIM#616840 Neurodegeneration;HP:0002180 26942284;30452786;28862745 False 3 100;0;0 6.225 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS13C gene VPS13C Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "autosomal recessive early-onset Parkinson disease 23 MONDO:0014796" Neurodegeneration;HP:0002180 33579389;37330543;34875562 False 3 100;0;0 6.225 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS13D gene VPS13D Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317" Neurodegeneration;HP:0002180 29604224;29518281 False 3 100;0;0 6.225 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS35 gene VPS35 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown {Parkinson disease 17} MIM#614203;Cognitive decline Neurodegeneration;HP:0002180 False 3 0;0;0 6.225 False ENSG00000069329 ENSG00000069329 HGNC:13487 VPS35 gene VPS35 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 17, MIM# 614203 Neurodegeneration;HP:0002180 21763482;21763483;22801713;34704029 False 3 100;0;0 6.225 True ENSG00000069329 ENSG00000069329 HGNC:13487 VPS41 gene VPS41 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay Neurodegeneration;HP:0002180 32808683;33764426 False 3 100;0;0 6.225 True ENSG00000006715 ENSG00000006715 HGNC:12713 VWA3B gene VWA3B Expert Review Green;GeneReviews;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 22 MIM#616948 Neurodegeneration;HP:0002180 26157035 False 3 50;0;50 6.225 True ENSG00000168658 ENSG00000168658 HGNC:28385 WARS2 gene WARS2 Expert Review Green;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 Neurodegeneration;HP:0002180 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 6.225 True ENSG00000116874 ENSG00000116874 HGNC:12730 WARS2 gene WARS2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738 Neurodegeneration;HP:0002180 PMID: 29120065;34890876;31970218 False 3 100;0;0 6.225 True ENSG00000116874 ENSG00000116874 HGNC:12730 WASHC5 gene WASHC5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 8, autosomal dominant, 603563;MONDO:0011339 Neurodegeneration;HP:0002180 23455931;17160902;31814071;26572744 False 3 100;0;0 6.225 False ENSG00000164961 ENSG00000164961 HGNC:28984 WDR45 gene WDR45 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked complex neurodevelopmental disorder MONDO:0100148 Neurodegeneration;HP:0002180 28211668 False 3 100;0;0 6.225 True ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45 gene WDR45 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegeneration with brain iron accumulation 5 MIM#300894 Neurodegeneration;HP:0002180 23435086 False 3 100;0;0 6.225 False ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45B gene WDR45B Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Profound developmental delay, early-onset refractory epilepsy, progressive spastic quadriplegia and contractures, and brain malformations;Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM#617977 Neurodegeneration;HP:0002180 21937992;28503735;27431290 False 3 100;0;0 6.225 True ENSG00000141580 ENSG00000141580 HGNC:25072 WDR73 gene WDR73 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway Mowat syndrome, when patients are ambulant ataxia is a recognisednfeature;Galloway-Mowat Syndrome 1, 251300 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000177082 ENSG00000177082 HGNC:25928 WDR81 gene WDR81 Expert Review Red;Expert Review Red;Expert list;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital hydrocephalus 3 with brain anomalies, 617967;Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Cerebellar ataxia, mental retardation and dysequilibrium syndrome 2, 610185 Neurodegeneration;HP:0002180 21885617;28556411;28969387 False 3 33;0;67 6.225 True ENSG00000167716 ENSG00000167716 HGNC:26600 WFS1 gene WFS1 Expert Review Green;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wolfram syndrome 1, 222300 Neurodegeneration;HP:0002180 25211237 False 3 100;0;0 6.225 True ENSG00000109501 ENSG00000109501 HGNC:12762 WWOX gene WWOX Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 12, 6143232;Early infantile epileptic encephalopathy 28, 616211;Autosomal recessive spinocerebellar ataxia 12, 614322 Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 False ENSG00000186153 ENSG00000186153 HGNC:12799 XK gene XK Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females McLeod syndrome with or without chronic granulomatous disease (MIM#300842) Neurodegeneration;HP:0002180 12899725 False 3 100;0;0 6.225 True ENSG00000047597 ENSG00000047597 HGNC:12811 XPR1 gene XPR1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 6, MIM# 616413 Neurodegeneration;HP:0002180 25938945 False 3 100;0;0 6.225 True ENSG00000143324 ENSG00000143324 HGNC:12827 XRCC1 gene XRCC1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 26 MIM#617633 Neurodegeneration;HP:0002180 28002403;29472272 False 3 100;0;0 6.225 True ENSG00000073050 ENSG00000073050 HGNC:12828 ZFYVE26 gene ZFYVE26 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 15, autosomal recessive, MIM# 270700" Neurodegeneration;HP:0002180 False 3 100;0;0 6.225 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZFYVE26 gene ZFYVE26 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 15, autosomal recessive, MIM# 270700;Spastic paraplegia and retinal degeneration;Kjellin syndrome;Parkinsonism" Neurodegeneration;HP:0002180 PMID: 33033739;21462267 False 3 100;0;0 6.225 True ENSG00000072121 ENSG00000072121 HGNC:20761 AAAS gene AAAS Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Achalasia-addisonianism-alacrimia syndrome MIM#231550;complicated hereditary spastic paraplegia Neurodegeneration;HP:0002180 30381913 False 2 0;100;0 6.225 True ENSG00000094914 ENSG00000094914 HGNC:13666 ACBD5 gene ACBD5 Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy;syndromic cleft palate;ataxia;retinal dystrophy Neurodegeneration;HP:0002180 27799409;23105016 False 2 50;50;0 6.225 True ENSG00000107897 ENSG00000107897 HGNC:23338 AFG3L2 gene AFG3L2 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 28, MIM# 610246;optic atrophy;spastic ataxia;L-dopa-responsive parkinsonism Neurodegeneration;HP:0002180 30252181;36110148 False 2 33;33;33 6.225 True ENSG00000141385 ENSG00000141385 HGNC:315 ALK gene ALK Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic-dystonic diplegia Neurodegeneration;HP:0002180 PMID: 32989326 False 2 0;100;0 6.225 True ENSG00000171094 ENSG00000171094 HGNC:427 ANG gene ANG Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis 9 (MONDO: 0012753;MIM#611895) Neurodegeneration;HP:0002180 17886298;16501576;18087731;20301623 False 2 100;0;0 6.225 True ENSG00000214274 ENSG00000214274 HGNC:483 APOE gene APOE Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 2, MIM# 104310 Neurodegeneration;HP:0002180 False 2 0;100;0 6.225 True ENSG00000130203 ENSG00000130203 HGNC:613 APP gene APP Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 1, familial, MIM# 104300 Neurodegeneration;HP:0002180 False 2 0;100;0 6.225 True ENSG00000142192 ENSG00000142192 HGNC:620 ATG5 gene ATG5 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Spinocerebellar ataxia, autosomal recessive 25 Neurodegeneration;HP:0002180 16625204;26812546 False 2 0;100;0 6.225 True ENSG00000057663 ENSG00000057663 HGNC:589 ATP2B4 gene ATP2B4 Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pure and complicated hereditary spastic paraplegia Neurodegeneration;HP:0002180 29691679;25798335;25119969 False 2 0;100;0 6.225 False ENSG00000058668 ENSG00000058668 HGNC:817 BICD2 gene BICD2 Expert list;Expert Review Amber;Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM#615290;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, MIM#618291 Neurodegeneration;HP:0002180 23664120;25497877;24482476 False 2 0;100;0 6.225 False ENSG00000185963 ENSG00000185963 HGNC:17208 C17orf80 gene C17orf80 Expert Review Amber;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970 Neurodegeneration;HP:0002180 41720819 False 2 0;100;0 6.225 True ENSG00000141219 ENSG00000141219 HGNC:29601 CAPN1 gene CAPN1 Expert list;Expert Review Amber;Expert list;Expert Review Green;Expert Review Green;Expert list;Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76, autosomal recessive, 616907;MONDO:0014827 Neurodegeneration;HP:0002180 27320912;29678961;30572172;31023339;31104286 False 2 50;50;0 6.225 False ENSG00000014216 ENSG00000014216 HGNC:1476 CCDC88C gene CCDC88C Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early-onset pure hereditary spastic paraplegia Neurodegeneration;HP:0002180 33602173 False 2 0;100;0 6.225 True ENSG00000015133 ENSG00000015133 HGNC:19967 CCDC88C gene CCDC88C Victorian Clinical Genetics Services;GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown autosomal dominant spinocerebellar ataxia;?Spinocerebellar ataxia 40, 616053 Neurodegeneration;HP:0002180 25062847;30398676 False 2 33;67;0 6.225 False ENSG00000015133 ENSG00000015133 HGNC:19967 CCNF gene CCNF Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141 Neurodegeneration;HP:0002180 29102476;31577344;27080313;28105640;31445393;28852778 False 2 0;100;0 6.225 True ENSG00000162063 ENSG00000162063 HGNC:1591 CCNF gene CCNF Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141 Neurodegeneration;HP:0002180 27080313 False 2 0;100;0 6.225 True ENSG00000162063 ENSG00000162063 HGNC:1591 CHMP3 gene CHMP3 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia (MONDO:0019064), CHMP3-related Neurodegeneration;HP:0002180 PMID: 35710109 False 2 0;100;0 6.225 True ENSG00000115561 ENSG00000115561 HGNC:29865 CHP1 gene CHP1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 9, autosomal recessive, OMIM #618438 Neurodegeneration;HP:0002180 29379881;32787936 False 2 50;50;0 6.225 True ENSG00000187446 ENSG00000187446 HGNC:17433 COASY gene COASY Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 6, MIM# 615643 Neurodegeneration;HP:0002180 28489334;24360804 False 2 0;100;0 6.225 True ENSG00000068120 ENSG00000068120 HGNC:29932 COL4A2 gene COL4A2 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Familial porencephaly MONDO:0020496 Neurodegeneration;HP:0002180 35699195;37272523;36300346 False 2 0;100;0 6.225 True ENSG00000134871 ENSG00000134871 HGNC:2203 CPT1C gene CPT1C Expert Review Amber;Royal Melbourne Hospital;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 73, autosomal dominant, MIM#616282;MONDO:0014568 Neurodegeneration;HP:0002180 25751282;30911584;30564185;23973755;41312619 False 2 50;50;0 6.225 True ENSG00000169169 ENSG00000169169 HGNC:18540 CYLD gene CYLD Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132 Neurodegeneration;HP:0002180 32185393 False 2 0;50;50 6.225 True ENSG00000083799 ENSG00000083799 HGNC:2584 CYLD gene CYLD Expert Review Amber;Literature;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132 Neurodegeneration;HP:0002180 32666117;32666099;32185393 False 2 25;50;25 6.225 True Other ENSG00000083799 ENSG00000083799 HGNC:2584 DDC gene DDC Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aromatic L-amino acid decarboxylase deficiency, MIM# 608643;Infantile-onset parkinsonism & dystonia;Bulbar dysfunction;Oculogyric crisis;Autonomic dysfunction;Intellectual disability Neurodegeneration;HP:0002180 PMID: 33983693 False 2 50;50;0 6.225 True ENSG00000132437 ENSG00000132437 HGNC:2719 DHDDS gene DHDDS Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Developmental delay and seizures with or without movement abnormalities, MIM# 617836;Myoclonic Epilepsy;Parkinsonism;Ataxia;Intellectual disability Neurodegeneration;HP:0002180 PMID: 34837344;29100083 False 2 50;50;0 6.225 True ENSG00000117682 ENSG00000117682 HGNC:20603 DNAJC7 gene DNAJC7 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 31768050;40802071;35039179;34233860;32897108;37870677;35456894 False 2 33;67;0 6.225 True ENSG00000168259 ENSG00000168259 HGNC:12392 DSTYK gene DSTYK Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 23, MIM#270750 Neurodegeneration;HP:0002180 28157540;23862974 False 2 0;100;0 6.225 True ENSG00000133059 ENSG00000133059 HGNC:29043 EPM2A gene EPM2A Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780;Progressive Myoclonic Epilepsy;Parkinsonism Neurodegeneration;HP:0002180 27574708;28818698 False 2 50;50;0 6.225 True ENSG00000112425 ENSG00000112425 HGNC:3413 EXOSC3 gene EXOSC3 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1b;Complicated hereditary spastic paraplegia Neurodegeneration;HP:0002180 25149867;23975261 False 2 0;100;0 6.225 True ENSG00000107371 ENSG00000107371 HGNC:17944 FIG4 gene FIG4 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis Type 11 (MONDO: 0012945;MIM#612577) Neurodegeneration;HP:0002180 False 2 100;0;0 6.225 True ENSG00000112367 ENSG00000112367 HGNC:16873 GBA gene GBA Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Other {Lewy body dementia, susceptibility to} (MIM# 127750) Neurodegeneration;HP:0002180 23588557;32439597;31010158 False 2 0;100;0 6.225 True ENSG00000177628 ENSG00000177628 HGNC:4177 GJC2 gene GJC2 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 44, autosomal recessive, MIM# 613206" Neurodegeneration;HP:0002180 19056803;31431325;25059390 False 2 0;100;0 6.225 True ENSG00000198835 ENSG00000198835 HGNC:17494 GLT8D1 gene GLT8D1 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 30811981 False 2 50;50;0 6.225 True ENSG00000016864 ENSG00000016864 HGNC:24870 HARS gene HARS Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal multisystem ataxic syndrome Neurodegeneration;HP:0002180 32333447 False 2 33;67;0 6.225 True ENSG00000170445 ENSG00000170445 HGNC:4816 HNRNPA1 gene HNRNPA1 Expert Review Amber;Other Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease without frontotemporal dementia 3 MIM#615424;Amyotrophic lateral sclerosis 20 MIM#615426 Neurodegeneration;HP:0002180 24612671;24119545;23455423 False 2 0;0;100 6.225 True ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA2B1 gene HNRNPA2B1 Expert Review Amber;ClinGen Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis MONDO:0004976 Neurodegeneration;HP:0002180 25299611 False 2 0;0;100 6.225 True ENSG00000122566 ENSG00000122566 HGNC:5033 HNRNPA2B1 gene HNRNPA2B1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 2 MIM#615422 Neurodegeneration;HP:0002180 23455423;30279180;29358076;26744327;23635965 False 2 0;100;0 6.225 True ENSG00000122566 ENSG00000122566 HGNC:5033 IRF2BPL gene IRF2BPL Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures 618088" Neurodegeneration;HP:0002180 PMID: 30057031;30166628 False 2 0;100;0 6.225 True ENSG00000119669 ENSG00000119669 HGNC:14282 KCNQ2 gene KCNQ2 Expert Review Amber;Expert list;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 7, 613720;Myokymia, 121200 Neurodegeneration;HP:0002180 22169383;20962009;10575255 False 2 33;67;0 6.225 True ENSG00000075043 ENSG00000075043 HGNC:6296 KIF5A gene KIF5A Expert Review Amber;Other Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis, susceptibility to, 25 MONDO:0060670 Neurodegeneration;HP:0002180 33077544;36604770 False 2 0;100;0 6.225 True Other ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 10, autosomal dominant MIM#604187 Neurodegeneration;HP:0002180 18853458 False 2 0;100;0 6.225 True ENSG00000155980 ENSG00000155980 HGNC:6323 LGALSL gene LGALSL Expert Review Amber;ClinGen Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Unknown amyotrophic lateral sclerosis MONDO:0004976 Neurodegeneration;HP:0002180 30940688 False 2 0;100;0 6.225 True ENSG00000119862 ENSG00000119862 HGNC:25012 LYST gene LYST Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spastic paraplegia;Spastic paraplegia;Chediak-Higashi syndrome, 214500 Neurodegeneration;HP:0002180 26307451;24521565 False 2 0;100;0 6.225 False ENSG00000143669 ENSG00000143669 HGNC:1968 MAPK8IP3 gene MAPK8IP3 Expert Review Amber;Literature;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431 Neurodegeneration;HP:0002180 30612693;30945334 False 2 0;100;0 6.225 True ENSG00000138834 ENSG00000138834 HGNC:6884 MARS gene MARS Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 70, autosomal recessive, MIM# 620323 Neurodegeneration;HP:0002180 24482476;34585293 False 2 0;50;50 6.225 True ENSG00000166986 ENSG00000166986 HGNC:6898 MATR3 gene MATR3 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 21 MIM#606070;frontotemporal dementia;multisystem proteinopathy Neurodegeneration;HP:0002180 24686783;30015619;28029397;33408686 False 2 0;100;0 6.225 True ENSG00000015479 ENSG00000015479 HGNC:6912 MKKS gene MKKS Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 6, 605231 Neurodegeneration;HP:0002180 15637713 False 2 67;33;0 6.225 True ENSG00000125863 ENSG00000125863 HGNC:7108 MTPAP gene MTPAP Expert Review Green;Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Ataxia, spastic, 4,;Autosomal recessive spastic ataxia 4, 613672 Neurodegeneration;HP:0002180 20970105;26319014;25008111 False 2 50;50;0 6.225 True ENSG00000107951 ENSG00000107951 HGNC:25532 MT-TC gene MT-TC Expert Review Amber;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TC-related Neurodegeneration;HP:0002180 8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363 False 2 0;100;0 6.225 True ENSG00000210140 ENSG00000210140 HGNC:7477 NHLRC1 gene NHLRC1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora), MIM# 254780;Lafora disease;Progressive Myoclonic Epilepsy;Parkinsonism Neurodegeneration;HP:0002180 22425593;32301727 False 2 50;50;0 6.225 True ENSG00000187566 ENSG00000187566 HGNC:21576 PCDHA9 gene PCDHA9 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal amyotrophic lateral sclerosis MONDO:0004976 Neurodegeneration;HP:0002180 38467605 False 2 0;100;0 6.225 True ENSG00000204961 ENSG00000204961 HGNC:8675 PCNA gene PCNA Expert Review Amber;ClinGen Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary ataxia MONDO:0100309 Neurodegeneration;HP:0002180 24911150, 33426167, 36990216 False 2 0;100;0 6.225 True ENSG00000132646 ENSG00000132646 HGNC:8729 PLD3 gene PLD3 GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Spinocerebellar ataxia 46 Neurodegeneration;HP:0002180 29053796;30312375;30312384;38059248 False 2 0;100;0 6.225 False ENSG00000105223 ENSG00000105223 HGNC:17158 PNPLA6 gene PNPLA6 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 39, autosomal recessive, MIM# 612020" Neurodegeneration;HP:0002180 18313024 False 2 0;100;0 6.225 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA6 gene PNPLA6 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal PNPLA6-related spastic paraplegia with or without ataxia MONDO:0100149 Neurodegeneration;HP:0002180 32623594;36825042 False 2 0;100;0 6.225 True ENSG00000032444 ENSG00000032444 HGNC:16268 POLG gene POLG Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial DNA depletion syndrome 4a MONDO:0008758" Neurodegeneration;HP:0002180 15477547;14694057;16638794 False 2 0;100;0 6.225 True ENSG00000140521 ENSG00000140521 HGNC:9179 PRKCG gene PRKCG Expert Review Amber;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14, MIM# 605361 Neurodegeneration;HP:0002180 34292398 False 2 0;100;0 6.225 True ENSG00000126583 ENSG00000126583 HGNC:9402 PRPH gene PRPH Expert Review Amber;Expert Review Amber;Expert list;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Amyotrophic lateral sclerosis, susceptibility to}, 105400 Neurodegeneration;HP:0002180 20363051;15322088;15446584 False 2 0;100;0 6.225 True ENSG00000135406 ENSG00000135406 HGNC:9461 PRPS1 gene PRPS1 Literature;Expert Review Amber;Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy Neurodegeneration;HP:0002180 33898739;28967191 False 2 0;100;0 6.225 False ENSG00000147224 ENSG00000147224 HGNC:9462 PTPA gene PTPA Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Intellectual disability, MONDO: 36073231, PTPA-related;Parkinson disease MONDO:0005180, PTPA-related Neurodegeneration;HP:0002180 36073231;37448355;37046398 False 2 0;100;0 6.225 True ENSG00000119383 ENSG00000119383 HGNC:9308 RBMX gene RBMX Expert Review Amber;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related Neurodegeneration;HP:0002180 39263607 False 2 0;100;0 6.225 True ENSG00000147274 ENSG00000147274 HGNC:9910 RBMX gene RBMX Expert Review Amber;Expert Review Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related Neurodegeneration;HP:0002180 39263607 False 2 0;100;0 6.225 True ENSG00000147274 ENSG00000147274 HGNC:9910 RFXANK gene RFXANK Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive Ataxia and Neurologic Regression;MHC class II deficiency, complementation group B MIM#209920 Neurodegeneration;HP:0002180 PMID: 33855173;23314770;28676232 False 2 50;50;0 6.225 True ENSG00000064490 ENSG00000064490 HGNC:9987 RNF13 gene RNF13 Expert Review Amber;Literature;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 PMID: 35879052 False 2 50;50;0 6.225 True ENSG00000082996 ENSG00000082996 HGNC:10057 SDHA gene SDHA Expert list;Expert Review Amber;Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259 Neurodegeneration;HP:0002180 10976639;27683074 False 2 0;100;0 6.225 False ENSG00000073578 ENSG00000073578 HGNC:10680 SIDT2 gene SIDT2 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lysosomal storage disease, MONDO:0002561, SIDT2-related Neurodegeneration;HP:0002180 PMID: 40541391 False 2 0;100;0 6.225 True ENSG00000149577 ENSG00000149577 HGNC:24272 SORL1 gene SORL1 Expert Review Amber;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, MONDO:0004975, SORL1-related Neurodegeneration;HP:0002180 27026413;39226352;40182695 False 2 0;50;50 6.225 True ENSG00000137642 ENSG00000137642 HGNC:11185 SOX10 gene SOX10 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurocristopathy;PCWH syndrome, MIM#609136;Complicated hereditary spastic paraplegia Neurodegeneration;HP:0002180 28534044 False 2 0;100;0 6.225 True ENSG00000100146 ENSG00000100146 HGNC:11190 SPTSSA gene SPTSSA Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 90B, autosomal recessive , MIM# 620417;Spastic paraplegia 90A, autosomal dominant, MIM# 620416 Neurodegeneration;HP:0002180 36718090;40533086 False 2 50;50;0 6.225 True ENSG00000165389 ENSG00000165389 HGNC:20361 SQSTM1 gene SQSTM1 Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 MONDO:0014640" Neurodegeneration;HP:0002180 False 2 100;0;0 6.225 True ENSG00000161011 ENSG00000161011 HGNC:11280 SQSTM1 gene SQSTM1 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437) Neurodegeneration;HP:0002180 22084127;22972638;27554286;31362587;28490746;31859009;23942205 False 2 50;50;0 6.225 True ENSG00000161011 ENSG00000161011 HGNC:11280 SREBF2 gene SREBF2 Expert Review Amber;Literature;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, MONDO:0019064, SREBF2-related Neurodegeneration;HP:0002180 39814172 False 2 0;100;0 6.225 True ENSG00000198911 ENSG00000198911 HGNC:11290 SS18L1 gene SS18L1 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis (MONDO:0004976) Neurodegeneration;HP:0002180 25888396;24360741;23708140;30976389 False 2 50;50;0 6.225 True ENSG00000184402 ENSG00000184402 HGNC:15592 SVBP gene SVBP Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 94, autosomal recessive, MIM# 621150" Neurodegeneration;HP:0002180 39412222 False 2 0;100;0 6.225 True ENSG00000177868 ENSG00000177868 HGNC:29204 SYNGAP1 gene SYNGAP1 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant mental retardation 5, 612621 Neurodegeneration;HP:0002180 26989088 False 2 0;100;0 6.225 True ENSG00000197283 ENSG00000197283 HGNC:11497 TAF15 gene TAF15 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 21438137;22065782;27810362;28889094 False 2 0;100;0 6.225 True ENSG00000172660 ENSG00000270647 HGNC:11547 TAF15 gene TAF15 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Amyotrophic lateral sclerosis;Frontotemporal dementia Neurodegeneration;HP:0002180 28889094 False 2 0;100;0 6.225 False ENSG00000172660 ENSG00000270647 HGNC:11547 TBCB gene TBCB Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382 Neurodegeneration;HP:0002180 PMID: 40856104 False 2 0;100;0 6.225 True ENSG00000105254 ENSG00000105254 HGNC:1989 TDP1 gene TDP1 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250 Neurodegeneration;HP:0002180 31182267;12244316;39576382 False 2 0;100;0 6.225 True ENSG00000042088 ENSG00000042088 HGNC:18884 TENM4 gene TENM4 Literature;Expert Review Amber;Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted tremor, hereditary essential, 5 MONDO:0014756 Neurodegeneration;HP:0002180 41449293;36689009;26188006;29249217;34589676;22915103 False 2 0;100;0 6.225 False ENSG00000149256 ENSG00000149256 HGNC:29945 THG1L gene THG1L Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 28, MIM# 618800 Neurodegeneration;HP:0002180 27307223;30214071;31168944 False 2 0;100;0 6.225 True ENSG00000113272 ENSG00000113272 HGNC:26053 TIA1 gene TIA1 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyotrophic lateral sclerosis 26 with or without frontotemporal dementia 619133" Neurodegeneration;HP:0002180 29235362;29886022;29773329;29699721;29216908;24659297;29457785;28817800 False 2 0;100;0 6.225 True ENSG00000116001 ENSG00000116001 HGNC:11802 TIA1 gene TIA1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders Other Multisystem proteinopathy Neurodegeneration;HP:0002180 36861178;29599744;29457785 False 2 0;100;0 6.225 True ENSG00000116001 ENSG00000116001 HGNC:11802 TMEM138 gene TMEM138 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 16, MIM# 614465" Neurodegeneration;HP:0002180 False 2 0;100;0 6.225 True ENSG00000149483 ENSG00000149483 HGNC:26944 TMEM231 gene TMEM231 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 20, MIM# 614970;Meckel syndrome 11 615397 Neurodegeneration;HP:0002180 False 2 0;100;0 6.225 True ENSG00000205084 ENSG00000205084 HGNC:37234 TRPC3 gene TRPC3 GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodegeneration;HP:0002180 25477146;26112884 False 2 0;100;0 6.225 False ENSG00000138741 ENSG00000138741 HGNC:12335 UBA5 gene UBA5 Expert Review Amber;Royal Melbourne Hospital;GeneReviews Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Autosomal recessive spinocerebellar ataxia 24, 617133;Early infantile epileptic encephalopathy 44, 617132 Neurodegeneration;HP:0002180 26872069;29902590 False 2 0;100;0 6.225 True ENSG00000081307 ENSG00000081307 HGNC:23230 UBQLN4 gene UBQLN4 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis Neurodegeneration;HP:0002180 28463112;30804504 False 2 0;100;0 6.225 False ENSG00000160803 ENSG00000160803 HGNC:1237 UBR4 gene UBR4 Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Episodic ataxia;Episodic ataxia type 8, 616055 Neurodegeneration;HP:0002180 29062094;23982692;28600779 False 2 0;100;0 6.225 True ENSG00000127481 ENSG00000127481 HGNC:30313 UNC80 gene UNC80 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 Neurodegeneration;HP:0002180 27513830 False 2 0;100;0 6.225 True ENSG00000144406 ENSG00000144406 HGNC:26582 UQCRC1 gene UQCRC1 Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinsonism with polyneuropathy, MIM# 619279 Neurodegeneration;HP:0002180 33141179;33248804 False 2 50;50;0 6.225 True ENSG00000010256 ENSG00000010256 HGNC:12585 USP8 gene USP8 Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complicated hereditary spastic paraplegia Neurodegeneration;HP:0002180 24482476 False 2 0;100;0 6.225 True ENSG00000138592 ENSG00000138592 HGNC:12631 VAMP1 gene VAMP1 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic ataxia 1, autosomal dominant, MIM# 108600" Neurodegeneration;HP:0002180 22958904 False 2 0;100;0 6.225 True ENSG00000139190 ENSG00000139190 HGNC:12642 VAMP1 gene VAMP1 Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Autosomal dominant spastic ataxia 1, 108600;Spastic ataxia 1, autosomal dominant, 108600 Neurodegeneration;HP:0002180 22958904 False 2 0;100;0 6.225 False ENSG00000139190 ENSG00000139190 HGNC:12642 VPS37A gene VPS37A Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 53, autosomal recessive, MIM# 614898, AR Neurodegeneration;HP:0002180 22717650 False 2 0;100;0 6.225 True ENSG00000155975 ENSG00000155975 HGNC:24928 VRK1 gene VRK1 Expert Review Amber;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Adult-onset spinal muscular atrophy without pontocerebellar hypoplasia;Distal hereditary motor neuropathy;dHMN/dSMA Neurodegeneration;HP:0002180 31560180;32242460;31178479;31837156;30847374;34169149;26583493 False 2 0;50;50 6.225 True ENSG00000100749 ENSG00000100749 HGNC:12718 VRK1 gene VRK1 Expert Review Amber;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 1A, 607596 Neurodegeneration;HP:0002180 19646678;21937992;25609612;24126608;27281532 False 2 0;100;0 6.225 True ENSG00000100749 ENSG00000100749 HGNC:12718 ZFYVE26 gene ZFYVE26 Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic paraplegia 15, 270700 Neurodegeneration;HP:0002180 24367272;18394578 False 2 0;100;0 6.225 False ENSG00000072121 ENSG00000072121 HGNC:20761 AR_SBMA_CAG str AR Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal and bulbar muscular atrophy of Kennedy MIM#313200 Neurodegeneration;HP:0002180 20301508;29325606 False 3 100;0;0 6.225 True ENSG00000169083 ENSG00000169083 HGNC:644 X 66765160 66765225 67545318 67545383 CAG 34 38 ATN1_DRPLA_CAG str ATN1 Expert Review Green;Expert List Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 Neurodegeneration;HP:0002180 29325606;20301664 False 3 100;0;0 6.225 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 ATN1_DRPLA_CAG str ATN1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 Neurodegeneration;HP:0002180 29325606;20301664 False 3 100;0;0 6.225 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 ATXN10_SCA10_ATTCT str ATXN10 Expert Review Green;Expert List Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 10 MIM#603516 Neurodegeneration;HP:0002180 20301354 False 3 100;0;0 6.225 True ENSG00000130638 ENSG00000130638 HGNC:10549 22 46191235 46191304 45795355 45795424 ATTCT 32 800 ATXN1_SCA1_CAG str ATXN1 Expert Review Green;Expert List Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 1 MIM#164400 Neurodegeneration;HP:0002180 29325606;20301363 False 3 100;0;0 6.225 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327918 16327953 16327687 16327722 CAG 35 39 ATXN1_SCA1_CAG str ATXN1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar Ataxia type 1;Parkinsonism;OMIM 164400 Neurodegeneration;HP:0002180 " PMID: 24602359" False 3 100;0;0 6.225 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327867 16327953 16327636 16327722 CAG 36 45 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 2 MONDO:0008458 Neurodegeneration;HP:0002180 40741828 False 3 100;0;0 6.225 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 Neurodegeneration;HP:0002180 20301452 False 3 100;0;0 6.225 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599016 CAG 31 35 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 Neurodegeneration;HP:0002180 11761482;17923635;8896555;29325606;20301452 False 3 100;0;0 6.225 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 ATXN3_SCA3_CAG str ATXN3 Expert Review Green;Expert List Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 Neurodegeneration;HP:0002180 20301375;29325606 False 3 100;0;0 6.225 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 ATXN3_SCA3_CAG str ATXN3 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 Neurodegeneration;HP:0002180 11176969;7574470;7874163;20301375;29325606 False 3 100;0;0 6.225 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 ATXN7_SCA7_CAG str ATXN7 Expert Review Green;Expert List Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 7 MIM#164500 Neurodegeneration;HP:0002180 29325606;20301433 False 3 100;0;0 6.225 True ENSG00000163635 ENSG00000163635 HGNC:10560 3 63898362 63898391 63912686 63912715 CAG 27 37 ATXN8OS_SCA8_CTG str ATXN8OS Expert Review Green;Expert List Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 Neurodegeneration;HP:0002180 20301445 False 3 100;0;0 6.225 True ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139422 CTG 50 80 ATXN8OS_SCA8_CTG str ATXN8OS Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 Neurodegeneration;HP:0002180 24285970;20301445;10192387 False 3 100;0;0 6.225 True ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139428 CTG 50 80 BEAN1_SCA31_TGGAA str BEAN1 Expert Review Green;Expert List Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 31 MIM#117210 Neurodegeneration;HP:0002180 19878914;31755042 False 3 100;0;0 6.225 True ENSG00000166546 ENSG00000166546 HGNC:24160 16 66524300 66524369 66490397 66490466 TGGAA 22 80 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Neurodegeneration;HP:0002180 25577942;21944779;21944778 False 3 100;0;0 6.225 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Neurodegeneration;HP:0002180 25577942;21944779;21944778;31779815 False 3 100;0;0 6.225 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 Neurodegeneration;HP:0002180 25577942;21944779;21944778 False 3 100;0;0 6.225 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 CACNA1A_SCA6_CAG str CACNA1A Expert Review Green;Expert List Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500 Neurodegeneration;HP:0002180 20301319;29325606 False 3 100;0;0 6.225 True ENSG00000141837 ENSG00000141837 HGNC:1388 19 13318673 13318691 13207859 13207897 CAG 18 20 CSTB_EPM1_CCCCGCCCCGCG str CSTB Literature;Expert Review Green;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 Neurodegeneration;HP:0002180 29325606;20301321 False 3 100;0;0 6.225 False ENSG00000160213 ENSG00000160213 HGNC:2482 21 45196325 45196360 43776444 43776479 CCCCGCCCCGCG 3 30 DAB1_SCA37_ATTTC str DAB1 Literature;Expert Review Green;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 37 MIM#615945 Neurodegeneration;HP:0002180 28686858;31145571 False 3 100;0;0 6.225 False ENSG00000173406 ENSG00000173406 HGNC:2661 1 57832716 57832797 57367044 57367121 ATTTC 0 31 FGF14_SCA27B_GAA str FGF14 Literature;Expert Review Green;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs) Neurodegeneration;HP:0002180 37165652;36516086;36493768 False 3 100;0;0 6.225 False ENSG00000102466 ENSG00000102466 HGNC:3671 13 102813926 102814076 102161576 102161726 GAA 249 300 FMR1_FXTAS_CGG str FMR1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 Neurodegeneration;HP:0002180 27340021;28176767;20301558;23765048;25227148;11445641 False 3 100;0;0 6.225 True ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FMR1_FXTAS_CGG str FMR1 Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 Neurodegeneration;HP:0002180 23765048;25227148 False 3 100;0;0 6.225 False ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FXN_FRDA_GAA str FXN Expert Review Green;Expert List Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 Neurodegeneration;HP:0002180 20301458;8596916 False 3 100;0;0 6.225 True ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037301 GAA 33 66 FXN_FRDA_GAA str FXN Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 Neurodegeneration;HP:0002180 20301458 False 3 100;0;0 6.225 False ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 HTT_HD_CAG str HTT Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease MIM#143100 Neurodegeneration;HP:0002180 20301482;29325606 False 3 100;0;0 6.225 False ENSG00000197386 ENSG00000197386 HGNC:4851 4 3076604 3076666 3074877 3074939 CAG 26 40 JPH3_HDL2_CTG str JPH3 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 Neurodegeneration;HP:0002180 11558794;20301701 False 3 100;0;0 6.225 True ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 JPH3_HDL2_CTG str JPH3 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 Neurodegeneration;HP:0002180 20301701 False 3 100;0;0 6.225 False ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 LRP12_ALS_CGG str LRP12 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyotrophic lateral sclerosis MONDO:0004976;Amyotrophic lateral sclerosis 28, MIM# 620452" Neurodegeneration;HP:0002180 37339631 False 3 100;0;0 6.225 True ENSG00000147650 ENSG00000147650 HGNC:31708 8 105601201 105601227 104588973 104588999 CGG 50 61 NOP56_SCA36_GGCCTG str NOP56 Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 36 MIM#614153 Neurodegeneration;HP:0002180 21683323 False 3 100;0;0 6.225 False ENSG00000101361 ENSG00000101361 HGNC:15911 20 2633380 2633403 2652734 2652757 GGCCTG 14 650 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 Neurodegeneration;HP:0002180 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 6.225 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 Neurodegeneration;HP:0002180 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 6.225 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 PPP2R2B_SCA12_CAG str PPP2R2B Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 Neurodegeneration;HP:0002180 31286011;27864267;33811808;10581021 False 3 100;0;0 6.225 True ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 PPP2R2B_SCA12_CAG str PPP2R2B Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 Neurodegeneration;HP:0002180 27864267;33811808 False 3 100;0;0 6.225 False ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 PRNP_CJD_octapeptide str PRNP Literature;Expert Review Green;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 Neurodegeneration;HP:0002180 2159587;20301407 False 3 100;0;0 6.225 False ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699424 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 PRNP_CJD_octapeptide str PRNP Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 Neurodegeneration;HP:0002180 2159587;20301407 False 3 100;0;0 6.225 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 PRNP_CJD_octapeptide str PRNP Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 Neurodegeneration;HP:0002180 2159587;20301407 False 3 100;0;0 6.225 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 RFC1_CANVAS_ANNGN str RFC1 Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 Neurodegeneration;HP:0002180 30926972 False 3 100;0;0 6.225 False ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 RFC1_CANVAS_ANNGN str RFC1 Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease MONDO:0005180 Neurodegeneration;HP:0002180 39833204;39152783;38789445;36705320;35013364 False 3 100;0;0 6.225 True ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 TAF1_XDP_CCCTCT str TAF1 Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia-Parkinsonism, X-linked MIM#314250 Neurodegeneration;HP:0002180 17273961;29229810 False 3 100;0;0 6.225 True ENSG00000147133 ENSG00000147133 HGNC:11535 X 70672905 70672979 71453055 71453129 CCCTCT 13 30 TBP_SCA17_CAG str TBP Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 Neurodegeneration;HP:0002180 10484774;20301611;29325606;27172828;14638975;11313753;11914409 False 3 100;0;0 6.225 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 TBP_SCA17_CAG str TBP Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 Neurodegeneration;HP:0002180 10484774;20301611 False 3 100;0;0 6.225 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 TBP_SCA17_CAG str TBP Expert list;Expert Review Green;Expert Review Green;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 Neurodegeneration;HP:0002180 20301611;29325606 False 3 100;0;0 6.225 False ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 ZFHX3_SCA4_GGC str ZFHX3 Literature;Expert Review Green;Expert Review Green;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 Neurodegeneration;HP:0002180 38035881;38197134 False 3 100;0;0 6.225 False ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 THAP11_SCA51_CAG str THAP11 Literature;Expert Review Amber;Expert Review Amber;Literature Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 51 MONDO:0975800 Neurodegeneration;HP:0002180 15368101;24677642;34165550;38113319;40459937;39651830;37148549 False 2 0;100;0 6.225 False ENSG00000168286 ENSG00000168286 HGNC:23194 16 67876766 67876853 67842863 67842950 CAG 39 47 ISCA-37404-Loss region Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Angelman syndrome, MIM# 105830;Prader-Willi syndrome, MIM# 176270" Neurodegeneration;HP:0002180 20301323;20301505 False 3 100;0;0 6.225 True 15 22782170 28134729 3 80 cnv_loss Angelman and Prader-Willi syndromes ISCA-37405-Loss region NPHP1 Expert Review Green;Expert list;Expert list Neurodegenerative disease - adult onset Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Nephronophthisis 1, juvenile, MIM# 256100;Joubert syndrome 4, MIM# 609583;Senior-Loken syndrome 1, MIM# 266900" Neurodegeneration;HP:0002180 29146700 False 3 100;0;0 6.225 True ENSG00000144061 ENSG00000144061 HGNC:7905 2 110122329 110205017 3 80 cnv_loss NPHP1 deletion