Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
A4GALT	gene	A4GALT	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	A4GALT-congenital disorder of glycosylation MONDO:0100587				12823750;15142124;10747952;10993874;11896312;27612185		False	3	50;0;50	21.664	True		ENSG00000128274	ENSG00000128274	HGNC:18149													
AAAS	gene	AAAS	Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Achalasia-addisonianism-alacrimia syndrome MIM#231550						False	3	100;0;0	21.664	True		ENSG00000094914	ENSG00000094914	HGNC:13666													
AAAS	gene	AAAS	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMSN;Glucocorticoid deficiency with achalasia;Achalasia-addisonianism-alacrimia syndrome, MIM# 231550						False	3	100;0;0	21.664	True		ENSG00000094914	ENSG00000094914	HGNC:13666													
AARS1	gene	AARS1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Charcot Marie Tooth disease, axonal, type 2N, 613287;HMSN, dHMN/dSMA				20045102;22009580;22206013;30373780;26032230		False	3	100;0;0	21.664	False		ENSG00000090861	ENSG00000090861	HGNC:20													
AARS1	gene	AARS1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 29, MIM#616339				28493438;25817015		False	3	100;0;0	21.664	True		ENSG00000090861	ENSG00000090861	HGNC:20													
AARS1	gene	AARS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 29, MIM# 616339				28493438;25817015		False	3	100;0;0	21.664	True		ENSG00000090861	ENSG00000090861	HGNC:20													
AARS2	gene	AARS2	Expert Review Green;Other;Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 8 MIM#614096				21549344;25058219		False	3	100;0;0	21.664	True		ENSG00000124608	ENSG00000124608	HGNC:21022													
AARS2	gene	AARS2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, progressive, with ovarian failure, 615889						False	3	100;0;0	21.664	False		ENSG00000124608	ENSG00000124608	HGNC:21022													
AARS2	gene	AARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 8 MIM#614096;Leukoencephalopathy, progressive, with ovarian failure MIM#615889;MONDO:0013570				30706699;27839525;21549344;25058219;24808023		False	3	100;0;0	21.664	True		ENSG00000124608	ENSG00000124608	HGNC:21022													
ABAT	gene	ABAT	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GABA-transaminase deficiency, MIM#613163				10407778;20052547;27596361;28411234		False	3	100;0;0	21.664	True		ENSG00000183044	ENSG00000183044	HGNC:23													
ABAT	gene	ABAT	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	mtDNA depletion syndrome (MDS)				25738457;27903293		False	3	100;0;0	21.664	True		ENSG00000183044	ENSG00000183044	HGNC:23													
ABAT	gene	ABAT	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GABA-transaminase deficiency, MIM# 613163				28411234;27596361;20052547;10407778;6148708		False	3	100;0;0	21.664	True		ENSG00000183044	ENSG00000183044	HGNC:23													
ABCA1	gene	ABCA1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Tangier Disease (MONDO:0008783;MIM#205400)				29582519;4165386;31751110		False	3	50;50;0	21.664	True		ENSG00000165029	ENSG00000165029	HGNC:29													
ABCA2	gene	ABCA2	Expert Review Green;Expert Review;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with poor growth and with or without seizures or ataxia, 618808				30237576;29302074;31047799		False	3	100;0;0	21.664	True		ENSG00000107331	ENSG00000107331	HGNC:32													
ABCB11	gene	ABCB11	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cholestasis, progressive familial intrahepatic 2 MIM#601847;disorder of bile acid metabolism				9806540		False	3	100;0;0	21.664	True		ENSG00000073734	ENSG00000073734	HGNC:42													
ABCB4	gene	ABCB4	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive familial intrahepatic cholestasis type 3, MONDO:0011214				8666348, 9419367, 26474921, 32793533, 11313315		False	3	100;0;0	21.664	True		ENSG00000005471	ENSG00000005471	HGNC:45													
ABCB7	gene	ABCB7	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Anaemia, sideroblastic, with ataxia, MIM# 301310				10196363;10196363;33157103;31772327;31511561;26242992		False	3	100;0;0	21.664	True		ENSG00000131269	ENSG00000131269	HGNC:48													
ABCB7	gene	ABCB7	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	301310 Anemia, sideroblastic, with ataxia				10196363;30401706;29787825		False	3	0;0;0	21.664	False		ENSG00000131269	ENSG00000131269	HGNC:48													
ABCB7	gene	ABCB7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Anaemia, sideroblastic, with ataxia, MIM# 301310				10196363;10196363;33157103;31772327;31511561;26242992		False	3	100;0;0	21.664	True		ENSG00000131269	ENSG00000131269	HGNC:48													
ABCD1	gene	ABCD1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Adrenomyeloneuropathy, adult (MIM#300100);Adrenomyeloneuropathy, spastic paraparesis, adrenal insufficiency, axonal sensory-motor neuropathy, sphincter disturbance				20301491		False	3	100;0;0	21.664	True		ENSG00000101986	ENSG00000101986	HGNC:61													
ABCD1	gene	ABCD1	Expert Review Green;Royal Melbourne Hospital;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Adrenoleukodystrophy MIM# 300100, XLR						False	3	100;0;0	21.664	True		ENSG00000101986	ENSG00000101986	HGNC:61													
ABCD1	gene	ABCD1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	adrenoleukodystrophy (MONDO:0018544)				15811009;8651290;7825602;21700483		False	3	100;0;0	21.664	True		ENSG00000101986	ENSG00000101986	HGNC:61													
ABCD1	gene	ABCD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Adrenoleukodystrophy, MIM#	300100"						False	3	100;0;0	21.664	True		ENSG00000101986	ENSG00000101986	HGNC:61													
ABCD1	gene	ABCD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Adrenoleukodystrophy, MIM#	300100"						False	3	100;0;0	21.664	True		ENSG00000101986	ENSG00000101986	HGNC:61													
ABHD12	gene	ABHD12	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674;disorder of of endocannabinoid metabolism				20797687		False	3	100;0;0	21.664	True		ENSG00000100997	ENSG00000100997	HGNC:15868													
ABHD12	gene	ABHD12	Expert Review Green;NHS GMS;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Onset 2nd decade, neuropathy with SNCV, sensory neuronal hearing loss, retinitis pigmentosa, spastic paraplegia, ataxia;Neurodegeneration, childhood-onset, with cerebellar atrophy,612674;HMSN						False	3	100;0;0	21.664	False		ENSG00000100997	ENSG00000100997	HGNC:15868													
ABHD12	gene	ABHD12	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674						False	3	100;0;0	21.664	True		ENSG00000100997	ENSG00000100997	HGNC:15868													
ABHD16A	gene	ABHD16A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities				PMID: 34587489		False	3	100;0;0	21.664	True		ENSG00000204427	ENSG00000204427	HGNC:13921													
ABHD16A	gene	ABHD16A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities				PMID: 34587489		False	3	100;0;0	21.664	True		ENSG00000204427	ENSG00000204427	HGNC:13921													
ABHD5	gene	ABHD5	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chanarin-Dorfman syndrome MIM#275630;neutral lipid storage disease with ichthyosis;lipid metabolism				30795549		False	3	100;0;0	21.664	True		ENSG00000011198	ENSG00000011198	HGNC:21396													
ABHD5	gene	ABHD5	Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dorfman-Chanarin disease MONDO:0010155				31883530		False	3	100;0;0	21.664	True		ENSG00000011198	ENSG00000011198	HGNC:21396													
ACAD9	gene	ACAD9	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency due to ACAD9 deficiency 611126				30025539		False	3	100;0;0	21.664	True		ENSG00000177646	ENSG00000177646	HGNC:21497													
ACAD9	gene	ACAD9	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 20 MIM#611126				30025539		False	3	100;0;0	21.664	True		ENSG00000177646	ENSG00000177646	HGNC:21497													
ACAD9	gene	ACAD9	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 20, MIM# 611126						False	3	100;0;0	21.664	True		ENSG00000177646	ENSG00000177646	HGNC:21497													
ACADM	gene	ACADM	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acyl-CoA dehydrogenase, medium chain, deficiency of, MIM# 201450						False	3	100;0;0	21.664	True		ENSG00000117054	ENSG00000117054	HGNC:89													
ACADM	gene	ACADM	Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acyl-CoA dehydrogenase, medium chain, deficiency of MIM#201450				25778941;1972503;26223887		False	3	100;0;0	21.664	True		ENSG00000117054	ENSG00000117054	HGNC:89													
ACADM	gene	ACADM	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acyl-CoA dehydrogenase, medium chain, deficiency of 201450;Rhabdomyolysis						False	3	100;0;0	21.664	True		ENSG00000117054	ENSG00000117054	HGNC:89													
ACADSB	gene	ACADSB	Expert Review Green;Expert Review Green;Literature;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	2-methylbutyrylglycinuria MIM#610006				25778941;17945527		False	3	100;0;0	21.664	True		ENSG00000196177	ENSG00000196177	HGNC:91													
ACADSB	gene	ACADSB	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	2-methylbutyrylglycinuria MIM#610006				11013134;17945527;30730842		False	3	100;0;0	21.664	True		ENSG00000196177	ENSG00000196177	HGNC:91													
ACADVL	gene	ACADVL	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	VLCAD deficiency, MIM# 201475						False	3	100;0;0	21.664	True		ENSG00000072778	ENSG00000072778	HGNC:92													
ACADVL	gene	ACADVL	Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	VLCAD deficiency MIM#201475				25778941;8845838;29459657		False	3	100;0;0	21.664	True		ENSG00000072778	ENSG00000072778	HGNC:92													
ACADVL	gene	ACADVL	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	VLCAD deficiency 201475				9546340;24263034		False	3	100;0;0	21.664	True		ENSG00000072778	ENSG00000072778	HGNC:92													
ACAT1	gene	ACAT1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alpha-methylacetoacetic aciduria, MIM#203750;Deficiency of acetyl-CoA acetyltransferase;Beta-ketothiolase deficiency MONDO:0008760				17236799;1715688		False	3	100;0;0	21.664	True		ENSG00000075239	ENSG00000075239	HGNC:93													
ACAT1	gene	ACAT1	Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Alpha-methylacetoacetic aciduria	MIM#203750"				31268215;25778941;1715688		False	3	100;0;0	21.664	True		ENSG00000075239	ENSG00000075239	HGNC:93													
ACBD5	gene	ACBD5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Retinal dystrophy with leukodystrophy (MIM#618863)				27799409;23105016		False	3	100;0;0	21.664	True		ENSG00000107897	ENSG00000107897	HGNC:23338													
ACBD5	gene	ACBD5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive leukodystrophy;syndromic cleft palate;ataxia;retinal dystrophy				23105016;27799409		False	3	100;0;0	21.664	False		ENSG00000107897	ENSG00000107897	HGNC:23338													
ACBD6	gene	ACBD6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785				37951597		False	3	100;0;0	21.664	True		ENSG00000230124	ENSG00000230124	HGNC:23339													
ACBD6	gene	ACBD6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785				37951597		False	3	100;0;0	21.664	True		ENSG00000230124	ENSG00000230124	HGNC:23339													
ACER3	gene	ACER3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, progressive, early childhood-onset, OMIM:617762				32816236;26792856;34281620		False	3	50;50;0	21.664	True		ENSG00000078124	ENSG00000078124	HGNC:16066													
ACO2	gene	ACO2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Infantile cerebellar-retinal degeneration, MIM#614559;Optic atrophy 9, MIM# 616289				22405087;25351951;30689204;32519519;25351951;34056600		False	3	100;0;0	21.664	True		ENSG00000100412	ENSG00000100412	HGNC:118													
ACO2	gene	ACO2	Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile cerebellar-retinal degeneration, MIM#614559						False	3	100;0;0	21.664	True		ENSG00000100412	ENSG00000100412	HGNC:118													
ACOX1	gene	ACOX1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mitchell syndrome, MIM# 618960				32169171		False	3	100;0;0	21.664	True		ENSG00000161533	ENSG00000161533	HGNC:119													
ACOX1	gene	ACOX1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470;Mitchell syndrome, MIM# 618960				32169171;17458872		False	3	100;0;0	21.664	True		ENSG00000161533	ENSG00000161533	HGNC:119													
ACOX1	gene	ACOX1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470;Mitchell syndrome, MIM# 618960						False	3	0;0;0	21.664	True		ENSG00000161533	ENSG00000161533	HGNC:119													
ACOX1	gene	ACOX1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470						False	3	0;0;0	21.664	True		ENSG00000161533	ENSG00000161533	HGNC:119													
ACOX2	gene	ACOX2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bile acid synthesis defect, congenital, 6, 617308				27647924;27884763;29287774;35395098		False	3	67;33;0	21.664	True		ENSG00000168306	ENSG00000168306	HGNC:120													
ACP5	gene	ACP5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spondyloenchondrodysplasia with immune dysregulation, MIM# 607944				21217755;21217752		False	3	100;0;0	21.664	True		ENSG00000102575	ENSG00000102575	HGNC:124													
ACTA1	gene	ACTA1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Myopathy, scapulohumeroperoneal	616852"				28606400;25938801		False	3	100;0;0	21.664	True		ENSG00000143632	ENSG00000143632	HGNC:129													
ACTA2	gene	ACTA2	Genomics England PanelApp;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Multisystemic smooth muscle dysfunction syndrome,613834;Aortic aneurysm familial thoracic 6,611788;Moyamoya Disease;Moyamoya disease 5;Moyamoya disease 5,614042						False	3	0;100;0	21.664	False		ENSG00000107796	ENSG00000107796	HGNC:130													
ACTA2	gene	ACTA2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	multisystemic smooth muscle dysfunction syndrome MONDO:0013452				29300374		False	3	100;0;0	21.664	True	Other	ENSG00000107796	ENSG00000107796	HGNC:130													
ACTB	gene	ACTB	Expert Review Green;Expert Review;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Baraitser-Winter syndrome 1 243310 Thrombocytopenia 8, with dysmorphic features and developmental delay, MIM# 620475				(PMID:22366783,25052316,31970217)		False	3	100;0;0	21.664	True		ENSG00000075624	ENSG00000075624	HGNC:132													
ACTB	gene	ACTB	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Baraitser-Winter syndrome 1, 243310;Dystonia, juvenile-onset, 607371				29788902;28487785		False	3	100;0;0	21.664	True	Other	ENSG00000075624	ENSG00000075624	HGNC:132													
ACTG1	gene	ACTG1	Expert Review Green;Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Baraitser-Winter syndrome 2, MIM#	614583"				22366783;25052316		False	3	100;0;0	21.664	True		ENSG00000184009	ENSG00000184009	HGNC:144													
ACTL6B	gene	ACTL6B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 76, MIM#	618468;Intellectual developmental disorder with severe speech and ambulation defects, MIM#	618470"				31134736;31031012;30656450;30237576		False	3	100;0;0	21.664	True		ENSG00000077080	ENSG00000077080	HGNC:160													
ACTN2	gene	ACTN2	Expert Review Green;Literature;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myopathy, distal, 6, adult onset MIM#618655;ACTN2-related cardiac and skeletal myopathy, MONDO:0700349				30900782;34170073;36116040;34471957;34386585		False	3	67;33;0	21.664	True	Other	ENSG00000077522	ENSG00000077522	HGNC:164													
ACVR1	gene	ACVR1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Fibrodysplasia ossificans progressiva, MIM# 135100				27565519		False	3	100;0;0	21.664	True		ENSG00000115170	ENSG00000115170	HGNC:171													
ACVRL1	gene	ACVRL1	Expert Review Green;Genomics England PanelApp;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Telangiectasia, hereditary hemorrhagic, type 2  600376						False	3	100;0;0	21.664	False		ENSG00000139567	ENSG00000139567	HGNC:175													
ACY1	gene	ACY1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aminoacylase 1 deficiency MIM#609924;disorder of amino acid metabolism				16465618;17562838;24117009		False	3	100;0;0	21.664	True		ENSG00000243989	ENSG00000243989	HGNC:177													
ACY1	gene	ACY1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aminoacylase 1 deficiency, MIM# 609924				(PMID: 16465618,16274666, 24117009)		False	3	100;0;0	21.664	True		ENSG00000243989	ENSG00000243989	HGNC:177													
ADA	gene	ADA	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adenosine deaminase deficiency, partial MIM#102700;Severe combined immunodeficiency due to ADA deficiency MIM#102700;disorder of purine metabolism				3475710;3684597;2783588;1680289		False	3	100;0;0	21.664	True		ENSG00000196839	ENSG00000196839	HGNC:186													
ADAM22	gene	ADAM22	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 61 (MIM#617933)				27066583;30237576;35373813		False	3	50;50;0	21.664	True		ENSG00000008277	ENSG00000008277	HGNC:201													
ADAR	gene	ADAR	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 6;neuroinflammatory disorder with cerebral calcification;progressive loss of cognition;spasticity;dystonia;parkinsonism;OMIM 615010				PMID: 32911246		False	3	100;0;0	21.664	True		ENSG00000160710	ENSG00000160710	HGNC:225													
ADAR	gene	ADAR	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 6, MIM# 615010;Dyschromatosis symmetrica hereditaria, MIM# 127400						False	3	100;0;0	21.664	True		ENSG00000160710	ENSG00000160710	HGNC:225													
ADAR	gene	ADAR	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 6, 615010 autosomal recessive						False	3	100;0;0	21.664	True		ENSG00000160710	ENSG00000160710	HGNC:225													
ADAR	gene	ADAR	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	dystonia;Aicardi-Goutieres syndrome 6, 615010						False	3	100;0;0	21.664	False		ENSG00000160710	ENSG00000160710	HGNC:225													
ADAR	gene	ADAR	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 6, MIM#615010				23001123;24262145;23001123;30692772		False	3	100;0;0	21.664	True		ENSG00000160710	ENSG00000160710	HGNC:225													
ADAR	gene	ADAR	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 6, MIM#	615010"						False	3	100;0;0	21.664	True		ENSG00000160710	ENSG00000160710	HGNC:225													
ADARB1	gene	ADARB1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862;Intellectual disability;microcephaly;seizures				32220291;32719099		False	3	100;0;0	21.664	True		ENSG00000197381	ENSG00000197381	HGNC:226													
ADCY5	gene	ADCY5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651				22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617		False	3	100;0;0	21.664	True		ENSG00000173175	ENSG00000173175	HGNC:236													
ADCY5	gene	ADCY5	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651				22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617		False	3	100;0;0	21.664	False		ENSG00000173175	ENSG00000173175	HGNC:236													
ADGRG1	gene	ADGRG1	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polymicrogyria, Frontoparietal, 606854;Polymicrogyria, perisylvian type, 615752						False	3	100;0;0	21.664	True		ENSG00000205336	ENSG00000205336	HGNC:4512													
ADGRG1	gene	ADGRG1	Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polymicrogyria, bilateral frontoparietal, MIM#606854				16240336;33299078		False	3	100;0;0	21.664	True		ENSG00000205336	ENSG00000205336	HGNC:4512													
ADGRV1	gene	ADGRV1	Expert Review Green;Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epilepsy, MONDO:0005027, ADGRV1-related				29266188;29261713;32962041;34160719		False	3	50;50;0	21.664	True		ENSG00000164199	ENSG00000164199	HGNC:17416													
ADNP	gene	ADNP	Expert Review Green;Expert Review;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Helsmoortel-van der Aa syndrome MIM#615873				(PMID: 27054228;24531329)		False	3	100;0;0	21.664	True		ENSG00000101126	ENSG00000101126	HGNC:15766													
ADPRS	gene	ADPRS	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, stress-induced with variable ataxia and seizures, 618170				30100084;30401461		False	3	100;0;0	21.664	True		ENSG00000116863	ENSG00000116863	HGNC:21304													
ADPRS	gene	ADPRS	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, stress-induced, with variable ataxia and seizures (MIM#618170)				30100084;30401461		False	3	100;0;0	21.664	True		ENSG00000116863	ENSG00000116863	HGNC:21304													
ADPRS	gene	ADPRS	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, stress-induced, with variable ataxia and seizures (MIM#618170)				30100084;30401461		False	3	100;0;0	21.664	True		ENSG00000116863	ENSG00000116863	HGNC:21304													
ADSL	gene	ADSL	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adenylosuccinase deficiency MIM#103050;disorder of purine metabolism				1302001;22180458;18524658;27626380		False	3	100;0;0	21.664	True		ENSG00000239900	ENSG00000239900	HGNC:291													
ADSL	gene	ADSL	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adenylosuccinase deficiency MIM#103050				1302001;22180458;18524658;27626380		False	3	100;0;0	21.664	True		ENSG00000239900	ENSG00000239900	HGNC:291													
ADSS1	gene	ADSS1	Expert Review Green;Literature;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	adenylosuccinate synthetase-like 1-related distal myopathy MONDO:0018834				26506222;28268051;34635388;32646962		False	3	100;0;0	21.664	True		ENSG00000185100	ENSG00000185100	HGNC:20093													
AFF3	gene	AFF3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	KINSSHIP syndrome, MIM# 619297;Intellectual disability;seizures;hypertrichosis				31388108;33961779		False	3	100;0;0	21.664	True		ENSG00000144218	ENSG00000144218	HGNC:6473													
AFG2A	gene	AFG2A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, hearing loss, and mental retardation syndrome, MIM# 616577				27246907;29343804;26299366		False	3	100;0;0	21.664	True		ENSG00000145375	ENSG00000145375	HGNC:18119													
AFG2A	gene	AFG2A	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, hearing loss, and mental retardation syndrome MIM#616577				30009132;29343804		False	3	100;0;0	21.664	True		ENSG00000145375	ENSG00000145375	HGNC:18119													
AFG2B	gene	AFG2B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616				34626583		False	3	100;0;0	21.664	True		ENSG00000171763	ENSG00000171763	HGNC:28762													
AFG2B	gene	AFG2B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616				34626583		False	3	100;0;0	21.664	True		ENSG00000171763	ENSG00000171763	HGNC:28762													
AFG3L2	gene	AFG3L2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 5, autosomal recessive, MIM# 614487;Spinocerebellar ataxia 28, MIM# 610246				22022284;20208537;20725928;33075064;32248051;30910913		False	3	100;0;0	21.664	True	Other	ENSG00000141385	ENSG00000141385	HGNC:315													
AFG3L2	gene	AFG3L2	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic ataxia 5, autosomal recessive (MIM#614487);Spinocerebellar ataxia 28 (MIM#610246);Optic atrophy 12, MIM# 618977				29181157;26539208;30252181;30389403;32219868;32600459;32548275;20725928		False	3	100;0;0	21.664	True		ENSG00000141385	ENSG00000141385	HGNC:315													
AFG3L2	gene	AFG3L2	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic ataxia 5, autosomal recessive MIM#614487;Spinocerebellar ataxia 28 MIM#610246				20725928		False	3	100;0;0	21.664	True		ENSG00000141385	ENSG00000141385	HGNC:315													
AFG3L2	gene	AFG3L2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 5, autosomal recessive, MIM# 614487, MONDO:0013776;Early-onset spastic paraplegia, later myoclonic epilepsy, sensory-motor axonal neuropathy, ataxia, dystonia				22022284;25401298		False	3	100;0;0	21.664	True		ENSG00000141385	ENSG00000141385	HGNC:315													
AGA	gene	AGA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aspartylglucosaminuria, MIM# 208400				(PMID: 33439067;8333236;19175389;15036433;8064811;8946839;1756604)		False	3	100;0;0	21.664	True		ENSG00000038002	ENSG00000038002	HGNC:318													
AGA	gene	AGA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aspartylglucosaminuria, MIM# 208400;MONDO:0008830				1703489;1904874;8064811;8946839		False	3	100;0;0	21.664	True		ENSG00000038002	ENSG00000038002	HGNC:318													
AGK	gene	AGK	Expert Review Green;Other;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sengers Syndrome (MIM#212350;MONDO:0008922)				22284826		False	3	100;0;0	21.664	True		ENSG00000006530	ENSG00000006530	HGNC:21869													
AGK	gene	AGK	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sengers syndrome, MIM#212350;Cataract 38 MIM#614691				22415731;25208612;22415731;25208612;37354892		False	3	100;0;0	21.664	True		ENSG00000006530	ENSG00000006530	HGNC:21869													
AGL	gene	AGL	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease IIIa and IIIb, MIM# 232400						False	3	100;0;0	21.664	True		ENSG00000162688	ENSG00000162688	HGNC:321													
AGL	gene	AGL	Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease IIIa 232400;Glycogen storage disease IIIb 232400				20301788		False	3	100;0;0	21.664	True		ENSG00000162688	ENSG00000162688	HGNC:321													
AGMO	gene	AGMO	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, AGMO-related				31555905;27000257		False	3	100;0;0	21.664	True		ENSG00000187546	ENSG00000187546	HGNC:33784													
AGO1	gene	AGO1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with language delay and behavioral abnormalities, with or without seizures, MIM# 620292				35060114;30213762;25356899		False	3	100;0;0	21.664	True		ENSG00000092847	ENSG00000092847	HGNC:3262													
AGPS	gene	AGPS	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000018510	ENSG00000018510	HGNC:327													
AGTPBP1	gene	AGTPBP1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650				30420557, 28600779, 30976113, 38153683, 28325758		False	3	100;0;0	21.664	True		ENSG00000135049	ENSG00000135049	HGNC:17258													
AGTPBP1	gene	AGTPBP1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650				30420557, 28600779, 30976113, 38153683, 28325758		False	3	100;0;0	21.664	True		ENSG00000135049	ENSG00000135049	HGNC:17258													
AGXT	gene	AGXT	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperoxaluria, primary, type 1, MIM#259900						False	3	100;0;0	21.664	True		ENSG00000172482	ENSG00000172482	HGNC:341													
AGXT	gene	AGXT	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000172482	ENSG00000172482	HGNC:341													
AHCY	gene	AHCY	Expert Review Green;Expert Review Green;Expert list;Expert list;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase MIM#613752				28779239;15024124;30121674		False	3	100;0;0	21.664	True		ENSG00000101444	ENSG00000101444	HGNC:343													
AHCY	gene	AHCY	Expert Review Green;NHS GMS;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase MIM#613752;disorder of methionine metabolism				28779239;26095522;20852937;15024124;27626380		False	3	100;0;0	21.664	True		ENSG00000101444	ENSG00000101444	HGNC:343													
AHI1	gene	AHI1	Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 3				25616960		False	3	100;0;0	21.664	True		ENSG00000135541	ENSG00000135541	HGNC:21575													
AIFM1	gene	AIFM1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, MIM# 300232				28842795;27102849		False	3	100;0;0	21.664	True		ENSG00000156709	ENSG00000156709	HGNC:8768													
AIFM1	gene	AIFM1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Combined oxidative phosphorylation deficiency 6;Cowchock syndrome;HMSN				3856385;22019070;26173962;25583628		False	3	100;0;0	21.664	True		ENSG00000156709	ENSG00000156709	HGNC:8768													
AIFM1	gene	AIFM1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Combined oxidative phosphorylation deficiency 6, 300816;Cowchock syndrome, 310490;Deafness, X-linked 5, 300614;Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232						False	3	100;0;0	21.664	True		ENSG00000156709	ENSG00000156709	HGNC:8768													
AIFM1	gene	AIFM1	Expert Review Green;Other;Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Combined oxidative phosphorylation deficiency 6 (COXPD6) (MIM#300816);Encephalamyopathy, Mitochondrial, X-Linked				20362274;22019070;26173962		False	3	100;0;0	21.664	True		ENSG00000156709	ENSG00000156709	HGNC:8768													
AIMP1	gene	AIMP1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 3, MIM#260600				21092922;24958424;33402283;32531460;30486714;30477741		False	3	100;0;0	21.664	True		ENSG00000164022	ENSG00000164022	HGNC:10648													
AIMP1	gene	AIMP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 3, MIM# 260600				21092922;24958424;33402283;32531460;30486714;30477741		False	3	100;0;0	21.664	True		ENSG00000164022	ENSG00000164022	HGNC:10648													
AIMP1	gene	AIMP1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 3 260600						False	3	0;0;0	21.664	False		ENSG00000164022	ENSG00000164022	HGNC:10648													
AIRIM	gene	AIRIM	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, C1orf109-related				40760247		False	3	100;0;0	21.664	True		ENSG00000116922	ENSG00000116922	HGNC:26039													
AJAP1	gene	AJAP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder, MONDO:0700092, AJAP1-related				38985877		False	3	100;0;0	21.664	True		ENSG00000196581	ENSG00000196581	HGNC:30801													
AKR1D1	gene	AKR1D1	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bile acid synthesis defect, congenital, 2 MIM#235555;disorder of bile acid metabolism				12970144;20522910;15030995		False	3	100;0;0	21.664	True		ENSG00000122787	ENSG00000122787	HGNC:388													
AKT1	gene	AKT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Other	Proteus syndrome, somatic, MIM# 176920				21793738		False	3	50;50;0	21.664	True		ENSG00000142208	ENSG00000142208	HGNC:391													
AKT3	gene	AKT3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2 MIM#615937				22729224		False	3	100;0;0	21.664	True	Other	ENSG00000117020	ENSG00000117020	HGNC:393													
ALAS2	gene	ALAS2	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	300752 Protoporphyria, erythropoietic, X-linked;Sideroblastic anaemia - increased serum ferritin;300751 Anemia, sideroblastic, 1				24003969;30401706;10029606;30098397		False	3	0;0;0	21.664	False		ENSG00000158578	ENSG00000158578	HGNC:397													
ALDH18A1	gene	ALDH18A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Spastic paraplegia 9B, autosomal recessive, MIM#	616586;Spastic paraplegia 9A, autosomal dominant, MIM# 601162"				26026163;29915212		False	3	100;0;0	21.664	True		ENSG00000059573	ENSG00000059573	HGNC:9722													
ALDH18A1	gene	ALDH18A1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cutis laxa, autosomal recessive, type IIIA MIM#219150;Spastic paraplegia 9A, autosomal dominant MIM#601162;Spastic paraplegia 9B, autosomal recessive MIM#616586;Cutis laxa, autosomal dominant 3 MIM#616603;disorders of ornithine or proline metabolism				32221810;11092761;29754261;26026163		False	3	100;0;0	21.664	True		ENSG00000059573	ENSG00000059573	HGNC:9722													
ALDH18A1	gene	ALDH18A1	Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Adolescent-onset and adult-onset spastic paraplegia, dysarthria and motor neuronopathy, cataracts, skeletal abnormalities						False	3	100;0;0	21.664	False		ENSG00000059573	ENSG00000059573	HGNC:9722													
ALDH3A2	gene	ALDH3A2	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sjogren-Larsson syndrome MIM#270200;disorder of lipid metabolism				8528251;31273323		False	3	100;0;0	21.664	True		ENSG00000072210	ENSG00000072210	HGNC:403													
ALDH3A2	gene	ALDH3A2	Expert Review Green;Literature;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sjogren-Larsson syndrome, MIM# 270200				(PMID:32021380,30372562		False	3	100;0;0	21.664	True		ENSG00000072210	ENSG00000072210	HGNC:403													
ALDH3A2	gene	ALDH3A2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sj gren-Larsson syndrome						False	3	100;0;0	21.664	True		ENSG00000072210	ENSG00000072210	HGNC:403													
ALDH3A2	gene	ALDH3A2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Sjogren-Larsson syndrome, MIM#	270200"						False	3	100;0;0	21.664	True		ENSG00000072210	ENSG00000072210	HGNC:403													
ALDH4A1	gene	ALDH4A1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperprolinemia, type II MIM#239510;disorders of ornithine or proline metabolism				9700195;31884946		False	3	100;0;0	21.664	True		ENSG00000159423	ENSG00000159423	HGNC:406													
ALDH4A1	gene	ALDH4A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperprolinaemia, type II, MIM#239510				9700195, 31884946		False	3	100;0;0	21.664	True		ENSG00000159423	ENSG00000159423	HGNC:406													
ALDH5A1	gene	ALDH5A1	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinic semialdehyde dehydrogenase deficiency MIM#271980;disorder of neurotransmitter metabolism				9683595;14635103;32887777		False	3	100;0;0	21.664	True		ENSG00000112294	ENSG00000112294	HGNC:408													
ALDH5A1	gene	ALDH5A1	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinic semialdehyde dehydrogenase deficiency, MIM# 271980				9683595;14635103;32402538		False	3	100;0;0	21.664	True		ENSG00000112294	ENSG00000112294	HGNC:408													
ALDH5A1	gene	ALDH5A1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinic semialdehyde dehydrogenase deficiency, MIM# 271980				9683595;14635103;32402538		False	3	100;0;0	21.664	True		ENSG00000112294	ENSG00000112294	HGNC:408													
ALDH5A1	gene	ALDH5A1	Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinic semialdehyde dehydrogenase deficiency, MIM# 271980				14635103		False	3	100;0;0	21.664	True		ENSG00000112294	ENSG00000112294	HGNC:408													
ALDH6A1	gene	ALDH6A1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonate semialdehyde dehydrogenase deficiency MIM#614105;disorder of valine and pyrimidine metabolism				32151545;10947204;21863277;23835272		False	3	100;0;0	21.664	True		ENSG00000119711	ENSG00000119711	HGNC:7179													
ALDH7A1	gene	ALDH7A1	Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, pyridoxine-dependent, MIM# 266100				33200442		False	3	100;0;0	21.664	True		ENSG00000164904	ENSG00000164904	HGNC:877													
ALDH7A1	gene	ALDH7A1	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, pyridoxine-dependent MM#266100;disorder of lysine metabolism				16491085;17068770		False	3	100;0;0	21.664	True		ENSG00000164904	ENSG00000164904	HGNC:877													
ALDH7A1	gene	ALDH7A1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, pyridoxine-dependent, MIM# 266100						False	3	100;0;0	21.664	True		ENSG00000164904	ENSG00000164904	HGNC:877													
ALDOA	gene	ALDOA	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease XII 611881				8598869;25392908;14615364		False	3	100;0;0	21.664	True		ENSG00000149925	ENSG00000149925	HGNC:414													
ALDOA	gene	ALDOA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease XII , MIM#611881				7331996;8598869;25392908		False	3	100;0;0	21.664	True		ENSG00000149925	ENSG00000149925	HGNC:414													
ALDOB	gene	ALDOB	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fructose intolerance, hereditary, MIM# 229600						False	3	100;0;0	21.664	True		ENSG00000136872	ENSG00000136872	HGNC:417													
ALG1	gene	ALG1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ik, MIM# 608540				26931382		False	3	100;0;0	21.664	True		ENSG00000033011	ENSG00000033011	HGNC:18294													
ALG1	gene	ALG1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Congenital disorder of glycosylation, type Ik	608540"				26931382		False	3	100;0;0	21.664	True		ENSG00000033011	ENSG00000033011	HGNC:18294													
ALG11	gene	ALG11	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Congenital disorder of glycosylation, type Ip, MIM#	613661"				30676690		False	3	100;0;0	21.664	True		ENSG00000253710	ENSG00000253710	HGNC:32456													
ALG11	gene	ALG11	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ip, MIM# 613661				30676690		False	3	100;0;0	21.664	True		ENSG00000253710	ENSG00000253710	HGNC:32456													
ALG12	gene	ALG12	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Congenital disorder of glycosylation, type Ig	607143"				31481313		False	3	100;0;0	21.664	True		ENSG00000182858	ENSG00000182858	HGNC:19358													
ALG13	gene	ALG13	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Congenital disorder of glycosylation, type Is (MIM# 300884)				22492991;28887793;26138355;31444733;23033978;23934111;24781210;24896178;25732998;26138355;26482601;28940310;32238909		False	3	67;33;0	21.664	True		ENSG00000101901	ENSG00000101901	HGNC:30881													
ALG13	gene	ALG13	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Congenital disorder of glycosylation, type Is (MIM# 300884)				23033978;23934111;24781210;24896178;25732998;26138355;26482601;28940310;32238909		False	3	100;0;0	21.664	True		ENSG00000101901	ENSG00000101901	HGNC:30881													
ALG14	gene	ALG14	Expert list;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenic syndrome, congenital, 15, without tubular aggregates 616227;Intellectual developmental disorder with epilepsy, behavioral abnormalities, and coarse facies (IDDEBF), MIM#619031;Myopathy, epilepsy, and progressive cerebral atrophy, MIM# 619036;Disorder of N-glycosylation				30221345, 23404334, 28733338, 33751823, 34971077		False	3	100;0;0	21.664	True		ENSG00000172339	ENSG00000172339	HGNC:28287													
ALG14	gene	ALG14	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	intellectual developmental disorder with epilepsy, behavioral abnormalities, and coarse facies (IDDEBF), MIM#619031;Myopathy, epilepsy, and progressive cerebral atrophy, MIM# 619036				30221345, 23404334, 28733338, 33751823, 34971077		False	3	100;0;0	21.664	True		ENSG00000172339	ENSG00000172339	HGNC:28287													
ALG2	gene	ALG2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ii (MIM# 607906)				12684507;23404334;24461433		False	3	50;0;50	21.664	True		ENSG00000119523	ENSG00000119523	HGNC:23159													
ALG2	gene	ALG2	Expert Review Green;NHS GMS;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenic syndrome, congenital, 14, with tubular aggregates, MIM# 616228;Congenital disorder of glycosylation, type Ii, MIM# 607906				(PMID:12684507;28733338;28007376)		False	3	33;0;67	21.664	True		ENSG00000119523	ENSG00000119523	HGNC:23159													
ALG3	gene	ALG3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Id, MIM# 601110				31067009		False	3	100;0;0	21.664	True		ENSG00000214160	ENSG00000214160	HGNC:23056													
ALG3	gene	ALG3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Id, MIM# 601110				31067009		False	3	100;0;0	21.664	True		ENSG00000214160	ENSG00000214160	HGNC:23056													
ALG6	gene	ALG6	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ic (MIM#603147)				10914684;27498540		False	3	100;0;0	21.664	True		ENSG00000088035	ENSG00000088035	HGNC:23157													
ALG6	gene	ALG6	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ic (MIM#603147)				10914684;27498540		False	3	100;0;0	21.664	True		ENSG00000088035	ENSG00000088035	HGNC:23157													
ALG8	gene	ALG8	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ih, MIM# 608104				26066342;35716054		False	3	100;0;0	21.664	True		ENSG00000159063	ENSG00000159063	HGNC:23161													
ALG8	gene	ALG8	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ih, MIM# 608104				26066342		False	3	100;0;0	21.664	True		ENSG00000159063	ENSG00000159063	HGNC:23161													
ALG9	gene	ALG9	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Il, MIM#608776;Gillessen-Kaesbach-Nishimura syndrome, MIM# 263210				28932688;25966638;26453364		False	3	100;0;0	21.664	True		ENSG00000086848	ENSG00000086848	HGNC:15672													
ALG9	gene	ALG9	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Il, MIM#608776				28932688		False	3	100;0;0	21.664	True		ENSG00000086848	ENSG00000086848	HGNC:15672													
ALKBH8	gene	ALKBH8	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder, autosomal recessive 71, MIM#	618504"				31079898		False	3	0;100;0	21.664	True		ENSG00000137760	ENSG00000137760	HGNC:25189													
ALPK1	gene	ALPK1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"ROSAH syndrome, MIM#	614979"						False	3	100;0;0	21.664	True		ENSG00000073331	ENSG00000073331	HGNC:20917													
ALPL	gene	ALPL	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hypophosphatasia;disorder of bone metabolism				3174660;1409720		False	3	100;0;0	21.664	True		ENSG00000162551	ENSG00000162551	HGNC:438													
ALPL	gene	ALPL	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hypophosphatasia, adult 146300 (AD, AR);Hypophosphatasia, childhood 241510 AR;Hypophosphatasia, infantile 241500 AR;Odontohypophosphatasia 146300 AD, AR				19500388;23688511;3174660;1409720		False	3	100;0;0	21.664	True	Other	ENSG00000162551	ENSG00000162551	HGNC:438													
ALS2	gene	ALS2	ClinGen;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	ALS2-related motor neuron disease, MONDO:0100227				30128655, 33409823, 11586298, 16240357, 23282280, 24562058, 33155358		False	3	100;0;0	21.664	True		ENSG00000003393	ENSG00000003393	HGNC:443													
ALS2	gene	ALS2	ClinGen;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	ALS2-related motor neuron disease, MONDO:0100227				30128655, 33409823, 11586298, 16240357, 23282280, 24562058, 33155358		False	3	100;0;0	21.664	True		ENSG00000003393	ENSG00000003393	HGNC:443													
AMACR	gene	AMACR	Expert Review Green;Expert Review;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alpha-methylacyl-CoA racemase deficiency, MIM# 614307				35428665;21576695;11060344;21686617		False	3	100;0;0	21.664	True		ENSG00000242110	ENSG00000242110	HGNC:451													
AMACR	gene	AMACR	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000242110	ENSG00000242110	HGNC:451													
AMACR	gene	AMACR	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alpha-methylacyl-CoA racemase deficiency (MIM#614307);Retinopathy, myelopathy, axonal or SNCV neuropathy, elevated phytanic and pristanic acids				36108118;10655068;20821052;18032455		False	3	100;0;0	21.664	True		ENSG00000242110	ENSG00000242110	HGNC:451													
AMACR	gene	AMACR	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bile acid synthesis defect, congenital, 4, MIM# 214950;Alpha-methylacyl-CoA racemase deficiency, MIM# 614307				35641312;35428665		False	3	100;0;0	21.664	True		ENSG00000242110	ENSG00000242110	HGNC:451													
AMFR	gene	AMFR	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 89, autosomal recessive, MIM# 620379				37119330		False	3	100;0;0	21.664	True		ENSG00000159461	ENSG00000159461	HGNC:463													
AMPD2	gene	AMPD2	Expert Review Green;Other;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 9, MIM#615809				23911318;27066553		False	3	100;0;0	21.664	True		ENSG00000116337	ENSG00000116337	HGNC:469													
AMT	gene	AMT	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycine encephalopathy MIM#605899;disorder of glycine metabolism				8188235;10873393;11592811		False	3	100;0;0	21.664	True		ENSG00000145020	ENSG00000145020	HGNC:473													
AMT	gene	AMT	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycine encephalopathy MIM#605899;disorder of glycine metabolism				8188235;10873393;11592811		False	3	100;0;0	21.664	True		ENSG00000145020	ENSG00000145020	HGNC:473													
ANGPTL6	gene	ANGPTL6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebral aneurysm				29304371;33106390		False	3	100;0;0	21.664	True		ENSG00000130812	ENSG00000130812	HGNC:23140													
ANK2	gene	ANK2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Complex neurodevelopmental disorder, MONDO:0100038, ANK2-related				PMID:37195288		False	3	100;0;0	21.664	True		ENSG00000145362	ENSG00000145362	HGNC:493													
ANKRD11	gene	ANKRD11	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	KBG syndrome, MIM#148050				29565525;30182498		False	3	100;0;0	21.664	True		ENSG00000167522	ENSG00000167522	HGNC:21316													
ANKRD17	gene	ANKRD17	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chopra-Amiel-Gordan syndrome, MIM# 619504;Intellectual disability;dysmorphic features				33909992		False	3	50;50;0	21.664	True		ENSG00000132466	ENSG00000132466	HGNC:23575													
ANO10	gene	ANO10	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 10 MIM#613728						False	3	100;0;0	21.664	True		ENSG00000160746	ENSG00000160746	HGNC:25519													
ANO3	gene	ANO3	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 24, 615034;familial form of cranio-cervical dystonia				33388357		False	3	100;0;0	21.664	False		ENSG00000134343	ENSG00000134343	HGNC:14004													
ANO4	gene	ANO4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, ANO4-related				38744284		False	3	100;0;0	21.664	True		ENSG00000151572	ENSG00000151572	HGNC:23837													
ANO5	gene	ANO5	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Miyoshi muscular dystrophy 3 613319;Muscular dystrophy, limb-girdle, type 2L 611307				23193613		False	3	100;0;0	21.664	True		ENSG00000171714	ENSG00000171714	HGNC:27337													
ANO5	gene	ANO5	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, type 2L, 611307;Miyoshi muscular dystrophy 3, 613319				20096397;32399949		False	3	100;0;0	21.664	True		ENSG00000171714	ENSG00000171714	HGNC:27337													
ANXA11	gene	ANXA11	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis type 23 MONDO:0027694				36458208;39755715;38896345;38896262		False	3	100;0;0	21.664	True	Other	ENSG00000122359	ENSG00000122359	HGNC:535													
ANXA11	gene	ANXA11	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amytrophic lateral sclerosis 23 MIM#617839				28469040;29845112;30109997		False	3	100;0;0	21.664	False		ENSG00000122359	ENSG00000122359	HGNC:535													
AOPEP	gene	AOPEP	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Dystonia 31, MIM#	619565"				34596301		False	3	100;0;0	21.664	False		ENSG00000148120	ENSG00000148120	HGNC:1361													
AOPEP	gene	AOPEP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 31, MIM# 619565;Childhood/Adolescence onset generalised dystonia;Dystonia parkinsonism;Zech-Boesch Syndrome				PMID: 35306330		False	3	100;0;0	21.664	True		ENSG00000148120	ENSG00000148120	HGNC:1361													
AP1G1	gene	AP1G1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Usmani-Riazuddin syndrome, autosomal dominant, MIM# 619467;Usmani-Riazuddin syndrome, autosomal recessive, MIM# 619548;Neurodevelopmental disorder (NDD);Intellectual Disability;Epilepsy				34102099		False	3	100;0;0	21.664	True		ENSG00000166747	ENSG00000166747	HGNC:555													
AP1S1	gene	AP1S1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	MEDNIK Syndrome (MONDO:0012251, MIM#609313);Congenital-onset, Mental retardation, Enteropathy (severe congenital diarrhoea), Deafness, sensory-motor Neuropathy with intermediate conduction velocities, Ichthyosis, Keratoderma				30244301;23423674		False	3	50;50;0	21.664	True		ENSG00000106367	ENSG00000106367	HGNC:559													
AP1S1	gene	AP1S1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	MEDNIK syndrome MONDO:0012251;Disorders of copper metabolism				31399000		False	3	0;0;0	21.664	False		ENSG00000106367	ENSG00000106367	HGNC:559													
AP1S2	gene	AP1S2	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Pettigrew syndrome, MIM# 304340						False	3	100;0;0	21.664	True		ENSG00000182287	ENSG00000182287	HGNC:560													
AP1S2	gene	AP1S2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Pettigrew syndrome, MIM# 304340				19161147;17617514		False	3	100;0;0	21.664	True		ENSG00000182287	ENSG00000182287	HGNC:560													
AP2M1	gene	AP2M1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder 60 with seizures, MIM#	618587"				31104773		False	3	100;0;0	21.664	True		ENSG00000161203	ENSG00000161203	HGNC:564													
AP2S1	gene	AP2S1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, AP2S1-related				31981491;33057194;35982160;35982159		False	3	100;0;0	21.664	True		ENSG00000042753	ENSG00000042753	HGNC:565													
AP3B2	gene	AP3B2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Early-onset epileptic encephalopathy with optic atrophy, MIM#617276				27889060		False	3	100;0;0	21.664	True		ENSG00000103723	ENSG00000103723	HGNC:567													
AP4B1	gene	AP4B1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 47, autosomal recessive	MIM#614066"				29193663		False	3	100;0;0	21.664	True		ENSG00000134262	ENSG00000134262	HGNC:572													
AP4B1	gene	AP4B1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 47, autosomal recessive, 614066				21620353;22290197;24700674;24781758;32979048;32171285;32166732;31525725;31525725		False	3	100;0;0	21.664	True		ENSG00000134262	ENSG00000134262	HGNC:572													
AP4B1	gene	AP4B1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 47, autosomal recessive, MIM# 614066				21620353;22290197;24700674;24781758;32166732		False	3	100;0;0	21.664	True		ENSG00000134262	ENSG00000134262	HGNC:572													
AP4E1	gene	AP4E1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 51, autosomal recessive, 613744				20972249;21620353;21937992;32979048;23472171		False	3	100;0;0	21.664	True		ENSG00000081014	ENSG00000081014	HGNC:573													
AP4M1	gene	AP4M1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 50, autosomal recessive, 612936				19559397;21937992;21937992;32979048;31915823;29096665;28464862;25496299		False	3	100;0;0	21.664	True		ENSG00000221838	ENSG00000221838	HGNC:574													
AP4S1	gene	AP4S1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	developmental delay;Spastic paraplegia 52, autosomal recessive, 614067;seizures				21620353;25552650;32979048;32216065;31915823;30283821;27444738		False	3	100;0;0	21.664	True		ENSG00000100478	ENSG00000100478	HGNC:575													
AP5B1	gene	AP5B1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related				40081374		False	3	50;50;0	21.664	True		ENSG00000254470	ENSG00000254470	HGNC:25104													
AP5M1	gene	AP5M1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related				40081374		False	3	100;0;0	21.664	False		ENSG00000053770	ENSG00000053770	HGNC:20192													
AP5Z1	gene	AP5Z1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of autophagy;hereditary spastic paraplegia MONDO:0019064				26085577;29884839		False	3	100;0;0	21.664	True		ENSG00000242802	ENSG00000242802	HGNC:22197													
AP5Z1	gene	AP5Z1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 48, autosomal recessive, MIM#	613647"				26085577		False	3	50;50;0	21.664	True		ENSG00000242802	ENSG00000242802	HGNC:22197													
APC2	gene	APC2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia, complex, with other brain malformations 10, MIM#618677				31585108		False	3	100;0;0	21.664	True		ENSG00000115266	ENSG00000115266	HGNC:24036													
APOA1	gene	APOA1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Amyloidosis, 3 or more types	105200;Renal failure, Axonal sensory-motor neuropathy, amyloid nephropathy"						False	3	100;0;0	21.664	True		ENSG00000118137	ENSG00000118137	HGNC:600													
APP	gene	APP	Other;Expert Review Green;Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset autosomal dominant Alzheimer disease MONDO:0015140				36845656		False	3	100;0;0	21.664	False		ENSG00000142192	ENSG00000142192	HGNC:620													
APP	gene	APP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease MONDO:0007088				20301340;1671712;1678058;1908231;1302033		False	3	100;0;0	21.664	True	Other	ENSG00000142192	ENSG00000142192	HGNC:620													
APTX	gene	APTX	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-oculomotor apraxia type 1;Dystonia				15876520		False	3	100;0;0	21.664	True		ENSG00000137074	ENSG00000137074	HGNC:15984													
APTX	gene	APTX	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia MIM#208920				30986824;26256098		False	3	100;0;0	21.664	True		ENSG00000137074	ENSG00000137074	HGNC:15984													
APTX	gene	APTX	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminaemia MIM#208920				30986824;26256098;11586299		False	3	100;0;0	21.664	True		ENSG00000137074	ENSG00000137074	HGNC:15984													
APTX	gene	APTX	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia (MIM#208920)				11586299		False	3	100;0;0	21.664	True		ENSG00000137074	ENSG00000137074	HGNC:15984													
ARF1	gene	ARF1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Periventricular nodular heterotopia 8, MIM# 618185				28868155;34353862		False	3	100;0;0	21.664	True		ENSG00000143761	ENSG00000143761	HGNC:652													
ARF3	gene	ARF3	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO:0700092), ARF3-related;Global developmental delay;Intellectual disability;Seizures;Morphological abnormality of the central nervous system				34346499;36369169		False	3	33;67;0	21.664	True		ENSG00000134287	ENSG00000134287	HGNC:654													
ARFGEF1	gene	ARFGEF1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay, impaired speech, and behavioral abnormalities, MIM# 619964				34113008		False	3	100;0;0	21.664	True		ENSG00000066777	ENSG00000066777	HGNC:15772													
ARFGEF2	gene	ARFGEF2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Periventricular heterotopia with microcephaly (MIM#608097)				25160555;26126837;23812912		False	3	100;0;0	21.664	True		ENSG00000124198	ENSG00000124198	HGNC:15853													
ARG1	gene	ARG1	NHS GMS;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Argininemia, 207800				2365823;29726057		False	3	100;0;0	21.664	True		ENSG00000118520	ENSG00000118520	HGNC:663													
ARG1	gene	ARG1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive spastic tetraplegia;Argininaemia, 207800				29726057		False	3	100;0;0	21.664	True		ENSG00000118520	ENSG00000118520	HGNC:663													
ARG1	gene	ARG1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Argininemia MIM#207800;Urea cycle disorders and inherited hyperammonaemias;disorder of arginine metabolism				2365823;1598908;29726057		False	3	100;0;0	21.664	True		ENSG00000118520	ENSG00000118520	HGNC:663													
ARHGAP19	gene	ARHGAP19	Literature;Literature;Expert Review Green;Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2KK, MIM# 621466				41086021		False	3	100;0;0	21.664	False		ENSG00000213390	ENSG00000213390	HGNC:23724													
ARHGEF9	gene	ARHGEF9	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Epileptic encephalopathy, early infantile, 8, MIM# 300607				31942680;30048823;29130122;28620718		False	3	100;0;0	21.664	True		ENSG00000131089	ENSG00000131089	HGNC:14561													
ARID1A	gene	ARID1A	Expert Review Green;Expert Review;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 2 #614607				(PMID:34942405;25168959;33303725;35571021;23906836;23929686)		False	3	100;0;0	21.664	True		ENSG00000117713	ENSG00000117713	HGNC:11110													
ARID1B	gene	ARID1B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 1 MIM#135900						False	3	100;0;0	21.664	True		ENSG00000049618	ENSG00000049618	HGNC:18040													
ARL13B	gene	ARL13B	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 8, MIM#	612291"						False	3	100;0;0	21.664	True		ENSG00000169379	ENSG00000169379	HGNC:25419													
ARL6IP1	gene	ARL6IP1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HSAN/SFN;Childhood-onset spastic paraplegia with mutilating, sensory>motor axonal neuropathy						False	3	100;0;0	21.664	True		ENSG00000170540	ENSG00000170540	HGNC:697													
ARL6IP1	gene	ARL6IP1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 61, autosomal recessive, MIM#615685				24482476;31272422;30980493;28471035		False	3	100;0;0	21.664	True		ENSG00000170540	ENSG00000170540	HGNC:697													
ARSA	gene	ARSA	Expert Review Green;Literature;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy - # 250100;Arylsulfatase A deficiency				(PMID: 33195324;10987380;37359369;20301309;36324388;19021637)		False	3	100;0;0	21.664	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARSA	gene	ARSA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic Leukodystrophy, 250100;Metachromatic leukodystrophy (#250100)						False	3	100;0;0	21.664	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARSA	gene	ARSA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy, MIM# 250100;Severe late infantile form with mental retardation and severe course. Regression before 30 months;adult-onset, psychiatric symptoms, leukodystrophy on MRI, progressive neuropathy with SNCV, optic atrophy						False	3	100;0;0	21.664	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARSA	gene	ARSA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy, MIM#250100						False	3	100;0;0	21.664	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARSA	gene	ARSA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Metachromatic leukodystrophy, MIM#	250100"						False	3	100;0;0	21.664	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARSA	gene	ARSA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy, MIM# 250100;MONDO:0009591						False	3	100;0;0	21.664	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARSA	gene	ARSA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy, MIM# 250100, adult-onset				29486463;26890752;15710861		False	3	100;0;0	21.664	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARSB	gene	ARSB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type VI (Maroteaux-Lamy), MIM# 253200;MONDO:0009661				11668612		False	3	100;0;0	21.664	True		ENSG00000113273	ENSG00000113273	HGNC:714													
ARSK	gene	ARSK	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis MONDO:0019249, ARSK-related				34916232;32856704		False	3	100;0;0	21.664	True		ENSG00000164291	ENSG00000164291	HGNC:25239													
ARSL	gene	ARSL	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Chondrodysplasia punctata, X-linked recessive (MIM#302950)				23470839		False	3	0;100;0	21.664	True		ENSG00000157399	ENSG00000157399	HGNC:719													
ARV1	gene	ARV1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Developmental and epileptic encephalopathy 38, MIM#	617020"				35227294;27270415;25558065		False	3	100;0;0	21.664	True		ENSG00000173409	ENSG00000173409	HGNC:29561													
ARX	gene	ARX	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Partington syndrome, MIM# 309510;Dystonia				11889467;15200506		False	3	100;0;0	21.664	True	Other	ENSG00000004848	ENSG00000004848	HGNC:18060													
ARX	gene	ARX	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Epileptic encephalopathy, early infantile, 1 MIM#308350;Hydranencephaly with abnormal genitalia MIM#300215;Lissencephaly, X-linked 2 MIM#300215;Mental retardation, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510;Proud syndrome MIM#300004				14722918;19738637;32519823;28150386;21496008		False	3	100;0;0	21.664	True		ENSG00000004848	ENSG00000004848	HGNC:18060													
ASAH1	gene	ASAH1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinal muscular atrophy with progressive myoclonic epilepsy;dHMN/dSMA						False	3	100;0;0	21.664	False		ENSG00000104763	ENSG00000104763	HGNC:735													
ASAH1	gene	ASAH1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Farber lipogranulomatosis, MIM# 228000						False	3	100;0;0	21.664	True		ENSG00000104763	ENSG00000104763	HGNC:735													
ASAH1	gene	ASAH1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinal muscular atrophy with progressive myoclonic epilepsy, 159950				8955159;22703880;27026573		False	3	100;0;0	21.664	True		ENSG00000104763	ENSG00000104763	HGNC:735													
ASCC1	gene	ASCC1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinal muscular atrophy with congenital bone fractures 2				26924529		False	3	100;0;0	21.664	True		ENSG00000138303	ENSG00000138303	HGNC:24268													
ASCC1	gene	ASCC1	Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	spinal muscular atrophy with congenital bone fractures 2 (MONDO:0014807;MIM#616867)				26924529;28218388		False	3	100;0;0	21.664	True		ENSG00000138303	ENSG00000138303	HGNC:24268													
ASH1L	gene	ASH1L	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 52, MIM#617796				34373061;25961944;34782621;32469098		False	3	100;0;0	21.664	True		ENSG00000116539	ENSG00000116539	HGNC:19088													
ASL	gene	ASL	Expert Review Green;NHS GMS;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Argininosuccinic aciduria MIM#207900;Urea cycle disorders and inherited hyperammonaemias;disorder of amino acid metabolism				2263616;12384776		False	3	100;0;0	21.664	True		ENSG00000126522	ENSG00000126522	HGNC:746													
ASNS	gene	ASNS	Expert Review Green;Expert Review Green;Literature;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Asparagine synthetase deficiency, MIM#615574;microcephaly;cerebral atrophy;drug-resistant epilepsy;axial hypotonia;progressive appendicular spasticity;abnormal myelination				24139043;25227173;29279279;27469131;28776279;29375865;26318253		False	3	100;0;0	21.664	True	Other	ENSG00000070669	ENSG00000070669	HGNC:753													
ASPA	gene	ASPA	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Canavan disease MIM#271900;disorder of amino acid metabolism				8252036;8023850		False	3	100;0;0	21.664	True		ENSG00000108381	ENSG00000108381	HGNC:756													
ASPA	gene	ASPA	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Canavan disease MIM#271900;disorder of amino acid metabolism				8252036;8023850		False	3	100;0;0	21.664	True		ENSG00000108381	ENSG00000108381	HGNC:756													
ASPA	gene	ASPA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Canavan disease, MIM#	271900"						False	3	100;0;0	21.664	True		ENSG00000108381	ENSG00000108381	HGNC:756													
ASPM	gene	ASPM	Expert Review Green;ClinGen;Literature;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Primary autosomal recessive Microcephaly 5 - OMIM #608716				(PMID:32239881;19770472;18452193;16141009)		False	3	100;0;0	21.664	True		ENSG00000066279	ENSG00000066279	HGNC:19048													
ASS1	gene	ASS1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Citrullinemia MIM#215700;Urea cycle disorders and inherited hyperammonaemias;disorder of amino acid metabolism				19006241		False	3	100;0;0	21.664	True		ENSG00000130707	ENSG00000130707	HGNC:758													
ASTN1	gene	ASTN1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;epilepsy;structural brain malformations				29706646;27431290;26539891		False	3	100;0;0	21.664	True		ENSG00000152092	ENSG00000152092	HGNC:773													
ASXL3	gene	ASXL3	Expert Review Green;Literature;ClinGen;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bainbridge-Ropers syndrome, OMIM:615115				PMID:33151654;34436830;29367179		False	3	100;0;0	21.664	True		ENSG00000141431	ENSG00000141431	HGNC:29357													
ATAD1	gene	ATAD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperekplexia 4, MIM#618011				28180185;29390050;29659736		False	3	100;0;0	21.664	True		ENSG00000138138	ENSG00000138138	HGNC:25903													
ATAD3A	gene	ATAD3A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Harel-Yoon syndrome, MIM# 617183				28158749;27640307		False	3	100;0;0	21.664	True		ENSG00000197785	ENSG00000197785	HGNC:25567													
ATAD3A	gene	ATAD3A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Harel-Yoon syndrome, MIM# 617183;Pontocerebellar hypoplasia, hypotonia, and respiratory insufficiency syndrome, neonatal lethal (PHRINL SYNDROME), MIM# 618810				27640307;32004445;28549128		False	3	100;0;0	21.664	True	Other	ENSG00000197785	ENSG00000197785	HGNC:25567													
ATAD3A	gene	ATAD3A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Global developmental delay, optic atrophy, axonal neuropathy, hypertrophic cardiomyopathy						False	3	100;0;0	21.664	False		ENSG00000197785	ENSG00000197785	HGNC:25567													
ATCAY	gene	ATCAY	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, cerebellar, Cayman type, MIM# 601238;MONDO:0011025				14556008;29449188;23226316;26343454		False	3	50;50;0	21.664	True		ENSG00000167654	ENSG00000167654	HGNC:779													
ATG12	gene	ATG12	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	ATG12-related neurodevelopmental disorder, MONDO:0700092				41895291		False	3	100;0;0	21.664	True		ENSG00000145782	ENSG00000145782	HGNC:588													
ATG7	gene	ATG7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, SCAR31, MIM#619422				34161705		False	3	100;0;0	21.664	True		ENSG00000197548	ENSG00000197548	HGNC:16935													
ATIC	gene	ATIC	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	AICA-ribosiduria due to ATIC deficiency MIM#608688;disorders of purine metabolism				15114530;32557644		False	3	100;0;0	21.664	True		ENSG00000138363	ENSG00000138363	HGNC:794													
ATL1	gene	ATL1	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	HSN1D;Neuropathy, hereditary sensory, type ID, 613708;Hereditary spastic paraplegia, 182600;Hereditary sensory neuropathy				21194679;22340599		False	3	0;0;0	21.664	False		ENSG00000198513	ENSG00000198513	HGNC:11231													
ATL1	gene	ATL1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hereditary sensory neuropathy type ID, MIM 613708;Spastic paraplegia 3A, MIM 182600;Hereditary spastic paraplegia, AR				16401858;16537571;17657515;28396731;24473461;26888483		False	3	100;0;0	21.664	True		ENSG00000198513	ENSG00000198513	HGNC:11231													
ATL1	gene	ATL1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 3A, autosomal dominant MIM#182600				16765570		False	3	100;0;0	21.664	False		ENSG00000198513	ENSG00000198513	HGNC:11231													
ATL1	gene	ATL1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	HSAN/SFN;Neuropathy, hereditary sensory, type ID , MIM#613708;MONDO:0013381				21194679;24604904;22340599		False	3	100;0;0	21.664	False		ENSG00000198513	ENSG00000198513	HGNC:11231													
ATL3	gene	ATL3	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary sensory neuropathy type IF;HSAN/SFN				24459106;30666337;30339187;24736309		False	3	100;0;0	21.664	False		ENSG00000184743	ENSG00000184743	HGNC:24526													
ATL3	gene	ATL3	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neuropathy, hereditary sensory, type IF, 615632;HSN1F				24459106;24736309		False	3	0;0;0	21.664	False		ENSG00000184743	ENSG00000184743	HGNC:24526													
ATM	gene	ATM	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia telangiectasia;Dystonia						False	3	100;0;0	21.664	False		ENSG00000149311	ENSG00000149311	HGNC:795													
ATM	gene	ATM	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-telangiectasia MIM#208900						False	3	100;0;0	21.664	True		ENSG00000149311	ENSG00000149311	HGNC:795													
ATN1	gene	ATN1	Expert Review Green;Expert list;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital hypotonia, epilepsy, developmental delay, and digital anomalies, MIM#618494				30827498		False	3	100;0;0	21.664	True		ENSG00000111676	ENSG00000111676	HGNC:3033													
ATP11A	gene	ATP11A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, hypomyelinating, 24 , MIM# 619851				34403372;39432785		False	3	33;67;0	21.664	True	Other	ENSG00000068650	ENSG00000068650	HGNC:13552													
ATP11A	gene	ATP11A	Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Focal epilepsy MONDO:0005384, ATP11A;Leukodystrophy, hypomyelinating, 24 MIM#619851				34403372;39432785;40185629		False	3	50;50;0	21.664	True		ENSG00000068650	ENSG00000068650	HGNC:13552													
ATP13A2	gene	ATP13A2	Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 78, autosomal recessive, 617225;Kufor-Rakeb syndrome, 606693 AR;complicated hereditary spastic paraplegia;Adult-onset lower-limb predominant spastic paraparesis				27217339;28137957		False	3	100;0;0	21.664	False		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome MIM#606693				21094623;20853184;20310007		False	3	100;0;0	21.664	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome MIM#606693				30868101;21362476;31588715;22388936		False	3	100;0;0	21.664	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome, MIM# 606693						False	3	100;0;0	21.664	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 78, autosomal recessive 617225				28137957;31996848		False	3	100;0;0	21.664	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	parkinsonism due to ATP13A2 deficiency MONDO:0017809				25900096;20301402		False	3	100;0;0	21.664	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome MIM#606693				21362476;21696388;31588715;32559632;33033738;33091395;34405108		False	3	100;0;0	21.664	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome (OMIM 606693)				22743658;23447832;29325618;20310007		False	3	100;0;0	21.664	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome MONDO:0011706				40028680;30992063		False	3	100;0;0	21.664	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP1A1	gene	ATP1A1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;seizures;hypomagnesaemia				30388404		False	3	100;0;0	21.664	True		ENSG00000163399	ENSG00000163399	HGNC:799													
ATP1A1	gene	ATP1A1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, axonal, type 2DD,MIM# 618036;MONDO:0054833				29499166		False	3	100;0;0	21.664	False		ENSG00000163399	ENSG00000163399	HGNC:799													
ATP1A2	gene	ATP1A2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fetal akinesia, respiratory insufficiency, microcephaly, polymicrogyria, and dysmorphic facies, MIM# 619602				30690204		False	3	100;0;0	21.664	True		ENSG00000018625	ENSG00000018625	HGNC:800													
ATP1A2	gene	ATP1A2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 98, MIM# 619605				33880529		False	3	100;0;0	21.664	True		ENSG00000018625	ENSG00000018625	HGNC:800													
ATP1A2	gene	ATP1A2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alternating hemiplegia of childhood 1, MIM# 104290				15174025;15286158;33126486;31766058;24097848		False	3	100;0;0	21.664	True		ENSG00000018625	ENSG00000018625	HGNC:800													
ATP1A3	gene	ATP1A3	Expert list;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002				15260953, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	21.664	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP1A3	gene	ATP1A3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder MONDO:0700002				20301294;17282997;15260953;17595045;17516473;22534615		False	3	100;0;0	21.664	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP1A3	gene	ATP1A3	Expert Review Green;Expert list;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002				15260953;17282997;19351654, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	21.664	False		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP1A3	gene	ATP1A3	Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002				15260953, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	21.664	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP1A3	gene	ATP1A3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002				33880529, 15260953, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	21.664	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP2A1	gene	ATP2A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brody myopathy, MIM# 601003				32040565		False	3	50;50;0	21.664	True		ENSG00000196296	ENSG00000196296	HGNC:811													
ATP2B1	gene	ATP2B1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 66, MIM# 619910				PMID: 35358416		False	3	100;0;0	21.664	True		ENSG00000070961	ENSG00000070961	HGNC:814													
ATP2B2	gene	ATP2B2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related				PMID: 37675773		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000157087	ENSG00000157087	HGNC:815													
ATP2B2	gene	ATP2B2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related				PMID: 37675773		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000157087	ENSG00000157087	HGNC:815													
ATP2B2	gene	ATP2B2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related				PMID: 37675773		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000157087	ENSG00000157087	HGNC:815													
ATP2B3	gene	ATP2B3	Expert Review Green;Expert list;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Spinocerebellar ataxia, X-linked 1				37821930;36207321;31680123;28807751;28720891;27653636;25953895		False	3	50;50;0	21.664	True		ENSG00000067842	ENSG00000067842	HGNC:816													
ATP5F1A	gene	ATP5F1A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD				34483339;34954817;40859057		False	3	100;0;0	21.664	True		ENSG00000152234	ENSG00000152234	HGNC:823													
ATP5F1A	gene	ATP5F1A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358);Combined oxidative phosphorylation deficiency 22 616045;Mitochondrial complex V (ATP synthase) deficiency nuclear type 4, 615228;Mitochondrial disorder, autosomal dominant				23599390;23596069;34483339;34954817;40672495		False	3	33;33;33	21.664	True		ENSG00000152234	ENSG00000152234	HGNC:823													
ATP5F1D	gene	ATP5F1D	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, MIM# 618120				29478781		False	3	100;0;0	21.664	True		ENSG00000099624	ENSG00000099624	HGNC:837													
ATP5F1E	gene	ATP5F1E	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 3 MIM#614053				20566710;27626380;20026007;34954817		False	3	50;50;0	21.664	True		ENSG00000124172	ENSG00000124172	HGNC:838													
ATP5MC3	gene	ATP5MC3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Dystonia, early-onset, and/or spastic paraplegia, MIM#	619681"				34636445;34954817		False	3	100;0;0	21.664	True		ENSG00000154518	ENSG00000154518	HGNC:843													
ATP5MC3	gene	ATP5MC3	Expert Review Green;Literature;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia, early-onset, and/or spastic paraplegia, MIM#619681				34636445;34954817		False	3	100;0;0	21.664	True		ENSG00000154518	ENSG00000154518	HGNC:843													
ATP5MC3	gene	ATP5MC3	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia, early-onset, and/or spastic paraplegia, MIM#619681				34636445;34954817		False	3	100;0;0	21.664	True		ENSG00000154518	ENSG00000154518	HGNC:843													
ATP5PO	gene	ATP5PO	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 7, MIM# 620359				34954817;35621276		False	3	100;0;0	21.664	True		ENSG00000241837	ENSG00000241837	HGNC:850													
ATP5PO	gene	ATP5PO	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 7, MIM# 620359				35621276;34954817		False	3	100;0;0	21.664	True		ENSG00000241837	ENSG00000241837	HGNC:850													
ATP6AP1	gene	ATP6AP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"immunodeficiency-47 (MIM# 	300972)"				PMID: 27231034		False	3	100;0;0	21.664	True		ENSG00000071553	ENSG00000071553	HGNC:868													
ATP6AP2	gene	ATP6AP2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Parkinsonism with spasticity, X-linked, MIM#	300911"				30985297;23595882		False	3	100;0;0	21.664	True		ENSG00000182220	ENSG00000182220	HGNC:18305													
ATP6AP2	gene	ATP6AP2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Congenital disorder of glycosylation, type IIr, MIM# 301045				29127204;29388887		False	3	100;0;0	21.664	True		ENSG00000182220	ENSG00000182220	HGNC:18305													
ATP6AP2	gene	ATP6AP2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked, syndromic, Hedera type MIM#300423				23595882		False	3	100;0;0	21.664	True	Other	ENSG00000182220	ENSG00000182220	HGNC:18305													
ATP6V0A1	gene	ATP6V0A1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971				PMID:34909687		False	3	50;50;0	21.664	True		ENSG00000033627	ENSG00000033627	HGNC:865													
ATP6V0A1	gene	ATP6V0A1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971				PMID:34909687		False	3	50;50;0	21.664	True		ENSG00000033627	ENSG00000033627	HGNC:865													
ATP6V0A2	gene	ATP6V0A2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cutis laxa, autosomal recessive, type IIA, MIM# 219200;Wrinkly skin syndrome, MIM#278250				29952037;22773132		False	3	100;0;0	21.664	True		ENSG00000185344	ENSG00000185344	HGNC:18481													
ATP6V0A2	gene	ATP6V0A2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cutis laxa, type IIA,219200				18157129;22773132		False	3	100;0;0	21.664	True		ENSG00000185344	ENSG00000185344	HGNC:18481													
ATP6V0C	gene	ATP6V0C	Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, early-onset, with or without developmental delay, MIM#620465;Epilepsy;Intellectual Disability;microcephaly				33190975;33090716		False	3	50;50;0	21.664	True		ENSG00000185883	ENSG00000185883	HGNC:855													
ATP6V1A	gene	ATP6V1A	Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epileptic encephalopathy, infantile or early childhood, 618012;Cutis laxa, type IID, 617403				29668857;28065471		False	3	100;0;0	21.664	True		ENSG00000114573	ENSG00000114573	HGNC:851													
ATP6V1B2	gene	ATP6V1B2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy;Intellectual Disability;microcephaly, DOORS syndrome				31655144;32934366;32597767		False	3	100;0;0	21.664	True		ENSG00000147416	ENSG00000147416	HGNC:854													
ATP7A	gene	ATP7A	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Menkes disease MIM#309400;Occipital horn syndrome MIM#304150;disorder of copper matabolism				7842019;8981948		False	3	100;0;0	21.664	True		ENSG00000165240	ENSG00000165240	HGNC:869													
ATP7A	gene	ATP7A	Royal Melbourne Hospital;NHS GMS;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;NHS GMS;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Spinal muscular atrophy, distal, X-linked 3, MIM# 300489;dHMN/dSMA				20170900;33137485;31969342;31558336		False	3	100;0;0	21.664	False		ENSG00000165240	ENSG00000165240	HGNC:869													
ATP7A	gene	ATP7A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Menkes disease, 309400				26937406;21924848;29789304		False	3	100;0;0	21.664	True		ENSG00000165240	ENSG00000165240	HGNC:869													
ATP7A	gene	ATP7A	Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Menkes disease MIM#309400						False	3	100;0;0	21.664	True		ENSG00000165240	ENSG00000165240	HGNC:869													
ATP7A	gene	ATP7A	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Disorders of copper metabolism;Menkes disease MONDO:0010651, occipital Horn Syndrome (OHS, OMIM #304150), X-linked distal spinal muscular atrophy-3 (SMAX3, OMIM #300489)				20170900, 33137485,  31969342, 31558336		False	3	0;0;0	21.664	False		ENSG00000165240	ENSG00000165240	HGNC:869													
ATP7B	gene	ATP7B	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease MIM#277900				17435591		False	3	50;50;0	21.664	True		ENSG00000123191	ENSG00000123191	HGNC:870													
ATP7B	gene	ATP7B	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease, MIM# 277900						False	3	100;0;0	21.664	True		ENSG00000123191	ENSG00000123191	HGNC:870													
ATP7B	gene	ATP7B	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	277900 WILSON DISEASE				24002824;18210110;27982432;28433102;24266916		False	3	0;0;0	21.664	False		ENSG00000123191	ENSG00000123191	HGNC:870													
ATP7B	gene	ATP7B	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease, MIM# 277900;Dystonia				32662046		False	3	100;0;0	21.664	True		ENSG00000123191	ENSG00000123191	HGNC:870													
ATP8A2	gene	ATP8A2	Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268				22892528;31612321		False	3	100;0;0	21.664	True		ENSG00000132932	ENSG00000132932	HGNC:13533													
ATP8B1	gene	ATP8B1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cholestasis, progressive familial intrahepatic 1 MIM#211600;disorder of bile acid metabolism				9500542		False	3	100;0;0	21.664	True		ENSG00000081923	ENSG00000081923	HGNC:3706													
ATP9A	gene	ATP9A	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with poor growth and behavioural abnormalities, MIM# 620242				34379057;34764295;36604604;40226306		False	3	100;0;0	21.664	True		ENSG00000054793	ENSG00000054793	HGNC:13540													
ATRX	gene	ATRX	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	ATR-X-related syndrome MONDO:0016980						False	3	100;0;0	21.664	True		ENSG00000085224	ENSG00000085224	HGNC:886													
AUH	gene	AUH	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-Methylglutaconic aciduria type 1;Dystonia						False	3	100;0;0	21.664	True		ENSG00000148090	ENSG00000148090	HGNC:890													
AUH	gene	AUH	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type I, MIM# 250950						False	3	100;0;0	21.664	True		ENSG00000148090	ENSG00000148090	HGNC:890													
B3GALNT2	gene	B3GALNT2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181;MONDO:0014071				23453667;33290285;29791932;29273094;28688748;28303321		False	3	100;0;0	21.664	True		ENSG00000162885	ENSG00000162885	HGNC:28596													
B3GALNT2	gene	B3GALNT2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 11 MIM#615181				PMID: 29791932, PMID: 29273094, PMID: 35127920		False	3	100;0;0	21.664	True		ENSG00000162885	ENSG00000162885	HGNC:28596													
B3GALT6	gene	B3GALT6	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Al-Gazali syndrome, MIM# 609465;Ehlers-Danlos syndrome, spondylodysplastic type, 2, MIM# 615349, MONDO:0014139;Spondyloepimetaphyseal dysplasia with joint laxity, type 1, with or without fractures, MIM# 271640, MONDO:0010075				25149931;29443383;23664117;29931299;23664117;23664118;31614862		False	3	100;0;0	21.664	True		ENSG00000176022	ENSG00000176022	HGNC:17978													
B3GAT3	gene	B3GAT3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects, MIM# 245600				26754439;31988067;26086840;25893793;21763480;24668659		False	3	100;0;0	21.664	True		ENSG00000149541	ENSG00000149541	HGNC:923													
B3GLCT	gene	B3GLCT	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peters-plus syndrome (MIM# 261540)				18199743;16909395		False	3	100;0;0	21.664	True		ENSG00000187676	ENSG00000187676	HGNC:20207													
B4GALNT1	gene	B4GALNT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 26, autosomal recessive (MIM #609195)				23746551;24103911		False	3	100;0;0	21.664	True		ENSG00000135454	ENSG00000135454	HGNC:4117													
B4GALNT1	gene	B4GALNT1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 26, autosomal recessive MIM#609195						False	3	100;0;0	21.664	True		ENSG00000135454	ENSG00000135454	HGNC:4117													
B4GALT1	gene	B4GALT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	100;0;0	21.664	True		ENSG00000086062	ENSG00000086062	HGNC:924													
B4GALT7	gene	B4GALT7	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ehlers-Danlos syndrome, spondylodysplastic type, 1, 130070				23956117;24755949;31278392;31614862;31862401		False	3	100;0;0	21.664	True		ENSG00000027847	ENSG00000027847	HGNC:930													
BAAT	gene	BAAT	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bile acid conjugation defect 1, MIM# 619232;Hypercholanemia, familial MIM#607748;disorder of bile acid metabolism				12704386;23415802		False	3	100;0;0	21.664	True		ENSG00000136881	ENSG00000136881	HGNC:932													
BAG3	gene	BAG3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myopathy, myofibrillar, 6 612954				PMID: 25208129;22734908;30061062		False	3	100;0;0	21.664	True		ENSG00000151929	ENSG00000151929	HGNC:939													
BAIAP2	gene	BAIAP2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 120, MIM# 621468				41133935;38149472		False	3	100;0;0	21.664	True		ENSG00000175866	ENSG00000175866	HGNC:947													
BAP1	gene	BAP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Kury-Isidor syndrome	, MIM#619762"				PMID: 35051358		False	3	100;0;0	21.664	True		ENSG00000163930	ENSG00000163930	HGNC:950													
BBS1	gene	BBS1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 1, 209900				15637713		False	3	100;0;0	21.664	True		ENSG00000174483	ENSG00000174483	HGNC:966													
BCAP31	gene	BCAP31	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Deafness, dystonia and cerebellar hypomyelination, MIM#300475				24011989;28332767;30713915;31330203;32652807		False	3	100;0;0	21.664	True		ENSG00000185825	ENSG00000185825	HGNC:16695													
BCAP31	gene	BCAP31	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Deafness, dystonia, and cerebral hypomyelination, 300475						False	3	100;0;0	21.664	False		ENSG00000185825	ENSG00000185825	HGNC:16695													
BCAS3	gene	BCAS3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hengel-Maroofian-Schols syndrome, MIM# 619641				34022130		False	3	100;0;0	21.664	True		ENSG00000141376	ENSG00000141376	HGNC:14347													
BCAS3	gene	BCAS3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hengel-Maroofian-Schols syndrome, MIM# 619641				34022130		False	3	100;0;0	21.664	True		ENSG00000141376	ENSG00000141376	HGNC:14347													
BCAS3	gene	BCAS3	Expert Review Green;Literature;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hengel-Maroofian-Schols syndrome, MIM# 619641				34981858		False	3	100;0;0	21.664	True		ENSG00000141376	ENSG00000141376	HGNC:14347													
BCKDHA	gene	BCKDHA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Maple syrup urine disease, type Ia, MIM# 248600				34883003;34556729;34288399		False	3	100;0;0	21.664	True		ENSG00000248098	ENSG00000248098	HGNC:986													
BCKDHB	gene	BCKDHB	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Episodic ataxia during metabolic crises;paroxysmal nonkinesigenic dyskinesia				PMID 32151765		False	3	0;0;0	21.664	True		ENSG00000083123	ENSG00000083123	HGNC:987													
BCKDHB	gene	BCKDHB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Maple syrup urine disease, type Ib, MIM# 248600				34883003;34556729;34288399		False	3	100;0;0	21.664	True		ENSG00000083123	ENSG00000083123	HGNC:987													
BCKDHB	gene	BCKDHB	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Maple Syrup Urine Disease, Metabolic encephalopathy, elevated branched chain amino acids in urine, acute axonal neuropathy						False	3	100;0;0	21.664	True		ENSG00000083123	ENSG00000083123	HGNC:987													
BCKDK	gene	BCKDK	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Branched-chain keto acid dehydrogenase kinase deficiency	MIM#614923"				PMID: 22956686, PMID: 35216372, PMID: 36729635		False	3	100;0;0	21.664	True		ENSG00000103507	ENSG00000103507	HGNC:16902													
BCS1L	gene	BCS1L	Expert Review Green;Literature;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bjornstad syndrome, MIM# 262000;Leigh syndrome, MIM# 256000;BCS1L-related mitochondrial disease				24172246;17314340;9545407		False	3	100;0;0	21.664	True		ENSG00000074582	ENSG00000074582	HGNC:1020													
BCS1L	gene	BCS1L	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III disorders;Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000074582	ENSG00000074582	HGNC:1020													
BCS1L	gene	BCS1L	Expert Review Green;Literature;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bjornstad syndrome, MIM# 262000;Leigh syndrome, MIM# 256000;BCS1L-related mitochondrial disease				26563427;24172246;17314340;9545407		False	3	100;0;0	21.664	True		ENSG00000074582	ENSG00000074582	HGNC:1020													
BICD2	gene	BICD2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM# 615290;MONDO:0014121;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, MIM# 618291;dHMN/dSMA				23664116;23664119;23664120;27751653;28635954;30054298;29528393		False	3	100;0;0	21.664	False		ENSG00000185963	ENSG00000185963	HGNC:17208													
BICD2	gene	BICD2	Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	distal myopathy MONDO:0018949				27784775;28635954;31561939;29306765		False	3	100;0;0	21.664	True		ENSG00000185963	ENSG00000185963	HGNC:17208													
BLOC1S1	gene	BLOC1S1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), BLOC1S1-related				33875846;https://www.medrxiv.org/content/10.1101/2025.07.17.25331211v1		False	3	100;0;0	21.664	True		ENSG00000135441	ENSG00000135441	HGNC:4200													
BLOC1S1	gene	BLOC1S1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), BLOC1S1-related				https://www.medrxiv.org/content/10.1101/2025.07.17.25331211v1		False	3	100;0;0	21.664	True		ENSG00000135441	ENSG00000135441	HGNC:4200													
BLTP1	gene	BLTP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	lkuraya-Kucinskas syndrome, MIM# 617822				29290337;30906834		False	3	100;0;0	21.664	True		ENSG00000138688	ENSG00000138688	HGNC:26953													
BOLA3	gene	BOLA3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia, MIM# 614299				30302924;29654549;30302924		False	3	100;0;0	21.664	True		ENSG00000163170	ENSG00000163170	HGNC:24415													
BOLA3	gene	BOLA3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia, MIM# 614299				30302924;29654549;30302924		False	3	100;0;0	21.664	True		ENSG00000163170	ENSG00000163170	HGNC:24415													
BOLA3	gene	BOLA3	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia, MIM#614299				30302924;29654549;30302924		False	3	100;0;0	21.664	True		ENSG00000163170	ENSG00000163170	HGNC:24415													
BORCS5	gene	BORCS5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysosomal storage disease, MONDO:0002561, BORCS5-related				40385417		False	3	100;0;0	21.664	True		ENSG00000165714	ENSG00000165714	HGNC:17950													
BORCS5	gene	BORCS5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysosomal storage disease, MONDO:0002561, BORCS5-related				40385417		False	3	100;0;0	21.664	True		ENSG00000165714	ENSG00000165714	HGNC:17950													
BORCS8	gene	BORCS8	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987				38128568		False	3	100;0;0	21.664	True		ENSG00000254901	ENSG00000254901	HGNC:37247													
BPTF	gene	BPTF	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dysmorphic facies and distal limb anomalies AD, MIM#617755				33522091;28942966		False	3	100;0;0	21.664	True		ENSG00000171634	ENSG00000171634	HGNC:3581													
BRAF	gene	BRAF	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiofaciocutaneous syndrome, MIM# 115150				34309696		False	3	100;0;0	21.664	True		ENSG00000157764	ENSG00000157764	HGNC:1097													
BRAT1	gene	BRAT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056				26483087;26494257;27282546		False	3	100;0;0	21.664	True		ENSG00000106009	ENSG00000106009	HGNC:21701													
BRAT1	gene	BRAT1	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056				26483087;26494257;27282546		False	3	100;0;0	21.664	True		ENSG00000106009	ENSG00000106009	HGNC:21701													
BRSK1	gene	BRSK1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, BRSK1-related				41035394		False	3	100;0;0	21.664	True		ENSG00000160469	ENSG00000160469	HGNC:18994													
BSCL2	gene	BSCL2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Silver spastic paraplegia syndrome MIM#270685;Encephalopathy, progressive, with or without lipodystrophy	MIM#615924"						False	3	100;0;0	21.664	True		ENSG00000168000	ENSG00000168000	HGNC:15832													
BSCL2	gene	BSCL2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Silver spastic paraplegia syndrome MIM#270685;Neuropathy, distal hereditary motor, type VA MIM#600794				16765570		False	3	100;0;0	21.664	False		ENSG00000168000	ENSG00000168000	HGNC:15832													
BSCL2	gene	BSCL2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Encephalopathy, progressive, with or without lipodystrophy, MIM#615924;Developmental and epileptic encephalopathy, BSCL2-related, dominant, MONDO:0100062				11479539;15181077;15126564;23564749;31369919;35290466		False	3	100;0;0	21.664	True		ENSG00000168000	ENSG00000168000	HGNC:15832													
BSCL2	gene	BSCL2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neuropathy, distal hereditary motor, type VC, MIM# 619112				14981520;15732094		False	3	100;0;0	21.664	False		ENSG00000168000	ENSG00000168000	HGNC:15832													
BSN	gene	BSN	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), BSN-related						False	3	100;0;0	21.664	True		ENSG00000164061	ENSG00000164061	HGNC:1117													
BTD	gene	BTD	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Biotinidase deficiency MIM#253260;disorder of biotin metabolism				7550325		False	3	100;0;0	21.664	True		ENSG00000169814	ENSG00000169814	HGNC:1122													
BTD	gene	BTD	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Biotinidase deficiency, MIM 253260				10801053;12359137;7550325		False	3	100;0;0	21.664	True		ENSG00000169814	ENSG00000169814	HGNC:1122													
C12orf57	gene	C12orf57	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Temtamy syndrome MIM#218340				29383837;31853307		False	3	100;0;0	21.664	True		ENSG00000111678	ENSG00000111678	HGNC:29521													
C19orf12	gene	C19orf12	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 4, MIM# 614298				23278385;21981780;23269600		False	3	100;0;0	21.664	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
C19orf12	gene	C19orf12	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 4, 614298;Spastic paraplegia 43, autosomal recessive, 615043				33688131;21981780;22508347;23269600;31804703;30088953;20039086		False	3	100;0;0	21.664	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
C19orf12	gene	C19orf12	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodegeneration with brain iron accumulation 4 MONDO:0013674				21981780;23278385;23447832		False	3	100;0;0	21.664	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
C19orf12	gene	C19orf12	Expert Review Green;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial membrane protein-associated neurodegeneration (MPAN);Neurodegeneration with brain iron accumulation 4, MIM# 614298;Spastic paraplegia 43, autosomal recessive, MIM# 615043				33688131;21981780;22508347;23269600;31804703;30088953;20039086		False	3	100;0;0	21.664	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
C19orf12	gene	C19orf12	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	neurodegeneration with brain iron accumulation 4 MONDO:0013674				21981780;22508347		False	3	100;0;0	21.664	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
C19orf12	gene	C19orf12	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset spastic paraplegia and sensory-motor axonal neuropathy, NBIA with optic atrophy, extrapyramidal signs						False	3	100;0;0	21.664	False		ENSG00000131943	ENSG00000131943	HGNC:25443													
C1QA	gene	C1QA	Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Immunology Flagship;Melbourne Genomics Health Alliance Immunology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	C1q deficiency, MIM# 613652				9225968;21654842;9590289		False	3	100;0;0	21.664	True		ENSG00000173372	ENSG00000173372	HGNC:1241													
C1QBP	gene	C1QBP	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 33, MIM# 617713				28942965		False	3	100;0;0	21.664	True		ENSG00000108561	ENSG00000108561	HGNC:1243													
C1QBP	gene	C1QBP	Expert Review Green;Literature;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive external opthalmoplegia;mitochondrial myopathy				32652806;28942965		False	3	100;0;0	21.664	True		ENSG00000108561	ENSG00000108561	HGNC:1243													
C1R	gene	C1R	Literature;Other;Expert Review Green;Other;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ehlers-Danlos syndrome, periodontal type, 1 (MIM# 130080);Leukodystrophy - adult onset				8958339;30535813		False	3	50;50;0	21.664	False	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000159403	ENSG00000159403	HGNC:1246													
C2orf69	gene	C2orf69	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423				34038740;33945503		False	3	100;0;0	21.664	True		ENSG00000178074	ENSG00000178074	HGNC:26799													
C2orf69	gene	C2orf69	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423				34038740;33945503		False	3	100;0;0	21.664	True		ENSG00000178074	ENSG00000178074	HGNC:26799													
C2orf69	gene	C2orf69	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423				34038740;33945503		False	3	100;0;0	21.664	True		ENSG00000178074	ENSG00000178074	HGNC:26799													
CA2	gene	CA2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Osteopetrosis, autosomal recessive 3, with renal tubular acidosis, MIM# 259730				25674028		False	3	100;0;0	21.664	True		ENSG00000104267	ENSG00000104267	HGNC:1373													
CA5A	gene	CA5A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hyperammonemia due to carbonic anhydrase VA deficiency, MIM#	615751"						False	3	100;0;0	21.664	True		ENSG00000174990	ENSG00000174990	HGNC:1377													
CA8	gene	CA8	Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3;Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3, 613227				21937992;19461874		False	3	100;0;0	21.664	True		ENSG00000178538	ENSG00000178538	HGNC:1382													
CACNA1A	gene	CACNA1A	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 42, MIM# 617106;Episodic ataxia, type 2 MIM#108500				34267336;27476654		False	3	67;33;0	21.664	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1A	gene	CACNA1A	Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 2 MIM#108500						False	3	100;0;0	21.664	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1A	gene	CACNA1A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 2 MIM#108500;Spinocerebellar ataxia 6 MIM#183086				25468264;23441182;19232643;18758887;11344116		False	3	100;0;0	21.664	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1A	gene	CACNA1A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 2 MIM#108500						False	3	50;50;0	21.664	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1B	gene	CACNA1B	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements, MIM#	618497"				30982612		False	3	100;0;0	21.664	True		ENSG00000148408	ENSG00000148408	HGNC:1389													
CACNA1C	gene	CACNA1C	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Neurodevelopmental disorder with hypotonia, language delay, and skeletal defects with or without seizures, MIM#	620029"				34163037		False	3	100;0;0	21.664	True		ENSG00000151067	ENSG00000151067	HGNC:1390													
CACNA1D	gene	CACNA1D	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Primary aldosteronism, seizures, and neurologic abnormalities MIM#615474				25620733;28472301;31139143		False	3	100;0;0	21.664	True		ENSG00000157388	ENSG00000157388	HGNC:1391													
CACNA1E	gene	CACNA1E	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 69, MIM#618285				30343943		False	3	100;0;0	21.664	True		ENSG00000198216	ENSG00000198216	HGNC:1392													
CACNA1G	gene	CACNA1G	Expert Review Green;Expert list;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits MIM#618087						False	3	100;0;0	21.664	True		ENSG00000006283	ENSG00000006283	HGNC:1394													
CACNA1G	gene	CACNA1G	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM#	618087"				29878067		False	3	100;0;0	21.664	True		ENSG00000006283	ENSG00000006283	HGNC:1394													
CACNA1G	gene	CACNA1G	Expert Review Green;Expert list;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM#618087				29878067		False	3	100;0;0	21.664	True		ENSG00000006283	ENSG00000006283	HGNC:1394													
CACNA1I	gene	CACNA1I	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with variable intellectual disability and speech impairment, with or without seizures (NEDISS), MIM#620114				33704440		False	3	100;0;0	21.664	True	Other	ENSG00000100346	ENSG00000100346	HGNC:1396													
CACNA1S	gene	CACNA1S	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	{Malignant hyperthermia susceptibility 5}, 601887				20301325;28011884		False	3	100;0;0	21.664	True	Other	ENSG00000081248	ENSG00000081248	HGNC:1397													
CACNA2D2	gene	CACNA2D2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar atrophy with seizures and variable developmental delay MIM#618501				23339110;24358150;30410802;29997391;31402629		False	3	100;0;0	21.664	True		ENSG00000007402	ENSG00000007402	HGNC:1400													
CACNA2D2	gene	CACNA2D2	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar atrophy with seizures and variable developmental delay MIM#618501				23339110;24358150;30410802;29997391;31402629;11487633;11756448;4177347;14660671;15331424		False	3	100;0;0	21.664	True		ENSG00000007402	ENSG00000007402	HGNC:1400													
CAD	gene	CAD	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 50, MIM#	616457"				28007989;25678555		False	3	100;0;0	21.664	True		ENSG00000084774	ENSG00000084774	HGNC:1424													
CAD	gene	CAD	Expert Review Green;Literature;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 50;OMIM # 616457				PMID: 32820246		False	3	100;0;0	21.664	True		ENSG00000084774	ENSG00000084774	HGNC:1424													
CADM3	gene	CADM3	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519				33889941;38074074		False	3	33;67;0	21.664	False		ENSG00000162706	ENSG00000162706	HGNC:17601													
CAMK2A	gene	CAMK2A	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	?Mental retardation, autosomal recessive 63 MIM#618095;Mental retardation, autosomal dominant 53 MIM#617798				PMID: 32600977;29784083;29560374		False	3	100;0;0	21.664	True	Other	ENSG00000070808	ENSG00000070808	HGNC:1460													
CAMK2B	gene	CAMK2B	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 54, MIM# 617799				29100089;29560374;32875707		False	3	100;0;0	21.664	True		ENSG00000058404	ENSG00000058404	HGNC:1461													
CAMK4	gene	CAMK4	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Autism;Behavioral abnormality;Abnormality of movement;Dystonia;Ataxia;Chorea;Myoclonus				30262571;33098801;33211350		False	3	100;0;0	21.664	True		ENSG00000152495	ENSG00000152495	HGNC:1464													
CAMSAP1	gene	CAMSAP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia, complex, with other brain malformations 12, MIM# 620316				36283405		False	3	100;0;0	21.664	True		ENSG00000130559	ENSG00000130559	HGNC:19946													
CAMTA1	gene	CAMTA1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cerebellarataxia, nonprogressive, with mental retardation, 614756;Cerebellar ataxia with mental retardation, 614756				32157189;22693284		False	3	100;0;0	21.664	True		ENSG00000171735	ENSG00000171735	HGNC:18806													
CAPN1	gene	CAPN1	Expert list;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 76 autosomal recessive, 616907;MONDO:0014827				27153400		False	3	100;0;0	21.664	False		ENSG00000014216	ENSG00000014216	HGNC:1476													
CAPN3	gene	CAPN3	Expert Review Green;Literature;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, autosomal dominant 4, MIM# 618129;Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM# 253600				31937337;28881388;32342993;32557990		False	3	100;0;0	21.664	True		ENSG00000092529	ENSG00000092529	HGNC:1480													
CAPRIN1	gene	CAPRIN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy				39878554		False	3	100;0;0	21.664	True		ENSG00000135387	ENSG00000135387	HGNC:6743													
CAPRIN1	gene	CAPRIN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy				39878554		False	3	100;0;0	21.664	True		ENSG00000135387	ENSG00000135387	HGNC:6743													
CAPRIN1	gene	CAPRIN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Neurodevelopmental disorder with language impairment, autism, and attention deficit-hyperactivity disorder, MIM#	620782;Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636"				35979925;35977029;28135719;31398340		False	3	67;33;0	21.664	True		ENSG00000135387	ENSG00000135387	HGNC:6743													
CAPRIN1	gene	CAPRIN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy				39878554		False	3	100;0;0	21.664	True		ENSG00000135387	ENSG00000135387	HGNC:6743													
CARS2	gene	CARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 27, MIM# 616672;MONDO:0014728				25361775;25787132;30139652		False	3	100;0;0	21.664	True		ENSG00000134905	ENSG00000134905	HGNC:25695													
CARS2	gene	CARS2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 27, MIM# 616672				25361775;25787132;30139652		False	3	100;0;0	21.664	True		ENSG00000134905	ENSG00000134905	HGNC:25695													
CASK	gene	CASK	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	FG syndrome 4, 300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749						False	3	100;0;0	21.664	True		ENSG00000147044	ENSG00000147044	HGNC:1497													
CASK	gene	CASK	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	FG syndrome 4 MIM#300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749;Mental retardation, with or without nystagmus MIM#300422				24278995		False	3	100;0;0	21.664	True		ENSG00000147044	ENSG00000147044	HGNC:1497													
CASP8	gene	CASP8	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autoimmune lymphoproliferative syndrome, type IIB MIM#607271				41026346		False	3	100;0;0	21.664	True		ENSG00000064012	ENSG00000064012	HGNC:1509													
CASQ1	gene	CASQ1	Expert Review Green;Expert list;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myopathy, vacuolar, with CASQ1 aggregates MIM#616231				30258016		False	3	67;33;0	21.664	True		ENSG00000143318	ENSG00000143318	HGNC:1512													
CASQ1	gene	CASQ1	Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myopathy, vacuolar, with CASQ1 aggregates 616231				PMID: 26136523;30258016		False	3	100;0;0	21.664	True		ENSG00000143318	ENSG00000143318	HGNC:1512													
CASR	gene	CASR	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypocalcemia, autosomal dominant, MIM# 601198				32775520;35402765;8733126;8813042		False	3	50;0;50	21.664	True		ENSG00000036828	ENSG00000036828	HGNC:1514													
CAT	gene	CAT	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000121691	ENSG00000121691	HGNC:1516													
CAV3	gene	CAV3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myopathy, distal, Tateyama type 614321;Rippling muscle disease 2 606072				PMID: 27312022;26185955;32090499		False	3	50;50;0	21.664	True		ENSG00000182533	ENSG00000182533	HGNC:1529													
CAV3	gene	CAV3	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, type IC 607801;Rippling muscle disease 606072;Myopathy, distal, Tateyama type 614321						False	3	100;0;0	21.664	True		ENSG00000182533	ENSG00000182533	HGNC:1529													
CBL	gene	CBL	Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	early-onset moyamoya angiopathy;Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia, 613563				25283271;28343148;28589114		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000110395	ENSG00000110395	HGNC:1541													
CBS	gene	CBS	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria, B6-responsive and nonresponsive types MIM#236200;disorder of intracellular cobalamin metabolism;metabolic disorder of sulfur metabolism				7967489		False	3	100;0;0	21.664	True		ENSG00000160200	ENSG00000160200	HGNC:1550													
CBY1	gene	CBY1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	intellectual disability;cerebellar ataxia;molar tooth sign;polydactyly;Joubert syndrome				33131181;25103236;25220153		False	3	100;0;0	21.664	True		ENSG00000100211	ENSG00000100211	HGNC:1307													
CC2D2A	gene	CC2D2A	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 9, MIM#612285				18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408		False	3	100;0;0	21.664	True		ENSG00000048342	ENSG00000048342	HGNC:29253													
CC2D2A	gene	CC2D2A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 9, MIM#612285				18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408		False	3	100;0;0	21.664	True		ENSG00000048342	ENSG00000048342	HGNC:29253													
CCDC186	gene	CCDC186	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, CCDC186-related				33259146;37569695;40633195		False	3	100;0;0	21.664	True		ENSG00000165813	ENSG00000165813	HGNC:24349													
CCDC82	gene	CCDC82	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, CCDC82-related				35373332;35118659;27457812		False	3	100;0;0	21.664	True		ENSG00000149231	ENSG00000149231	HGNC:26282													
CCDC88A	gene	CCDC88A	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PEHO syndrome-like, 617507				26917597;30392057		False	3	100;0;0	21.664	True		ENSG00000115355	ENSG00000115355	HGNC:25523													
CCDC88C	gene	CCDC88C	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hydrocephalus, congenital, 1	MIM#236600"				PMID: 29341397, PMID: 23042809, PMID: 21031079		False	3	50;50;0	21.664	True		ENSG00000015133	ENSG00000015133	HGNC:19967													
CCM2	gene	CCM2	Expert Review Green;Genomics England PanelApp;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cerebral cavernous malformations 2;Cerebral Cavernous Malformation;Capillary malformation-arteriovenous malformation 608354;Cerebral Cavernous Malformations				14624391;20301470		False	3	100;0;0	21.664	False		ENSG00000136280	ENSG00000136280	HGNC:21708													
CCT3	gene	CCT3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with speech or visual impairment and brain hypomyelination, MIM# 621034				39480921		False	3	100;0;0	21.664	True		ENSG00000163468	ENSG00000163468	HGNC:1616													
CD59	gene	CD59	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hemolytic anemia, CD59-mediated, with or without immune-mediated polyneuropathy	612300"				24382084;23149847		False	3	100;0;0	21.664	True		ENSG00000085063	ENSG00000085063	HGNC:1689													
CD99L2	gene	CD99L2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder, MONDO:0700092;CD99L2-related				41690933		False	3	100;0;0	21.664	True		ENSG00000102181	ENSG00000102181	HGNC:18237													
CD99L2	gene	CD99L2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder, MONDO:0700092;CD99L2-related				41690933		False	3	100;0;0	21.664	True		ENSG00000102181	ENSG00000102181	HGNC:18237													
CDK13	gene	CDK13	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder MIM#617360				PMID: 29021403, PMID: 35063350		False	3	100;0;0	21.664	True		ENSG00000065883	ENSG00000065883	HGNC:1733													
CDK19	gene	CDK19	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual disability;epileptic encephalopathy;Epileptic encephalopathy, early infantile, 87, MIM#	618916"				32330417		False	3	100;0;0	21.664	True		ENSG00000155111	ENSG00000155111	HGNC:19338													
CDK5	gene	CDK5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lissencephaly 7 with cerebellar hypoplasia 	MIM#616342"				25560765;40186457		False	3	50;50;0	21.664	True		ENSG00000164885	ENSG00000164885	HGNC:1774													
CDKL5	gene	CDKL5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Developmental and epileptic encephalopathy 2, MIM# 300672				19793311		False	3	100;0;0	21.664	True		ENSG00000008086	ENSG00000008086	HGNC:11411													
CECR2	gene	CECR2	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CECR2-related;neural tube defects, susceptibility to MONDO:0020705, CECR2-related				41964217;37424722		False	3	100;0;0	21.664	False		ENSG00000099954	ENSG00000099954	HGNC:1840													
CELF2	gene	CELF2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 97, MIM#619561				33131106		False	3	100;0;0	21.664	True		ENSG00000048740	ENSG00000048740	HGNC:2550													
CELF4	gene	CELF4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CELF4-related				40108438		False	3	100;0;0	21.664	True		ENSG00000101489	ENSG00000101489	HGNC:14015													
CELSR1	gene	CELSR1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), CELSR1-related				41530147;36453712		False	3	100;0;0	21.664	False		ENSG00000075275	ENSG00000075275	HGNC:1850													
CEP290	gene	CEP290	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 5, MIM# 610188				18327255;20690115;16682973;16682970;17564967;16909394;17564974		False	3	100;0;0	21.664	True		ENSG00000198707	ENSG00000198707	HGNC:29021													
CEP41	gene	CEP41	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 15, MIM# 614464				22246503		False	3	100;0;0	21.664	True		ENSG00000106477	ENSG00000106477	HGNC:12370													
CEP85L	gene	CEP85L	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lissencephaly, posterior predominant				32097630		False	3	100;0;0	21.664	True		ENSG00000111860	ENSG00000111860	HGNC:21638													
CERS1	gene	CERS1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic, 8 MIM#616230				24782409;21625621;30800706		False	3	100;0;0	21.664	True		ENSG00000223802	ENSG00000223802	HGNC:14253													
CERT1	gene	CERT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, speech delay, and dysmorphic facies (MIM#616351)				PMID: 36976648		False	3	100;0;0	21.664	True	Other	ENSG00000113163	ENSG00000113163	HGNC:2205													
CHCHD10	gene	CHCHD10	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911				24934289;31690696;30877432;32369233;28069311		False	3	100;0;0	21.664	True		ENSG00000250479	ENSG00000250479	HGNC:15559													
CHCHD10	gene	CHCHD10	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinal muscular atrophy, Jokela type: 615048;CMT2;dHMN/dSMA				22535186;27066538		False	3	100;0;0	21.664	False		ENSG00000250479	ENSG00000250479	HGNC:15559													
CHCHD10	gene	CHCHD10	Expert Review Green;Literature;Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532				30874923;29112723;25193783;24934289		False	3	100;0;0	21.664	True	Other	ENSG00000250479	ENSG00000250479	HGNC:15559													
CHCHD10	gene	CHCHD10	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911;Spinal muscular atrophy, Jokela type 615048;Myopathy, isolated mitochondrial, autosomal dominant 616209				24934289;25428574;25193783;32042922;31690696;30877432;30874923;31261376		False	3	100;0;0	21.664	True	Other	ENSG00000250479	ENSG00000250479	HGNC:15559													
CHCHD10	gene	CHCHD10	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	100;0;0	21.664	False		ENSG00000250479	ENSG00000250479	HGNC:15559													
CHCHD2	gene	CHCHD2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 22, autosomal dominant MIM#616710				32068847;25662902;31600778		False	3	100;0;0	21.664	True		ENSG00000106153	ENSG00000106153	HGNC:21645													
CHCHD2	gene	CHCHD2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 22, autosomal dominant MIM#616710				32068847;25662902;31600778;26705026		False	3	100;0;0	21.664	False		ENSG00000106153	ENSG00000106153	HGNC:21645													
CHD1	gene	CHD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Pilarowski-Bjornsson syndrome, MIM#617682				28866611		False	3	100;0;0	21.664	True		ENSG00000153922	ENSG00000153922	HGNC:1915													
CHD2	gene	CHD2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, childhood-onset (MIM # 615369)						False	3	100;0;0	21.664	True		ENSG00000173575	ENSG00000173575	HGNC:1917													
CHD3	gene	CHD3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Snijders Blok-Campeau syndrome MIM#618205				PMID: 32483341		False	3	100;0;0	21.664	True		ENSG00000170004	ENSG00000170004	HGNC:1918													
CHD4	gene	CHD4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Sifrim-Hitz-Weiss syndrome, MIM# 617159;Childhood idiopathic epilepsy and sinus arrhythmia				27479907;27616479;34109749		False	3	100;0;0	21.664	True		ENSG00000111642	ENSG00000111642	HGNC:1919													
CHD5	gene	CHD5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Epilepsy				33944996		False	3	100;0;0	21.664	True		ENSG00000116254	ENSG00000116254	HGNC:16816													
CHKA	gene	CHKA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, movement abnormalities, and seizures, MIM#620023				35202461		False	3	100;0;0	21.664	True		ENSG00000110721	ENSG00000110721	HGNC:1937													
CHKB	gene	CHKB	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Muscular dystrophy, congenital, megaconial type, MIM#	602541;Intellectual disability;Abnormal mitochondria"				21665002;23692895;24997086		False	3	100;0;0	21.664	True		ENSG00000100288	ENSG00000100288	HGNC:1938													
CHMP2B	gene	CHMP2B	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795;MONDO:0010936)				20301378;16041373		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000083937	ENSG00000083937	HGNC:24537													
CHMP2B	gene	CHMP2B	Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795, MONDO:0010936)				20301378;16041373		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000083937	ENSG00000083937	HGNC:24537													
CHRNA1	gene	CHRNA1	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	myasthenic syndrome, congenital, 1B, fast-channel MONDO:0012156				36634413		False	3	100;0;0	21.664	True		ENSG00000138435	ENSG00000138435	HGNC:1955													
CHRNA2	gene	CHRNA2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, nocturnal frontal lobe, type 4 MIM#610353				16826524;25770198;30809122;25847220		False	3	100;0;0	21.664	True		ENSG00000120903	ENSG00000120903	HGNC:1956													
CHRNA4	gene	CHRNA4	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, nocturnal frontal lobe, 1, MIM# 600513				14623738;23114665		False	3	100;0;0	21.664	True	Other	ENSG00000101204	ENSG00000101204	HGNC:1958													
CHRNB2	gene	CHRNB2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, nocturnal frontal lobe, 3, MIM# 605375				11062464;11104662;19153075;32536355;25770198;23032131		False	3	100;0;0	21.664	True		ENSG00000160716	ENSG00000160716	HGNC:1962													
CHST14	gene	CHST14	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ehlers-Danlos syndrome, musculocontractural type 1, MIM# 601776				26373698		False	3	100;0;0	21.664	True		ENSG00000169105	ENSG00000169105	HGNC:24464													
CHST3	gene	CHST3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spondyloepiphyseal dysplasia with congenital joint dislocations, MIM# 143095				18513679		False	3	100;0;0	21.664	True		ENSG00000122863	ENSG00000122863	HGNC:1971													
CHST6	gene	CHST6	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Macular corneal dystrophy, MIM# 217800, MONDO:0009020				11818380;16207214;26604660		False	3	100;0;0	21.664	True		ENSG00000183196	ENSG00000183196	HGNC:6938													
CHSY1	gene	CHSY1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Temtamy preaxial brachydactyly syndrome, MIM# 605282, MONDO:0011533;CHSY1-CDG (Disorders of protein O-glycosylation, O-mannosylglycan synthesis deficiencies)				21129728;21129727;24269551		False	3	100;0;0	21.664	True		ENSG00000131873	ENSG00000131873	HGNC:17198													
CIAO1	gene	CIAO1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 10, MIM#620960				38411040;38196629		False	3	100;0;0	21.664	True		ENSG00000144021	ENSG00000144021	HGNC:14280													
CIC	gene	CIC	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 45, MIM# 617600				28288114		False	3	100;0;0	21.664	True		ENSG00000079432	ENSG00000079432	HGNC:14214													
CIC	gene	CIC	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Mental retardation, autosomal dominant 45 617600						False	3	100;0;0	21.664	False		ENSG00000079432	ENSG00000079432	HGNC:14214													
CISD2	gene	CISD2	Expert Review Green;Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wolfram syndrome 2 MIM#604928				29237418;28335035;27459537;26230298;17846994		False	3	100;0;0	21.664	True		ENSG00000145354	ENSG00000145354	HGNC:24212													
CLCN2	gene	CLCN2	Expert Review Green;Victorian Clinical Genetics Services;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with ataxia, MIM# 615651				29403011;29403012;23707145		False	3	100;0;0	21.664	True		ENSG00000114859	ENSG00000114859	HGNC:2020													
CLCN2	gene	CLCN2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with ataxia, MIM#	615651"				23707145		False	3	100;0;0	21.664	True		ENSG00000114859	ENSG00000114859	HGNC:2020													
CLCN3	gene	CLCN3	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	"Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512;Neurodevelopmental disorder with seizures and brain abnormalities, MIM#	619517"				34186028		False	3	100;0;0	21.664	True	Other	ENSG00000109572	ENSG00000109572	HGNC:2021													
CLCN4	gene	CLCN4	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Raynaud-Claes syndrome, MIM#300114;intellectual disability;epilepsy;autistic features;mood disorders;cerebral white matter changes;progressive appendicular spasticity				27550844		False	3	100;0;0	21.664	True		ENSG00000073464	ENSG00000073464	HGNC:2022													
CLCN6	gene	CLCN6	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Benign partial epilepsy;febrile seizures;NCL				25794116;21107136;33217309		False	3	100;0;0	21.664	True	Other	ENSG00000011021	ENSG00000011021	HGNC:2024													
CLDN10	gene	CLDN10	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of magnesium metabolism;HELIX syndrome MONDO:0060564				28686597		False	3	0;0;0	21.664	False		ENSG00000134873	ENSG00000134873	HGNC:2033													
CLDN11	gene	CLDN11	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypomyelinating leukodystrophy-22, MIM#619328				33313762		False	3	100;0;0	21.664	True		ENSG00000013297	ENSG00000013297	HGNC:8514													
CLDN16	gene	CLDN16	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of magnesium metabolism;renal hypomagnesemia 3 MONDO:0009550				26426912, 16501001, 10878661		False	3	0;0;0	21.664	False		ENSG00000113946	ENSG00000113946	HGNC:2037													
CLDN19	gene	CLDN19	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of magnesium metabolism;renal hypomagnesemia 5 with ocular involvement MONDO:0009548				17033971, 22422540, 27530400		False	3	0;0;0	21.664	False		ENSG00000164007	ENSG00000164007	HGNC:2040													
CLDN5	gene	CLDN5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disorder, MONDO:0002254, CLDN5-related				35714222;36477332		False	3	50;50;0	21.664	True		ENSG00000184113	ENSG00000184113	HGNC:2047													
CLDN5	gene	CLDN5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disorder, MONDO:0002254, CLDN5-related				PMID: 36477332		False	3	100;0;0	21.664	True		ENSG00000184113	ENSG00000184113	HGNC:2047													
CLN3	gene	CLN3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ceroid lipofuscinosis, neuronal, 3	204200"				19353721		False	3	100;0;0	21.664	True		ENSG00000188603	ENSG00000188603	HGNC:2074													
CLN3	gene	CLN3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 3, MIM# 204200;MONDO:0008767				7553855		False	3	100;0;0	21.664	True		ENSG00000188603	ENSG00000188603	HGNC:2074													
CLN3	gene	CLN3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 3, MIM# 204200;MONDO:0008767				7553855		False	3	100;0;0	21.664	True		ENSG00000188603	ENSG00000188603	HGNC:2074													
CLN3	gene	CLN3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 3 MIM#204200				19489875;11342698		False	3	100;0;0	21.664	True		ENSG00000188603	ENSG00000188603	HGNC:2074													
CLN5	gene	CLN5	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis neuronal 5, MIM# 256731						False	3	100;0;0	21.664	True		ENSG00000102805	ENSG00000102805	HGNC:2076													
CLN5	gene	CLN5	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ceroid lipofuscinosis, neuronal, 5, MIM#	256731"				32983231;15728307;20157158		False	3	100;0;0	21.664	True		ENSG00000102805	ENSG00000102805	HGNC:2076													
CLN5	gene	CLN5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 5, MIM# 256731;MONDO:0009745				20157158		False	3	100;0;0	21.664	True		ENSG00000102805	ENSG00000102805	HGNC:2076													
CLN6	gene	CLN6	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300				11791207;11727201;21549341		False	3	100;0;0	21.664	True		ENSG00000128973	ENSG00000128973	HGNC:2077													
CLN6	gene	CLN6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, Kufs type, adult onset MIM#204300				30561534		False	3	100;0;0	21.664	True		ENSG00000128973	ENSG00000128973	HGNC:2077													
CLN6	gene	CLN6	Expert Review Green;Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300				11791207;11727201;21549341;33798445;33024953		False	3	100;0;0	21.664	True		ENSG00000128973	ENSG00000128973	HGNC:2077													
CLN6	gene	CLN6	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300				11791207;11727201;21549341;30561534		False	3	100;0;0	21.664	True		ENSG00000128973	ENSG00000128973	HGNC:2077													
CLN8	gene	CLN8	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 8, MIM# 600143;Ceroid lipofuscinosis, neuronal, 8, Northern epilepsy variant, MIM# 610003				10508524;15024724;16570191		False	3	100;0;0	21.664	True		ENSG00000182372	ENSG00000182372	HGNC:2079													
CLN8	gene	CLN8	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 8, MIM# 600143;Ceroid lipofuscinosis, neuronal, 8, Northern epilepsy variant, MIM# 610003				10508524;15024724;16570191		False	3	100;0;0	21.664	True		ENSG00000182372	ENSG00000182372	HGNC:2079													
CLP1	gene	CLP1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 10;dHMN/dSMA						False	3	100;0;0	21.664	False		ENSG00000172409	ENSG00000172409	HGNC:16999													
CLPB	gene	CLPB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271;3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835;Neutropenia, severe congenital, 9, autosomal dominant, MIM# 619813				25597510;34140661		False	3	100;0;0	21.664	True		ENSG00000162129	ENSG00000162129	HGNC:30664													
CLPB	gene	CLPB	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271;3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835				25597510;34140661		False	3	100;0;0	21.664	True		ENSG00000162129	ENSG00000162129	HGNC:30664													
CLPP	gene	CLPP	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 3, MIM# 614129				23541340;27087618;27899912;25254289		False	3	100;0;0	21.664	True		ENSG00000125656	ENSG00000125656	HGNC:2084													
CLPP	gene	CLPP	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 3, MIM# 614129				25254289		False	3	100;0;0	21.664	True		ENSG00000125656	ENSG00000125656	HGNC:2084													
CLPP	gene	CLPP	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 3, MIM#614129				27899912		False	3	100;0;0	21.664	True		ENSG00000125656	ENSG00000125656	HGNC:2084													
CLTC	gene	CLTC	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 56, MIM# 617854				29100083;26822784		False	3	100;0;0	21.664	True		ENSG00000141367	ENSG00000141367	HGNC:2092													
CNKSR2	gene	CNKSR2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, Houge type, MIM# 301008				34266427		False	3	100;0;0	21.664	True		ENSG00000149970	ENSG00000149970	HGNC:19701													
CNNM2	gene	CNNM2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Hypomagnesemia 6, renal MIM#613882;Hypomagnesemia, seizures, and mental retardation MIM#616418				34604137;35170241		False	3	100;0;0	21.664	True		ENSG00000148842	ENSG00000148842	HGNC:103													
CNNM2	gene	CNNM2	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	renal hypomagnesemia 6 MONDO:0013480;Disorders of magnesium metabolism				34604137, 35170241		False	3	0;0;0	21.664	False		ENSG00000148842	ENSG00000148842	HGNC:103													
CNOT9	gene	CNOT9	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092				PMID: 37092538		False	3	100;0;0	21.664	True		ENSG00000144580	ENSG00000144580	HGNC:10445													
CNP	gene	CNP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 20, MIM# 619071				32128616;12590258;40396300		False	3	50;50;0	21.664	True		ENSG00000173786	ENSG00000173786	HGNC:2158													
CNPY3	gene	CNPY3	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 60 (MIM 617929)				29394991;30237576		False	3	100;0;0	21.664	True		ENSG00000137161	ENSG00000137161	HGNC:11968													
CNTN2	gene	CNTN2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, MONDO:0015653, CNTN2-related;Epilepsy, myoclonic, familial adult, 5 MIM#615400				23518707;34120799;34691156		False	3	33;33;33	21.664	True		ENSG00000184144	ENSG00000184144	HGNC:2172													
CNTNAP1	gene	CNTNAP1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelinating neuropathy, congenital, 3, MIM# 618186;Lethal congenital contracture syndrome 7, MIM# 616286				28374019;29882456		False	3	100;0;0	21.664	True		ENSG00000108797	ENSG00000108797	HGNC:8011													
CNTNAP1	gene	CNTNAP1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelinating neuropathy, congenital, 3 (MONDO:0017049;MIM#618186)				29511323;27881385		False	3	100;0;0	21.664	True		ENSG00000108797	ENSG00000108797	HGNC:8011													
CNTNAP2	gene	CNTNAP2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia-focal epilepsy syndrome, MIM# 610042				16571880;19896112;27439707		False	3	100;0;0	21.664	True		ENSG00000174469	ENSG00000174469	HGNC:13830													
COA6	gene	COA6	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 13, MIM# 616501;Cardioencephalomyopathy, fatal infantile, MONDO:0014668				24549041;25339201;31851937;26160915		False	3	100;0;0	21.664	True		ENSG00000168275	ENSG00000168275	HGNC:18025													
COA7	gene	COA7	Expert Review Green;Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387				30885959;29718187		False	3	100;0;0	21.664	True		ENSG00000162377	ENSG00000162377	HGNC:25716													
COA7	gene	COA7	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3, MONDO:0020770				37750949;37264311		False	3	100;0;0	21.664	False		ENSG00000162377	ENSG00000162377	HGNC:25716													
COA7	gene	COA7	Expert Review Green;Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387						False	3	100;0;0	21.664	True		ENSG00000162377	ENSG00000162377	HGNC:25716													
COA7	gene	COA7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3, MONDO:0020770				37750949;37264311		False	3	100;0;0	21.664	False		ENSG00000162377	ENSG00000162377	HGNC:25716													
COA7	gene	COA7	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3, 618387;Cerebellar atrophy, leukoencephalopathy and spinal cord atrophy in some patients. Axonal sensory and motor neuropathy						False	3	100;0;0	21.664	False		ENSG00000162377	ENSG00000162377	HGNC:25716													
COA7	gene	COA7	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387				27683825;29718187		False	3	100;0;0	21.664	True		ENSG00000162377	ENSG00000162377	HGNC:25716													
COA8	gene	COA8	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, MIM# 220110				25175347		False	3	100;0;0	21.664	True		ENSG00000256053	ENSG00000256053	HGNC:20492													
COA8	gene	COA8	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 17, MIM#619061				25175347		False	3	100;0;0	21.664	True		ENSG00000256053	ENSG00000256053	HGNC:20492													
COASY	gene	COASY	GeneReviews;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	OMIM 618266);COASY protein-associated neurodegeneration (CoPAN						False	3	100;0;0	21.664	False		ENSG00000068120	ENSG00000068120	HGNC:29932													
COASY	gene	COASY	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodegeneration with brain iron accumulation 6, MONDO:0014290;Neurodegeneration with brain iron accumulation 6 615643				23447832;24360804;27021474		False	3	100;0;0	21.664	True		ENSG00000068120	ENSG00000068120	HGNC:29932													
COASY	gene	COASY	Expert Review Green;Expert Review Green;Literature;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 6 MIM#615643;Pontocerebellar hypoplasia, type 12 MIM#618266				25778941;24360804;30089828;28489334		False	3	100;0;0	21.664	True		ENSG00000068120	ENSG00000068120	HGNC:29932													
COG1	gene	COG1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIg, MIM# 611209				16537452;19008299;17904886;11980916		False	3	100;0;0	21.664	True		ENSG00000166685	ENSG00000166685	HGNC:6545													
COG4	gene	COG4	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIj 613489				21185756;19494034		False	3	100;0;0	21.664	True		ENSG00000103051	ENSG00000103051	HGNC:18620													
COG5	gene	COG5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIi, MIM# 613612				23228021;31572517;32174980		False	3	100;0;0	21.664	True		ENSG00000164597	ENSG00000164597	HGNC:14857													
COG6	gene	COG6	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIl, MIM# 614576				20605848;23430903;26260076;32905044;32683677;31420886		False	3	100;0;0	21.664	True		ENSG00000133103	ENSG00000133103	HGNC:18621													
COG7	gene	COG7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIe , MIM#608779				15107842;17356545;28883096		False	3	100;0;0	21.664	True		ENSG00000168434	ENSG00000168434	HGNC:18622													
COG7	gene	COG7	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIe , MIM#608779				15107842;17356545;28883096		False	3	100;0;0	21.664	True		ENSG00000168434	ENSG00000168434	HGNC:18622													
COG8	gene	COG8	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIh, MIM# 611182				17220172;28619360;30690882;17331980		False	3	100;0;0	21.664	True		ENSG00000213380	ENSG00000213380	HGNC:18623													
COL18A1	gene	COL18A1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Knobloch syndrome, type 1, MIM# 267750				27259167;25456301		False	3	100;0;0	21.664	True		ENSG00000182871	ENSG00000182871	HGNC:2195													
COL3A1	gene	COL3A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polymicrogyria with or without vascular-type ehlers-danlos syndrome, MIM # 618343				PMID: 28258187, PMID: 37393059, PMID: 28742248, PMID: 22235340		False	3	100;0;0	21.664	True		ENSG00000168542	ENSG00000168542	HGNC:2201													
COL3A1	gene	COL3A1	Genomics England PanelApp;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ehlers-Danlos syndrome, type IV  130050						False	3	100;0;0	21.664	False		ENSG00000168542	ENSG00000168542	HGNC:2201													
COL4A1	gene	COL4A1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Brain small vessel disease 1 with or without ocular anomalies	MONDO:0008289;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant	MONDO:0032814"				35699195;37272523;36300346;30413629		False	3	100;0;0	21.664	True		ENSG00000187498	ENSG00000187498	HGNC:2202													
COL4A1	gene	COL4A1	Expert Review Green;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, MIM# 611773;Brain small vessel disease with or without ocular anomalies, MIM# 175780				27794444;25719457		False	3	100;0;0	21.664	True		ENSG00000187498	ENSG00000187498	HGNC:2202													
COL4A1	gene	COL4A1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Brain small vessel disease with or without ocular anomalies, MIM# 175780				24372060;22134833;25719457;23225343;22932948		False	3	100;0;0	21.664	True		ENSG00000187498	ENSG00000187498	HGNC:2202													
COL4A1	gene	COL4A1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, 611773;Brain small vessel disease with or without ocular anomalies, 175780						False	3	100;0;0	21.664	False		ENSG00000187498	ENSG00000187498	HGNC:2202													
COL4A1	gene	COL4A1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps MIM#611773;Brain small vessel disease with or without ocular anomalies MIM#175780;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MIM#618564				24628545;25719457;21625620;23225343;23065703;20818663;20301768		False	3	100;0;0	21.664	True		ENSG00000187498	ENSG00000187498	HGNC:2202													
COL4A2	gene	COL4A2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cerebral Palsy MONDO#0006497, COL4A2-related;Brain small vessel disease 2 MIM# 614483				33528536;33912663;22209246;30315939;22333902		False	3	100;0;0	21.664	True		ENSG00000134871	ENSG00000134871	HGNC:2203													
COL6A1	gene	COL6A1	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Bethlem myopathy MIM#158810;Ullrich congenital muscular dystrophy MIM#254090				20301676;25535305;15955946;23738969;29277723;24443028		False	3	100;0;0	21.664	True		ENSG00000142156	ENSG00000142156	HGNC:2211													
COL6A2	gene	COL6A2	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090				20301676		False	3	100;0;0	21.664	True		ENSG00000142173	ENSG00000142173	HGNC:2212													
COL6A3	gene	COL6A3	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090				20301676;26004199;32037012;26872670;32037012		False	3	100;0;0	21.664	True		ENSG00000163359	ENSG00000163359	HGNC:2213													
COLGALT1	gene	COLGALT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain small vessel disease 3 MIM#618360				30412317;33709034;31759980		False	3	100;0;0	21.664	True		ENSG00000130309	ENSG00000130309	HGNC:26182													
COLGALT1	gene	COLGALT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain small vessel disease 3 MIM#618360				30412317;33709034;31759980		False	3	100;0;0	21.664	True		ENSG00000130309	ENSG00000130309	HGNC:26182													
COQ2	gene	COQ2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 1, MIM# 607426;MONDO:0011829				16400613;17332895;17855635		False	3	100;0;0	21.664	True		ENSG00000173085	ENSG00000173085	HGNC:25223													
COQ2	gene	COQ2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 1, MIM# 607426;MONDO:0011829				16400613;17332895;17855635		False	3	100;0;0	21.664	True		ENSG00000173085	ENSG00000173085	HGNC:25223													
COQ2	gene	COQ2	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy;General Leukodystrophy & Mitochondrial Leukoencephalopathy;Coenzyme Q10 deficiency, primary, 1						False	3	0;0;0	21.664	False		ENSG00000173085	ENSG00000173085	HGNC:25223													
COQ4	gene	COQ4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 7, MIM# 616276				25658047;26185144;33704555		False	3	100;0;0	21.664	True		ENSG00000167113	ENSG00000167113	HGNC:19693													
COQ4	gene	COQ4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Spastic ataxia 10, autosomal recessive, MIM# 620666				25658047;26185144;33704555;36047608;38014483;38013626		False	3	100;0;0	21.664	True		ENSG00000167113	ENSG00000167113	HGNC:19693													
COQ4	gene	COQ4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Childhood-onset ataxia				30225196;33704555;30847826		False	3	100;0;0	21.664	True		ENSG00000167113	ENSG00000167113	HGNC:19693													
COQ5	gene	COQ5	Expert Review Green;Victorian Clinical Genetics Services;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary 9, MIM#619028				29044765;37599337;21937992;41199775;36266294		False	3	100;0;0	21.664	True		ENSG00000110871	ENSG00000110871	HGNC:28722													
COQ5	gene	COQ5	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 9 MIM#619028				29044765;37599337;21937992;41199775;36266294		False	3	33;0;67	21.664	True		ENSG00000110871	ENSG00000110871	HGNC:28722													
COQ5	gene	COQ5	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 9 MIM#619028				29044765;37599337;21937992;41199775;36266294		False	3	33;0;67	21.664	True		ENSG00000110871	ENSG00000110871	HGNC:28722													
COQ6	gene	COQ6	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 6 MIM#614650				28125198		False	3	100;0;0	21.664	True		ENSG00000119723	ENSG00000119723	HGNC:20233													
COQ7	gene	COQ7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuronopathy, distal hereditary motor, autosomal recessive 9, MIM# 620402				PMID: 36454683;36758993;36759155		False	3	67;33;0	21.664	True		ENSG00000167186	ENSG00000167186	HGNC:2244													
COQ7	gene	COQ7	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary spastic paraplegia, COQ7-related (MONDO#0019064)				PMID: 33215859		False	3	50;0;50	21.664	False		ENSG00000167186	ENSG00000167186	HGNC:2244													
COQ7	gene	COQ7	Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 8 MIM#616733				31240163		False	3	100;0;0	21.664	True		ENSG00000167186	ENSG00000167186	HGNC:2244													
COQ7	gene	COQ7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	primary coenzyme Q10 deficiency 8, MONDO:0014754				37170631;36759155;36758993		False	3	100;0;0	21.664	True		ENSG00000167186	ENSG00000167186	HGNC:2244													
COQ8A	gene	COQ8A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 4 MIM#612016				PMID 32337771		False	3	100;0;0	21.664	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
COQ8A	gene	COQ8A	Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 4 MIM#612016				32337771		False	3	100;0;0	21.664	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
COQ8A	gene	COQ8A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 4 MIM#612016				32337771		False	3	100;0;0	21.664	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
COQ8A	gene	COQ8A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 4 MIM#612016				32337771		False	3	100;0;0	21.664	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
COQ8A	gene	COQ8A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Coenzyme Q10 deficiency, primary, 4, MIM#	612016"				32337771		False	3	100;0;0	21.664	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
COQ8B	gene	COQ8B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Nephrotic syndrome, type 9 MIM#615573				24270420		False	3	100;0;0	21.664	True		ENSG00000123815	ENSG00000123815	HGNC:19041													
COQ9	gene	COQ9	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 5, MIM#614654				19375058;26081641;23255162;31821167		False	3	100;0;0	21.664	True		ENSG00000088682	ENSG00000088682	HGNC:25302													
COQ9	gene	COQ9	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 5, MIM#614654				19375058;26081641;23255162;31821167		False	3	100;0;0	21.664	True		ENSG00000088682	ENSG00000088682	HGNC:25302													
COX10	gene	COX10	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy;General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial complex IV disorder						False	3	0;0;0	21.664	False		ENSG00000006695	ENSG00000006695	HGNC:2260													
COX10	gene	COX10	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 3, MIM# 619046				10767350;12928484;15455402;27290639		False	3	100;0;0	21.664	True		ENSG00000006695	ENSG00000006695	HGNC:2260													
COX11	gene	COX11	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease (MONDO:0044970), COX11-related				36030551		False	3	100;0;0	21.664	True		ENSG00000166260	ENSG00000166260	HGNC:2261													
COX11	gene	COX11	Expert Review Green;Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease (MONDO:0044970), COX11-related				36030551		False	3	100;0;0	21.664	True		ENSG00000166260	ENSG00000166260	HGNC:2261													
COX15	gene	COX15	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy;Mitochondrial complex IV disorders						False	3	0;0;0	21.664	False		ENSG00000014919	ENSG00000014919	HGNC:2263													
COX15	gene	COX15	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119				33746038;32232962;26959537;21412973;12474143;15235026		False	3	100;0;0	21.664	True		ENSG00000014919	ENSG00000014919	HGNC:2263													
COX18	gene	COX18	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 25, MIM# 621487;Charcot-Marie-Tooth disease, axonal, type 2MM, MIM# 621488				37468577;40830826		False	3	100;0;0	21.664	True		ENSG00000163626	ENSG00000163626	HGNC:26801													
COX18	gene	COX18	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 25, MIM# 621487;Charcot-Marie-Tooth disease, axonal, type 2MM, MIM# 621488				PMID:37468577;40830826		False	3	67;0;33	21.664	True		ENSG00000163626	ENSG00000163626	HGNC:26801													
COX20	gene	COX20	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	sensory neuronopathy;sensory neuron disease;ganglionopathy				PMID: 33751098		False	3	100;0;0	21.664	False		ENSG00000203667	ENSG00000203667	HGNC:26970													
COX20	gene	COX20	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, 220110;Mitochondrial complex IV deficiency						False	3	100;0;0	21.664	False		ENSG00000203667	ENSG00000203667	HGNC:26970													
COX20	gene	COX20	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 11, MIM#619054				24202787;31079202;30656193;23125284;32606554		False	3	100;0;0	21.664	True		ENSG00000203667	ENSG00000203667	HGNC:26970													
COX4I1	gene	COX4I1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 16, MIM#619060;regression;seizures;short stature;mild dysmorphic features;Fanconi anemia				28766551;22592081;31290619		False	3	33;33;33	21.664	True		ENSG00000131143	ENSG00000131143	HGNC:2265													
COX6A1	gene	COX6A1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot Marie Tooth disease, recessive intermediate D, 616039;MONDO:0014467;HMSN				25152455;26302975;25152455		False	3	100;0;0	21.664	False		ENSG00000111775	ENSG00000111775	HGNC:2277													
COX6A1	gene	COX6A1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot Marie Tooth disease, recessive intermediate D, MIM# 616039;MONDO:0014467				25152455;26302975;25152455		False	3	100;0;0	21.664	True		ENSG00000111775	ENSG00000111775	HGNC:2277													
COX6A2	gene	COX6A2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 18, MIM#619062				31155743;23460811		False	3	100;0;0	21.664	True		ENSG00000156885	ENSG00000156885	HGNC:2279													
COX6B1	gene	COX6B1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 7, MIM# 619051				18499082;24781756		False	3	100;0;0	21.664	True		ENSG00000126267	ENSG00000126267	HGNC:2280													
COX7B	gene	COX7B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Linear skin defects with multiple congenital anomalies 2, MIM#300887				23122588		False	3	100;0;0	21.664	True		ENSG00000131174	ENSG00000131174	HGNC:2291													
COXFA4	gene	COXFA4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065;Leigh syndrome				30361421;28988874;23746447		False	3	100;0;0	21.664	True		ENSG00000189043	ENSG00000189043	HGNC:7687													
CP	gene	CP	Victorian Clinical Genetics Services;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290				20301666		False	3	100;0;0	21.664	False		ENSG00000047457	ENSG00000047457	HGNC:2295													
CP	gene	CP	GeneReviews;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminemia						False	3	100;0;0	21.664	False		ENSG00000047457	ENSG00000047457	HGNC:2295													
CP	gene	CP	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminaemia, MIM#604290						False	3	100;0;0	21.664	True		ENSG00000047457	ENSG00000047457	HGNC:2295													
CP	gene	CP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminaemia, MIM#604290						False	3	100;0;0	21.664	True		ENSG00000047457	ENSG00000047457	HGNC:2295													
CP	gene	CP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hemosiderosis, systemic, due to aceruloplasminemia MIM#604290				7539672;https://doi.org/10.1093/qjmed/89.5.355;28874056;28012953		False	3	100;0;0	21.664	False		ENSG00000047457	ENSG00000047457	HGNC:2295													
CP	gene	CP	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	604290 ACERULOPLASMINEMIA;604290 Hemosiderosis, systemic, due to aceruloplasminemia				15338274		False	3	0;0;0	21.664	False		ENSG00000047457	ENSG00000047457	HGNC:2295													
CPLANE1	gene	CPLANE1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 17, MIM#	614615"						False	3	100;0;0	21.664	True		ENSG00000197603	ENSG00000197603	HGNC:25801													
CPLX1	gene	CPLX1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 63, MIM#	617976"				26539891;28422131		False	3	100;0;0	21.664	True		ENSG00000168993	ENSG00000168993	HGNC:2309													
CPOX	gene	CPOX	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coproporphyria, MIM#121300;Harderoporphyria, MIM#121300						False	3	100;0;0	21.664	True		ENSG00000080819	ENSG00000080819	HGNC:2321													
CPSF3	gene	CPSF3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, hypotonia, and seizures (NEDMHS), MIM#619876				35121750		False	3	100;0;0	21.664	True		ENSG00000119203	ENSG00000119203	HGNC:2326													
CPT1A	gene	CPT1A	Expert Review Green;Expert Review Green;Literature;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	CPT deficiency, hepatic, type IA MIM#255120				25778941;12189492;23430932		False	3	100;0;0	21.664	True		ENSG00000110090	ENSG00000110090	HGNC:2328													
CPT1A	gene	CPT1A	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	CPT deficiency, hepatic, type IA, MIM# 255120				12189492;33565078;34869124;20696606		False	3	67;33;0	21.664	True		ENSG00000110090	ENSG00000110090	HGNC:2328													
CPT1A	gene	CPT1A	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	CPT deficiency, hepatic, type IA, MIM# 255120				12189492		False	3	100;0;0	21.664	True		ENSG00000110090	ENSG00000110090	HGNC:2328													
CPT2	gene	CPT2	Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"CPT II deficiency, infantile MIM#600649;CPT II deficiency, lethal neonatal	MIM#608836;CPT II deficiency, myopathic, stress-induced	MIM#255110"				25778941;12673791;30957255		False	3	100;0;0	21.664	True		ENSG00000157184	ENSG00000157184	HGNC:2330													
CPT2	gene	CPT2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	CPT II deficiency, infantile 600649;CPT II deficiency, lethal neonatal 608836;CPT II deficiency, myopathic, stress-induced 255110						False	3	100;0;0	21.664	True		ENSG00000157184	ENSG00000157184	HGNC:2330													
CPT2	gene	CPT2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	CPT II deficiency, infantile 600649;CPT II deficiency, lethal neonatal 608836;CPT II deficiency, myopathic, stress-induced 255110				PMID: 20301431;35028265;36478999		False	3	100;0;0	21.664	True		ENSG00000157184	ENSG00000157184	HGNC:2330													
CPT2	gene	CPT2	Expert Review Green;Expert list;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	CPT II deficiency, myopathic, stress-induced (exercise intolerance and rhabdomyolysis, late onset) 255110						False	3	100;0;0	21.664	True		ENSG00000157184	ENSG00000157184	HGNC:2330													
CRADD	gene	CRADD	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 34, with variant lissencephaly, MIM# 614499				PMID: 27773430;30914828		False	3	50;50;0	21.664	True		ENSG00000169372	ENSG00000169372	HGNC:2340													
CREBBP	gene	CREBBP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Menke-Hennekam syndrome 1, MIM#	618332"				29460469		False	3	100;0;0	21.664	True		ENSG00000005339	ENSG00000005339	HGNC:2348													
CRELD1	gene	CRELD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Jeffries-Lakhani neurodevelopmental syndrome, MIM# 620771				37947183		False	3	100;0;0	21.664	True		ENSG00000163703	ENSG00000163703	HGNC:14630													
CRLS1	gene	CRLS1	Expert Review Green;Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 57, MIM# 620167				35147173		False	3	100;0;0	21.664	True		ENSG00000088766	ENSG00000088766	HGNC:16148													
CRPPA	gene	CRPPA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, 616052				23390185;30060766;28688748;26404900		False	3	100;0;0	21.664	True		ENSG00000214960	ENSG00000214960	HGNC:37276													
CRPPA	gene	CRPPA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7 614643;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7 616052						False	3	100;0;0	21.664	True		ENSG00000214960	ENSG00000214960	HGNC:37276													
CRPPA	gene	CRPPA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643				28688748;30060766;22522420;24120487;35863218		False	3	67;33;0	21.664	True		ENSG00000214960	ENSG00000214960	HGNC:37276													
CSF1R	gene	CSF1R	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	100;0;0	21.664	False		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSF1R	gene	CSF1R	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	leukoencephalopathy, diffuse hereditary, with spheroids 1 MONDO:0800027				25935893;22934315;22934315		False	3	100;0;0	21.664	True		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSF1R	gene	CSF1R	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain abnormalities, neurodegeneration, and dysosteosclerosis, MIM# 618476;BANDDOS				30982609;33749994;34135456		False	3	100;0;0	21.664	True		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSF1R	gene	CSF1R	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Brain abnormalities, neurodegeneration, and dysosteosclerosis, (MIM#618476)				PMID: 22197934;24336230;30982608;30982609		False	3	100;0;0	21.664	True		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSF1R	gene	CSF1R	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia				24198292;25563800;25935893		False	3	100;0;0	21.664	False		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSF1R	gene	CSF1R	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukoencephalopathy, diffuse hereditary, with spheroids, 221820						False	3	100;0;0	21.664	False		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSGALNACT1	gene	CSGALNACT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation;Skeletal dysplasia, mild, with joint laxity and advanced bone age, MIM# 618870				31705726;31325655		False	3	100;0;0	21.664	True		ENSG00000147408	ENSG00000147408	HGNC:24290													
CSMD1	gene	CSMD1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038				PMID 38816421		False	3	100;0;0	21.664	True		ENSG00000183117	ENSG00000183117	HGNC:14026													
CSMD1	gene	CSMD1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038				PMID: 38816421		False	3	100;0;0	21.664	True		ENSG00000183117	ENSG00000183117	HGNC:14026													
CSMD3	gene	CSMD3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, MONDO:0005027, CSMD3-related				PMID: 40632521		False	3	100;0;0	21.664	True		ENSG00000164796	ENSG00000164796	HGNC:19291													
CSNK2A1	gene	CSNK2A1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Okur-Chung neurodevelopmental syndrome, MIM# 617062				PMID: 35679446;36588763		False	3	100;0;0	21.664	True		ENSG00000101266	ENSG00000101266	HGNC:2457													
CSNK2B	gene	CSNK2B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732				PMID: 34041744		False	3	100;0;0	21.664	True		ENSG00000204435	ENSG00000204435	HGNC:2460													
CSNK2B	gene	CSNK2B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732				34041744;28585349;28762608		False	3	100;0;0	21.664	True		ENSG00000204435	ENSG00000204435	HGNC:2460													
CST3	gene	CST3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebral amyloid angiopathy MIM#105150;Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214				22435454;8866434;2602413;8108423;38489591		False	3	50;50;0	21.664	True	Other	ENSG00000101439	ENSG00000101439	HGNC:2475													
CST3	gene	CST3	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214				38489591		False	3	100;0;0	21.664	False		ENSG00000101439	ENSG00000101439	HGNC:2475													
CSTB	gene	CSTB	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM#254800				9012407;9054946		False	3	50;50;0	21.664	True		ENSG00000160213	ENSG00000160213	HGNC:2482													
CSTB	gene	CSTB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800				32920378;18028412		False	3	50;50;0	21.664	True		ENSG00000160213	ENSG00000160213	HGNC:2482													
CTBP1	gene	CTBP1	Expert Review Green;Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, MIM#617915				27094857;28955726;31041561		False	3	100;0;0	21.664	True		ENSG00000159692	ENSG00000159692	HGNC:2494													
CTC1	gene	CTC1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebroretinal microangiopathy with calcifications and cysts, MIM#	612199"				22267198;22387016		False	3	100;0;0	21.664	True		ENSG00000178971	ENSG00000178971	HGNC:26169													
CTC1	gene	CTC1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199				22267198;22387016;22532422;22899577;24372060		False	3	100;0;0	21.664	True		ENSG00000178971	ENSG00000178971	HGNC:26169													
CTDP1	gene	CTDP1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital cataracts, facial dysmorphism, and neuropathy (MIM#604168)				20301787		False	3	50;50;0	21.664	True		ENSG00000060069	ENSG00000060069	HGNC:2498													
CTNNA2	gene	CTNNA2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical dysplasia, complex, with other brain malformations 9, MIM#618174				30013181		False	3	100;0;0	21.664	True		ENSG00000066032	ENSG00000066032	HGNC:2510													
CTNS	gene	CTNS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cystinosis, late-onset juvenile or adolescent nephropathic	219900;Cystinosis, nephropathic	219800;Cystinosis, ocular nonnephropathic	219750"				PMID: 32564281		False	3	100;0;0	21.664	True		ENSG00000040531	ENSG00000040531	HGNC:2518													
CTSA	gene	CTSA	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Brain small vessel disease 6 with leukoencephalopathy, MIM# 621394				31177426		False	3	100;0;0	21.664	False		ENSG00000064601	ENSG00000064601	HGNC:9251													
CTSA	gene	CTSA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galactosialidosis, MIM# 256540				8514852;8968752		False	3	100;0;0	21.664	True		ENSG00000064601	ENSG00000064601	HGNC:9251													
CTSC	gene	CTSC	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	ectodermal dysplasia syndrome MONDO:0019287;Other disorders of complex molecule degradation				31282082;29884839		False	3	0;0;0	21.664	False		ENSG00000109861	ENSG00000109861	HGNC:2528													
CTSC	gene	CTSC	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Haim-Munk syndrome MIM#245010;Papillon-Lefevre syndrome MIM#245000;other lysosomal disorder				10581027		False	3	100;0;0	21.664	True		ENSG00000109861	ENSG00000109861	HGNC:2528													
CTSD	gene	CTSD	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 10, MIM# 610127;MONDO:0012414				16685649;16670177;25298308;33681191;29284168;27072142		False	3	100;0;0	21.664	True		ENSG00000117984	ENSG00000117984	HGNC:2529													
CTSD	gene	CTSD	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 10, MIM# 610127;MONDO:0012414				16685649;16670177;25298308;33681191;29284168;27072142		False	3	100;0;0	21.664	True		ENSG00000117984	ENSG00000117984	HGNC:2529													
CTSF	gene	CTSF	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 13 (Kufs type) MIM#615362				PMID: 23297359;25274848;27668283;27524508;35139754		False	3	100;0;0	21.664	True		ENSG00000174080	ENSG00000174080	HGNC:2531													
CTSF	gene	CTSF	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ceroid lipofuscinosis, neuronal, 13, Kufs type	615362"				PMID: 28749476;27668283;27524508		False	3	100;0;0	21.664	True		ENSG00000174080	ENSG00000174080	HGNC:2531													
CTSF	gene	CTSF	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 13, Kufs type, MIM# 615362				28749476;27668283;27524508		False	3	100;0;0	21.664	True		ENSG00000174080	ENSG00000174080	HGNC:2531													
CTSK	gene	CTSK	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Pycnodysostosis	265800"				PMID: 32667742;25725806;25304337		False	3	50;50;0	21.664	True		ENSG00000143387	ENSG00000143387	HGNC:2536													
CTU2	gene	CTU2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome, MIM#618142				PMID: 27480277;33559988		False	3	100;0;0	21.664	True		ENSG00000174177	ENSG00000174177	HGNC:28005													
CUL1	gene	CUL1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, CUL1-related				PMID: 41189326		False	3	100;0;0	21.664	True		ENSG00000055130	ENSG00000055130	HGNC:2551													
CUL4B	gene	CUL4B	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked, syndromic 15 (Cabezas type), 300354				22182342;17236139		False	3	100;0;0	21.664	True		ENSG00000158290	ENSG00000158290	HGNC:2555													
CUX2	gene	CUX2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 67, MIM#618141				2963073;29795476		False	3	100;0;0	21.664	True		ENSG00000111249	ENSG00000111249	HGNC:19347													
CWF19L1	gene	CWF19L1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 17, MIM#	616127"				33012273;36453471;37752213		False	3	50;0;50	21.664	True		ENSG00000095485	ENSG00000095485	HGNC:25613													
CWF19L1	gene	CWF19L1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 17, 616127;Autosomal recessive spinocerebellar ataxia type 17, 616127						False	3	100;0;0	21.664	False		ENSG00000095485	ENSG00000095485	HGNC:25613													
CYC1	gene	CYC1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 6 MIM#615453				23910460;34252606		False	3	100;0;0	21.664	True		ENSG00000179091	ENSG00000179091	HGNC:2579													
CYCS	gene	CYCS	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Thrombocytopenia 4, MIM#612004				18345000;24326104;30051457		False	3	100;0;0	21.664	True		ENSG00000172115	ENSG00000172115	HGNC:19986													
CYFIP2	gene	CYFIP2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 65, MIM#618008				29534297		False	3	100;0;0	21.664	True		ENSG00000055163	ENSG00000055163	HGNC:13760													
CYP27A1	gene	CYP27A1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, MIM# 213700						False	3	100;0;0	21.664	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis MIM#213700;Disorders of bile acid biosynthesis				PMID: 16816916;20301583;22658436		False	3	100;0;0	21.664	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMSN;Cholestanol storage disease						False	3	100;0;0	21.664	False		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebrotendinous xanthomatosis, MIM#	213700;Cerebrotendinous xanthomatosis,  infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas;Epilepsy;Parkinsonism;Ataxia;Peripheral neuropathy"				PMID: 30054180		False	3	100;0;0	21.664	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, 213700						False	3	100;0;0	21.664	False		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebrotendinous xanthomatosis	MIM#213700;Disorders of bile acid biosynthesis"				2019602		False	3	100;0;0	21.664	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	NHS GMS;Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, 213700						False	3	100;0;0	21.664	False		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, MIM# 213700;Cholestanol storage disease;Dystonia				19373932;21531161;25424010		False	3	100;0;0	21.664	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, 213700;MONDO:0008948;progressive lower extremity spasticity,often disproportionate to any degree of weakness						False	3	100;0;0	21.664	False		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP2U1	gene	CYP2U1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 56, autosomal recessive, MIM#615030				23176821		False	3	100;0;0	21.664	True		ENSG00000155016	ENSG00000155016	HGNC:20582													
CYP2U1	gene	CYP2U1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 56, autosomal recessive, 615030				23176821;32006740;29034544		False	3	100;0;0	21.664	True		ENSG00000155016	ENSG00000155016	HGNC:20582													
CYP2U1	gene	CYP2U1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 56, autosomal recessive, MIM#	615030"				30111349;33107650;23176821		False	3	100;0;0	21.664	True		ENSG00000155016	ENSG00000155016	HGNC:20582													
CYP7B1	gene	CYP7B1	Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood to adult-onset spastic paraplegia and bladder dysfunction, periventricular white matter abnormalities on MRI, one patient described with SNCV						False	3	100;0;0	21.664	False		ENSG00000172817	ENSG00000172817	HGNC:2652													
CYP7B1	gene	CYP7B1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bile acid synthesis defect, congenital, 3 MIM#613812;Spastic paraplegia 5A, autosomal recessive MIM#270800;Disorders of bile acid biosynthesis				9802883;18252231;31337596		False	3	100;0;0	21.664	True		ENSG00000172817	ENSG00000172817	HGNC:2652													
CYP7B1	gene	CYP7B1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 5A, autosomal recessive, MIM#	270800"				19439420;18252231		False	3	100;0;0	21.664	True		ENSG00000172817	ENSG00000172817	HGNC:2652													
CYP7B1	gene	CYP7B1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 5A, autosomal recessive, MIM#	270800"				24117163;19439420;19187859		False	3	100;0;0	21.664	True		ENSG00000172817	ENSG00000172817	HGNC:2652													
D2HGDH	gene	D2HGDH	Expert Review Green;Expert Review Green;NHS GMS;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-2-hydroxyglutaric aciduria MIM#600721				25778941;31349060;15609246;20020533		False	3	100;0;0	21.664	True		ENSG00000180902	ENSG00000180902	HGNC:28358													
D2HGDH	gene	D2HGDH	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-2-hydroxyglutaric aciduria MIM#600721				25778941;31349060;15609246;20020533		False	3	100;0;0	21.664	True		ENSG00000180902	ENSG00000180902	HGNC:28358													
D2HGDH	gene	D2HGDH	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L2-Hydroxyglutaric aciduria						False	3	0;0;0	21.664	False		ENSG00000180902	ENSG00000180902	HGNC:28358													
DAG1	gene	DAG1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9, 613818				21388311;25934851;24052401;25503980		False	3	100;0;0	21.664	True		ENSG00000173402	ENSG00000173402	HGNC:2666													
DAGLA	gene	DAGLA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuroocular syndrome 2, paroxysmal type, MIM# 168885				35737950		False	3	100;0;0	21.664	True		ENSG00000134780	ENSG00000134780	HGNC:1165													
DAGLB	gene	DAGLB	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease, MONDO:0005180, DALGB-related				35715418;40244389		False	3	100;0;0	21.664	True		ENSG00000164535	ENSG00000164535	HGNC:28923													
DAP3	gene	DAP3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 7, MIM# 621101				39701103		False	3	100;0;0	21.664	True		ENSG00000132676	ENSG00000132676	HGNC:2673													
DARS1	gene	DARS1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281				25527264;23643384		False	3	100;0;0	21.664	True		ENSG00000115866	ENSG00000115866	HGNC:2678													
DARS1	gene	DARS1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM#	615281"				23643384		False	3	100;0;0	21.664	True		ENSG00000115866	ENSG00000115866	HGNC:2678													
DARS2	gene	DARS2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2LL, MIM# 621485				20506600;19592391;33574740;40814755		False	3	50;50;0	21.664	True		ENSG00000117593	ENSG00000117593	HGNC:25538													
DARS2	gene	DARS2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation;Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105						False	3	100;0;0	21.664	False		ENSG00000117593	ENSG00000117593	HGNC:25538													
DARS2	gene	DARS2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM#	611105"				17384640;15002045;16788019		False	3	100;0;0	21.664	True		ENSG00000117593	ENSG00000117593	HGNC:25538													
DARS2	gene	DARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105				17384640;15002045;16788019		False	3	100;0;0	21.664	True		ENSG00000117593	ENSG00000117593	HGNC:25538													
DBH	gene	DBH	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dopamine beta-hydroxylase deficiency, MIM#223360				11857564		False	3	100;0;0	21.664	True		ENSG00000123454	ENSG00000123454	HGNC:2689													
DBT	gene	DBT	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Maple syrup urine disease, type II (MIM#248600)						False	3	100;0;0	21.664	True		ENSG00000137992	ENSG00000137992	HGNC:2698													
DCAF17	gene	DCAF17	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Woodhouse-Sakati syndrome, MIM#	241080"				19026396;20507343		False	3	100;0;0	21.664	True		ENSG00000115827	ENSG00000115827	HGNC:25784													
DCAF17	gene	DCAF17	GeneReviews;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Woodhouse-Sakati syndrome						False	3	100;0;0	21.664	False		ENSG00000115827	ENSG00000115827	HGNC:25784													
DCAF17	gene	DCAF17	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Woodhouse-Sakati syndrome MONDO:0009419;Dystonia				18175354;36185913;17167799		False	3	100;0;0	21.664	True		ENSG00000115827	ENSG00000115827	HGNC:25784													
DCTN1	gene	DCTN1	Expert list;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Perry syndrome, MONDO:0008201				20945553, 19136952, 24343258		False	3	100;0;0	21.664	True		ENSG00000204843	ENSG00000204843	HGNC:2711													
DCTN1	gene	DCTN1	Literature;Expert Review Green;Expert Review Amber;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Perry syndrome, MONDO:0008201				20945553, 19136952, 24343258		False	3	100;0;0	21.664	False		ENSG00000204843	ENSG00000204843	HGNC:2711													
DCTN1	gene	DCTN1	Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Perry syndrome, MONDO:0008201				20945553, 19136952, 24343258		False	3	100;0;0	21.664	True		ENSG00000204843	ENSG00000204843	HGNC:2711													
DCTN1	gene	DCTN1	Expert Review Green;Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neuronopathy, distal hereditary motor, type 7B, MONDO:0011879				12627231;15326253;33443672;32023010;27573046		False	3	100;0;0	21.664	False		ENSG00000204843	ENSG00000204843	HGNC:2711													
DCX	gene	DCX	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Lissencephaly, X-linked, MIM# 300067;Subcortical laminal heterotopia, X-linked 300067				10915612;9489699;12552055		False	3	100;0;0	21.664	True		ENSG00000077279	ENSG00000077279	HGNC:2714													
DDC	gene	DDC	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aromatic L-amino acid decarboxylase deficiency, MIM# 608643				20505134		False	3	100;0;0	21.664	True		ENSG00000132437	ENSG00000132437	HGNC:2719													
DDC	gene	DDC	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aromatic L-amino acid decarboxylase deficiency, MIM# 608643						False	3	100;0;0	21.664	True		ENSG00000132437	ENSG00000132437	HGNC:2719													
DDC	gene	DDC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aromatic L-amino acid decarboxylase deficiency, MIM# 608643;Infantile-onset parkinsonism & dystonia;Bulbar dysfunction;Oculogyric crisis;Autonomic dysfunction;Intellectual disability				33983693;36928758;36054588;35829818;35593933;30260058		False	3	67;33;0	21.664	True		ENSG00000132437	ENSG00000132437	HGNC:2719													
DDC	gene	DDC	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aromatic L-amino acid decarboxylase deficiency, 608643;Dystonia				20505134		False	3	100;0;0	21.664	True		ENSG00000132437	ENSG00000132437	HGNC:2719													
DDHD1	gene	DDHD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary spastic paraplegia 28, MONDO:0012256				15786464, 23176821, 24989667, 27216551, 26944165, 28818478, 29980238, 27999540, 33600578		False	3	100;0;0	21.664	True		ENSG00000100523	ENSG00000100523	HGNC:19714													
DDHD1	gene	DDHD1	ClinGen;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary spastic paraplegia 28, MONDO:0012256				15786464, 23176821, 24989667, 27216551, 26944165, 28818478, 29980238, 27999540, 33600578		False	3	50;50;0	21.664	True		ENSG00000100523	ENSG00000100523	HGNC:19714													
DDHD2	gene	DDHD2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 54, autosomal recessive, MIM#	615033;MONDO:0014018"				23486545;24482476;23176823		False	3	100;0;0	21.664	True		ENSG00000085788	ENSG00000085788	HGNC:29106													
DDHD2	gene	DDHD2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive paraplegia 54 (#615033). Complex form of disease ataxia reported amongst the phenotypic features in Citterio et al. (2014), Journal of Neurology, 261, pp.373-381 and Doi et al. (2014), Scientific Reports, 4, 7132.;Spastic paraplegia 54						False	3	100;0;0	21.664	False		ENSG00000085788	ENSG00000085788	HGNC:29106													
DDOST	gene	DDOST	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	DDOST-congenital disorder of glycosylation MONDO:0013789				22305527		False	3	67;33;0	21.664	True		ENSG00000244038	ENSG00000244038	HGNC:2728													
DDX39B	gene	DDX39B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, DDX39B-related				39918047		False	3	100;0;0	21.664	True		ENSG00000198563	ENSG00000198563	HGNC:13917													
DDX3X	gene	DDX3X	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958				30266093;26235985;25533962;33528536;30936465;31274575;30817323		False	3	100;0;0	21.664	True		ENSG00000215301	ENSG00000215301	HGNC:2745													
DEAF1	gene	DEAF1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, impaired expressive language, and with or without seizures 617171;Vulto-van Silfout-de Vries syndrome 615828				30923367;26048982;28940898;26834045		False	3	100;0;0	21.664	True		ENSG00000177030	ENSG00000177030	HGNC:14677													
DEGS1	gene	DEGS1	Expert Review Green;Expert list;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 18 618404						False	3	100;0;0	21.664	True		ENSG00000143753	ENSG00000143753	HGNC:13709													
DEGS1	gene	DEGS1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal							False	3	100;0;0	21.664	True		ENSG00000143753	ENSG00000143753	HGNC:13709													
DEGS1	gene	DEGS1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy hypomyelinating 18, MIM#618404				31186544;30620337;30620338		False	3	100;0;0	21.664	True		ENSG00000143753	ENSG00000143753	HGNC:13709													
DENND2B	gene	DENND2B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), DENND2B-related				PMID: 40717498		False	3	100;0;0	21.664	True		ENSG00000166444	ENSG00000166444	HGNC:11350													
DENND5A	gene	DENND5A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 49, MIM# 617281				27431290;27866705;32705489		False	3	100;0;0	21.664	True		ENSG00000184014	ENSG00000184014	HGNC:19344													
DENND5B	gene	DENND5B	Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with white matter anomalies, MONDO:0700092, DENND5B-related				PMID: 38387458		False	3	100;0;0	21.664	True		ENSG00000170456	ENSG00000170456	HGNC:28338													
DEPDC5	gene	DEPDC5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Epilepsy, familial focal, with variable foci 1 MIM#604364;Developmental and epileptic encephalopathy 111, MIM#	620504"				31444548;23542697;23542701		False	3	100;0;0	21.664	True		ENSG00000100150	ENSG00000100150	HGNC:18423													
DES	gene	DES	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Myofibrillar myopathy 1, MONDO:0011076				22395865, 20718792		False	3	50;50;0	21.664	True		ENSG00000175084	ENSG00000175084	HGNC:2770													
DGUOK	gene	DGUOK	Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070				11687800;12874104;15887277;23043144;26874653		False	3	50;0;50	21.664	True		ENSG00000114956	ENSG00000114956	HGNC:2858													
DGUOK	gene	DGUOK	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial Leukoencephalopathy;Mitochondrial DNA depletion syndrome 3						False	3	0;0;0	21.664	False		ENSG00000114956	ENSG00000114956	HGNC:2858													
DGUOK	gene	DGUOK	Expert Review Green;ClinGen	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070				11687800, 12874104, 15887277, 23043144, 26874653, 18205204, 29137425, 30956829, 35750291, 28215579, 20301766, 28215579, 17073823, 31127938		False	3	100;0;0	21.664	True		ENSG00000114956	ENSG00000114956	HGNC:2858													
DGUOK	gene	DGUOK	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070				11687800, 12874104, 15887277, 23043144, 26874653, 18205204, 29137425, 30956829, 35750291, 28215579, 20301766, 28215579, 17073823, 31127938		False	3	100;0;0	21.664	True		ENSG00000114956	ENSG00000114956	HGNC:2858													
DHCR24	gene	DHCR24	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Desmosterolosis, MONDO:0011217				11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936		False	3	100;0;0	21.664	True		ENSG00000116133	ENSG00000116133	HGNC:2859													
DHCR24	gene	DHCR24	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Desmosterolosis, MONDO:0011217				11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936		False	3	100;0;0	21.664	True		ENSG00000116133	ENSG00000116133	HGNC:2859													
DHCR7	gene	DHCR7	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Smith-Lemli-Opitz syndrome MIM#270400;Disorders of sterol biosynthesis				7560069;9634533		False	3	100;0;0	21.664	True		ENSG00000172893	ENSG00000172893	HGNC:2860													
DHDDS	gene	DHDDS	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type 1bb, MIM# 621567				27343064;21295283;28130426;29276052;32483926;36046393;24078709;28005406;36046393		False	3	100;0;0	21.664	True		ENSG00000117682	ENSG00000117682	HGNC:20603													
DHDDS	gene	DHDDS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental delay and seizures with or without movement abnormalities, MIM#617836;Congenital disorder of glycosylation, MIM#613861				29100083;27343064		False	3	100;0;0	21.664	True		ENSG00000117682	ENSG00000117682	HGNC:20603													
DHDDS	gene	DHDDS	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay and seizures with or without movement abnormalities, OMIM:617836				29100083;33798445;34182312;34382076		False	3	100;0;0	21.664	True		ENSG00000117682	ENSG00000117682	HGNC:20603													
DHFR	gene	DHFR	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Megaloblastic anemia due to dihydrofolate reductase deficiency, MIM#	613839"				21310276;21310277		False	3	100;0;0	21.664	True		ENSG00000228716	ENSG00000228716	HGNC:2861													
DHH	gene	DHH	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	46,XY gonadal dysgenesis-motor and sensory neuropathy syndrome, MONDO:0011766				31018998;29471294;11017805		False	3	100;0;0	21.664	True		ENSG00000139549	ENSG00000139549	HGNC:2865													
DHODH	gene	DHODH	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Miller syndrome MIM#263750;Disorders of pyrimidine metabolism				19915526		False	3	100;0;0	21.664	True		ENSG00000102967	ENSG00000102967	HGNC:2867													
DHPS	gene	DHPS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures and speech and walking impairment, MIM#618480				30661771		False	3	100;0;0	21.664	True		ENSG00000095059	ENSG00000095059	HGNC:2869													
DHRSX	gene	DHRSX	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type 1DD, MIM# 301133				38821050		False	3	100;0;0	21.664	True		ENSG00000169084	ENSG00000169084	HGNC:18399													
DHRSX	gene	DHRSX	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Congenital disorder of glycosylation, type 1DD, MIM#	301133"				38821050		False	3	100;0;0	21.664	True		ENSG00000169084	ENSG00000169084	HGNC:18399													
DHTKD1	gene	DHTKD1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	2-aminoadipic 2-oxoadipic aciduria MONDO:0008774				26141459, 25860818, 23141293		False	3	100;0;0	21.664	True		ENSG00000181192	ENSG00000181192	HGNC:23537													
DHX16	gene	DHX16	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuromuscular disease and ocular or auditory anomalies with or without seizures, MIM# 618733				PMID: 31256877;36211162		False	3	100;0;0	21.664	True		ENSG00000204560	ENSG00000204560	HGNC:2739													
DHX30	gene	DHX30	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with severe motor impairment and absent language, MIM#617804				29100085		False	3	100;0;0	21.664	True		ENSG00000132153	ENSG00000132153	HGNC:16716													
DHX9	gene	DHX9	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, MONDO:0015626, DHX9-related				37467750		False	3	100;0;0	21.664	False		ENSG00000135829	ENSG00000135829	HGNC:2750													
DIAPH1	gene	DIAPH1	Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive microcephaly-seizures-cortical blindness-developmental delay syndrome, MONDO:0014714				24781755, 26463574, 33662367, 36212620, 39076976, 39120629		False	3	100;0;0	21.664	True		ENSG00000131504	ENSG00000131504	HGNC:2876													
DIP2C	gene	DIP2C	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092), DIP2C-related				PMID: 38421105		False	3	50;50;0	21.664	True		ENSG00000151240	ENSG00000151240	HGNC:29150													
DLAT	gene	DLAT	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase E2 deficiency 245348;Dystonia				39007626;20022530;16049940		False	3	100;0;0	21.664	True		ENSG00000150768	ENSG00000150768	HGNC:2896													
DLAT	gene	DLAT	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase E2 deficiency MIM#245348				34138529		False	3	100;0;0	21.664	True		ENSG00000150768	ENSG00000150768	HGNC:2896													
DLD	gene	DLD	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dihydrolipoamide dehydrogenase deficiency MIM#246900				3769994;8506365;9934985;17404228;21558426;21930696		False	3	100;0;0	21.664	True		ENSG00000091140	ENSG00000091140	HGNC:2898													
DLG4	gene	DLG4	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 62 MIM#618793				33597769		False	3	100;0;0	21.664	True		ENSG00000132535	ENSG00000132535	HGNC:2903													
DLL1	gene	DLL1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;autism;seizures;variable brain abnormalities;scoliosis				31353024		False	3	100;0;0	21.664	True		ENSG00000198719	ENSG00000198719	HGNC:2908													
DMD	gene	DMD	Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Becker muscular dystrophy 300376				20301298		False	3	100;0;0	21.664	True		ENSG00000198947	ENSG00000198947	HGNC:2928													
DMD	gene	DMD	Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Duchenne muscular dystrophy 310200;Becker muscular dystrophy 300376				20301298		False	3	100;0;0	21.664	True		ENSG00000198947	ENSG00000198947	HGNC:2928													
DMXL2	gene	DMXL2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 81, MIM#	618663"				31688942;30237576		False	3	100;0;0	21.664	True		ENSG00000104093	ENSG00000104093	HGNC:2938													
DNA2	gene	DNA2	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 6 MIM#615156				31636600;23352259;25635128;28554558		False	3	50;50;0	21.664	True		ENSG00000138346	ENSG00000138346	HGNC:2939													
DNA2	gene	DNA2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Seckel syndrome 8, MIM#615807;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 6 MIM#615156				24389050;31045292;23352259;25635128;28554558		False	3	100;0;0	21.664	True		ENSG00000138346	ENSG00000138346	HGNC:2939													
DNAJB2	gene	DNAJB2	Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881)						False	3	100;0;0	21.664	True		ENSG00000135924	ENSG00000135924	HGNC:5228													
DNAJB2	gene	DNAJB2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881)				22522442;25274842;33369814;22522442		False	3	100;0;0	21.664	False		ENSG00000135924	ENSG00000135924	HGNC:5228													
DNAJB4	gene	DNAJB4	Expert Review Green;Literature;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	distal myopathy MONDO:0018949;Myopathy, MONDO:0005336, DNAJB4-related				36512060;36264506		False	3	100;0;0	21.664	True		ENSG00000162616	ENSG00000162616	HGNC:14886													
DNAJB6	gene	DNAJB6	Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Muscular dystrophy, limb-girdle, type 1E, 603511				26847086;26338452;24170373		False	3	100;0;0	21.664	True		ENSG00000105993	ENSG00000105993	HGNC:14888													
DNAJC12	gene	DNAJC12	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#	617384"				28132689;30139987;28892570		False	3	100;0;0	21.664	True		ENSG00000108176	ENSG00000108176	HGNC:28908													
DNAJC12	gene	DNAJC12	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384						False	3	100;0;0	21.664	True		ENSG00000108176	ENSG00000108176	HGNC:28908													
DNAJC12	gene	DNAJC12	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, mild, non-BH4-deficient, 617384						False	3	100;0;0	21.664	True		ENSG00000108176	ENSG00000108176	HGNC:28908													
DNAJC19	gene	DNAJC19	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type V MIM#610198				16055927;17244376;22797137		False	3	100;0;0	21.664	True		ENSG00000205981	ENSG00000205981	HGNC:30528													
DNAJC19	gene	DNAJC19	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type V 610198;dilated cardiomyopathy with ataxia (DCMA) syndrome;3-methylglutaconic aciduria type V, 610198						False	3	100;0;0	21.664	False		ENSG00000205981	ENSG00000205981	HGNC:30528													
DNAJC3	gene	DNAJC3	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, combined cerebellar and peripheral, with hearing loss and diabetes mellitus, MIM# 616192				25466870;32738013;34654017		False	3	100;0;0	21.664	True		ENSG00000102580	ENSG00000102580	HGNC:9439													
DNAJC3	gene	DNAJC3	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile-onset diabetes mellitus-central and peripheral neurodegeneration syndrome, MONDO:0014523				34654017;34630333;33486469;32738013;28940199		False	3	100;0;0	21.664	True		ENSG00000102580	ENSG00000102580	HGNC:9439													
DNAJC30	gene	DNAJC30	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leber Hereditary Optic Neuropathy, MIM#619382				PMID: 33465056		False	3	100;0;0	21.664	True		ENSG00000176410	ENSG00000176410	HGNC:16410													
DNAJC5	gene	DNAJC5	Expert list;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083				22978711;21820099;22235333;31919451;26659577		False	3	100;0;0	21.664	False		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNAJC5	gene	DNAJC5	Expert list;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083				22978711;21820099;22235333		False	3	100;0;0	21.664	True		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNAJC5	gene	DNAJC5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083						False	3	100;0;0	21.664	False		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNAJC5	gene	DNAJC5	Expert list;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083				21820099;22073189;22235333;22978711		False	3	100;0;0	21.664	True		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNAJC5	gene	DNAJC5	Expert Review Green;ClinGen	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083				22978711;21820099;22235333;31919451;26659577		False	3	100;0;0	21.664	True		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNAJC6	gene	DNAJC6	Expert list;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 19a, juvenile-onset - MIM#615528;Parkinson disease 19b, early-onset - MIM#615528				22563501, 23211418, 26528954, 33983693		False	3	100;0;0	21.664	True		ENSG00000116675	ENSG00000116675	HGNC:15469													
DNM1	gene	DNM1	Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 31A, autosomal dominant, MIM# 616346;Developmental and epileptic encephalopathy 31B, autosomal recessive, MIM# 620352				25262651;27066543;33372033;34172529;36553519;37900685		False	3	100;0;0	21.664	True		ENSG00000106976	ENSG00000106976	HGNC:2972													
DNM1L	gene	DNM1L	Literature;ClinGen;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726				31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748		False	3	100;0;0	21.664	True	Other	ENSG00000087470	ENSG00000087470	HGNC:2973													
DNM1L	gene	DNM1L	Expert Review Green;Literature;ClinGen	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726				31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748		False	3	100;0;0	21.664	True	Other	ENSG00000087470	ENSG00000087470	HGNC:2973													
DNM1L	gene	DNM1L	ClinGen;Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726				31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748		False	3	0;0;0	21.664	False	Other	ENSG00000087470	ENSG00000087470	HGNC:2973													
DNM2	gene	DNM2	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	autosomal dominant centronuclear myopathy MONDO:0008048				16227997;33458580;30232666;24465259;23938035		False	3	100;0;0	21.664	True		ENSG00000079805	ENSG00000079805	HGNC:2974													
DNM2	gene	DNM2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	"Centronuclear myopathy 1	160150	AD	3 Charcot-Marie-Tooth disease, axonal type 2M, MIM#	606482;Charcot-Marie-Tooth disease, dominant intermediate B, MIM#	606482;Lethal congenital contracture syndrome 5, MIM#	615368"						False	3	100;0;0	21.664	True		ENSG00000079805	ENSG00000079805	HGNC:2974													
DNM2	gene	DNM2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Charcot-Marie-Tooth disease, axonal type 2M, MIM# 606482;Charcot-Marie-Tooth disease, dominant intermediate B, MIM# 606482;MONDO:0011674				15731758;17636067;33459893;31628461		False	3	100;0;0	21.664	False		ENSG00000079805	ENSG00000079805	HGNC:2974													
DNMT1	gene	DNMT1	Expert Review Green;ClinGen;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584				22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424		False	3	100;0;0	21.664	False		ENSG00000130816	ENSG00000130816	HGNC:2976													
DNMT1	gene	DNMT1	ClinGen;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584				22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424		False	3	0;100;0	21.664	False		ENSG00000130816	ENSG00000130816	HGNC:2976													
DNMT1	gene	DNMT1	Expert Review Green;ClinGen;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584				22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424		False	3	100;0;0	21.664	False		ENSG00000130816	ENSG00000130816	HGNC:2976													
DOCK3	gene	DOCK3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292						False	3	100;0;0	21.664	True		ENSG00000088538	ENSG00000088538	HGNC:2989													
DOCK6	gene	DOCK6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adams-Oliver syndrome 2 MIM#614219				28884918;40481473;30111349		False	3	100;0;0	21.664	True		ENSG00000130158	ENSG00000130158	HGNC:19189													
DOCK7	gene	DOCK7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 23 MIM#615859;MONDO:0014371				24814191;30771731;30807358		False	3	100;0;0	21.664	True		ENSG00000116641	ENSG00000116641	HGNC:19190													
DOHH	gene	DOHH	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, DOHH-related (MONDO#0700092)				PMID: 30661771;35858628		False	3	100;0;0	21.664	True		ENSG00000129932	ENSG00000129932	HGNC:28662													
DOK7	gene	DOK7	Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Myasthenic syndrome, congenital, 10	254300"				31453852;32360404;31561939;31449669		False	3	100;0;0	21.664	True		ENSG00000175920	ENSG00000175920	HGNC:26594													
DOLK	gene	DOLK	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	DK1-CDG, MONDO:0012556;Congenital disorder of glycosylation, type Im, MIM# 610768				17273964;22242004;23890587;30653653;28816422;24144945		False	3	100;0;0	21.664	True		ENSG00000175283	ENSG00000175283	HGNC:23406													
DOLK	gene	DOLK	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation type Im, 610768				23890587;28816422;24144945		False	3	100;0;0	21.664	True		ENSG00000175283	ENSG00000175283	HGNC:23406													
DOP1A	gene	DOP1A	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DOP1A-related				42164854;38818041		False	3	100;0;0	21.664	True		ENSG00000083097	ENSG00000083097	HGNC:21194													
DPAGT1	gene	DPAGT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ij, MIM# 608093;DPAGT1-CDG MONDO:0011964				12872255;22492991;22304930;31153949;30653653;30117111		False	3	100;0;0	21.664	True		ENSG00000172269	ENSG00000172269	HGNC:2995													
DPAGT1	gene	DPAGT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ij, MIM# 608093;DPAGT1-CDG MONDO:0011964				12872255;22492991;22304930;31153949;30653653;30117111		False	3	100;0;0	21.664	True		ENSG00000172269	ENSG00000172269	HGNC:2995													
DPM1	gene	DPM1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ie, MIM# 608799				23856421;16641202;10642602;10642597		False	3	100;0;0	21.664	True		ENSG00000000419	ENSG00000000419	HGNC:3005													
DPM1	gene	DPM1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ie, 608799				23856421		False	3	100;0;0	21.664	True		ENSG00000000419	ENSG00000000419	HGNC:3005													
DPM2	gene	DPM2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Iu, MIM#615042				23109149;33129689		False	3	100;0;0	21.664	True		ENSG00000136908	ENSG00000136908	HGNC:3006													
DPM3	gene	DPM3	Expert Review Green;Expert Review;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15	MIM#612937"				19576565;28803818;31266720		False	3	100;0;0	21.664	True		ENSG00000179085	ENSG00000179085	HGNC:3007													
DPM3	gene	DPM3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 , MIM#612937;Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992				31266720;28803818;19576565;31266720;31469168		False	3	100;0;0	21.664	True		ENSG00000179085	ENSG00000179085	HGNC:3007													
DPYD	gene	DPYD	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dihydropyrimidine dehydrogenase deficiency 274270;5-fluorouracil toxicity 274270						False	3	0;0;0	21.664	False		ENSG00000188641	ENSG00000188641	HGNC:3012													
DPYD	gene	DPYD	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dihydropyrimidine dehydrogenase deficiency, MIM# 274270				19296131;10071185;29152729		False	3	100;0;0	21.664	True		ENSG00000188641	ENSG00000188641	HGNC:3012													
DPYD	gene	DPYD	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dihydropyrimidine dehydrogenase deficiency MIM#274270;5-fluorouracil toxicity MIM#274270;Disorders of pyrimidine metabolism				8051923		False	3	100;0;0	21.664	True		ENSG00000188641	ENSG00000188641	HGNC:3012													
DPYS	gene	DPYS	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dihydropyrimidinuria MIM#222748;Disorders of pyrimidine metabolism						False	3	100;0;0	21.664	True		ENSG00000147647	ENSG00000147647	HGNC:3013													
DRD1	gene	DRD1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DRD1-related				41966088;37048120		False	3	100;0;0	21.664	True		ENSG00000184845	ENSG00000184845	HGNC:3020													
DRD2	gene	DRD2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Combined dystonia, MONDO:0020065, DRD2-related;dystonia;chorea;anxiety;ataxia;orofacial dyskinesia;tremor;memory problems				33200438		False	3	100;0;0	21.664	True	Other	ENSG00000149295	ENSG00000149295	HGNC:3023													
DRP2	gene	DRP2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Charcot Marie Tooth, intermediate X-linked;HMSN				22764250;26227883;31217940		False	3	100;0;0	21.664	False		ENSG00000102385	ENSG00000102385	HGNC:3032													
DSCAM	gene	DSCAM	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO:0700092), DSCAM-related				42063257;28600779;33170561		False	3	100;0;0	21.664	True		ENSG00000171587	ENSG00000171587	HGNC:3039													
DST	gene	DST	Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type VI MIM#614653				28468842;32528525;22522446;30371979		False	3	100;0;0	21.664	True		ENSG00000151914	ENSG00000151914	HGNC:1090													
DST	gene	DST	Literature;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neuropathy, hereditary sensory and autonomic, type VI, MIM#	614653;MONDO:0013839;HSAN/SFN"				22522446;30371979;28468842		False	3	100;0;0	21.664	False		ENSG00000151914	ENSG00000151914	HGNC:1090													
DTNA	gene	DTNA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Muscular dystrophy, MONDO:0020121, DTNA-related				PMID: 36799992		False	3	50;50;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000134769	ENSG00000134769	HGNC:3057													
DYNC1H1	gene	DYNC1H1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 13, MIM# 614563				21820100;32788638;27549087;25512093;28196890		False	3	100;0;0	21.664	True		ENSG00000197102	ENSG00000197102	HGNC:2961													
DYNC1H1	gene	DYNC1H1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, axonal, type 20, MIM# 614228				21820100;32788638;27549087		False	3	100;0;0	21.664	False		ENSG00000197102	ENSG00000197102	HGNC:2961													
DYRK1A	gene	DYRK1A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 7, MIM# 614104;MONDO:0013578				25707398;21294719;23160955;23099646;33159716		False	3	100;0;0	21.664	True		ENSG00000157540	ENSG00000157540	HGNC:3091													
DYSF	gene	DYSF	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, type 2B 253601;Myopathy, distal, with anterior tibial onset  606768;Miyoshi muscular dystrophy 1 254130				32978841;27602406		False	3	100;0;0	21.664	True		ENSG00000135636	ENSG00000135636	HGNC:3097													
DYSF	gene	DYSF	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, distal, with anterior tibial onset, 606768;Miyoshi muscular dystrophy 1, 254130;Muscular dystrophy, limb-girdle, type 2B, 253601				23243261		False	3	100;0;0	21.664	True		ENSG00000135636	ENSG00000135636	HGNC:3097													
EARS2	gene	EARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome MONDO:0009723;Combined oxidative phosphorylation deficiency 12 MIM#614924;leukoencephalopathy-thalamus and brainstem anomalies-high lactate syndrome MONDO:0013971				22492562;23008233;25854774;26619324;26893310;27206875;27571996;27117034		False	3	100;0;0	21.664	True		ENSG00000103356	ENSG00000103356	HGNC:29419													
EARS2	gene	EARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome MONDO:0009723;Combined oxidative phosphorylation deficiency 12 MIM#614924;leukoencephalopathy-thalamus and brainstem anomalies-high lactate syndrome MONDO:0013971				22492562;23008233;25854774;26619324;26893310;27206875;27571996;27117034		False	3	100;0;0	21.664	True		ENSG00000103356	ENSG00000103356	HGNC:29419													
EARS2	gene	EARS2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Combined oxidative phosphorylation deficiency 12, MIM#	614924;Leukoencephalopathy with thalamus and brainstem involvement and high lactate"				22492562;23008233;25854774;26619324;26893310		False	3	100;0;0	21.664	True		ENSG00000103356	ENSG00000103356	HGNC:29419													
EBF3	gene	EBF3	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypotonia, ataxia and delayed development syndrome, 617330						False	3	100;0;0	21.664	False		ENSG00000108001	ENSG00000108001	HGNC:19087													
ECHS1	gene	ECHS1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM#	616277"				32677093;32858208		False	3	100;0;0	21.664	True		ENSG00000127884	ENSG00000127884	HGNC:3151													
ECHS1	gene	ECHS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome MONDO:0009723				26000322;25393721;25125611;28409271;29575569;28755360;26099313		False	3	100;0;0	21.664	True		ENSG00000127884	ENSG00000127884	HGNC:3151													
ECHS1	gene	ECHS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277				PMID: 29575569;35098523		False	3	100;0;0	21.664	True		ENSG00000127884	ENSG00000127884	HGNC:3151													
ECHS1	gene	ECHS1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM#	616277"				31399326;25125611;25393721		False	3	100;0;0	21.664	True		ENSG00000127884	ENSG00000127884	HGNC:3151													
ECM1	gene	ECM1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Urbach-Wiethe disease, MIM# 247100				27398129;26336196;12603844		False	3	100;0;0	21.664	True		ENSG00000143369	ENSG00000143369	HGNC:3153													
ECM1	gene	ECM1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Urbach-Wiethe disease, MIM# 247100				PMID: 11929856;28434238		False	3	100;0;0	21.664	True		ENSG00000143369	ENSG00000143369	HGNC:3153													
EDEM3	gene	EDEM3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type 2V, MIM# 619493				34143952		False	3	100;0;0	21.664	True		ENSG00000116406	ENSG00000116406	HGNC:16787													
EEF1A2	gene	EEF1A2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 38, MIM# 616393;MONDO:0014617;Developmental and epileptic encephalopathy 33, MIM# 616409;MONDO:0014625				24697219;32196822;32160274;32062104;31893083		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000101210	ENSG00000101210	HGNC:3192													
EEF1B2	gene	EEF1B2	Expert Review Green;Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092;non-syndromic ID and seizures				31845318;21937992;35015920		False	3	100;0;0	21.664	True		ENSG00000114942	ENSG00000114942	HGNC:3208													
EEFSEC	gene	EEFSEC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102				39753114		False	3	100;0;0	21.664	True		ENSG00000132394	ENSG00000132394	HGNC:24614													
EEFSEC	gene	EEFSEC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102				39753114		False	3	100;0;0	21.664	True		ENSG00000132394	ENSG00000132394	HGNC:24614													
EFTUD2	gene	EFTUD2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mandibulofacial dysostosis, Guion-Almeida type, MIM#610536				22305528;19334086		False	3	100;0;0	21.664	True		ENSG00000108883	ENSG00000108883	HGNC:30858													
EGR2	gene	EGR2	Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 1D 607678 AD;Dejerine-Sottas disease 145900 AD, AR;Hypomyelinating neuropathy, congenital, 1 605253 AD, AR				11523566;31852952		False	3	100;0;0	21.664	False	Other	ENSG00000122877	ENSG00000122877	HGNC:3239													
EHMT1	gene	EHMT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Kleefstra syndrome 1, MIM# 610253;MONDO:0027407				16826528;19264732;19293338;22670143;30448833		False	3	100;0;0	21.664	True		ENSG00000181090	ENSG00000181090	HGNC:24650													
EIF2AK2	gene	EIF2AK2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness;early onset dystonia				33236446;33866603		False	3	100;0;0	21.664	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
EIF2AK2	gene	EIF2AK2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness				32197074		False	3	100;0;0	21.664	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
EIF2AK2	gene	EIF2AK2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877;Neurodevelopmental Syndrome;Developmental delays;Ataxia;Parkinsonism;White matter alterations				PMID: 32197074		False	3	100;0;0	21.664	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
EIF2AK2	gene	EIF2AK2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877				PMID: 32197074		False	3	100;0;0	21.664	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
EIF2B1	gene	EIF2B1	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896;Neonatal diabetes mellitus, MONDO:0016391, EIF2B1-related				11835386;26285592;15776425;18263758;25843247;25761052;30014503;31882561		False	3	100;0;0	21.664	True		ENSG00000111361	ENSG00000111361	HGNC:3257													
EIF2B1	gene	EIF2B1	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	21.664	True		ENSG00000111361	ENSG00000111361	HGNC:3257													
EIF2B1	gene	EIF2B1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"						False	3	100;0;0	21.664	True		ENSG00000111361	ENSG00000111361	HGNC:3257													
EIF2B2	gene	EIF2B2	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	21.664	True		ENSG00000119718	ENSG00000119718	HGNC:3258													
EIF2B2	gene	EIF2B2	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter, MIM#603896;Ovarioleukodystrophy, MIM# 603896				21484434;14566705;28041799;30266093;28597716		False	3	100;0;0	21.664	True		ENSG00000119718	ENSG00000119718	HGNC:3258													
EIF2B2	gene	EIF2B2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"						False	3	100;0;0	21.664	True		ENSG00000119718	ENSG00000119718	HGNC:3258													
EIF2B3	gene	EIF2B3	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	leukoencephalopathy with vanishing white matter MONDO:0011380				11835386;19158808;21484434;18263758;25843247;25761052;28904586;28597716		False	3	100;0;0	21.664	True		ENSG00000070785	ENSG00000070785	HGNC:3259													
EIF2B3	gene	EIF2B3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"						False	3	100;0;0	21.664	True		ENSG00000070785	ENSG00000070785	HGNC:3259													
EIF2B3	gene	EIF2B3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	21.664	True		ENSG00000070785	ENSG00000070785	HGNC:3259													
EIF2B4	gene	EIF2B4	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	leukoencephalopathy with vanishing white matter MONDO:0011380				11835386;12707859;18263758;25843247;25761052;30014503		False	3	100;0;0	21.664	True		ENSG00000115211	ENSG00000115211	HGNC:3260													
EIF2B4	gene	EIF2B4	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"						False	3	100;0;0	21.664	True		ENSG00000115211	ENSG00000115211	HGNC:3260													
EIF2B4	gene	EIF2B4	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	21.664	True		ENSG00000115211	ENSG00000115211	HGNC:3260													
EIF2B5	gene	EIF2B5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with vanishing white matter, MIM#	603896"						False	3	100;0;0	21.664	True		ENSG00000145191	ENSG00000145191	HGNC:3261													
EIF2B5	gene	EIF2B5	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	leukoencephalopathy with vanishing white matter MONDO:0011380				11704758;12325082;12707859;14694060;15136689;18263758;25843247;25761052		False	3	100;0;0	21.664	True		ENSG00000145191	ENSG00000145191	HGNC:3261													
EIF2B5	gene	EIF2B5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	21.664	True		ENSG00000145191	ENSG00000145191	HGNC:3261													
EIF2S3	gene	EIF2S3	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	MEHMO syndrome MIM# 300148				33714664;32799315;28055140		False	3	100;0;0	21.664	True		ENSG00000130741	ENSG00000130741	HGNC:3267													
EIF3F	gene	EIF3F	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mental retardation, autosomal recessive 67, MIM#	618295"				30409806		False	3	100;0;0	21.664	True		ENSG00000175390	ENSG00000175390	HGNC:3275													
EIF4A2	gene	EIF4A2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455				37485550		False	3	100;0;0	21.664	True		ENSG00000156976	ENSG00000156976	HGNC:3284													
EIF4A2	gene	EIF4A2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455				PMID: 36528028		False	3	100;0;0	21.664	True	Other	ENSG00000156976	ENSG00000156976	HGNC:3284													
ELAC2	gene	ELAC2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 17, MIM#615440				23849775;31045291		False	3	100;0;0	21.664	True		ENSG00000006744	ENSG00000006744	HGNC:14198													
ELFN1	gene	ELFN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dursun-Ozgul neurodevelopmental syndrome, MIM# 621344				PMID:40576023		False	3	100;0;0	21.664	True		ENSG00000225968	ENSG00000225968	HGNC:33154													
ELFN1	gene	ELFN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dursun-Ozgul neurodevelopmental syndrome, MIM# 621344				PMID:40576023		False	3	100;0;0	21.664	True		ENSG00000225968	ENSG00000225968	HGNC:33154													
ELOVL1	gene	ELOVL1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, MIM# 618527				29496980;32123819;30487246		False	3	100;0;0	21.664	False		ENSG00000066322	ENSG00000066322	HGNC:14418													
ELOVL1	gene	ELOVL1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, MIM#	618527"				29496980;32123819;30487246		False	3	100;0;0	21.664	True		ENSG00000066322	ENSG00000066322	HGNC:14418													
ELOVL4	gene	ELOVL4	Expert Review Green;Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ichthyosis, spastic quadriplegia, and mental retardation (MIM#614457)				22100072;24571530;33652762		False	3	100;0;0	21.664	True		ENSG00000118402	ENSG00000118402	HGNC:14415													
ELOVL4	gene	ELOVL4	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190						False	3	100;0;0	21.664	False		ENSG00000118402	ENSG00000118402	HGNC:14415													
ELOVL5	gene	ELOVL5	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 38, MIM#615957				25065913		False	3	100;0;0	21.664	False		ENSG00000012660	ENSG00000012660	HGNC:21308													
ELP1	gene	ELP1	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Familial dysautonomia;NEUROPATHY, HEREDITARY SENSORY AND AUTONOMIC, TYPE III;Dysautonomia, familial, 223900				17985250;11179021;11179008;8102296		False	3	0;0;0	21.664	False		ENSG00000070061	ENSG00000070061	HGNC:5959													
ELP1	gene	ELP1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dysautonomia, familial, 223900;Riley-Day syndrome MONDO:0009131;Hereditary sensory and autonomic neuropathy 3;HSAN/SFN				11179008;11179021;17644305		False	3	100;0;0	21.664	False		ENSG00000070061	ENSG00000070061	HGNC:5959													
EMC1	gene	EMC1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, EMC1-related				35234901;26942288		False	3	100;0;0	21.664	True		ENSG00000127463	ENSG00000127463	HGNC:28957													
EMC10	gene	EMC10	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with dysmorphic facies and variable seizures, MIM# 619264				32869858;33531666;35684946;37318954;40150819		False	3	100;0;0	21.664	True		ENSG00000161671	ENSG00000161671	HGNC:27609													
EMD	gene	EMD	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Emery-Dreifuss muscular dystrophy 1, X-linked 310300				21697856;31802929		False	3	100;0;0	21.664	True		ENSG00000102119	ENSG00000102119	HGNC:3331													
EML1	gene	EML1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Band heterotopia (MIM# 600348)				31710781		False	3	100;0;0	21.664	True		ENSG00000066629	ENSG00000066629	HGNC:3330													
ENG	gene	ENG	Expert Review Green;Genomics England PanelApp;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Telangiectasia, hereditary hemorrhagic, type 1 187300				15024723;20301525		False	3	100;0;0	21.664	False		ENSG00000106991	ENSG00000106991	HGNC:3349													
ENO3	gene	ENO3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease XIII, MIM#612932				31741825;11506403;18070103;25267339		False	3	100;0;0	21.664	True		ENSG00000108515	ENSG00000108515	HGNC:3354													
ENO3	gene	ENO3	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease XIII 612932				11506403;31741825;25267339		False	3	100;0;0	21.664	True		ENSG00000108515	ENSG00000108515	HGNC:3354													
ENTPD1	gene	ENTPD1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 64, autosomal recessive, MIM# 615683				35471564		False	3	100;0;0	21.664	True		ENSG00000138185	ENSG00000138185	HGNC:3363													
ENTPD1	gene	ENTPD1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 64, autosomal recessive MIM#615683				24482476;30652007;35471564		False	3	100;0;0	21.664	True		ENSG00000138185	ENSG00000138185	HGNC:3363													
EOGT	gene	EOGT	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adams-Oliver syndrome 4 (MIM  #615297);scalp aplasia cutis congenita;transverse terminal limb defects						False	3	100;0;0	21.664	True		ENSG00000163378	ENSG00000163378	HGNC:28526													
EP400	gene	EP400	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder with or without early-onset generalized epilepsy - MONDO:0030930				39708813		False	3	100;0;0	21.664	True		ENSG00000183495	ENSG00000183495	HGNC:11958													
EPB41L3	gene	EPB41L3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities MONDO:0030063				39292993		False	3	100;0;0	21.664	True		ENSG00000082397	ENSG00000082397	HGNC:3380													
EPG5	gene	EPG5	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Vici syndrome MIM#242840;Congenital disorders of autophagy				23222957;26715604		False	3	100;0;0	21.664	True		ENSG00000152223	ENSG00000152223	HGNC:29331													
EPG5	gene	EPG5	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of autophagy;Vici syndrome MONDO:0009452;Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506				33674710;34130600;29884839;41053928;36410285;40192014		False	3	100;0;0	21.664	True		ENSG00000152223	ENSG00000152223	HGNC:29331													
EPG5	gene	EPG5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder with parkinsonism or other movement abnormalities MONDO:0980990				41159719;41053928;40192014		False	3	100;0;0	21.664	True		ENSG00000152223	ENSG00000152223	HGNC:29331													
EPG5	gene	EPG5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506				41053928;36410285;40192014		False	3	100;0;0	21.664	True		ENSG00000152223	ENSG00000152223	HGNC:29331													
EPG5	gene	EPG5	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Vici syndrome, MIM# 242840				23222957;26917586		False	3	100;0;0	21.664	True		ENSG00000152223	ENSG00000152223	HGNC:29331													
EPHB4	gene	EPHB4	Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Capillary malformation-arteriovenous malformation 2, 618196						False	3	100;0;0	21.664	False		ENSG00000196411	ENSG00000196411	HGNC:3395													
EPM2A	gene	EPM2A	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780				9771710		False	3	100;0;0	21.664	True		ENSG00000112425	ENSG00000112425	HGNC:3413													
EPM2A	gene	EPM2A	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780				12019207		False	3	100;0;0	21.664	True		ENSG00000112425	ENSG00000112425	HGNC:3413													
EPM2A	gene	EPM2A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lafora disease MONDO:0009697				9771710;9931343;11175283;12019207;12560877;14722920		False	3	100;0;0	21.664	True		ENSG00000112425	ENSG00000112425	HGNC:3413													
EPM2A	gene	EPM2A	Expert Review Green;Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive myoclonic epilepsy 2A, Lafora, 254780;Epilepsy, progressive myoclonic 2A (Lafora) 254780						False	3	100;0;0	21.664	False		ENSG00000112425	ENSG00000112425	HGNC:3413													
EPRS1	gene	EPRS1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 15, MIM#	617951"				29576217		False	3	100;0;0	21.664	True		ENSG00000136628	ENSG00000136628	HGNC:3418													
ERBB3	gene	ERBB3	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Visceral neuropathy, familial, 1, autosomal recessive, MIM# 243180;Complex neurocristinopathy				17701904;31752936;33720042;33497358		False	3	100;0;0	21.664	True		ENSG00000065361	ENSG00000065361	HGNC:3431													
ERBB4	gene	ERBB4	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 19 MIM#615515				24119685;28889094		False	3	100;0;0	21.664	True		ENSG00000178568	ENSG00000178568	HGNC:3432													
ERCC4	gene	ERCC4	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM#	278760"				29403087;28431612;29892709		False	3	100;0;0	21.664	False		ENSG00000175595	ENSG00000175595	HGNC:3436													
ERCC6	gene	ERCC6	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne syndrome, type B, MIM#133540				17092472;20522568		False	3	100;0;0	21.664	True		ENSG00000225830	ENSG00000225830	HGNC:3438													
ERCC6	gene	ERCC6	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne syndrome;UV-sensitive syndrome;General Leukodystrophy & Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000225830	ENSG00000225830	HGNC:3438													
ERCC6	gene	ERCC6	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne syndrome, type B MIM#133540				25453614;20301516		False	3	100;0;0	21.664	True		ENSG00000225830	ENSG00000225830	HGNC:3438													
ERCC8	gene	ERCC8	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne syndrome, type A, MIM# 216400				26204423;17092472;20522568		False	3	100;0;0	21.664	True		ENSG00000049167	ENSG00000049167	HGNC:3439													
ERCC8	gene	ERCC8	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne syndrome, type A MIM#216400						False	3	100;0;0	21.664	True		ENSG00000049167	ENSG00000049167	HGNC:3439													
ERCC8	gene	ERCC8	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cockayne Syndrome;UV-sensitive syndrome;General Leukodystrophy & Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000049167	ENSG00000049167	HGNC:3439													
ERLIN1	gene	ERLIN1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 62, 615681;Hereditary spastic paraplegia						False	3	100;0;0	21.664	True		ENSG00000107566	ENSG00000107566	HGNC:16947													
ERLIN2	gene	ERLIN2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 18, autosomal recessive, MIM# 611225;Spastic paraplegia 18A, autosomal dominant, MIM# 620512				23109145;21330303;32094424;29528531		False	3	100;0;0	21.664	True		ENSG00000147475	ENSG00000147475	HGNC:1356													
ERLIN2	gene	ERLIN2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	hereditary spastic paraplegia 18 MONDO:0012639				38607533;38427163;34734492;32042907		False	3	100;0;0	21.664	True		ENSG00000147475	ENSG00000147475	HGNC:1356													
ESAM	gene	ESAM	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with intracranial haemorrhage, seizures, and spasticity, MIM# 620371				36996813		False	3	100;0;0	21.664	True		ENSG00000149564	ENSG00000149564	HGNC:17474													
ESAM	gene	ESAM	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with intracranial haemorrhage, seizures, and spasticity, MIM# 620371				36996813		False	3	100;0;0	21.664	True		ENSG00000149564	ENSG00000149564	HGNC:17474													
ESRRG	gene	ESRRG	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Movement disorder, MONDO:0005395, ESRRG-related				41265451		False	3	100;0;0	21.664	True		ENSG00000196482	ENSG00000196482	HGNC:3474													
ETFA	gene	ETFA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIA MIM#231680;Multiple acyl-CoA dehydrogenase deficiency (MADD)				1882842;12815589		False	3	100;0;0	21.664	True		ENSG00000140374	ENSG00000140374	HGNC:3481													
ETFA	gene	ETFA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIA, MIM# 231680						False	3	100;0;0	21.664	True		ENSG00000140374	ENSG00000140374	HGNC:3481													
ETFA	gene	ETFA	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIA 231680				21347544;1430199		False	3	100;0;0	21.664	True		ENSG00000140374	ENSG00000140374	HGNC:3481													
ETFB	gene	ETFB	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIB MIM#231680;Multiple acyl-CoA dehydrogenase deficiency (MADD)				12815589;7912128		False	3	100;0;0	21.664	True		ENSG00000105379	ENSG00000105379	HGNC:3482													
ETFB	gene	ETFB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIB, MIM# 231680						False	3	100;0;0	21.664	True		ENSG00000105379	ENSG00000105379	HGNC:3482													
ETFDH	gene	ETFDH	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIC, MIM# 231680						False	3	100;0;0	21.664	True		ENSG00000171503	ENSG00000171503	HGNC:3483													
ETFDH	gene	ETFDH	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple acyl-CoA dehydrogenase deficiency MONDO:0009282;sensory neuropathy				32608139;35309592;26821934		False	3	100;0;0	21.664	True		ENSG00000171503	ENSG00000171503	HGNC:3483													
ETFDH	gene	ETFDH	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIC MIM#231680;Multiple acyl-CoA dehydrogenase deficiency (MADD)				19249206;17412732		False	3	100;0;0	21.664	True		ENSG00000171503	ENSG00000171503	HGNC:3483													
ETFDH	gene	ETFDH	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIC 231680				17412732;27038534		False	3	100;0;0	21.664	True		ENSG00000171503	ENSG00000171503	HGNC:3483													
ETFDH	gene	ETFDH	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy;Glutaric Acidemia IIC						False	3	0;0;0	21.664	False		ENSG00000171503	ENSG00000171503	HGNC:3483													
ETHE1	gene	ETHE1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ethylmalonic encephalopathy , MIM#602473				14732903;28933811		False	3	100;0;0	21.664	True		ENSG00000105755	ENSG00000105755	HGNC:23287													
ETHE1	gene	ETHE1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ethylmalonic encephalopathy, MIM#	602473"				18593870		False	3	100;0;0	21.664	True		ENSG00000105755	ENSG00000105755	HGNC:23287													
ETHE1	gene	ETHE1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ethylmalonic encephalopathy , MIM#602473				14732903;28933811		False	3	100;0;0	21.664	True		ENSG00000105755	ENSG00000105755	HGNC:23287													
EXOC7	gene	EXOC7	Expert Review Green;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	brain atrophy;seizures;developmental delay;microcephaly				PMID: 32103185		False	3	100;0;0	21.664	True		ENSG00000182473	ENSG00000182473	HGNC:23214													
EXOSC3	gene	EXOSC3	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 1B, MIM# 614678				22544365;23284067;24524299		False	3	100;0;0	21.664	True		ENSG00000107371	ENSG00000107371	HGNC:17944													
EXOSC5	gene	EXOSC5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, brain abnormalities, and cardiac conduction defects, MIM# 619576;Short stature;Motor developmental delays;Cerebellar hypoplasia;Ataxia				32504085;29302074		False	3	100;0;0	21.664	True		ENSG00000077348	ENSG00000077348	HGNC:24662													
EXOSC8	gene	EXOSC8	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	dHMN/dSMA;Pontocerebellar hypoplasia, type 1c, MIM# 616081				24989451		False	3	100;0;0	21.664	True		ENSG00000120699	ENSG00000120699	HGNC:17035													
EXOSC9	gene	EXOSC9	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 1D, MIM# 618065				30690203;29727687		False	3	100;0;0	21.664	True		ENSG00000123737	ENSG00000123737	HGNC:9137													
EXT1	gene	EXT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Exostoses, multiple, type 1 133700;Multiple exostoses type I (Disorders of protein O-glycosylation, O-xylosylglycan synthesis deficiencies)				7550340;9521425		False	3	100;0;0	21.664	True		ENSG00000182197	ENSG00000182197	HGNC:3512													
EXT2	gene	EXT2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Seizures, scoliosis, and macrocephaly syndrome 616682;Exostoses, multiple, type 2 133701;Multiple exostoses type II (Disorders of protein O-glycosylation, O-xylosylglycan synthesis deficiencies)				30288735;30075207;26246518		False	3	100;0;0	21.664	True		ENSG00000151348	ENSG00000151348	HGNC:3513													
EXT2	gene	EXT2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seizures, scoliosis, and macrocephaly syndrome, MIM#616682						False	3	100;0;0	21.664	True		ENSG00000151348	ENSG00000151348	HGNC:3513													
EXTL3	gene	EXTL3	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunoskeletal dysplasia with neurodevelopmental abnormalities, MIM# 617425				28132690;28148688;28331220		False	3	100;0;0	21.664	True		ENSG00000012232	ENSG00000012232	HGNC:3518													
FA2H	gene	FA2H	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 35, autosomal recessive, MIM#	612319"				20104589;23745665;19068277;20853438;22146942		False	3	100;0;0	21.664	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FA2H	gene	FA2H	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia;Spastic paraplegia 35, autosomal recessive 612319;fatty acid hydroxylase-associated neurodegeneration				19068277;20104589;20853438;31135052		False	3	100;0;0	21.664	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FA2H	gene	FA2H	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 35, autosomal recessive	MIM#612319"				31135052		False	3	100;0;0	21.664	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FA2H	gene	FA2H	GeneReviews;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fatty acid hydroxylase-associated neurodegeneration (FAHN)						False	3	100;0;0	21.664	False		ENSG00000103089	ENSG00000103089	HGNC:21197													
FA2H	gene	FA2H	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 35, autosomal recessive, MIM#611026				29423566		False	3	100;0;0	21.664	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FA2H	gene	FA2H	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 35, autosomal recessive, MIM#612319				31837835;30446360;22965561;21592092		False	3	100;0;0	21.664	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FAH	gene	FAH	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Tyrosinemia, type I, MIM#	276700"						False	3	100;0;0	21.664	True		ENSG00000103876	ENSG00000103876	HGNC:3579													
FAM111A	gene	FAM111A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Kenny-Caffey syndrome, type 2, MIM# 127000				32734340;23996431;35205306		False	3	100;0;0	21.664	True		ENSG00000166801	ENSG00000166801	HGNC:24725													
FAM20C	gene	FAM20C	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Raine syndrome, MIM# 259775				27862258;20825432;36914045;34259997;32299476;29341424		False	3	50;0;50	21.664	True		ENSG00000177706	ENSG00000177706	HGNC:22140													
FAR1	gene	FAR1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Cataracts, spastic paraparesis, and speech delay, MIM#619338;Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#	616154"				PMID: 33239752		False	3	100;0;0	21.664	True		ENSG00000197601	ENSG00000197601	HGNC:26222													
FAR1	gene	FAR1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Peroxisomal fatty acyl-CoA reductase 1 disorder (MIM#616154);Cataracts, spastic paraparesis, and speech delay, MIM#619338				25439727;33239752		False	3	50;50;0	21.664	True		ENSG00000197601	ENSG00000197601	HGNC:26222													
FARS2	gene	FARS2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 77, autosomal recessive, 617046				26553276;25851414;29126765		False	3	100;0;0	21.664	True		ENSG00000145982	ENSG00000145982	HGNC:21062													
FARS2	gene	FARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	combined oxidative phosphorylation defect type 14 MONDO:0013986				30250868;30177229;29126765;28043061		False	3	100;0;0	21.664	True		ENSG00000145982	ENSG00000145982	HGNC:21062													
FARS2	gene	FARS2	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	combined oxidative phosphorylation defect type 14 MONDO:0013986;hereditary spastic paraplegia 77 MONDO:0014882				30250868;30177229;29126765;28043061		False	3	100;0;0	21.664	True		ENSG00000145982	ENSG00000145982	HGNC:21062													
FARSA	gene	FARSA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Rajab interstitial lung disease with brain calcifications 2, MIM#	619013"				31355908;33598926		False	3	67;0;33	21.664	True		ENSG00000179115	ENSG00000179115	HGNC:3592													
FARSB	gene	FARSB	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Rajab syndrome, MIM#613658;interstitial lung disease;brain calcifications;microcephaly;intellectual disability				29573043;19161147;29979980;30014610		False	3	100;0;0	21.664	True		ENSG00000116120	ENSG00000116120	HGNC:17800													
FASTKD2	gene	FASTKD2	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 44, MIM# 618855;FASTKD2-related infantile mitochondrial encephalomyopathy MONDO:0015632				18771761;28499982;31944455;34234304		False	3	100;0;0	21.664	True		ENSG00000118246	ENSG00000118246	HGNC:29160													
FASTKD2	gene	FASTKD2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, MIM#220110				18771761;28499982;31944455;34234304		False	3	50;50;0	21.664	True		ENSG00000118246	ENSG00000118246	HGNC:29160													
FASTKD2	gene	FASTKD2	Expert Review Green;Other;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 44 (MIM#618855)				31944455;18771761		False	3	50;50;0	21.664	True		ENSG00000118246	ENSG00000118246	HGNC:29160													
FASTKD5	gene	FASTKD5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 24, MIM# 621431				PMID: 40499538		False	3	100;0;0	21.664	True		ENSG00000215251	ENSG00000215251	HGNC:25790													
FAT2	gene	FAT2	GeneReviews;Royal Melbourne Hospital;Expert list;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 45, MIM#617769				29053796;33884300		False	3	50;50;0	21.664	False		ENSG00000086570	ENSG00000086570	HGNC:3596													
FBLN5	gene	FBLN5	Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	HMSN;Neuropathy, hereditary, with or without age-related macular degeneration, MIM#608895				32757322;31945625;23328402;28332470		False	3	100;0;0	21.664	False		ENSG00000140092	ENSG00000140092	HGNC:3602													
FBP1	gene	FBP1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fructose-1,6-bisphosphatase deficiency, MIM# 229700				9382095		False	3	100;0;0	21.664	True		ENSG00000165140	ENSG00000165140	HGNC:3606													
FBXL4	gene	FBXL4	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type), MIM# 615471				28383868		False	3	100;0;0	21.664	True		ENSG00000112234	ENSG00000112234	HGNC:13601													
FBXL4	gene	FBXL4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) MIM#615471				28940506		False	3	100;0;0	21.664	True		ENSG00000112234	ENSG00000112234	HGNC:13601													
FBXL4	gene	FBXL4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) MIM#615471				28940506		False	3	100;0;0	21.664	True		ENSG00000112234	ENSG00000112234	HGNC:13601													
FBXO11	gene	FBXO11	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with dysmorphic facies and behavioral abnormalities, 618089				30057029;29796876		False	3	100;0;0	21.664	True		ENSG00000138081	ENSG00000138081	HGNC:13590													
FBXO28	gene	FBXO28	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 100, MIM# 619777				33280099		False	3	100;0;0	21.664	True		ENSG00000143756	ENSG00000143756	HGNC:29046													
FBXO28	gene	FBXO28	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 100, MIM# 619777				33280099		False	3	100;0;0	21.664	True		ENSG00000143756	ENSG00000143756	HGNC:29046													
FBXO7	gene	FBXO7	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 15, autosomal recessive MIM#260300				18513678;19038853		False	3	100;0;0	21.664	False		ENSG00000100225	ENSG00000100225	HGNC:13586													
FBXO7	gene	FBXO7	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile parkinsonism;Dystonia						False	3	0;0;0	21.664	False		ENSG00000100225	ENSG00000100225	HGNC:13586													
FBXO7	gene	FBXO7	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	parkinsonian-pyramidal syndrome MONDO:0009830				20301402		False	3	100;0;0	21.664	True		ENSG00000100225	ENSG00000100225	HGNC:13586													
FCSK	gene	FCSK	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Congenital disorder of glycosylation with defective fucosylation 2, MIM#	618324"				30503518;35718084;36426412		False	3	100;0;0	21.664	True		ENSG00000157353	ENSG00000157353	HGNC:29500													
FCSK	gene	FCSK	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation with defective fucosylation 2, MIM# 618324				30503518		False	3	100;0;0	21.664	True		ENSG00000157353	ENSG00000157353	HGNC:29500													
FDFT1	gene	FDFT1	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Squalene synthase deficiency, MIM# 618156				29909962		False	3	50;50;0	21.664	True		ENSG00000079459	ENSG00000079459	HGNC:3629													
FDFT1	gene	FDFT1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	squalene synthase deficiency MONDO:0032566				29909962		False	3	100;0;0	21.664	True		ENSG00000079459	ENSG00000079459	HGNC:3629													
FDX2	gene	FDX2	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy, MIM# 251900;inborn mitochondrial myopathy MONDO:0009637				24281368;28803783;30010796;35079622;34905296		False	3	100;0;0	21.664	True		ENSG00000267673	ENSG00000267673	HGNC:30546													
FDX2	gene	FDX2	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy MIM#251900				24281368;30010796;28803783		False	3	100;0;0	21.664	True		ENSG00000267673	ENSG00000267673	HGNC:30546													
FDXR	gene	FDXR	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Auditory neuropathy and optic atrophy, MIM#617717;Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887				30250212;28965846;29040572;33348459;37046037;37481223		False	3	100;0;0	21.664	True		ENSG00000161513	ENSG00000161513	HGNC:3642													
FDXR	gene	FDXR	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887				30250212;28965846;29040572;33348459;37046037;37481223		False	3	100;0;0	21.664	True		ENSG00000161513	ENSG00000161513	HGNC:3642													
FGD4	gene	FGD4	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot Marie Tooth disease, type 4H, 609311;MONDO:0012250;HMSN				17564959;31152969;28847448;28543957		False	3	100;0;0	21.664	False		ENSG00000139132	ENSG00000139132	HGNC:19125													
FGF12	gene	FGF12	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 47, MIM# 617166				32645220;27164707;27830185;27872899		False	3	100;0;0	21.664	True		ENSG00000114279	ENSG00000114279	HGNC:3668													
FGF13	gene	FGF13	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 90, MIM# 301058;Intellectual disability;epilepsy				33245860		False	3	100;0;0	21.664	True		ENSG00000129682	ENSG00000129682	HGNC:3670													
FGF14	gene	FGF14	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 27 MIM#609307						False	3	100;0;0	21.664	True		ENSG00000102466	ENSG00000102466	HGNC:3671													
FGFR1	gene	FGFR1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Hartsfield syndrome	(MIM#615465)"				26937548;31512363;23812909;26931467		False	3	100;0;0	21.664	True		ENSG00000077782	ENSG00000077782	HGNC:3688													
FGFR3	gene	FGFR3	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypochondroplasia, MIM#146000				24630288;27485793;23649205;12794698		False	3	100;0;0	21.664	True		ENSG00000068078	ENSG00000068078	HGNC:3690													
FH	gene	FH	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fumarase deficiency, MIM#606812				20301679;10805328;20549362;15221078;16151915		False	3	100;0;0	21.664	True		ENSG00000091483	ENSG00000091483	HGNC:3700													
FH	gene	FH	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	hereditary leiomyomatosis and renal cell cancer MONDO:0007888;fumaric aciduria MONDO:0011730				11865300;28300276;20301430;8200987;20549362;31746132;20301679		False	3	100;0;0	21.664	True		ENSG00000091483	ENSG00000091483	HGNC:3700													
FHL1	gene	FHL1	Expert Review Green;Expert list;Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Reducing body myopathy MONDO:0019948;X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680				19716112;20186852;20301609;18179901;25274776;34366191;18274675;19181672		False	3	67;33;0	21.664	True		ENSG00000022267	ENSG00000022267	HGNC:3702													
FICD	gene	FICD	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 92, autosomal recessive, MIM# 620911				36136088		False	3	100;0;0	21.664	False		ENSG00000198855	ENSG00000198855	HGNC:18416													
FICD	gene	FICD	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 92, autosomal recessive, MIM# 620911				36136088		False	3	100;0;0	21.664	True		ENSG00000198855	ENSG00000198855	HGNC:18416													
FIG4	gene	FIG4	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4J, MIM# 611228;MONDO:0012640;HMSN				17572665;21705420;24878229		False	3	100;0;0	21.664	False		ENSG00000112367	ENSG00000112367	HGNC:16873													
FIG4	gene	FIG4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease type 4J, MONDO:0012640				41177402;40884084;40118803;40062820;37950760;37868919		False	3	100;0;0	21.664	True		ENSG00000112367	ENSG00000112367	HGNC:16873													
FIG4	gene	FIG4	Expert Review Green;Expert list;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4J 611228;Yunis-Varon syndrome 216340;leukoencephalopathy				30740813;29688489		False	3	100;0;0	21.664	False		ENSG00000112367	ENSG00000112367	HGNC:16873													
FITM2	gene	FITM2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Siddiqi syndrome MIM#618635;dystonia;deafness				28067622;30214770;30288795		False	3	100;0;0	21.664	True		ENSG00000197296	ENSG00000197296	HGNC:16135													
FKRP	gene	FKRP	Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Limb-girdle muscular dystrophy;Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type				11592034;11741828;14647208;19299310;19155270		False	3	100;0;0	21.664	True		ENSG00000181027	ENSG00000181027	HGNC:17997													
FKRP	gene	FKRP	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5 613153;Muscular dystrophy-dystroglycanopathy (congenital with or without mental retardation), type B, 5 606612;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 607155						False	3	100;0;0	21.664	True		ENSG00000181027	ENSG00000181027	HGNC:17997													
FKRP	gene	FKRP	Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 607155				27602406;11592034;11741828;14647208;19299310;19155270		False	3	100;0;0	21.664	True		ENSG00000181027	ENSG00000181027	HGNC:17997													
FKTN	gene	FKTN	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy MONDO:0018276				9690476;19017726;20301385;28680109		False	3	100;0;0	21.664	True		ENSG00000106692	ENSG00000106692	HGNC:3622													
FKTN	gene	FKTN	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (with brain and eye anomalies), 253800;Muscular dystrophy-dystroglycanopathy (without mental retardation), 613152;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 4, 611588;Cardiomyopathy, dilated, 1X, 611615				9690476;19017726;20301385;28680109		False	3	100;0;0	21.664	True		ENSG00000106692	ENSG00000106692	HGNC:3622													
FKTN	gene	FKTN	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 4 253800;Muscular dystrophy-dystroglycanopathy (congenital without mental retardation), type B, 4 613152;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 4 611588						False	3	100;0;0	21.664	True		ENSG00000106692	ENSG00000106692	HGNC:3622													
FLAD1	gene	FLAD1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100				34454814;34718578;31392824;30982706;30311138;30427553;28433476;27259049;25058219		False	3	100;0;0	21.664	True		ENSG00000160688	ENSG00000160688	HGNC:24671													
FLAD1	gene	FLAD1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100				34454814;34718578;31392824;30982706;30311138;30427553;28433476;27259049;25058219		False	3	100;0;0	21.664	True		ENSG00000160688	ENSG00000160688	HGNC:24671													
FLAD1	gene	FLAD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency, MIM#	255100"				25058219;27259049;16643857;20060505;30061063;30982706;30311138;31392824;30427553		False	3	0;100;0	21.664	True		ENSG00000160688	ENSG00000160688	HGNC:24671													
FLNA	gene	FLNA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Heterotopia, periventricular, 1, MIM#	300049"				30089473		False	3	100;0;0	21.664	True		ENSG00000196924	ENSG00000196924	HGNC:3754													
FLNC	gene	FLNC	Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Cardiomyopathy, familial restrictive 5	617047;Myopathy, distal, 4	614065;Myopathy, myofibrillar, 5	609524"				PMID: 29858533		False	3	100;0;0	21.664	True	Other	ENSG00000128591	ENSG00000128591	HGNC:3756													
FLVCR1	gene	FLVCR1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, posterior column, with retinitis pigmentosa MIM#609033						False	3	100;0;0	21.664	True		ENSG00000162769	ENSG00000162769	HGNC:24682													
FLVCR1	gene	FLVCR1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ataxia, posterior column, with retinitis pigmentosa, MIM#	609033"				21267618;21070897		False	3	100;0;0	21.664	True		ENSG00000162769	ENSG00000162769	HGNC:24682													
FLVCR1	gene	FLVCR1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, FLVCR1-related				39306721		False	3	100;0;0	21.664	True		ENSG00000162769	ENSG00000162769	HGNC:24682													
FLVCR2	gene	FLVCR2	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790				30712878;20206334;20518025;20690116;25677735		False	3	100;0;0	21.664	True		ENSG00000119686	ENSG00000119686	HGNC:20105													
FLVCR2	gene	FLVCR2	Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Proliferative Vasculopathy And Hydranencephaly-Hydrocephaly Syndrome				20206334		False	3	67;0;33	21.664	False		ENSG00000119686	ENSG00000119686	HGNC:20105													
FMO3	gene	FMO3	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trimethylaminuria MIM#602079;Disorders and variants of other enzymes that oxidise xenobiotics				27604308;9536088		False	3	100;0;0	21.664	True		ENSG00000007933	ENSG00000007933	HGNC:3771													
FOLR1	gene	FOLR1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration due to cerebral folate transport deficiency 613068						False	3	0;0;0	21.664	False		ENSG00000110195	ENSG00000110195	HGNC:3791													
FOLR1	gene	FOLR1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration due to cerebral folate transport deficiency, 613068;Neurodegeneration due to cerebral folate transport deficiency						False	3	100;0;0	21.664	False		ENSG00000110195	ENSG00000110195	HGNC:3791													
FOLR1	gene	FOLR1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodegeneration due to cerebral folate transport deficiency, MIM#	613068"				19732866;30420205;27743887		False	3	100;0;0	21.664	True		ENSG00000110195	ENSG00000110195	HGNC:3791													
FOLR1	gene	FOLR1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration due to cerebral folate transport deficiency, MIM# 613068				19732866;30420205;27743887		False	3	100;0;0	21.664	True		ENSG00000110195	ENSG00000110195	HGNC:3791													
FOXG1	gene	FOXG1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Rett syndrome, congenital variant;Dystonia				27029630		False	3	100;0;0	21.664	True		ENSG00000176165	ENSG00000176165	HGNC:3811													
FOXG1	gene	FOXG1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Rett syndrome, congenital variant, MIM#	613454;Developmental and Epileptic Encephalopathy;Dystonia,;Athetosis;Parkinsonism;Stereotypies"				PMID: 21953941		False	3	100;0;0	21.664	True		ENSG00000176165	ENSG00000176165	HGNC:3811													
FOXG1	gene	FOXG1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Rett syndrome, congenital variant, MIM# 613454				18571142;30842224		False	3	100;0;0	21.664	True		ENSG00000176165	ENSG00000176165	HGNC:3811													
FOXP1	gene	FOXP1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder with language impairment with or without autistic features, MIM#	613670"				26633542;28741757;34109629		False	3	100;0;0	21.664	True		ENSG00000114861	ENSG00000114861	HGNC:3823													
FOXRED1	gene	FOXRED1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome due to mitochondrial complex I deficiency, MIM#256000				20858599;20818383;31434271		False	3	100;0;0	21.664	True		ENSG00000110074	ENSG00000110074	HGNC:26927													
FOXRED1	gene	FOXRED1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 19 MIM#618241				33613441		False	3	100;0;0	21.664	True		ENSG00000110074	ENSG00000110074	HGNC:26927													
FRMD5	gene	FRMD5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094				36206744		False	3	100;0;0	21.664	True		ENSG00000171877	ENSG00000171877	HGNC:28214													
FRMD5	gene	FRMD5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094				36206744		False	3	100;0;0	21.664	True		ENSG00000171877	ENSG00000171877	HGNC:28214													
FRRS1L	gene	FRRS1L	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy, 37 MONDO:0014859				27236917;27239025;30692144		False	3	100;0;0	21.664	True		ENSG00000260230	ENSG00000260230	HGNC:1362													
FRRS1L	gene	FRRS1L	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 37, MIM# 616981;Seizures;Chorea;Parkinsonism;Developmental delay				PMID: 29086067		False	3	100;0;0	21.664	True		ENSG00000260230	ENSG00000260230	HGNC:1362													
FTCD	gene	FTCD	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutamate formiminotransferase deficiency MIM#229100;Disorders of histidine, tryptophan or lysine metabolism				http://iembase.com/disorder/47		False	3	100;0;0	21.664	True		ENSG00000160282	ENSG00000160282	HGNC:3974													
FTH1	gene	FTH1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodegeneration with brain iron accumulation 9, MIM# 620669				37660254		False	3	50;50;0	21.664	True	Other	ENSG00000167996	ENSG00000167996	HGNC:3976													
FTL	gene	FTL	GeneReviews;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuroferritinopathy						False	3	100;0;0	21.664	False		ENSG00000087086	ENSG00000087086	HGNC:3999													
FTL	gene	FTL	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodegeneration with brain iron accumulation 3, MIM# 606159				11438811;15099026;12746423;18413574		False	3	100;0;0	21.664	True		ENSG00000087086	ENSG00000087086	HGNC:3999													
FTL	gene	FTL	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration with brain iron accumulation 3, MIM# 606159				11438811;18854324;15099026;15173247		False	3	100;0;0	21.664	True		ENSG00000087086	ENSG00000087086	HGNC:3999													
FTL	gene	FTL	Expert Review Green;NHS Genomic Medicine Service;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	606159 NEURODEGENERATION WITH BRAIN IRON ACCUMULATION 3;LFTD;NBIA3;615604 L-FERRITIN DEFICIENCY;HRFTC;606159 Neurodegeneration with brain iron accumulation 3;600886 HYPERFERRITINEMIA WITH OR WITHOUT CATARACT;600886 Hyperferritinemia-cataract syndrome;615604 L-ferritin deficiency, dominant and recessive				23940258;18413574;23421845;19176363		False	3	100;0;0	21.664	True		ENSG00000087086	ENSG00000087086	HGNC:3999													
FTL	gene	FTL	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted					23447832;20301320		False	3	100;0;0	21.664	False		ENSG00000087086	ENSG00000087086	HGNC:3999													
FUCA1	gene	FUCA1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fucosidosis;General Leukodystrophy & Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000179163	ENSG00000179163	HGNC:4006													
FUCA1	gene	FUCA1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fucosidosis, MIM# 230000;MONDO:0009254				10094192		False	3	100;0;0	21.664	True		ENSG00000179163	ENSG00000179163	HGNC:4006													
FUCA1	gene	FUCA1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fucosidosis, MIM#230000				31064022		False	3	100;0;0	21.664	True		ENSG00000179163	ENSG00000179163	HGNC:4006													
FUCA1	gene	FUCA1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fucosidosis, MIM# 230000;MONDO:0009254				10094192		False	3	100;0;0	21.664	True		ENSG00000179163	ENSG00000179163	HGNC:4006													
FUS	gene	FUS	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030				32941707;32770214		False	3	100;0;0	21.664	True		ENSG00000089280	ENSG00000089280	HGNC:4010													
FUS	gene	FUS	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia (MIM#608030)				19251628;19251627		False	3	100;0;0	21.664	True		ENSG00000089280	ENSG00000089280	HGNC:4010													
FUT8	gene	FUT8	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation with defective fucosylation, 618005				29304374		False	3	100;0;0	21.664	True		ENSG00000033170	ENSG00000033170	HGNC:4019													
FUT8	gene	FUT8	Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation with defective fucosylation, 618005				29304374		False	3	100;0;0	21.664	True		ENSG00000033170	ENSG00000033170	HGNC:4019													
FXN	gene	FXN	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia, MIM# 229300				10500103;11351132		False	3	100;0;0	21.664	True		ENSG00000165060	ENSG00000165060	HGNC:3951													
FXN	gene	FXN	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia, 229300						False	3	100;0;0	21.664	False		ENSG00000165060	ENSG00000165060	HGNC:3951													
FXN	gene	FXN	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Friedreich ataxia, MIM#	229300"						False	3	100;0;0	21.664	True	Other	ENSG00000165060	ENSG00000165060	HGNC:3951													
FXN	gene	FXN	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300						False	3	100;0;0	21.664	True		ENSG00000165060	ENSG00000165060	HGNC:3951													
FZR1	gene	FZR1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 109, MIM# 620145				34788397		False	3	100;0;0	21.664	True		ENSG00000105325	ENSG00000105325	HGNC:24824													
G6PC1	gene	G6PC1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease Ia, MIM# 232200				8733042		False	3	100;0;0	21.664	True		ENSG00000131482	ENSG00000131482	HGNC:4056													
G6PC3	gene	G6PC3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dursun syndrome 612541;Neutropenia, severe congenital 4, autosomal recessive 612541				21385794		False	3	0;100;0	21.664	True		ENSG00000141349	ENSG00000141349	HGNC:24861													
GAA	gene	GAA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease II, MIM# 232300;MONDO:0009290				16917947		False	3	100;0;0	21.664	True		ENSG00000171298	ENSG00000171298	HGNC:4065													
GAA	gene	GAA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease II (MIM#232300);MONDO:0009290				25103075;27365701		False	3	100;0;0	21.664	True		ENSG00000171298	ENSG00000171298	HGNC:4065													
GAA	gene	GAA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease II (MIM#232300)				25103075;27365701		False	3	100;0;0	21.664	True		ENSG00000171298	ENSG00000171298	HGNC:4065													
GAA	gene	GAA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Glycogen storage disease II	232300"				PMID: 29880332		False	3	100;0;0	21.664	True		ENSG00000171298	ENSG00000171298	HGNC:4065													
GABBR2	gene	GABBR2	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy, 59 MONDO:0033368;Gamma-aminobutyric acid neurotransmitter disorders				35850019		False	3	0;0;0	21.664	False		ENSG00000136928	ENSG00000136928	HGNC:4507													
GABBR2	gene	GABBR2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 59, MIM# 617904				29100083;25262651;28856709		False	3	100;0;0	21.664	True		ENSG00000136928	ENSG00000136928	HGNC:4507													
GABRA1	gene	GABRA1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 19, MIM# 615744				24623842		False	3	100;0;0	21.664	True		ENSG00000022355	ENSG00000022355	HGNC:4075													
GABRA1	gene	GABRA1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 19 615744;Rett syndrome;Rett-like phenotypes;idiopathic generalized Epilepsy;Dravet syndrome				11992121;21714819;24623842;30842224		False	3	100;0;0	21.664	True		ENSG00000022355	ENSG00000022355	HGNC:4075													
GABRA2	gene	GABRA2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 78, MIM#	618557"				29961870;31032849;29422393		False	3	100;0;0	21.664	True		ENSG00000151834	ENSG00000151834	HGNC:4076													
GABRA3	gene	GABRA3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Epilepsy, X-linked 2, with or without impaired intellectual development and dysmorphic features, MIM#	301091"				PMID: 29053855		False	3	100;0;0	21.664	True		ENSG00000011677	ENSG00000011677	HGNC:4077													
GABRA4	gene	GABRA4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, GABRA4-related				35152403;35781801		False	3	100;0;0	21.664	True		ENSG00000109158	ENSG00000109158	HGNC:4078													
GABRA5	gene	GABRA5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 79;OMIM #618559				31056671;29961870		False	3	100;0;0	21.664	True		ENSG00000186297	ENSG00000186297	HGNC:4079													
GABRB1	gene	GABRB1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 45, MIM#	617153"				23934111;27273810;31618474		False	3	100;0;0	21.664	True		ENSG00000163288	ENSG00000163288	HGNC:4081													
GABRB1	gene	GABRB1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy, 45 MONDO:0014942;Gamma-aminobutyric acid neurotransmitter disorders				23934111;27273810;35850019;31618474		False	3	0;0;0	21.664	False		ENSG00000163288	ENSG00000163288	HGNC:4081													
GABRB2	gene	GABRB2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631				38996765		False	3	100;0;0	21.664	True	Other	ENSG00000145864	ENSG00000145864	HGNC:4082													
GABRB2	gene	GABRB2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, infantile or early childhood, 2, MIM# 617829				27789573;29100083		False	3	100;0;0	21.664	True		ENSG00000145864	ENSG00000145864	HGNC:4082													
GABRB2	gene	GABRB2	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631;Gamma-aminobutyric acid neurotransmitter disorders				27789573;35850019;29100083		False	3	0;0;0	21.664	False		ENSG00000145864	ENSG00000145864	HGNC:4082													
GABRB3	gene	GABRB3	Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 43 MIM#617113				37647766		False	3	100;0;0	21.664	False	Other	ENSG00000166206	ENSG00000166206	HGNC:4083													
GABRB3	gene	GABRB3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 43, MIM# 617113				23934111;27476654		False	3	100;0;0	21.664	True		ENSG00000166206	ENSG00000166206	HGNC:4083													
GABRB3	gene	GABRB3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 43, MIM# 617113				23934111;27476654		False	3	100;0;0	21.664	True		ENSG00000166206	ENSG00000166206	HGNC:4083													
GABRD	gene	GABRD	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Epilepsy;Susceptibility to epilepsy, MIM#613060				15115768;34633442		False	3	100;0;0	21.664	True		ENSG00000187730	ENSG00000187730	HGNC:4084													
GABRD	gene	GABRD	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Epilepsy;Susceptibility to epilepsy, MIM#613060				15115768;34633442		False	3	100;0;0	21.664	True		ENSG00000187730	ENSG00000187730	HGNC:4084													
GABRG2	gene	GABRG2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 74 618396;Epilepsy, generalized, with febrile seizures plus, type 3 607681				11326274;11326275;27864268		False	3	100;0;0	21.664	True		ENSG00000113327	ENSG00000113327	HGNC:4087													
GABRG2	gene	GABRG2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 74 618396;Epilepsy, generalized, with febrile seizures plus, type 3 607681				11326274;11326275;27864268		False	3	100;0;0	21.664	True		ENSG00000113327	ENSG00000113327	HGNC:4087													
GAD1	gene	GAD1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 89, MIM# 619124				32282878		False	3	100;0;0	21.664	True		ENSG00000128683	ENSG00000128683	HGNC:4092													
GALC	gene	GALC	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Krabbe disease, MIM#	245200"						False	3	100;0;0	21.664	True		ENSG00000054983	ENSG00000054983	HGNC:4115													
GALC	gene	GALC	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Krabbe disease, MIM# 245200;MONDO:0009499				20886637		False	3	100;0;0	21.664	True		ENSG00000054983	ENSG00000054983	HGNC:4115													
GALC	gene	GALC	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Krabbe disease, MIM#	245200"						False	3	100;0;0	21.664	True		ENSG00000054983	ENSG00000054983	HGNC:4115													
GALC	gene	GALC	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Krabbe disease, MIM# 245200;MONDO:0009499				20886637		False	3	100;0;0	21.664	True		ENSG00000054983	ENSG00000054983	HGNC:4115													
GALC	gene	GALC	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Krabbe disease MIM#245200				9272171;11971051;22959700;26396125;26915362;28547031;31185936;32064984		False	3	100;0;0	21.664	False		ENSG00000054983	ENSG00000054983	HGNC:4115													
GALE	gene	GALE	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galactose epimerase deficiency MIM#230350;Disorders of galactose metabolism				27604308;9700591		False	3	100;0;0	21.664	True		ENSG00000117308	ENSG00000117308	HGNC:4116													
GALK1	gene	GALK1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galactokinase deficiency with cataracts MIM#230200;Disorders of galactose metabolism				27604308;5129682		False	3	100;0;0	21.664	True		ENSG00000108479	ENSG00000108479	HGNC:4118													
GALM	gene	GALM	Expert Review Green;NHS GMS;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galactosemia IV MIM#618881;Disorders of galactose metabolism				30451973;30910422		False	3	100;0;0	21.664	True		ENSG00000143891	ENSG00000143891	HGNC:24063													
GALNS	gene	GALNS	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis IVA, MIM# 253000;MONDO:0009659				9298823		False	3	100;0;0	21.664	True		ENSG00000141012	ENSG00000141012	HGNC:4122													
GALNT2	gene	GALNT2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation				32293671		False	3	100;0;0	21.664	True		ENSG00000143641	ENSG00000143641	HGNC:4124													
GALNT2	gene	GALNT2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIt, MIM# 618885				32293671		False	3	100;0;0	21.664	True		ENSG00000143641	ENSG00000143641	HGNC:4124													
GALNT3	gene	GALNT3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Tumoral calcinosis, hyperphosphatemic, familial, 1, MIM# 211900				15133511;20358599;32125652		False	3	100;0;0	21.664	True		ENSG00000115339	ENSG00000115339	HGNC:4125													
GALT	gene	GALT	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Galactosemia,	MIM#230400"				30718057		False	3	100;0;0	21.664	True		ENSG00000213930	ENSG00000213930	HGNC:4135													
GALT	gene	GALT	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galactosemia MIM#230400;Disorders of galactose metabolism				27604308;2011574		False	3	100;0;0	21.664	True		ENSG00000213930	ENSG00000213930	HGNC:4135													
GAMT	gene	GAMT	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral creatine deficiency syndrome 2 MIM#612736				19027335;33996490;12557293;19288536;16855203		False	3	50;0;50	21.664	True		ENSG00000130005	ENSG00000130005	HGNC:4136													
GAMT	gene	GAMT	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral creatine deficiency syndrome 2 MIM#612736;Disorders of creatinine metabolism				27604308;8651275		False	3	100;0;0	21.664	True		ENSG00000130005	ENSG00000130005	HGNC:4136													
GAMT	gene	GAMT	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral creatine deficiency syndrome 2 MIM#612736;Disorders of creatinine metabolism				27604308;8651275		False	3	100;0;0	21.664	True		ENSG00000130005	ENSG00000130005	HGNC:4136													
GAN	gene	GAN	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Giant axonal neuropathy-1, MIM# 256850				11062483		False	3	100;0;0	21.664	True		ENSG00000261609	ENSG00000261609	HGNC:4137													
GAN	gene	GAN	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Giant axonal neuropathy-1, MIM#	256850"				26381321;11062483		False	3	100;0;0	21.664	True		ENSG00000261609	ENSG00000261609	HGNC:4137													
GARS1	gene	GARS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial disease (MONDO:0044970), GARS1-related;Spinal muscular atrophy, infantile, James type, MIM# 619042;Charcot-Marie-Tooth disease, type 2D, MIM# 601472;Neuronopathy, distal hereditary motor, type VA, MIM# 600794;Multi-system mitochondrial disorder				17101916;22462675;31985473;32181591;12690580;25168514;26503042;29648643;16982418;24669931;28594869		False	3	100;0;0	21.664	True		ENSG00000106105	ENSG00000106105	HGNC:4162													
GARS1	gene	GARS1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	HMSN, dHMN/dSMA;Spinal muscular atrophy, infantile, James type, MIM# 619042;Neuropathy, distal hereditary motor, type V, 600794;Charcot Marie Tooth disease, type 2D, 601472				17101916;22462675;31985473;32181591;12690580;25168514;26503042;29648643;16982418		False	3	100;0;0	21.664	False		ENSG00000106105	ENSG00000106105	HGNC:4162													
GATA3	gene	GATA3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypoparathyroidism, sensorineural deafness, and renal dysplasia, MIM# 146255				32642802;19248180;26268891;16912130;15337474		False	3	100;0;0	21.664	True		ENSG00000107485	ENSG00000107485	HGNC:4172													
GATM	gene	GATM	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral creatine deficiency syndrome 3 MIM#612718				11555793;27604308		False	3	100;0;0	21.664	False		ENSG00000171766	ENSG00000171766	HGNC:4175													
GBA1	gene	GBA1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Gaucher disease, type III, MIM#	231000"				27789132		False	3	100;0;0	21.664	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GBA1	gene	GBA1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Gaucher disease, perinatal lethal, MIM# 608013;Gaucher disease, type I, MIM# 230800;Gaucher disease, type II, MIM# 230900;Gaucher disease, type III, MIM# 231000;Gaucher disease, type IIIC, MIM# 231005						False	3	100;0;0	21.664	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GBA1	gene	GBA1	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	230800 Gaucher disease, type I;230900 Gaucher disease, type II;231005 Gaucher disease, type IIIC;231000 Gaucher disease, type III				27265538;27816428;20575041		False	3	0;0;0	21.664	False		ENSG00000177628	ENSG00000177628	HGNC:4177													
GBA1	gene	GBA1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Gaucher disease, perinatal lethal, MIM# 608013;Gaucher disease, type I, MIM# 230800;Gaucher disease, type II, MIM# 230900;Gaucher disease, type III, MIM# 231000;Gaucher disease, type IIIC, MIM# 231005						False	3	100;0;0	21.664	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GBA1	gene	GBA1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson's disease, MONDO:0005180, GBA-related				PMID: 12809640;35639160		False	3	100;0;0	21.664	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GBA2	gene	GBA2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 46, autosomal recessive, MIM# 614409;MONDO:0013737				23332916;23332917;29524657		False	3	100;0;0	21.664	True		ENSG00000070610	ENSG00000070610	HGNC:18986													
GBA2	gene	GBA2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 46, autosomal recessive, MIM#	614409"				23332916;23332917		False	3	100;0;0	21.664	True		ENSG00000070610	ENSG00000070610	HGNC:18986													
GBA2	gene	GBA2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 46, autosomal recessive, 614409;SPG46, Spastic paraplegia, cognitive decline, thin corpus callosum, ataxia, cataracts, bulbar dysfunction, axonal sensory-motor neuropathy				20301682;23332917;29524657		False	3	100;0;0	21.664	True		ENSG00000070610	ENSG00000070610	HGNC:18986													
GBE1	gene	GBE1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease due to glycogen branching enzyme deficiency MONDO:0009292				8613547		False	3	100;0;0	21.664	True		ENSG00000114480	ENSG00000114480	HGNC:4180													
GBE1	gene	GBE1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease IV, MIM# 232500;Polyglucosan body disease, adult form MIM#263570				8613547;20301758		False	3	100;0;0	21.664	True		ENSG00000114480	ENSG00000114480	HGNC:4180													
GBE1	gene	GBE1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyglucosan body disease, adult form, 263570						False	3	100;0;0	21.664	False		ENSG00000114480	ENSG00000114480	HGNC:4180													
GBE1	gene	GBE1	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyglucosan body disease, adult form MIM#263570				23034915		False	3	100;0;0	21.664	False		ENSG00000114480	ENSG00000114480	HGNC:4180													
GBE1	gene	GBE1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Polyglucosan body disease, adult form	MIM#263570"				20301758;26194201		False	3	100;0;0	21.664	False		ENSG00000114480	ENSG00000114480	HGNC:4180													
GBE1	gene	GBE1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyglucosan body disease, adult form MIM#263570;Late-onset, cognitive impairment, spasticity, sensory-motor axonal neuropathy, bladder dysfunction, cerebellar and extrapyramidal signs also seen, periventricular white matter abnormalities on MRI				23034915;1763891;8494336;20301758		False	3	100;0;0	21.664	True		ENSG00000114480	ENSG00000114480	HGNC:4180													
GBF1	gene	GBF1	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Charcot-Marie-Tooth disease, dominant intermediate A, MIM# 606483;Axonal Neuropathy				32937143		False	3	100;0;0	21.664	False		ENSG00000107862	ENSG00000107862	HGNC:4181													
GCDH	gene	GCDH	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric aciduria, type I MIM#231670				25875215		False	3	100;0;0	21.664	True		ENSG00000105607	ENSG00000105607	HGNC:4189													
GCDH	gene	GCDH	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaricaciduria, type I MIM#231670;Organic acidurias				27604308;8541831;8900227		False	3	100;0;0	21.664	True		ENSG00000105607	ENSG00000105607	HGNC:4189													
GCDH	gene	GCDH	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	glutaryl-CoA dehydrogenase deficiency MONDO:0009281				32777384;21912879;31536184		False	3	100;0;0	21.664	True		ENSG00000105607	ENSG00000105607	HGNC:4189													
GCH1	gene	GCH1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, B, MIM# 233910				7730309		False	3	100;0;0	21.664	True		ENSG00000131979	ENSG00000131979	HGNC:4193													
GCH1	gene	GCH1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230				7874165;11113234;15753436		False	3	100;0;0	21.664	False		ENSG00000131979	ENSG00000131979	HGNC:4193													
GCH1	gene	GCH1	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary spastic paraplegia MONDO:0019064, GCH1-related				21935284;24509643;33713342		False	3	0;100;0	21.664	True		ENSG00000131979	ENSG00000131979	HGNC:4193													
GCH1	gene	GCH1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230				32170445;32278297;32746945;30314816		False	3	100;0;0	21.664	True		ENSG00000131979	ENSG00000131979	HGNC:4193													
GCH1	gene	GCH1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, B, MIM# 233910;Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230						False	3	100;0;0	21.664	True		ENSG00000131979	ENSG00000131979	HGNC:4193													
GCLC	gene	GCLC	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency MIM#230450;Disorders of the gamma-glutamyl cycle				27604308;10515893;18024385;11118286;10733484;12663448		False	3	100;0;0	21.664	True		ENSG00000001084	ENSG00000001084	HGNC:4311													
GCM2	gene	GCM2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypoparathyroidism, familial isolated 2, MIM# 618883				32642802;19940031;36405867;18583467		False	3	100;0;0	21.664	True		ENSG00000124827	ENSG00000124827	HGNC:4198													
GCSH	gene	GCSH	Expert Review Green;Literature;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multiple mitochondrial dysfunctions syndrome 7, MIM#	620423"				36190515		False	3	33;0;67	21.664	True		ENSG00000140905	ENSG00000140905	HGNC:4208													
GCSH	gene	GCSH	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multiple mitochondrial dysfunctions syndrome 7, MIM#	620423"				33890291;36190515		False	3	100;0;0	21.664	True		ENSG00000140905	ENSG00000140905	HGNC:4208													
GDAP1	gene	GDAP1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2K 607831, MIM# Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM# 607706;Charcot-Marie-Tooth disease, recessive intermediate, A, MIM# 608340;Charcot-Marie-Tooth disease, type 4A, MIM# 214400				16172208;21753178;21365284;20232219;11743580		False	3	100;0;0	21.664	False		ENSG00000104381	ENSG00000104381	HGNC:15968													
GDAP1	gene	GDAP1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Charcot-Marie-Tooth disease, axonal, type 2K	607831, MIM# Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM#	607706;Charcot-Marie-Tooth disease, recessive intermediate, A, MIM#	608340;Charcot-Marie-Tooth disease, type 4A, MIM#	214400"				16172208;21753178;21365284;20232219;11743580		False	3	100;0;0	21.664	True		ENSG00000104381	ENSG00000104381	HGNC:15968													
GDAP2	gene	GDAP2	Expert Review Green;Royal Melbourne Hospital;Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia						False	3	100;0;0	21.664	False		ENSG00000196505	ENSG00000196505	HGNC:18010													
GEMIN5	gene	GEMIN5	Expert Review Green;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, OMIM # 619333				34569062;33963192		False	3	100;0;0	21.664	True		ENSG00000082516	ENSG00000082516	HGNC:20043													
GFAP	gene	GFAP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alexander disease MONDO:0008752				34146839		False	3	100;0;0	21.664	True		ENSG00000131095	ENSG00000131095	HGNC:4235													
GFAP	gene	GFAP	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Alexander disease, MIM#	203450"				11138011;12034785;31004048;15732097		False	3	100;0;0	21.664	True		ENSG00000131095	ENSG00000131095	HGNC:4235													
GFAP	gene	GFAP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Alexander disease, MIM#	203450"						False	3	100;0;0	21.664	True		ENSG00000131095	ENSG00000131095	HGNC:4235													
GFAP	gene	GFAP	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease						False	3	100;0;0	21.664	False		ENSG00000131095	ENSG00000131095	HGNC:4235													
GFER	gene	GFER	Expert Review Green;Other;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, mitochondrial progressive, with congenital cataract and developmental delay (MIM#613076)				28155230;19409522;26018198		False	3	100;0;0	21.664	True		ENSG00000127554	ENSG00000127554	HGNC:4236													
GFER	gene	GFER	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay (MIM #613076)				28155230		False	3	100;0;0	21.664	True		ENSG00000127554	ENSG00000127554	HGNC:4236													
GFM1	gene	GFM1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 1 MIM#609060				31680380;25852744;26937387		False	3	100;0;0	21.664	True		ENSG00000168827	ENSG00000168827	HGNC:13780													
GFM1	gene	GFM1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 1 MIM#609060				31680380;25852744;26937387		False	3	100;0;0	21.664	True		ENSG00000168827	ENSG00000168827	HGNC:13780													
GFM1	gene	GFM1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 1;Mitochondrial Leukoencephalopathy;General Leukodystrophy & Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000168827	ENSG00000168827	HGNC:13780													
GFM2	gene	GFM2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 39, OMIM #618397				22700954;26016410;29075935		False	3	100;0;0	21.664	True		ENSG00000164347	ENSG00000164347	HGNC:29682													
GFPT1	gene	GFPT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenia, congenital, 12, with tubular aggregates, 610542;Limb-girdle congenital myasthenic syndrome;Leukoencephalopathy				21310273;30635494		False	3	100;0;0	21.664	True		ENSG00000198380	ENSG00000198380	HGNC:4241													
GFPT1	gene	GFPT1	Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenia, congenital, 12, with tubular aggregates MIM#610542;Limb-girdle congenital myasthenic syndrome				28712002;29905857;31449669		False	3	100;0;0	21.664	True		ENSG00000198380	ENSG00000198380	HGNC:4241													
GJA1	gene	GJA1	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850				31023660		False	3	100;0;0	21.664	False		ENSG00000152661	ENSG00000152661	HGNC:4274													
GJA1	gene	GJA1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Oculodentodigital dysplasia, MIM# 164200				26444782;31023660;31240666		False	3	100;0;0	21.664	True		ENSG00000152661	ENSG00000152661	HGNC:4274													
GJA1	gene	GJA1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850				31023660		False	3	100;0;0	21.664	False		ENSG00000152661	ENSG00000152661	HGNC:4274													
GJB1	gene	GJB1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800;Reversible posterior leukoencephalopathy				31842800		False	3	100;0;0	21.664	False		ENSG00000169562	ENSG00000169562	HGNC:4283													
GJB1	gene	GJB1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM# 302800;MONDO:0010549;HMSN				8266101;17100997;17353473		False	3	100;0;0	21.664	False		ENSG00000169562	ENSG00000169562	HGNC:4283													
GJC2	gene	GJC2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 2, MIM#	608804"				15192806;18094336		False	3	100;0;0	21.664	True		ENSG00000198835	ENSG00000198835	HGNC:17494													
GJC2	gene	GJC2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 2, MIM#	608804"				22669416;24374284;15192806		False	3	100;0;0	21.664	True		ENSG00000198835	ENSG00000198835	HGNC:17494													
GJC2	gene	GJC2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelinating leukodystrophy 2, 608804;Leukodystrophy, hypomyelinating, 2;Autosomal Recessive Ataxia;Spastic paraplegia 44, 613206						False	3	100;0;0	21.664	False		ENSG00000198835	ENSG00000198835	HGNC:17494													
GJC2	gene	GJC2	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 2, MIM#	608804"						False	3	100;0;0	21.664	True		ENSG00000198835	ENSG00000198835	HGNC:17494													
GK	gene	GK	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Glycerol kinase deficiency MIM#307030;Disorders of glycerol metabolism				27604308;8499912;8651297		False	3	100;0;0	21.664	True		ENSG00000198814	ENSG00000198814	HGNC:4289													
GLA	gene	GLA	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Fabry disease,	301500"						False	3	0;0;0	21.664	False		ENSG00000102393	ENSG00000102393	HGNC:4296													
GLA	gene	GLA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Cardiomyopathy;HSAN/SFN;Fabry disease				19318041;22497776		False	3	0;100;0	21.664	True		ENSG00000102393	ENSG00000102393	HGNC:4296													
GLA	gene	GLA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Fabry disease, MIM# 301500;MONDO:0010526				28613767;33673160		False	3	100;0;0	21.664	True		ENSG00000102393	ENSG00000102393	HGNC:4296													
GLA	gene	GLA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Fabry disease, Fabry disease, cardiac variant,  301500						False	3	100;0;0	21.664	False		ENSG00000102393	ENSG00000102393	HGNC:4296													
GLA	gene	GLA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Fabry disease	MONDO:0010526"				36927868;38254927;9213072;23949010;32510623		False	3	100;0;0	21.664	True		ENSG00000102393	ENSG00000102393	HGNC:4296													
GLB1	gene	GLB1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1-gangliosidosis, type I MIM#230500;GM1-gangliosidosis, type II MIM# 230600				24156116		False	3	100;0;0	21.664	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GLB1	gene	GLB1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1-gangliosidosis, type III , MIM#230650;Parkinsonism				PMID: 34514040		False	3	100;0;0	21.664	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GLB1	gene	GLB1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1 gangliosidosis type 3 MONDO:0009262				24156116;35937492;34514040;1353343		False	3	100;0;0	21.664	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GLB1	gene	GLB1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1-gangliosidosis, type I, MIM# 230500;GM1-gangliosidosis, type II, MIM# 230600;GM1-gangliosidosis, type III, MIM# 230650;Mucopolysaccharidosis type IVB (Morquio), MIM# 253010				1907800;1909089;17309651;11511921		False	3	100;0;0	21.664	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GLB1	gene	GLB1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"GM1-gangliosidosis, type I, MIM#	230500;GM1-gangliosidosis, type II, MIM#	230600"				25691190		False	3	100;0;0	21.664	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GLDC	gene	GLDC	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycine encephalopathy MIM#605899;Disorders of serine, glycine or glycerate metabolism				27604308;2246863;1634607		False	3	100;0;0	21.664	True		ENSG00000178445	ENSG00000178445	HGNC:4313													
GLDC	gene	GLDC	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycine encephalopathy (MIM#605899)				27604308;2246863;1634607;27362913		False	3	100;0;0	21.664	True		ENSG00000178445	ENSG00000178445	HGNC:4313													
GLI3	gene	GLI3	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Pallister-Hall syndrome, MIM# 146510						False	3	100;0;0	21.664	True		ENSG00000106571	ENSG00000106571	HGNC:4319													
GLRA1	gene	GLRA1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperekplexia 1, MIM# 149400				8298642;16832093		False	3	100;0;0	21.664	True		ENSG00000145888	ENSG00000145888	HGNC:4326													
GLRA1	gene	GLRA1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperekplexia 1, MIM# 149400				8298642;16832093		False	3	100;0;0	21.664	True		ENSG00000145888	ENSG00000145888	HGNC:4326													
GLRA2	gene	GLRA2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, Pilorge type, MIM# 301076				35294868		False	3	100;0;0	21.664	True		ENSG00000101958	ENSG00000101958	HGNC:4327													
GLRB	gene	GLRB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperekplexia 2, MIM# 614619				21391991;11929858;27843043		False	3	100;0;0	21.664	True		ENSG00000109738	ENSG00000109738	HGNC:4329													
GLRB	gene	GLRB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperekplexia 2, MIM# 614619				21391991;11929858;27843043		False	3	100;0;0	21.664	True		ENSG00000109738	ENSG00000109738	HGNC:4329													
GLRX5	gene	GLRX5	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	616860 Anemia, sideroblastic, 3, pyridoxine-refractory;Sideroblastic anaemia - increased serum ferritin				24003969;30401706;25342667;30098397		False	3	0;0;0	21.664	False		ENSG00000182512	ENSG00000182512	HGNC:20134													
GLRX5	gene	GLRX5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spasticity, childhood-onset, with hyperglycinemia	616859"				PMID: 24334290;30770271		False	3	50;50;0	21.664	True		ENSG00000182512	ENSG00000182512	HGNC:20134													
GLRX5	gene	GLRX5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spasticity, childhood-onset, with hyperglycinemia 616859				PMID: 24334290;30770271		False	3	100;0;0	21.664	True		ENSG00000182512	ENSG00000182512	HGNC:20134													
GLRX5	gene	GLRX5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Anaemia, sideroblastic, 3, pyridoxine-refractory, MIM# 616860						False	3	100;0;0	21.664	True		ENSG00000182512	ENSG00000182512	HGNC:20134													
GLS	gene	GLS	Expert Review Green;NHS GMS;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 71 MIM#618328;Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412;disorder of amino acid metabolism				30575854;30970188;30239721		False	3	100;0;0	21.664	True		ENSG00000115419	ENSG00000115419	HGNC:4331													
GLS	gene	GLS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 71, MIM# 618328;Infantile cataract, skin abnormalities, glutamate excess, and impaired intellectual development MONDO:0032685				30575854;38622440;37151363		False	3	50;50;0	21.664	True		ENSG00000115419	ENSG00000115419	HGNC:4331													
GLUD1	gene	GLUD1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hyperinsulinism-hyperammonemia syndrome, MIM# 606762				11214910;11297618		False	3	100;0;0	21.664	True		ENSG00000148672	ENSG00000148672	HGNC:4335													
GLUD1	gene	GLUD1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperinsulinism-hyperammonemia syndrome, MIM# 606762				11214910;11297618		False	3	100;0;0	21.664	True		ENSG00000148672	ENSG00000148672	HGNC:4335													
GLUL	gene	GLUL	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Glutamine deficiency, congenital MIM#610015;Developmental and epileptic encephalopathy 116, MIM# 620806				16267323;21353613;33150193		False	3	100;0;0	21.664	True		ENSG00000135821	ENSG00000135821	HGNC:4341													
GLUL	gene	GLUL	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Glutamine deficiency, congenital MIM#610015;Developmental and epileptic encephalopathy 116, MIM# 620806				16267323;21353613;33150193		False	3	100;0;0	21.664	True		ENSG00000135821	ENSG00000135821	HGNC:4341													
GLYCTK	gene	GLYCTK	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-glyceric aciduria MIM#220120;Disorders of serine, glycine or glycerate metabolism				20949620;31837836		False	3	100;0;0	21.664	True		ENSG00000168237	ENSG00000168237	HGNC:24247													
GLYCTK	gene	GLYCTK	NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-glyceric aciduria, MIM# 220120				3588091;30637540;28462797;20949620;28190537		False	3	100;0;0	21.664	True		ENSG00000168237	ENSG00000168237	HGNC:24247													
GM2A	gene	GM2A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, AB variant MIM#272750				28417072;28192816;27402091;33819415		False	3	100;0;0	21.664	True		ENSG00000196743	ENSG00000196743	HGNC:4367													
GM2A	gene	GM2A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"GM2-gangliosidosis, AB variant, MIM#	272750"						False	3	100;0;0	21.664	True		ENSG00000196743	ENSG00000196743	HGNC:4367													
GM2A	gene	GM2A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, AB variant, MIM#272750						False	3	100;0;0	21.664	True		ENSG00000196743	ENSG00000196743	HGNC:4367													
GMPPA	gene	GMPPA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alacrima, achalasia, and impaired intellectual development syndrome (MIM# 615510)				24035193;28574218		False	3	100;0;0	21.664	True		ENSG00000144591	ENSG00000144591	HGNC:22923													
GMPPB	gene	GMPPB	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14	MIM#615352;Limb myalgia;exercise intolerance;myoglobinuria"				28456886;27874200;25681410		False	3	100;0;0	21.664	True		ENSG00000173540	ENSG00000173540	HGNC:22932													
GMPPB	gene	GMPPB	Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 615352						False	3	100;0;0	21.664	False		ENSG00000173540	ENSG00000173540	HGNC:22932													
GMPPB	gene	GMPPB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 14 (MIM# 615350);Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 14 (MIM# 615351);Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 (MIM# 615352)						False	3	100;0;0	21.664	True		ENSG00000173540	ENSG00000173540	HGNC:22932													
GMPPB	gene	GMPPB	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 14 615350				30257713		False	3	100;0;0	21.664	True		ENSG00000173540	ENSG00000173540	HGNC:22932													
GNAI1	gene	GNAI1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, impaired speech, and behavioral abnormalities, MIM# 619854				28135719;33473207		False	3	100;0;0	21.664	True		ENSG00000127955	ENSG00000127955	HGNC:4384													
GNAL	gene	GNAL	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 25, MIM# 615073;MONDO:0014033				23222958;33175450;32180288		False	3	100;0;0	21.664	False		ENSG00000141404	ENSG00000141404	HGNC:4388													
GNAO1	gene	GNAO1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 17;Neurodevelopmental disorder with involuntary movements				28747448;30682224		False	3	100;0;0	21.664	True		ENSG00000087258	ENSG00000087258	HGNC:4389													
GNAO1	gene	GNAO1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	movement disorder, MONDO:0005395				38358016;35722775		False	3	100;0;0	21.664	True		ENSG00000087258	ENSG00000087258	HGNC:4389													
GNAO1	gene	GNAO1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with involuntary movements, 617493				28747448;30682224		False	3	100;0;0	21.664	True	Other	ENSG00000087258	ENSG00000087258	HGNC:4389													
GNAQ	gene	GNAQ	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Sturge-Weber syndrome, somatic, mosaic 185300				34124757;30920161		False	3	100;0;0	21.664	True	Other	ENSG00000156052	ENSG00000156052	HGNC:4390													
GNAS	gene	GNAS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)	Pseudohypoparathyroidism Ib, MIM# 603233				28296742;35600030;20444925		False	3	100;0;0	21.664	True		ENSG00000087460	ENSG00000087460	HGNC:4392													
GNB1	gene	GNB1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 42, MIM# 616973				32134617		False	3	100;0;0	21.664	True		ENSG00000078369	ENSG00000078369	HGNC:4396													
GNB1	gene	GNB1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 42, MIM# 616973;Myoclonus dystonia				30194818;27108799;27668284;31034681		False	3	100;0;0	21.664	True		ENSG00000078369	ENSG00000078369	HGNC:4396													
GNB4	gene	GNB4	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, dominant intermediate F, MIM# 615185;MONDO:0014074;HMSN				23434117;28642160;27908631		False	3	100;0;0	21.664	False		ENSG00000114450	ENSG00000114450	HGNC:20731													
GNB5	gene	GNB5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	gnb5-related intellectual disability-cardiac arrhythmia syndrome MONDO:0014953;Lodder-Merla syndrome, type 1, with impaired intellectual development and cardiac arrhythmia (MIM#617173);Lodder-Merla syndrome, type 2, with developmental delay and with or without cardiac arrhythmia (MIM#617182)				27523599;27677260;28697420;29368331		False	3	100;0;0	21.664	True		ENSG00000069966	ENSG00000069966	HGNC:4401													
GNE	gene	GNE	Expert Review Green;Expert Review;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Nonaka myopathy (MIM#605820)				22883483;20301439		False	3	50;50;0	21.664	True		ENSG00000159921	ENSG00000159921	HGNC:23657													
GNE	gene	GNE	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Nonaka myopathy 605820;Sialuria MIM#269921;ADUDP-GlcNAc epimerase/kinase deficiency (Disorders of multiple glycosylation and other glycosylation pathways)				12177386;12473753;32053088;29923088;10356312;11326336;11486897;27142465		False	3	100;0;0	21.664	True		ENSG00000159921	ENSG00000159921	HGNC:23657													
GNE	gene	GNE	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Nonaka myopathy, MIM#	605820"						False	3	100;0;0	21.664	True		ENSG00000159921	ENSG00000159921	HGNC:23657													
GNMT	gene	GNMT	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycine N-methyltransferase deficiency MIM#606664;Disorders of the metabolism of sulphur amino acids				11810299;14739680;17937387;27207470		False	3	100;0;0	21.664	True		ENSG00000124713	ENSG00000124713	HGNC:4415													
GNPAT	gene	GNPAT	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000116906	ENSG00000116906	HGNC:4416													
GNPTAB	gene	GNPTAB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GNPTAB-mucolipidosis MONDO:0100122;Mucolipidosis II alpha/beta, MIM# 252500;Mucolipidosis III alpha/beta, MIM# 252600						False	3	100;0;0	21.664	True		ENSG00000111670	ENSG00000111670	HGNC:29670													
GNPTG	gene	GNPTG	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucolipidosis III gamma, MIM# 252605;MONDO:0009652				10712439;19370764;19659762;33507475;33023972;32651481		False	3	100;0;0	21.664	True		ENSG00000090581	ENSG00000090581	HGNC:23026													
GNS	gene	GNS	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIID, MIM# 252940;Sanfilippo syndrome type D, MONDO:0009658				12573255;12624138;31536183;25851924		False	3	100;0;0	21.664	True		ENSG00000135677	ENSG00000135677	HGNC:4422													
GORAB	gene	GORAB	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Geroderma osteodysplasticum MIM#231070				PMID: 18348262;28807865;30631079.		False	3	100;0;0	21.664	True		ENSG00000120370	ENSG00000120370	HGNC:25676													
GOSR2	gene	GOSR2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 6 , MIM#614018				21549339;24458321;30363482		False	3	100;0;0	21.664	True		ENSG00000108433	ENSG00000108433	HGNC:4431													
GOSR2	gene	GOSR2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 6, 614018;Progressive myoclonic epilepsy 6, 614018						False	3	100;0;0	21.664	False		ENSG00000108433	ENSG00000108433	HGNC:4431													
GOT2	gene	GOT2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 82, MIM#	618721"				31422819		False	3	100;0;0	21.664	True		ENSG00000125166	ENSG00000125166	HGNC:4433													
GPAA1	gene	GPAA1	Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 15, 617810						False	3	100;0;0	21.664	True		ENSG00000197858	ENSG00000197858	HGNC:4446													
GPAA1	gene	GPAA1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Glycosylphosphatidylinositol biosynthesis defect 15, MIM#	617810"				29100095		False	3	100;0;0	21.664	True		ENSG00000197858	ENSG00000197858	HGNC:4446													
GPAA1	gene	GPAA1	Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 15, MIM# 617810				29100095		False	3	100;0;0	21.664	True		ENSG00000197858	ENSG00000197858	HGNC:4446													
GPD1	gene	GPD1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of mitochondrial shuttles and carriers;transient infantile hypertriglyceridemia and hepatosteatosis MONDO:0013771				29884839;35988808;24549054		False	3	100;0;0	21.664	True		ENSG00000167588	ENSG00000167588	HGNC:4455													
GPD1	gene	GPD1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypertriglyceridemia, transient infantile MIM#614480;glycerol-3-phosphate dehydrogenase deficiency				32591995;22226083;33447932		False	3	100;0;0	21.664	True		ENSG00000167588	ENSG00000167588	HGNC:4455													
GPHN	gene	GPHN	NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Molybdenum cofactor deficiency C, MIM# 615501;Epilepsy;Autism;Intellectual disability				22040219;11095995;26613940;24561070;23393157;34617111		False	3	100;0;0	21.664	True		ENSG00000171723	ENSG00000171723	HGNC:15465													
GPHN	gene	GPHN	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency C MIM#615501;Disorders of molybdenum cofactor metabolism				27604308;11095995;22040219;9812897		False	3	100;0;0	21.664	True		ENSG00000171723	ENSG00000171723	HGNC:15465													
GPHN	gene	GPHN	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of molybdenum cofactor metabolism;sulfite oxidase deficiency due to molybdenum cofactor deficiency type C MONDO:0014212				27604308, 11095995, 22040219, 9812897		False	3	0;0;0	21.664	False		ENSG00000171723	ENSG00000171723	HGNC:15465													
GPRC5B	gene	GPRC5B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephalic leukoencephalopathy with subcortical cysts 3 MIM#620447				37143309		False	3	100;0;0	21.664	True		ENSG00000167191	ENSG00000167191	HGNC:13308													
GPRC5B	gene	GPRC5B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephalic leukoencephalopathy with subcortical cysts 3 MIM#620447				37143309		False	3	100;0;0	21.664	True		ENSG00000167191	ENSG00000167191	HGNC:13308													
GPT2	gene	GPT2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281				27601654;25758935;31471722		False	3	100;0;0	21.664	True		ENSG00000166123	ENSG00000166123	HGNC:18062													
GPT2	gene	GPT2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281				29882329;31471722;27601654		False	3	100;0;0	21.664	True		ENSG00000166123	ENSG00000166123	HGNC:18062													
GPT2	gene	GPT2	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281				27601654;25758935		False	3	100;0;0	21.664	True		ENSG00000166123	ENSG00000166123	HGNC:18062													
GRIA1	gene	GRIA1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 67, MIM# 619927				35675825;38890806;37921875		False	3	50;0;50	21.664	True		ENSG00000155511	ENSG00000155511	HGNC:4571													
GRIA2	gene	GRIA2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual disability;autism;Rett-like features;epileptic encephalopathy;Neurodevelopmental disorder with language impairment and behavioral abnormalities, MIM#	618917"				31300657		False	3	100;0;0	21.664	True		ENSG00000120251	ENSG00000120251	HGNC:4572													
GRIA3	gene	GRIA3	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Glutamate neurotransmitter disorders;X-linked complex neurodevelopmental disorder MONDO:0100148				38038360		False	3	0;0;0	21.664	False		ENSG00000125675	ENSG00000125675	HGNC:4573													
GRIA3	gene	GRIA3	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, Wu type (MIM#300699)				32977175;17989220;38038360		False	3	100;0;0	21.664	True		ENSG00000125675	ENSG00000125675	HGNC:4573													
GRIA4	gene	GRIA4	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Glutamate neurotransmitter disorders;Neurodevelopmental disorder with or without seizures and gait abnormalities MONDO:0060641				35518358;29220673		False	3	0;0;0	21.664	False		ENSG00000152578	ENSG00000152578	HGNC:4574													
GRIA4	gene	GRIA4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864				35518358;29220673		False	3	100;0;0	21.664	True		ENSG00000152578	ENSG00000152578	HGNC:4574													
GRID2	gene	GRID2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 18, 616204						False	3	100;0;0	21.664	False		ENSG00000152208	ENSG00000152208	HGNC:4576													
GRIK2	gene	GRIK2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 6 MIM#611092;Neurodevelopmental disorder with impaired language and ataxia and with or without seizures MIM#619580				34375587;17847003;25039795		False	3	100;0;0	21.664	True		ENSG00000164418	ENSG00000164418	HGNC:4580													
GRIN1	gene	GRIN1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820				29365063;27164704;27164704;28051072		False	3	100;0;0	21.664	True		ENSG00000176884	ENSG00000176884	HGNC:4584													
GRIN1	gene	GRIN1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Glutamate neurotransmitter disorders;Complex neurodevelopmental disorder MONDO:0100038				29365063;27164704;28051072		False	3	0;0;0	21.664	False		ENSG00000176884	ENSG00000176884	HGNC:4584													
GRIN1	gene	GRIN1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 101, MIM# 619814;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820				29365063;27164704;27164704;28051072;34611970		False	3	100;0;0	21.664	True		ENSG00000176884	ENSG00000176884	HGNC:4584													
GRIN2A	gene	GRIN2A	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Glutamate neurotransmitter disorders;Complex neurodevelopmental disorder MONDO:0100038				30544257		False	3	0;0;0	21.664	False		ENSG00000183454	ENSG00000183454	HGNC:4585													
GRIN2A	gene	GRIN2A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epilepsy, focal, with speech disorder and with or without mental retardation, MIM# 245570				30544257;35983985		False	3	100;0;0	21.664	True	Other	ENSG00000183454	ENSG00000183454	HGNC:4585													
GRIN2B	gene	GRIN2B	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Glutamate neurotransmitter disorders;Complex neurodevelopmental disorder MONDO:0100038				28377535		False	3	0;0;0	21.664	False		ENSG00000273079	ENSG00000273079	HGNC:4586													
GRIN2B	gene	GRIN2B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	GRIN2B-related complex neurodevelopmental disorder MONDO:0700350;Developmental and epileptic encephalopathy 27 MIM#616139;Intellectual developmental disorder, autosomal dominant 6, with or without seizures MIM#613970				28377535		False	3	100;0;0	21.664	True		ENSG00000273079	ENSG00000273079	HGNC:4586													
GRIN2D	gene	GRIN2D	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Glutamate neurotransmitter disorders;Complex neurodevelopmental disorder MONDO:0100038				30280376;27616483		False	3	0;0;0	21.664	False		ENSG00000105464	ENSG00000105464	HGNC:4588													
GRIN2D	gene	GRIN2D	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 46, MIM# 617162;intellectual disability				27616483;30280376		False	3	100;0;0	21.664	True	Other	ENSG00000105464	ENSG00000105464	HGNC:4588													
GRM1	gene	GRM1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Cerebellar ataxia MONDO:0000437;Glutamate neurotransmitter disorders				26308914;31319223;22901947		False	3	0;0;0	21.664	False		ENSG00000152822	ENSG00000152822	HGNC:4593													
GRM1	gene	GRM1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 13;Spinocerebellar ataxia 44, 617691, autosomal recessive spinocerebellar ataxia type 13, 614831						False	3	100;0;0	21.664	False		ENSG00000152822	ENSG00000152822	HGNC:4593													
GRM7	gene	GRM7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, microcephaly, developmental delay;neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities (NEDSHBA), MIM#618922				32286009;32248644		False	3	100;0;0	21.664	True		ENSG00000196277	ENSG00000196277	HGNC:4599													
GRN	gene	GRN	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Frontotemporal lobar degeneration with ubiquitin-positive inclusions,	MIM#607485"						False	3	100;0;0	21.664	True		ENSG00000030582	ENSG00000030582	HGNC:4601													
GRN	gene	GRN	Expert Review Green;ClinGen	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923				18184915;23596077		False	3	100;0;0	21.664	True		ENSG00000030582	ENSG00000030582	HGNC:4601													
GRN	gene	GRN	Other;Expert Review Green;Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	GRN-related frontotemporal lobar degeneration with Tdp43 inclusions MONDO:0011842				36970046;36632182		False	3	100;0;0	21.664	False		ENSG00000030582	ENSG00000030582	HGNC:4601													
GRN	gene	GRN	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM# 607485				17923627;20301545		False	3	100;0;0	21.664	False		ENSG00000030582	ENSG00000030582	HGNC:4601													
GRN	gene	GRN	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	neuronal ceroid lipofuscinosis MONDO:0016295;GRN-related frontotemporal lobar degeneration with Tdp43 inclusions MONDO:0011842				37981505;38347588;29884839		False	3	0;0;0	21.664	False		ENSG00000030582	ENSG00000030582	HGNC:4601													
GRN	gene	GRN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923				20301545;17436289		False	3	100;0;0	21.664	True		ENSG00000030582	ENSG00000030582	HGNC:4601													
GRN	gene	GRN	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ceroid lipofuscinosis, neuronal, 11	614706"				PMID: 22608501;31855245		False	3	100;0;0	21.664	True		ENSG00000030582	ENSG00000030582	HGNC:4601													
GSN	gene	GSN	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Amyloidosis, Finnish type MIM#105120				8684801;228009;3513049		False	3	0;100;0	21.664	True		ENSG00000148180	ENSG00000148180	HGNC:4620													
GSPT2	gene	GSPT2	Expert Review Green;Genetic Health Queensland;Genomics England PanelApp;Genomics England PanelApp;Genetic Health Queensland	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder, MONDO:0700092, GSPT2-related				28414775;41420488		False	3	100;0;0	21.664	True		ENSG00000189369	ENSG00000189369	HGNC:4622													
GSS	gene	GSS	NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutathione synthetase deficiency, MIM# 266130						False	3	100;0;0	21.664	True		ENSG00000100983	ENSG00000100983	HGNC:4624													
GSS	gene	GSS	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutathione synthetase deficiency MIM#266130;Hemolytic anemia due to glutathione synthetase deficiency MIM#231900;Disorders of the gamma-glutamyl cycle				8896573		False	3	100;0;0	21.664	True		ENSG00000100983	ENSG00000100983	HGNC:4624													
GSS	gene	GSS	NHS GMS;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Gluthathione synthetase deficiency, MIM# 266130				15717202		False	3	100;0;0	21.664	True		ENSG00000100983	ENSG00000100983	HGNC:4624													
GSX2	gene	GSX2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Diencephalic-mesencephalic junction dysplasia syndrome 2	618646;Intellectual disability;Dystonia;Spastic tetra paresis"				31412107;39119454		False	3	100;0;0	21.664	True		ENSG00000180613	ENSG00000180613	HGNC:24959													
GTF3C3	gene	GTF3C3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201				PMID: 39636576		False	3	100;0;0	21.664	True		ENSG00000119041	ENSG00000119041	HGNC:4666													
GTPBP2	gene	GTPBP2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Jaberi-Elahi syndrome, MIM#617988				26675814;29449720		False	3	100;0;0	21.664	True		ENSG00000172432	ENSG00000172432	HGNC:4670													
GTPBP2	gene	GTPBP2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Jaberi-Elahi syndrome, MIM#617988				26675814;29449720;30790272		False	3	100;0;0	21.664	True		ENSG00000172432	ENSG00000172432	HGNC:4670													
GTPBP3	gene	GTPBP3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 23, MIM#616198				34276756;25434004		False	3	100;0;0	21.664	True		ENSG00000130299	ENSG00000130299	HGNC:14880													
GTPBP3	gene	GTPBP3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 23, MIM#616198				25434004		False	3	100;0;0	21.664	True		ENSG00000130299	ENSG00000130299	HGNC:14880													
GUCY1A1	gene	GUCY1A1	Expert Review Green;Genomics England PanelApp;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Moyamoya 6 with achalasia;Moyamoya 6 with achalasia, 615750				24581742;26777256		False	3	100;0;0	21.664	False		ENSG00000164116	ENSG00000164116	HGNC:4685													
GUK1	gene	GUK1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 21, MIM# 621071				39230499		False	3	100;0;0	21.664	True		ENSG00000143774	ENSG00000143774	HGNC:4693													
GUK1	gene	GUK1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 21, MIM# 621071				39230499		False	3	100;0;0	21.664	True		ENSG00000143774	ENSG00000143774	HGNC:4693													
GUSB	gene	GUSB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis VII, MIM# 253220;MONDO:0009662						False	3	100;0;0	21.664	True		ENSG00000169919	ENSG00000169919	HGNC:4696													
GYG1	gene	GYG1	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Glycogen storage disease XV 613507;Polyglucosan body myopathy 2 616199				25272951;26652229		False	3	100;0;0	21.664	True		ENSG00000163754	ENSG00000163754	HGNC:4699													
GYG1	gene	GYG1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease XV, MIM# 613507;Polyglucosan body myopathy 2, MIM# 616199				31791869;20357282;27718144		False	3	100;0;0	21.664	True		ENSG00000163754	ENSG00000163754	HGNC:4699													
GYG1	gene	GYG1	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyglucosan body myopathy 2, MIM# 616199;Glycogen storage disease XV , MIM# 613507				29422440;32477874;32528171		False	3	100;0;0	21.664	True		ENSG00000163754	ENSG00000163754	HGNC:4699													
GYS1	gene	GYS1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Glycogen storage disease 0, muscle, MIM#	611556"				17928598;19699667;21958591		False	3	100;0;0	21.664	True		ENSG00000104812	ENSG00000104812	HGNC:4706													
GYS1	gene	GYS1	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease 0, muscle 611556				17928598;19699667;18358695;21958591		False	3	100;0;0	21.664	True		ENSG00000104812	ENSG00000104812	HGNC:4706													
GYS2	gene	GYS2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease 0, liver (MIM#240600)				32395408;28245189		False	3	100;0;0	21.664	True		ENSG00000111713	ENSG00000111713	HGNC:4707													
H3-3A	gene	H3-3A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bryant-Li-Bhoj neurodevelopmental syndrome 1 MIM#619720				33268356		False	3	50;50;0	21.664	True		ENSG00000163041	ENSG00000163041	HGNC:4764													
H3-3B	gene	H3-3B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bryant-Li-Bhoj neurodevelopmental syndrome 2 MIM#619721				33268356		False	3	100;0;0	21.664	True		ENSG00000132475	ENSG00000132475	HGNC:4765													
HAAO	gene	HAAO	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Vertebral, cardiac, renal, and limb defects syndrome 1 MIM#617660;NAD deficiency				28792876;33942433		False	3	100;0;0	21.664	True		ENSG00000162882	ENSG00000162882	HGNC:4796													
HACE1	gene	HACE1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia and psychomotor retardation with or without seizures, 616756;MONDO:0014764				26424145;26437029;31321300		False	3	100;0;0	21.664	True		ENSG00000085382	ENSG00000085382	HGNC:21033													
HACE1	gene	HACE1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia and psychomotor retardation with or without seizures, 616756;MONDO:0014764;Spastic paraplegia;psychomotor retardation				26424145;26437029;31321300		False	3	100;0;0	21.664	True		ENSG00000085382	ENSG00000085382	HGNC:21033													
HADH	gene	HADH	Expert Review Green;Expert Review Green;NHS GMS;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530				25778941;23430856;27771675;11489939		False	3	100;0;0	21.664	True		ENSG00000138796	ENSG00000138796	HGNC:4799													
HADH	gene	HADH	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-hydroxyacyl-CoA dehydrogenase deficiency, MIM# 231530;Hyperinsulinemic hypoglycemia, familial, 4, MIM# 609975;SCHAD deficiency, MONDO:0009278						False	3	100;0;0	21.664	True		ENSG00000138796	ENSG00000138796	HGNC:4799													
HADHA	gene	HADHA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	LCHAD deficiency, MIM# 609016						False	3	100;0;0	21.664	True		ENSG00000084754	ENSG00000084754	HGNC:4801													
HADHA	gene	HADHA	Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	LCHAD deficiency MIM#609016;Trifunctional protein deficiency MIM#609015				25778941;7811722;29459657		False	3	100;0;0	21.664	True		ENSG00000084754	ENSG00000084754	HGNC:4801													
HADHA	gene	HADHA	Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	LCHAD deficiency MIM#609016;Trifunctional protein deficiency MIM#609015				25778941;7811722;29459657		False	3	100;0;0	21.664	True		ENSG00000084754	ENSG00000084754	HGNC:4801													
HADHA	gene	HADHA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	LCHAD deficiency MIM#609016;Mitochondrial trifunctional protein deficiency MIM#609015				8871579;23868323;33744096;12838198;36063482		False	3	0;100;0	21.664	True		ENSG00000084754	ENSG00000084754	HGNC:4801													
HADHB	gene	HADHB	Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trifunctional protein deficiency MIM#609015				25778941;30682426;9259266;29956646		False	3	100;0;0	21.664	True		ENSG00000138029	ENSG00000138029	HGNC:4803													
HADHB	gene	HADHB	Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trifunctional protein deficiency MIM#609015				25778941;30682426;9259266;29956646		False	3	100;0;0	21.664	True		ENSG00000138029	ENSG00000138029	HGNC:4803													
HADHB	gene	HADHB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trifunctional protein deficiency, MIM# 609015				30682426;28515471		False	3	100;0;0	21.664	True		ENSG00000138029	ENSG00000138029	HGNC:4803													
HAMP	gene	HAMP	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	613313 Hemochromatosis, type 2B;613313 HEMOCHROMATOSIS, TYPE 2B;HFE2B				12915468;15198949;12469120		False	3	0;0;0	21.664	False		ENSG00000105697	ENSG00000105697	HGNC:15598													
HARS1	gene	HARS1	Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, axonal, type 2W, MIM# 616625;MONDO:0014711;HMSN				26072516		False	3	100;0;0	21.664	False		ENSG00000170445	ENSG00000170445	HGNC:4816													
HARS2	gene	HARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 2, MIM# 614926				31827252		False	3	100;0;0	21.664	True		ENSG00000112855	ENSG00000112855	HGNC:4817													
HAX1	gene	HAX1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neutropaenia, severe congenital 3, autosomal recessive, MIM# 610738;Kostmann syndrome MONDO:0012548				17187068;18611981;19036076		False	3	100;0;0	21.664	True		ENSG00000143575	ENSG00000143575	HGNC:16915													
HCCS	gene	HCCS	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Linear skin defects with multiple congenital anomalies 1, MIM# 309801				17033964;30068298;24735900		False	3	100;0;0	21.664	True		ENSG00000004961	ENSG00000004961	HGNC:4837													
HCFC1	gene	HCFC1	Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541				34164576;24011988		False	3	100;0;0	21.664	True		ENSG00000172534	ENSG00000172534	HGNC:4839													
HCN1	gene	HCN1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 24, MIM# 615871;Generalized epilepsy with febrile seizures plus, type 10, MIM# 618482				24747641;30351409;30351409		False	3	100;0;0	21.664	True		ENSG00000164588	ENSG00000164588	HGNC:4845													
HCN2	gene	HCN2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Generalized epilepsy with febrile seizures plus, type 11, MIM#	602477;Febrile seizures, familial, 2, MIM# 602477;Genetic epilepsy with febrile seizures plus;Other seizure disorders"				40468825;22131395;30986657;29064616;20437590;12514127;17931874		False	3	100;0;0	21.664	True		ENSG00000099822	ENSG00000099822	HGNC:4846													
HDAC3	gene	HDAC3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, HDAC3-related				39047730		False	3	100;0;0	21.664	True		ENSG00000171720	ENSG00000171720	HGNC:4854													
HECTD1	gene	HECTD1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092				PMID: 39879987		False	3	100;0;0	21.664	True		ENSG00000092148	ENSG00000092148	HGNC:20157													
HECTD4	gene	HECTD4	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures, spasticity, and complete or partial agenesis of the corpus callosum, MIM# 620250				PMID: 36401616		False	3	100;0;0	21.664	False		ENSG00000173064	ENSG00000173064	HGNC:26611													
HECW2	gene	HECW2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, seizures, and absent language, MIM# 617268;intellectual disability;epilepsy;regression;microcephaly				29807643;29395664;27334371;27389779		False	3	67;33;0	21.664	True	Other	ENSG00000138411	ENSG00000138411	HGNC:29853													
HEPACAM	gene	HEPACAM	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	"Megalencephalic leukoencephalopathy with subcortical cysts 2A, MIM#	613925;Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, MIM#	613926"				21419380;21419380		False	3	100;0;0	21.664	True		ENSG00000165478	ENSG00000165478	HGNC:26361													
HEPACAM	gene	HEPACAM	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Megalencephalic leukoencephalopathy with subcortical cysts 2A, MIM# 613925;Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, MIM# 613926				21419380;21419380		False	3	100;0;0	21.664	True		ENSG00000165478	ENSG00000165478	HGNC:26361													
HERC2	gene	HERC2	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 38 (MIM 615516)				23065719;23243086;30902390;32571899;27848944;26077850;27759030		False	3	100;0;0	21.664	True		ENSG00000128731	ENSG00000128731	HGNC:4868													
HEXA	gene	HEXA	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, several forms, 272800;Tay-Sachs disease, 272800						False	3	100;0;0	21.664	False		ENSG00000213614	ENSG00000213614	HGNC:4878													
HEXA	gene	HEXA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, several forms, MIM# 272800;Tay-Sachs disease, MIM# 272800;MONDO:0010100						False	3	100;0;0	21.664	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
HEXA	gene	HEXA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, several forms 272800;Tay-Sachs disease 272800				31388111		False	3	100;0;0	21.664	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
HEXA	gene	HEXA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, several forms or Tay-Sachs disease MIM#272800				31995250;31076878		False	3	100;0;0	21.664	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
HEXA	gene	HEXA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Usually infantile-onset, developmental delay and cognitive decline, visual loss ( cherry red spot ), motor>sensory neuronopathy, hypometric saccades, adult-onset (second decade) cases described;Tay-Sachs disease				17015493;18642377;3159334;1838393		False	3	100;0;0	21.664	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
HEXA	gene	HEXA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Tay-Sachs disease, MIM#	272800"						False	3	100;0;0	21.664	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
HEXB	gene	HEXB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sandhoff disease, infantile, juvenile, and adult forms, MIM# 268800;MONDO:0010006						False	3	100;0;0	21.664	True		ENSG00000049860	ENSG00000049860	HGNC:4879													
HEXB	gene	HEXB	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sandhoff disease, infantile, juvenile, and adult forms MIM#268800				31995250;24263030		False	3	100;0;0	21.664	True		ENSG00000049860	ENSG00000049860	HGNC:4879													
HEXB	gene	HEXB	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Usually infantile-onset, developmental delay and cognitive decline, visual loss ( cherry red spot ), motor>sensory neuronopathy, hypometric saccades, adult-onset (second decade) cases described;Tay-Sachs disease						False	3	100;0;0	21.664	False		ENSG00000049860	ENSG00000049860	HGNC:4879													
HEXB	gene	HEXB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sandhoff disease, infantile, juvenile, and adult forms, MIM# 268800;MONDO:0010006						False	3	100;0;0	21.664	True		ENSG00000049860	ENSG00000049860	HGNC:4879													
HEXB	gene	HEXB	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sandhoff disease, infantile, juvenile, and adult forms, 268800;Sandhoff disease, 268800						False	3	100;0;0	21.664	False		ENSG00000049860	ENSG00000049860	HGNC:4879													
HFE	gene	HFE	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	235200 Hemochromatosis;235200 HEMOCHROMATOSIS, TYPE 1;235200HEMOCHROMATOSIS, TYPE 1;HFE1				18199861		False	3	0;0;0	21.664	False		ENSG00000010704	ENSG00000010704	HGNC:4886													
HGD	gene	HGD	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alkaptonuria MIM#203500;Disorders of phenylalanine or tyrosine metabolism				8782815;27604308		False	3	100;0;0	21.664	True		ENSG00000113924	ENSG00000113924	HGNC:4892													
HGSNAT	gene	HGSNAT	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIIC (Sanfilippo C), MIM# 252930;MONDO:0009657;Retinitis pigmentosa 73, MIM# 616544;MONDO:0014687				17033958;25859010;19479962;31228227;20825431;20583299		False	3	100;0;0	21.664	True		ENSG00000165102	ENSG00000165102	HGNC:26527													
HIBCH	gene	HIBCH	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620				26026795;25251209;24299452;32677093		False	3	100;0;0	21.664	True		ENSG00000198130	ENSG00000198130	HGNC:4908													
HIBCH	gene	HIBCH	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"3-hydroxyisobutryl-CoA hydrolase deficiency, MIM#	250620"				26026795;25251209;24299452;32677093		False	3	100;0;0	21.664	True		ENSG00000198130	ENSG00000198130	HGNC:4908													
HID1	gene	HID1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 105 with hypopituitarism MIM#619983				33999436		False	3	100;0;0	21.664	True		ENSG00000167861	ENSG00000167861	HGNC:15736													
HIKESHI	gene	HIKESHI	Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 13, MIM#616881						False	3	100;0;0	21.664	False		ENSG00000149196	ENSG00000149196	HGNC:26938													
HINT1	gene	HINT1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuromyotonia and axonal neuropathy, autosomal recessive, MIM# 137200;Gamstorp-Wohlfart syndrome, MONDO:0007646;HMSN, dHMN/dSMA				22961002;33663550;33404983;31848916		False	3	100;0;0	21.664	False		ENSG00000169567	ENSG00000169567	HGNC:4912													
HIVEP2	gene	HIVEP2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder, autosomal dominant 43, MIM#	616977"				27003583		False	3	100;0;0	21.664	True		ENSG00000010818	ENSG00000010818	HGNC:4921													
HJV	gene	HJV	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HFE2A;602390 HEMOCHROMATOSIS, TYPE 2A;602390 Hemochromatosis, type 2A				14982873		False	3	0;0;0	21.664	False		ENSG00000168509	ENSG00000168509	HGNC:4887													
HK1	gene	HK1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMSN;Neuropathy, hereditary motor and sensory, Russe type, 605285				19536174;26822750		False	3	100;0;0	21.664	False		ENSG00000156515	ENSG00000156515	HGNC:4922													
HK1	gene	HK1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Neurodevelopmental disorder with visual defects and brain anomalies, MIM#	618547"				40469904;38617198		False	3	100;0;0	21.664	True		ENSG00000156515	ENSG00000156515	HGNC:4922													
HLCS	gene	HLCS	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Holocarboxylase synthetase deficiency, MIM# 253270				10190325		False	3	100;0;0	21.664	True		ENSG00000159267	ENSG00000159267	HGNC:4976													
HLCS	gene	HLCS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Holocarboxylase synthetase deficiency, MIM# 253270						False	3	100;0;0	21.664	True		ENSG00000159267	ENSG00000159267	HGNC:4976													
HMBS	gene	HMBS	Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Porphyria, acute intermittent MIM#176000				25389600;18647325		False	3	100;0;0	21.664	True		ENSG00000256269	ENSG00000256269	HGNC:4982													
HMBS	gene	HMBS	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Porphyria, acute intermittent MIM#176000;MONDO:0008294				31205461;20301372;8563760		False	3	50;50;0	21.664	True		ENSG00000256269	ENSG00000256269	HGNC:4982													
HMBS	gene	HMBS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, porphyria-related, MIM# 620711				27558376;34089223		False	3	50;50;0	21.664	True		ENSG00000256269	ENSG00000256269	HGNC:4982													
HMGCL	gene	HMGCL	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMG-CoA lyase deficiency, MIM# 246450				8617516		False	3	100;0;0	21.664	True		ENSG00000117305	ENSG00000117305	HGNC:5005													
HMGCL	gene	HMGCL	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMG-CoA lyase deficiency, 246450				11461194		False	3	100;0;0	21.664	True		ENSG00000117305	ENSG00000117305	HGNC:5005													
HMGCL	gene	HMGCL	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMG-CoA lyase deficiency, MIM# 246450				8617516		False	3	100;0;0	21.664	True		ENSG00000117305	ENSG00000117305	HGNC:5005													
HMGCL	gene	HMGCL	Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMG-CoA lyase deficiency MIM#246450				25778941;11129331;19036343		False	3	100;0;0	21.664	True		ENSG00000117305	ENSG00000117305	HGNC:5005													
HMGCR	gene	HMGCR	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive limb-girdle muscular dystrophy (MONDO:0015152), HMGCR-related				PMID: 37167966;36745799		False	3	50;0;50	21.664	True		ENSG00000113161	ENSG00000113161	HGNC:5006													
HMGCS2	gene	HMGCS2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMG-CoA synthase-2 deficiency, MIM# 605911				33045405		False	3	100;0;0	21.664	True		ENSG00000134240	ENSG00000134240	HGNC:5008													
HMGCS2	gene	HMGCS2	Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMG-CoA synthase-2 deficiency MIM#605911				25778941;9337379;23751782		False	3	100;0;0	21.664	True		ENSG00000134240	ENSG00000134240	HGNC:5008													
HNRNPA1	gene	HNRNPA1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 20 MIM#615426				23455423;34291734		False	3	100;0;0	21.664	True		ENSG00000135486	ENSG00000135486	HGNC:5031													
HNRNPA1	gene	HNRNPA1	Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myopathy, distal, 3, MIM# 610099;inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 3 MONDO:0014179				23455423;27066560;34291734;34722876		False	3	100;0;0	21.664	True	Other	ENSG00000135486	ENSG00000135486	HGNC:5031													
HNRNPA2B1	gene	HNRNPA2B1	Expert Review Green;Literature;Literature;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	oculopharyngeal muscular dystrophy, MONDO:0008116, OMIM#620460				23455423;30279180;29358076;26744327;23635965;35484142		False	3	33;67;0	21.664	True		ENSG00000122566	ENSG00000122566	HGNC:5033													
HNRNPDL	gene	HNRNPDL	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Muscular dystrophy, limb-girdle, type 1G 609115				24647604;31267206;31995753;32407983;32904822;32367994		False	3	100;0;0	21.664	True		ENSG00000152795	ENSG00000152795	HGNC:5037													
HNRNPH2	gene	HNRNPH2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, Bain type MIM#300986				34907471;33728377;31670473;31236915;30887513		False	3	100;0;0	21.664	True		ENSG00000126945	ENSG00000126945	HGNC:5042													
HNRNPR	gene	HNRNPR	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dysmorphic facies and skeletal and brain abnormalities, MIM# 620073				26795593;31079900		False	3	100;0;0	21.664	True		ENSG00000125944	ENSG00000125944	HGNC:5047													
HNRNPU	gene	HNRNPU	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 54 MIM# 617391				28944577;28393272		False	3	100;0;0	21.664	True		ENSG00000153187	ENSG00000153187	HGNC:5048													
HPCA	gene	HPCA	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 2, torsion, autosomal recessive, 224500;MONDO:0009141;childhood-onset generalized dystonia;adolescence-onset segmental dystonia;generalized dystonia with additional neurological features				25799108;30991467;30145809		False	3	100;0;0	21.664	False		ENSG00000121905	ENSG00000121905	HGNC:5144													
HPD	gene	HPD	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hawkinsinuria MIM#140350;Tyrosinemia, type III MIM#276710;Disorders of phenylalanine or tyrosine metabolism				10942115;11073718;27604308		False	3	100;0;0	21.664	True		ENSG00000158104	ENSG00000158104	HGNC:5147													
HPDL	gene	HPDL	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome				32707086		False	3	100;0;0	21.664	True		ENSG00000186603	ENSG00000186603	HGNC:28242													
HPDL	gene	HPDL	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome				32707086		False	3	100;0;0	21.664	True		ENSG00000186603	ENSG00000186603	HGNC:28242													
HPDL	gene	HPDL	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome				32707086		False	3	100;0;0	21.664	True		ENSG00000186603	ENSG00000186603	HGNC:28242													
HPDL	gene	HPDL	Expert Review Green;Literature;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome				32707086		False	3	100;0;0	21.664	True		ENSG00000186603	ENSG00000186603	HGNC:28242													
HPRT1	gene	HPRT1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Lesch-Nyhan syndrome;Dystonia				20301328		False	3	100;0;0	21.664	True		ENSG00000165704	ENSG00000165704	HGNC:5157													
HPS1	gene	HPS1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hermansky-Pudlak syndrome 1, MIM#	203300"						False	3	100;0;0	21.664	True		ENSG00000107521	ENSG00000107521	HGNC:5163													
HRAS	gene	HRAS	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Costello syndrome, MIM# 218040				16329078;16372351;16443854		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000174775	ENSG00000174775	HGNC:5173													
HS2ST1	gene	HS2ST1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194;Developmental delay and corpus callosum, skeletal, and renal abnormalities;disorder of glycosaminoglycan metabolism				33159882		False	3	100;0;0	21.664	True		ENSG00000153936	ENSG00000153936	HGNC:5193													
HSD17B10	gene	HSD17B10	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	HSD10 mitochondrial disease, MIM# 300438						False	3	100;0;0	21.664	True		ENSG00000072506	ENSG00000072506	HGNC:4800													
HSD17B10	gene	HSD17B10	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	HSD10 mitochondrial disease, MIM# 300438						False	3	100;0;0	21.664	True		ENSG00000072506	ENSG00000072506	HGNC:4800													
HSD17B4	gene	HSD17B4	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy;Peroxisome-Associated Disorders & Zellweger Syndrome;D-bifunctional protein deficiency						False	3	0;0;0	21.664	False		ENSG00000133835	ENSG00000133835	HGNC:5213													
HSD17B4	gene	HSD17B4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-bifunctional protein deficiency, AR (MIM#261515);Perrault syndrome 1, AR (MIM#233400)				27790638		False	3	100;0;0	21.664	True		ENSG00000133835	ENSG00000133835	HGNC:5213													
HSD17B4	gene	HSD17B4	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-bifunctional protein deficiency, AR (MIM#261515);Perrault syndrome 1, AR (MIM#233400)				27790638		False	3	100;0;0	21.664	True		ENSG00000133835	ENSG00000133835	HGNC:5213													
HSD3B7	gene	HSD3B7	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bile acid synthesis defect, congenital, 1 MIM#607765;Disorders of bile acid biosynthesis				11067870;27604308		False	3	100;0;0	21.664	True		ENSG00000099377	ENSG00000099377	HGNC:18324													
HSPA9	gene	HSPA9	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Anaemia, sideroblastic, 4, MIM# 182170;Even-plus syndrome, MIM# 616854				29884839;21123823;26598328;26491070;39196378;36094340;38284453;38281662;35779070		False	3	100;0;0	21.664	True		ENSG00000113013	ENSG00000113013	HGNC:5244													
HSPB1	gene	HSPB1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease axonal type 2F MONDO:0011687				21785432;15122254;18832141;32639100;32334137;33943041;35328016		False	3	100;0;0	21.664	False		ENSG00000106211	ENSG00000106211	HGNC:5246													
HSPB8	gene	HSPB8	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	HMSN, dHMN/dSMA;Neuropathy, distal hereditary motor, type IIA, 158590;Charcot Marie Tooth disease, axonal, type 2L, 608673				15122253;15565283;29029362;28780615;28144995;26718575		False	3	100;0;0	21.664	False		ENSG00000152137	ENSG00000152137	HGNC:30171													
HSPB8	gene	HSPB8	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myopathy, myofibrillar, 13, with rimmed vacuoles, MIM# 621078;autosomal dominant distal axonal motor neuropathy-myofibrillar myopathy syndrome MONDO:0018773				32165108;26718575;31403083;28780615		False	3	100;0;0	21.664	True	Other	ENSG00000152137	ENSG00000152137	HGNC:30171													
HSPD1	gene	HSPD1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 4, MIM# 612233;Spastic paraplegia 13, autosomal dominant, MIM# 605280				18571143;27405012;32532876;28377887;27405012;11898127;17420924		False	3	100;0;0	21.664	True		ENSG00000144381	ENSG00000144381	HGNC:5261													
HSPD1	gene	HSPD1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 4, MIM# 612233				18571143;27405012;32532876;28377887;27405012;11898127;17420924		False	3	100;0;0	21.664	True		ENSG00000144381	ENSG00000144381	HGNC:5261													
HSPD1	gene	HSPD1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 13, autosomal dominant, 605280;Leukodystrophy, hypomyelinating, 4, 612233				18571143;27405012;32532876;28377887;27405012		False	3	100;0;0	21.664	True		ENSG00000144381	ENSG00000144381	HGNC:5261													
HSPD1	gene	HSPD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 4, MIM#	612233;Spastic paraplegia 13, autosomal dominant, MIM#	605280"						False	3	100;0;0	21.664	True		ENSG00000144381	ENSG00000144381	HGNC:5261													
HTRA1	gene	HTRA1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	CARASIL syndrome MIM#600142;Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2 MIM#616779				29895533;26063658;19387015		False	3	100;0;0	21.664	False		ENSG00000166033	ENSG00000166033	HGNC:9476													
HTRA1	gene	HTRA1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, 616779;CARASIL syndrome, 600142						False	3	100;0;0	21.664	False		ENSG00000166033	ENSG00000166033	HGNC:9476													
HTRA2	gene	HTRA2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"3-methylglutaconic aciduria, type VIII, MIM#	617248"				27208207;27696117		False	3	100;0;0	21.664	True		ENSG00000115317	ENSG00000115317	HGNC:14348													
HTRA2	gene	HTRA2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria type 8 MONDO:0044723				27208207;27696117;30114719		False	3	50;50;0	21.664	True		ENSG00000115317	ENSG00000115317	HGNC:14348													
HTRA2	gene	HTRA2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type VIII, MIM# 617248				27208207;27696117		False	3	100;0;0	21.664	True		ENSG00000115317	ENSG00000115317	HGNC:14348													
HYCC1	gene	HYCC1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelination and Congenital Cataract;Leukodystrophy, hypomyelinating, 5, 610532						False	3	0;0;0	21.664	False		ENSG00000122591	ENSG00000122591	HGNC:24587													
IARS2	gene	IARS2	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cataracts, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia, MIM#	616007"				28328135;30419932;25130867;30041933		False	3	100;0;0	21.664	True		ENSG00000067704	ENSG00000067704	HGNC:29685													
IARS2	gene	IARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cataracts, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia, MIM# 616007				28328135;30419932;25130867;30041933		False	3	100;0;0	21.664	True		ENSG00000067704	ENSG00000067704	HGNC:29685													
IBA57	gene	IBA57	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 3, MIM# 615330				23462291;25971455;27785568;28671726;28913435		False	3	100;0;0	21.664	True		ENSG00000181873	ENSG00000181873	HGNC:27302													
IBA57	gene	IBA57	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 74, autosomal recessive MIM#616451				25609768;30258207		False	3	100;0;0	21.664	True		ENSG00000181873	ENSG00000181873	HGNC:27302													
IBA57	gene	IBA57	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 3, MIM#615330				23462291;25971455;27785568;28671726;28913435		False	3	100;0;0	21.664	True		ENSG00000181873	ENSG00000181873	HGNC:27302													
IDH2	gene	IDH2	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	D-2-hydroxyglutaric aciduria 2 MIM#613657				25778941;27142242;20847235;24049096		False	3	100;0;0	21.664	True		ENSG00000182054	ENSG00000182054	HGNC:5383													
IDH2	gene	IDH2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	D-2-hydroxyglutaric aciduria 2, MIM# 613657				25778941;27142242;20847235;24049096		False	3	100;0;0	21.664	True		ENSG00000182054	ENSG00000182054	HGNC:5383													
IDH3A	gene	IDH3A	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Retinitis pigmentosa 90, MIM#619007				31012789;30478029;30058936;28412069		False	3	100;0;0	21.664	True		ENSG00000166411	ENSG00000166411	HGNC:5384													
IDH3G	gene	IDH3G	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Retinitis pigmentosa 99, MIM# 301148				40119724		False	3	100;0;0	21.664	True		ENSG00000067829	ENSG00000067829	HGNC:5386													
IDS	gene	IDS	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mucopolysaccharidosis II, MIM# 309900;MONDO:0010674;Hunter syndrome				9921913;9762601;8940265;1901826		False	3	100;0;0	21.664	True		ENSG00000010404	ENSG00000010404	HGNC:5389													
IDUA	gene	IDUA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis Ih, MIM# 607014;Mucopolysaccharidosis Ih/s, MIM# 607015;Mucopolysaccharidosis Is, MIM# 607016;Mucopolysaccharidosis type 1, MONDO:0001586						False	3	100;0;0	21.664	True		ENSG00000127415	ENSG00000127415	HGNC:5391													
IER3IP1	gene	IER3IP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, epilepsy, and diabetes syndrome, MIM# 614231;Primary microcephaly-epilepsy-permanent neonatal diabetes syndrome, MONDO:0013647				21835305;22991235;24138066;28711742		False	3	100;0;0	21.664	True		ENSG00000134049	ENSG00000134049	HGNC:18550													
IFIH1	gene	IFIH1	Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Aicardi-Goutieres syndrome 7, MIM#615846				24686847;34185153		False	3	100;0;0	21.664	True	Other	ENSG00000115267	ENSG00000115267	HGNC:18873													
IFIH1	gene	IFIH1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Aicardi-Goutieres syndrome 7 MIM#615846						False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000115267	ENSG00000115267	HGNC:18873													
IFIH1	gene	IFIH1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Aicardi-Goutieres syndrome 7 MIM#615846				25243380;31427910;24686847;24995871		False	3	100;0;0	21.664	True		ENSG00000115267	ENSG00000115267	HGNC:18873													
IFIH1	gene	IFIH1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Aicardi-Goutieres syndrome 7, MIM#615846				24686847		False	3	100;0;0	21.664	True		ENSG00000115267	ENSG00000115267	HGNC:18873													
IGHMBP2	gene	IGHMBP2	Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMSN, dHMN/dSMA;Charcot-Marie-Tooth disease, axonal, type 2S 616155;Neuronopathy, distal hereditary motor, type VI, 604320				25439726		False	3	100;0;0	21.664	False		ENSG00000132740	ENSG00000132740	HGNC:5542													
IKBKG	gene	IKBKG	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Incontinentia pigmenti, MIM# 308300				31874111;35289316		False	3	100;0;0	21.664	True		-	ENSG00000269335	HGNC:5961													
IMPDH2	gene	IMPDH2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dystonia				PMID: 33098801		False	3	100;0;0	21.664	True		ENSG00000178035	ENSG00000178035	HGNC:6053													
INF2	gene	INF2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot Marie Tooth disease, dominant intermediate E, 614455;HMSN				22187985;30680856;25943269		False	3	100;0;0	21.664	False		ENSG00000203485	ENSG00000203485	HGNC:23791													
INPP4A	gene	INPP4A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354				PMID: 39315527		False	3	100;0;0	21.664	True		ENSG00000040933	ENSG00000040933	HGNC:6074													
INPP4A	gene	INPP4A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354				PMID: 39315527		False	3	100;0;0	21.664	True		ENSG00000040933	ENSG00000040933	HGNC:6074													
INPP5E	gene	INPP5E	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 1						False	3	100;0;0	21.664	False		ENSG00000148384	ENSG00000148384	HGNC:21474													
IQSEC2	gene	IQSEC2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked 1, MIM# 309530;Neurodevelopmental disorder, X-linked, with poor or absent speech and behavioral abnormalities, MIM# 301164				31415821;20473311;30842726;33368194;23674175		False	3	100;0;0	21.664	True		ENSG00000124313	ENSG00000124313	HGNC:29059													
IRF2BPL	gene	IRF2BPL	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures 618088				PMID: 30057031;30166628		False	3	100;0;0	21.664	True		ENSG00000119669	ENSG00000119669	HGNC:14282													
IRF2BPL	gene	IRF2BPL	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with regression, abnormal movement, loss of speech and seizures, 618088				30057031		False	3	100;0;0	21.664	True		ENSG00000119669	ENSG00000119669	HGNC:14282													
IRF2BPL	gene	IRF2BPL	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures, MIM# 618088				30057031;30166628		False	3	100;0;0	21.664	True		ENSG00000119669	ENSG00000119669	HGNC:14282													
ISCA1	gene	ISCA1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multiple mitochondrial dysfunctions syndrome 5, MIM#	617613"				28356563;32092383;31016283;30113620;30105122		False	3	100;0;0	21.664	True		ENSG00000135070	ENSG00000135070	HGNC:28660													
ISCA1	gene	ISCA1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 5 MIM#617613				28356563;32092383;31016283;30113620;30105122		False	3	100;0;0	21.664	True		ENSG00000135070	ENSG00000135070	HGNC:28660													
ISCA1	gene	ISCA1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multiple mitochondrial dysfunctions syndrome 5, MIM#	617613"				28356563;32092383;31016283;30113620;30105122		False	3	100;0;0	21.664	True		ENSG00000135070	ENSG00000135070	HGNC:28660													
ISCA2	gene	ISCA2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 4, MIM# 616370				25539947;29297947;29122497;29359243		False	3	100;0;0	21.664	True		ENSG00000165898	ENSG00000165898	HGNC:19857													
ISCA2	gene	ISCA2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 4, 616370				25539947;29297947;29122497;29359243		False	3	100;0;0	21.664	True		ENSG00000165898	ENSG00000165898	HGNC:19857													
ISCU	gene	ISCU	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy with lactic acidosis, hereditary, MIM# 255125				29079705;18304497;18296749;19567699		False	3	100;0;0	21.664	True		ENSG00000136003	ENSG00000136003	HGNC:29882													
ISCU	gene	ISCU	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Myopathy with lactic acidosis, hereditary, MIM# 255125				29079705;18304497;18296749;19567699		False	3	100;0;0	21.664	True		ENSG00000136003	ENSG00000136003	HGNC:29882													
ISG15	gene	ISG15	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 38 with BG calcification, MIM# 616126				25307056;32944031		False	3	100;0;0	21.664	True		ENSG00000187608	ENSG00000187608	HGNC:4053													
ITM2B	gene	ITM2B	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia				10391242;10781099;33814452		False	3	100;0;0	21.664	False		ENSG00000136156	ENSG00000136156	HGNC:6174													
ITM2B	gene	ITM2B	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebral amyloid angiopathy MONDO:0005620				10391242;10781099;20385796;33814452		False	3	100;0;0	21.664	True		ENSG00000136156	ENSG00000136156	HGNC:6174													
ITPA	gene	ITPA	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 35, MIM# 616647				26224535;19498443;35234647;35098521;27604308;12384777		False	3	100;0;0	21.664	True		ENSG00000125877	ENSG00000125877	HGNC:6176													
ITPA	gene	ITPA	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Inosine triphosphatase deficiency MIM#613850;Developmental and epileptic encephalopathy 35 MIM#616647;Disorders of purine metabolism				27604308;12384777		False	3	100;0;0	21.664	True		ENSG00000125877	ENSG00000125877	HGNC:6176													
ITPR1	gene	ITPR1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 15 MIM#606658;Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360						False	3	100;0;0	21.664	True		ENSG00000150995	ENSG00000150995	HGNC:6180													
ITPR3	gene	ITPR3	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, demyelinating, type 1J, MIM# 620111;Immunodeficiency 133 with ectodermal dysplasia with or without peripheral neuropathy, MIM# 621254				32949214;24627108;36302985;39270020;39560673		False	3	100;0;0	21.664	False	Other	ENSG00000096433	ENSG00000096433	HGNC:6182													
JAG1	gene	JAG1	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Peripheral neuropathy				32065591;25707699		False	3	100;0;0	21.664	False		ENSG00000101384	ENSG00000101384	HGNC:6188													
JAG2	gene	JAG2	Expert Review Green;Other;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	muscular dystrophy, limb-girdle, autosomal recessive 27 MONDO:0030456				33861953		False	3	100;0;0	21.664	True		ENSG00000184916	ENSG00000184916	HGNC:6189													
JAM2	gene	JAM2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 8, autosomal recessive MIM#618824				31851307		False	3	100;0;0	21.664	True		ENSG00000154721	ENSG00000154721	HGNC:14686													
JAM3	gene	JAM3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hemorrhagic destruction of the brain, subependymal calcification, and cataracts, MIM# 613730				23255084;21109224		False	3	100;0;0	21.664	True		ENSG00000166086	ENSG00000166086	HGNC:15532													
JKAMP	gene	JKAMP	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM#	621533"				41643666		False	3	100;0;0	21.664	True		ENSG00000050130	ENSG00000050130	HGNC:20184													
KANSL1	gene	KANSL1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Koolen-De Vries syndrome MIM#610443				PMID: 28440867		False	3	100;0;0	21.664	True		ENSG00000120071	ENSG00000120071	HGNC:24565													
KARS1	gene	KARS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with or without deafness (LEPID), MIM#619147;Deafness, autosomal recessive 89, MIM# 613916;Congenital deafness and adult-onset progressive leukoencephalopathy (DEAPLE), MIM#619196				26741492;31618474;28887846;25330800;29615062;30252186;28496994;23768514;14975237		False	3	100;0;0	21.664	True		ENSG00000065427	ENSG00000065427	HGNC:6215													
KARS1	gene	KARS1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with or without deafness (LEPID), MIM#619147				30737337;31116475;30715177		False	3	100;0;0	21.664	True		ENSG00000065427	ENSG00000065427	HGNC:6215													
KARS1	gene	KARS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, progressive, infantile-onset, with or without deafness MIM#619147				26741492;31618474;28887846;25330800;29615062;30252186;28496994;23768514;14975237;33942428		False	3	100;0;0	21.664	True		ENSG00000065427	ENSG00000065427	HGNC:6215													
KARS1	gene	KARS1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with or without deafness (LEPID), MIM#619147				26741492;31618474;28887846;25330800;29615062;30252186;28496994		False	3	100;0;0	21.664	True		ENSG00000065427	ENSG00000065427	HGNC:6215													
KAT5	gene	KAT5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with dysmorphic facies, sleep disturbance, and brain abnormalities (NEDFASB), MIM#619103;Severe global developmental delay;Intellectual disability;Seizures;Microcephaly;Behavioral abnormality;Sleep disturbance;Morphological abnormality of the central nervous system;Short stature;Oral cleft;Abnormality of the face				32822602		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000172977	ENSG00000172977	HGNC:5275													
KAT6A	gene	KAT6A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Arboleda-Tham syndrome MIM#616268				PMID: 34748993		False	3	100;0;0	21.664	True		ENSG00000083168	ENSG00000083168	HGNC:13013													
KAT8	gene	KAT8	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;seizures;autism;dysmorphic features;Li-Ghorbani-Weisz syndrome, MIM#618974				31794431		False	3	100;0;0	21.664	True		ENSG00000103510	ENSG00000103510	HGNC:17933													
KATNB1	gene	KATNB1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lissencephaly 6, with microcephaly MIM#616212				PMID: 26640080		False	3	50;0;50	21.664	True		ENSG00000140854	ENSG00000140854	HGNC:6217													
KCNA1	gene	KCNA1	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	EPISODIC ATAXIA, TYPE 1;myokymia with periodic ataxia;Episodic ataxia/myokymia syndrome, 160120;Episodic ataxia/myokymia syndrome				11026449		False	3	100;0;0	21.664	True	Other	ENSG00000111262	ENSG00000111262	HGNC:6218													
KCNA1	gene	KCNA1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia/myokymia syndrome, MIM# 160120				11026449		False	3	100;0;0	21.664	True	Other	ENSG00000111262	ENSG00000111262	HGNC:6218													
KCNA1	gene	KCNA1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy;seizures;epileptic encephalopathies;episodic ataxia type 1 and epilepsy				PMID: 32316562		False	3	100;0;0	21.664	True		ENSG00000111262	ENSG00000111262	HGNC:6218													
KCNA2	gene	KCNA2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early infantile encephalopathy 32, MIM#616366				29050392		False	3	100;0;0	21.664	True		ENSG00000177301	ENSG00000177301	HGNC:6220													
KCNA2	gene	KCNA2	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early infantile encephalopathy 32, 616366				29050392		False	3	100;0;0	21.664	True		ENSG00000177301	ENSG00000177301	HGNC:6220													
KCNA2	gene	KCNA2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary spastic paraplegia and ataxia						False	3	100;0;0	21.664	False		ENSG00000177301	ENSG00000177301	HGNC:6220													
KCNA3	gene	KCNA3	Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, KCNA3-related				37964487		False	3	100;0;0	21.664	True		ENSG00000177272	ENSG00000177272	HGNC:6221													
KCNA6	gene	KCNA6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related				36318112;40472070		False	3	100;0;0	21.664	True		ENSG00000151079	ENSG00000151079	HGNC:6225													
KCNB1	gene	KCNB1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 26, MIM# 616056				31600826;31513310		False	3	100;0;0	21.664	True		ENSG00000158445	ENSG00000158445	HGNC:6231													
KCNC1	gene	KCNC1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, progressive myoclonic 7 (MIM#616187);Intellectual disability;Movement disorders				28145425;31353862;25401298		False	3	100;0;0	21.664	True		ENSG00000129159	ENSG00000129159	HGNC:6233													
KCNC2	gene	KCNC2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 103, MIM# 619913				32392612;31972370;35314505		False	3	50;50;0	21.664	True		ENSG00000166006	ENSG00000166006	HGNC:6234													
KCNC3	gene	KCNC3	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 13 MIM#605259						False	3	100;0;0	21.664	True		ENSG00000131398	ENSG00000131398	HGNC:6235													
KCND1	gene	KCND1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	neurodevelopmental disorder MONDO:0700092, KCND1-related				38772379		False	3	100;0;0	21.664	True		ENSG00000102057	ENSG00000102057	HGNC:6237													
KCND2	gene	KCND2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, KCND2-related				24501278;16934482;29581270;34245260		False	3	100;0;0	21.664	True		ENSG00000184408	ENSG00000184408	HGNC:6238													
KCND3	gene	KCND3	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 19, MIM#607346				32823520		False	3	100;0;0	21.664	True		ENSG00000171385	ENSG00000171385	HGNC:6239													
KCND3	gene	KCND3	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 19, MIM#	607346"				32823520		False	3	100;0;0	21.664	True		ENSG00000171385	ENSG00000171385	HGNC:6239													
KCNH1	gene	KCNH1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Temple-Baraitser syndrome, OMIM:611816 Zimmermann-Laband syndrome 1, OMIM:135500 Intellectual disability Encephalopathy without features of TBS/ZLS				PMID: 33594261		False	3	100;0;0	21.664	True		ENSG00000143473	ENSG00000143473	HGNC:6250													
KCNH5	gene	KCNH5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental and epileptic encephalopathy 112, MIM# 620537				36307226		False	3	100;0;0	21.664	True	Other	ENSG00000140015	ENSG00000140015	HGNC:6254													
KCNJ10	gene	KCNJ10	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	EAST syndrome MONDO:0013005, SESAME syndrome, MIM# 612780;Disorders of magnesium metabolism				19289823, 21849804, 11466414		False	3	0;0;0	21.664	False		ENSG00000177807	ENSG00000177807	HGNC:6256													
KCNJ10	gene	KCNJ10	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	SESAME syndrome, MIM# 612780				19289823;19420365;21849804;11466414		False	3	100;0;0	21.664	True		ENSG00000177807	ENSG00000177807	HGNC:6256													
KCNJ10	gene	KCNJ10	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seizures, Sensorineural Deafness, Ataxia, Mental Retardation, and Electrolyte Imbalance Syndrome;SESAME syndrome, 612780						False	3	100;0;0	21.664	False		ENSG00000177807	ENSG00000177807	HGNC:6256													
KCNJ11	gene	KCNJ11	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Diabetes mellitus, transient neonatal, 3 610582;Diabetes, permanent neonatal, with or without neurologic features 606176;Hyperinsulinemic hypoglycemia, familial, 2 601820				18250167;11395395;23275527;23345197		False	3	100;0;0	21.664	True		ENSG00000187486	ENSG00000187486	HGNC:6257													
KCNJ2	gene	KCNJ2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Andersen syndrome, MIM# 170390				16217063;16571646;16419128;17324964		False	3	100;0;0	21.664	True		ENSG00000123700	ENSG00000123700	HGNC:6263													
KCNJ4	gene	KCNJ4	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, KCNJ4-related				41830586		False	3	100;0;0	21.664	True	Other	ENSG00000168135	ENSG00000168135	HGNC:6265													
KCNK4	gene	KCNK4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Facial dysmorphism, hypertrichosis, epilepsy, intellectual/developmental delay, and gingival overgrowth syndrome 618381				30290154		False	3	100;0;0	21.664	True	Other	ENSG00000182450	ENSG00000182450	HGNC:6279													
KCNMA1	gene	KCNMA1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM# 609446				15937479;26195193		False	3	100;0;0	21.664	True		ENSG00000156113	ENSG00000156113	HGNC:6284													
KCNMA1	gene	KCNMA1	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy MIM#609446				26195193;15937479;29356177		False	3	100;0;0	21.664	False	Other	ENSG00000156113	ENSG00000156113	HGNC:6284													
KCNMA1	gene	KCNMA1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM# 609446;Cerebellar atrophy, developmental delay, and seizures, MIM# 617643;Liang-Wang syndrome, MIM# 618729				15937479;26195193;27567911;29545233;31427379;31152168		False	3	100;0;0	21.664	True		ENSG00000156113	ENSG00000156113	HGNC:6284													
KCNN2	gene	KCNN2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725				33242881		False	3	100;0;0	21.664	True		ENSG00000080709	ENSG00000080709	HGNC:6291													
KCNN2	gene	KCNN2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725				33242881		False	3	100;0;0	21.664	True		ENSG00000080709	ENSG00000080709	HGNC:6291													
KCNN2	gene	KCNN2	Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 34, myoclonic, MIM#619724;Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725				32212350;33242881		False	3	100;0;0	21.664	False		ENSG00000080709	ENSG00000080709	HGNC:6291													
KCNQ2	gene	KCNQ2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 7, 613720;Seizures, benign neonatal, 1, 121200				25959266;32917465;24318194		False	3	67;33;0	21.664	True	Other	ENSG00000075043	ENSG00000075043	HGNC:6296													
KCNQ2	gene	KCNQ2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myokymia, MIM# 121200;Seizures, benign neonatal, 1, MIM# 121200;Developmental and epileptic encephalopathy 7, MIM# 613720						False	3	100;0;0	21.664	True		ENSG00000075043	ENSG00000075043	HGNC:6296													
KCNQ3	gene	KCNQ3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Seizures, benign neonatal, 2, MIM# 121201				33337327;25524373;24851285		False	3	100;0;0	21.664	True		ENSG00000184156	ENSG00000184156	HGNC:6297													
KCNQ3	gene	KCNQ3	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Seizures, benign neonatal, 2, MIM# 121201				33337327		False	3	100;0;0	21.664	False		ENSG00000184156	ENSG00000184156	HGNC:6297													
KCNQ5	gene	KCNQ5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 46, MIM# 617601				28669405;30359776		False	3	100;0;0	21.664	True		ENSG00000185760	ENSG00000185760	HGNC:6299													
KCNT1	gene	KCNT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, nocturnal frontal lobe, 5, MIM# 615005;Epileptic encephalopathy, early infantile, 14, MIM# 614959				23086397;23086396;31872048;31532509		False	3	100;0;0	21.664	True		ENSG00000107147	ENSG00000107147	HGNC:18865													
KCNT2	gene	KCNT2	Expert Review Green;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 57, MIM#617771;Developmental and epileptic encephalopathy				29069600;29740868		False	3	100;0;0	21.664	True	Other	ENSG00000162687	ENSG00000162687	HGNC:18866													
KCTD17	gene	KCTD17	Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Dystonia 26, myoclonic MIM#616398				25983243;30642807;30579817		False	3	100;0;0	21.664	False		ENSG00000100379	ENSG00000100379	HGNC:25705													
KCTD3	gene	KCTD3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder MONDO:0700092, KCTD3-related				29406573		False	3	100;0;0	21.664	True		ENSG00000136636	ENSG00000136636	HGNC:21305													
KCTD7	gene	KCTD7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726), AR				33767931;33970744;22693283;22748208;22693283;22748208		False	3	100;0;0	21.664	True		ENSG00000243335	ENSG00000243335	HGNC:21957													
KCTD7	gene	KCTD7	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive myoclonus epilepsy MONDO:0020074;Neuronal ceroid lipofuscinosis				36368077;30295347;29884839		False	3	0;0;0	21.664	False		ENSG00000243335	ENSG00000243335	HGNC:21957													
KDM4B	gene	KDM4B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 65, MIM# 619320;Global developmental delay, intellectual disability and neuroanatomical defects				PMID: 33232677		False	3	100;0;0	21.664	True		ENSG00000127663	ENSG00000127663	HGNC:29136													
KDM5C	gene	KDM5C	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type MIM# 300534;MONDO:0010355				15586325;32279304		False	3	100;0;0	21.664	True		ENSG00000126012	ENSG00000126012	HGNC:11114													
KDM5C	gene	KDM5C	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type MIM# 300534;MONDO:0010355				23246292;32279304;26919706;15586325		False	3	100;0;0	21.664	True		ENSG00000126012	ENSG00000126012	HGNC:11114													
KICS2	gene	KICS2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 83, MIM# 621100				PMID: 39824192		False	3	100;0;0	21.664	True		ENSG00000174206	ENSG00000174206	HGNC:26517													
KIDINS220	gene	KIDINS220	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296;MONDO:0015007				27005418;29667355		False	3	100;0;0	21.664	True		ENSG00000134313	ENSG00000134313	HGNC:29508													
KIF1A	gene	KIF1A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	NESCAV syndrome, MIM# 614255				21820098;28708278		False	3	100;0;0	21.664	True		ENSG00000130294	ENSG00000130294	HGNC:888													
KIF1A	gene	KIF1A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia;spastic paraplegia;intellectual disability				32096284;32935419		False	3	100;0;0	21.664	False		ENSG00000130294	ENSG00000130294	HGNC:888													
KIF1A	gene	KIF1A	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary Sensory and Autonomic Neuropathy, Type II;Neuropathy, hereditary sensory, type IIC, 614213				25265257;21820098		False	3	0;0;0	21.664	False		ENSG00000130294	ENSG00000130294	HGNC:888													
KIF1A	gene	KIF1A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HSAN/SFN;Neuropathy, hereditary sensory, type IIC, 614213				21820098;28708278		False	3	100;0;0	21.664	False		ENSG00000130294	ENSG00000130294	HGNC:888													
KIF1A	gene	KIF1A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 30, autosomal dominant MIM# 610357;Spastic paraplegia 30, autosomal recessive 620607				26410750;21487076;22258533;32096284;31488895;29159194;25585697		False	3	100;0;0	21.664	True		ENSG00000130294	ENSG00000130294	HGNC:888													
KIF1C	gene	KIF1C	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 2, autosomal recessive, 611302;Spastic ataxia 2, autosomal recessive				24482476;24319291;31413903;29544888		False	3	100;0;0	21.664	True		ENSG00000129250	ENSG00000129250	HGNC:6317													
KIF1C	gene	KIF1C	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 2, autosomal recessive MIM#611302				24482476;24319291;31413903;29544888		False	3	100;0;0	21.664	True		ENSG00000129250	ENSG00000129250	HGNC:6317													
KIF21A	gene	KIF21A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Fibrosis of extraocular muscles, congenital, 1/3B, MIM#135700				37921537;39643435;41282472;32141982;24715754;36494820;22699964		False	3	100;0;0	21.664	True		ENSG00000139116	ENSG00000139116	HGNC:19349													
KIF2A	gene	KIF2A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411				23603762;27896282;27747449;29077851;31919497		False	3	100;0;0	21.664	True		ENSG00000068796	ENSG00000068796	HGNC:6318													
KIF5A	gene	KIF5A	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Myoclonus, intractable, neonatal	MIM#617235"				27414745;33681666;27463701		False	3	100;0;0	21.664	True		ENSG00000155980	ENSG00000155980	HGNC:6323													
KIF5A	gene	KIF5A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myoclonus, intractable, neonatal, MIM#617235				27463701;27414745		False	3	100;0;0	21.664	True		ENSG00000155980	ENSG00000155980	HGNC:6323													
KIF5A	gene	KIF5A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary Neuropathies;HMSN				30057544;29892902;28902413;26403765;25695920;25008398		False	3	100;0;0	21.664	False		ENSG00000155980	ENSG00000155980	HGNC:6323													
KIF5A	gene	KIF5A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spastic paraplegia 10, autosomal dominant, MIM#	604187"				16489470;21623771;15452312;18853458;16476820		False	3	100;0;0	21.664	True		ENSG00000155980	ENSG00000155980	HGNC:6323													
KIF5A	gene	KIF5A	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Amyotrophic lateral sclerosis, susceptibility to, 25} MIM#617921				29342275;30301576;29566793		False	3	100;0;0	21.664	False		ENSG00000155980	ENSG00000155980	HGNC:6323													
KIF5C	gene	KIF5C	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282				23603762;23033978;32562872		False	3	100;0;0	21.664	True		ENSG00000168280	ENSG00000168280	HGNC:6325													
KIF7	gene	KIF7	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Koubert syndrome 12;Acrocallosal syndrome, Schinzel type						False	3	100;0;0	21.664	False		ENSG00000166813	ENSG00000166813	HGNC:30497													
KLC2	gene	KLC2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia, optic atrophy, and neuropathy, MIM#609541						False	3	50;0;50	21.664	True		ENSG00000174996	ENSG00000174996	HGNC:20716													
KLC2	gene	KLC2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia, optic atrophy, and neuropathy MIM#609541				26385635		False	3	100;0;0	21.664	True		ENSG00000174996	ENSG00000174996	HGNC:20716													
KLHL20	gene	KLHL20	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390				PMID: 36214804		False	3	100;0;0	21.664	True		ENSG00000076321	ENSG00000076321	HGNC:25056													
KMT2A	gene	KMT2A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Wiedemann-Steiner syndrome MIM#605130				PMID: 37075569		False	3	100;0;0	21.664	True		ENSG00000118058	ENSG00000118058	HGNC:7132													
KMT2B	gene	KMT2B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 28, childhood-onset , MIM#617284				PMID: 33816656		False	3	100;0;0	21.664	True		ENSG00000272333	ENSG00000272333	HGNC:15840													
KMT2B	gene	KMT2B	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset dystonia;Dystonia 28, childhood-onset 617284;MONDO:0015004				27839873;27992417		False	3	100;0;0	21.664	False		ENSG00000272333	ENSG00000272333	HGNC:15840													
KMT2C	gene	KMT2C	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Kleefstra syndrome 2, MIM# 617768;Neurodevelopmental disorder, MONDO:0700092, KMT2C-related				39013459		False	3	100;0;0	21.664	True		ENSG00000055609	ENSG00000055609	HGNC:13726													
KMT2D	gene	KMT2D	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Kabuki syndrome 1	MIM#147920"				33552639;28404210;27922244;21882399		False	3	100;0;0	21.664	True		ENSG00000167548	ENSG00000167548	HGNC:7133													
KMT2E	gene	KMT2E	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	O'Donnell-Luria-Rodan syndrome, MIM# 618512;Intellectual disability;Autism;Seizures				31079897		False	3	100;0;0	21.664	True		ENSG00000005483	ENSG00000005483	HGNC:18541													
KPNA3	gene	KPNA3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia-88 (SPG88), MIM#620106				34564892		False	3	100;0;0	21.664	True		ENSG00000102753	ENSG00000102753	HGNC:6396													
KPTN	gene	KPTN	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 4, MIM#1615637				25847626;24239382;32358097;32808430		False	3	100;0;0	21.664	True		ENSG00000118162	ENSG00000118162	HGNC:6404													
KRAS	gene	KRAS	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Oculoectodermal syndrome, somatic MIM#600268;Schimmelpenning-Feuerstein-Mims syndrome, somatic mosaic MIM#163200				PMID: 37126322;37722300		False	3	100;0;0	21.664	True	Other	ENSG00000133703	ENSG00000133703	HGNC:6407													
KRIT1	gene	KRIT1	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cavernous malformations of CNS and retina, 116860;Cerebral cavernous malformations-1, 116860;Hyperkeratotic cutaneous capillary-venous malformations associated with cerebral capillary malformations, 116860				10508515;20301470		False	3	100;0;0	21.664	True		ENSG00000001631	ENSG00000001631	HGNC:1573													
KRIT1	gene	KRIT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Hyperkeratotic cutaneous capillary-venous malformations associated with cerebral capillary malformations MIM#116860;Cavernous malformations of CNS and retina	MIM#116860;Cerebral cavernous malformations-1 MIM#116860"				35836010;35444609		False	3	100;0;0	21.664	True		ENSG00000001631	ENSG00000001631	HGNC:1573													
KY	gene	KY	Expert Review Green;Other;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, myofibrillar, 7 (MIM#617114)				27484770;27485408;30591934;11136708		False	3	100;0;0	21.664	True		ENSG00000174611	ENSG00000174611	HGNC:26576													
KYNU	gene	KYNU	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hydroxykynureninuria MIM#236800;Vertebral, cardiac, renal, and limb defects syndrome 2 MIM#617661;Disorders of histidine, tryptophan or lysine metabolism				17334708;28792876;31923704		False	3	100;0;0	21.664	True		ENSG00000115919	ENSG00000115919	HGNC:6469													
L1CAM	gene	L1CAM	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Hereditary spastic paraplegia, 308840;MASA syndrome, 303350;X-linked hydrocephalus, 307000						False	3	100;0;0	21.664	True		ENSG00000198910	ENSG00000198910	HGNC:6470													
L2HGDH	gene	L2HGDH	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L-2-hydroxyglutaric aciduria, MIM#236792				29884839;37995940;37113859;34270333;17475916;28137912;15385440		False	3	100;0;0	21.664	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
L2HGDH	gene	L2HGDH	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L-2-hydroxyglutaric aciduria MIM#236792				PMID: 37113859		False	3	100;0;0	21.664	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
L2HGDH	gene	L2HGDH	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L-2-hydroxyglutaric aciduria MIM#236792;organic acidurias				27604308;15385440		False	3	100;0;0	21.664	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
L2HGDH	gene	L2HGDH	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"L-2-hydroxyglutaric aciduria, MIM#	236792"						False	3	100;0;0	21.664	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
L2HGDH	gene	L2HGDH	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L-2-hydroxyglutaric aciduria MIM#236792				24753671;18780161;15824270;10399870		False	3	100;0;0	21.664	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
LAMA1	gene	LAMA1	Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Poretti-Boltshauser syndrome;Cerebellar ataxia, intellectual disability, oculomotor apraxia, cerebellar cysts syndrome				26932191;25105227		False	3	100;0;0	21.664	True		ENSG00000101680	ENSG00000101680	HGNC:6481													
LAMA2	gene	LAMA2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM#	607855;Muscular dystrophy, limb-girdle, autosomal recessive 23	, MIM#618138"				33333793;34325301		False	3	100;0;0	21.664	True		ENSG00000196569	ENSG00000196569	HGNC:6482													
LAMA2	gene	LAMA2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138				30055037		False	3	100;0;0	21.664	True		ENSG00000196569	ENSG00000196569	HGNC:6482													
LAMB1	gene	LAMB1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Cystic leukoencephalopathy				29888467;25925986;34606115		False	3	50;50;0	21.664	True		ENSG00000091136	ENSG00000091136	HGNC:6486													
LAMC3	gene	LAMC3	Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cortical malformations, occipital, MIM#614115				33639934;21572413;34354730		False	3	100;0;0	21.664	True		ENSG00000050555	ENSG00000050555	HGNC:6494													
LAMP2	gene	LAMP2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Danon disease, MIM# 300257;MONDO:0010281						False	3	100;0;0	21.664	True		ENSG00000005893	ENSG00000005893	HGNC:6501													
LAMP2	gene	LAMP2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Danon disease, MIM# 300257						False	3	100;0;0	21.664	True		ENSG00000005893	ENSG00000005893	HGNC:6501													
LAMP2	gene	LAMP2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Danon disease, MIM# 300257;MONDO:0010281						False	3	100;0;0	21.664	True		ENSG00000005893	ENSG00000005893	HGNC:6501													
LARGE1	gene	LARGE1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6 613154;Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 6 MIM#608840						False	3	100;0;0	21.664	True		ENSG00000133424	ENSG00000133424	HGNC:6511													
LARS1	gene	LARS1	Expert Review Green;NHS GMS;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile liver failure syndrome 1, MIM# 615438;Seizures;Intellectual disability;Encephalopathy				32699352		False	3	100;0;0	21.664	True		ENSG00000133706	ENSG00000133706	HGNC:6512													
LARS1	gene	LARS1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile liver failure syndrome 1 MIM#615438;disorder of leucine metabolism				22607940;30349989;28774368		False	3	100;0;0	21.664	True		ENSG00000133706	ENSG00000133706	HGNC:6512													
LARS2	gene	LARS2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021;Leukodystrophy				29205794;32423379;30737337		False	3	100;0;0	21.664	True		ENSG00000011376	ENSG00000011376	HGNC:17095													
LARS2	gene	LARS2	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy				32442335;30737337		False	3	100;0;0	21.664	False		ENSG00000011376	ENSG00000011376	HGNC:17095													
LARS2	gene	LARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anaemia, MIM# 617021;Leukodystrophy				29205794;32423379;30737337;26537577;23541342		False	3	100;0;0	21.664	True		ENSG00000011376	ENSG00000011376	HGNC:17095													
LBR	gene	LBR	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Greenberg skeletal dysplasia MIM#215140;Disorders of sterol biosynthesis				12618959;27604308		False	3	100;0;0	21.664	True		ENSG00000143815	ENSG00000143815	HGNC:6518													
LCT	gene	LCT	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lactase deficiency, congenital MIM#223000;Other carbohydrate disorders				9758622;27604308		False	3	100;0;0	21.664	True		ENSG00000115850	ENSG00000115850	HGNC:6530													
LDB3	gene	LDB3	Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	myofibrillar myopathy 4 MONDO:0012277				24668811;27546599;25911362		False	3	100;0;0	21.664	True	Other	ENSG00000122367	ENSG00000122367	HGNC:15710													
LDHA	gene	LDHA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease XI, MIM# 612933				2334430;1959923;8327147		False	3	100;0;0	21.664	True		ENSG00000134333	ENSG00000134333	HGNC:6535													
LDHA	gene	LDHA	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease XI, MIM# 612933				2334430;1959923;8327147		False	3	100;0;0	21.664	True		ENSG00000134333	ENSG00000134333	HGNC:6535													
LDHD	gene	LDHD	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	D-lactic aciduria with susceptibility to gout MIM#245450				40678184		False	3	100;0;0	21.664	True		ENSG00000166816	ENSG00000166816	HGNC:19708													
LETM1	gene	LETM1	Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089				36055214		False	3	100;0;0	21.664	True		ENSG00000168924	ENSG00000168924	HGNC:6556													
LETM1	gene	LETM1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089				36055214		False	3	100;0;0	21.664	True		ENSG00000168924	ENSG00000168924	HGNC:6556													
LETM1	gene	LETM1	Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089				36055214		False	3	100;0;0	21.664	True		ENSG00000168924	ENSG00000168924	HGNC:6556													
LFNG	gene	LFNG	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spondylocostal dysostosis 3, autosomal recessive, MIM# 609813				9690472;16385447;30531807;9690473		False	3	100;0;0	21.664	True		ENSG00000106003	ENSG00000106003	HGNC:6560													
LGI1	gene	LGI1	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Epilepsy, familial temporal lobe, 1, MIM# 6000512;Developmental and epileptic encephalopathy 121, MIM# 621475				18711109;12205652;15079010;22496201;40455867		False	3	100;0;0	21.664	True		ENSG00000108231	ENSG00000108231	HGNC:6572													
LIAS	gene	LIAS	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperglycinemia, lactic acidosis, and seizures, MIM# 614462				22152680;24334290;26108146		False	3	100;0;0	21.664	True		ENSG00000121897	ENSG00000121897	HGNC:16429													
LIAS	gene	LIAS	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperglycinaemia, lactic acidosis, and seizures, MIM# 614462				22152680;24334290;26108146		False	3	100;0;0	21.664	True		ENSG00000121897	ENSG00000121897	HGNC:16429													
LIG3	gene	LIG3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780				PMID: 33855352		False	3	100;0;0	21.664	True		ENSG00000005156	ENSG00000005156	HGNC:6600													
LIG3	gene	LIG3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780				33855352		False	3	100;0;0	21.664	True		ENSG00000005156	ENSG00000005156	HGNC:6600													
LIG3	gene	LIG3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780				33855352		False	3	100;0;0	21.664	True		ENSG00000005156	ENSG00000005156	HGNC:6600													
LIPA	gene	LIPA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cholesteryl ester storage disease, MIM# 278000;Wolman disease, MIM# 278000;Lysosomal acid lipase deficiency, MONDO:0010204				11487567		False	3	100;0;0	21.664	True		ENSG00000107798	ENSG00000107798	HGNC:6617													
LIPT1	gene	LIPT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lipoyltransferase 1 deficiency, MIM#616299;Leigh-like presentation						False	3	100;0;0	21.664	True		ENSG00000144182	ENSG00000144182	HGNC:29569													
LIPT2	gene	LIPT2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM# 617668				28757203		False	3	100;0;0	21.664	True		ENSG00000175536	ENSG00000175536	HGNC:37216													
LIPT2	gene	LIPT2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM#617668				28757203		False	3	100;0;0	21.664	True		ENSG00000175536	ENSG00000175536	HGNC:37216													
LITAF	gene	LITAF	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, type 1C, MIM# 601098;MONDO:0010995				12525712;19541485;23359569;32665875;28211240		False	3	100;0;0	21.664	False		ENSG00000189067	ENSG00000189067	HGNC:16841													
LMBRD2	gene	LMBRD2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental delay with variable neurologic and brain abnormalities, MIM# 619694;Global developmental delay;Intellectual disability;Microcephaly;Seizures;Abnormality of nervous system morphology;Abnormality of the eye				32820033;https://doi.org/10.1101/797787		False	3	50;50;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000164187	ENSG00000164187	HGNC:25287													
LMNA	gene	LMNA	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Emery-Dreifuss muscular dystrophy 2, autosomal dominant	(MIM#181350)"				27220833;23746545;17377071		False	3	0;100;0	21.664	True	Other	ENSG00000160789	ENSG00000160789	HGNC:6636													
LMNB1	gene	LMNB1	Victorian Clinical Genetics Services;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, adult-onset, autosomal dominant MIM#169500				31695592		False	3	100;0;0	21.664	False		ENSG00000113368	ENSG00000113368	HGNC:6637													
LMNB1	gene	LMNB1	Victorian Clinical Genetics Services;Australian Genomcis Health Alliance Leukodystrophy Flagship;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Australian Genomcis Health Alliance Leukodystrophy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500;Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061				16951681;30842973		False	3	100;0;0	21.664	False		ENSG00000113368	ENSG00000113368	HGNC:6637													
LNPK	gene	LNPK	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with epilepsy and hypoplasia of the corpus callosum, MIM# 618090				30032983		False	3	100;0;0	21.664	True		ENSG00000144320	ENSG00000144320	HGNC:21610													
LONP1	gene	LONP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	CODAS syndrome, MIM#600373;mitochondrial disease (MONDO:0044970), LONP1-related				31636596;36353900;31923470		False	3	100;0;0	21.664	True		ENSG00000196365	ENSG00000196365	HGNC:9479													
LONP1	gene	LONP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	CODAS syndrome, MIM#600373;mitochondrial disease (MONDO:0044970), LONP1-related				31636596;36353900;31923470		False	3	100;0;0	21.664	True		ENSG00000196365	ENSG00000196365	HGNC:9479													
LPIN1	gene	LPIN1	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myoglobinuria, acute recurrent, autosomal recessive        268200				22481384;28649549;18817903;32410653		False	3	100;0;0	21.664	True		ENSG00000134324	ENSG00000134324	HGNC:13345													
LPIN1	gene	LPIN1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myoglobinuria, acute recurrent, autosomal recessive, MIM# 268200				18817903;32549891;32522502;32410653		False	3	100;0;0	21.664	True		ENSG00000134324	ENSG00000134324	HGNC:13345													
LRP10	gene	LRP10	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease MONDO:0005180				36434476;33913039;32613234;32597809;30964957;30597596;29887161		False	3	100;0;0	21.664	True		ENSG00000197324	ENSG00000197324	HGNC:14553													
LRP10	gene	LRP10	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease MONDO:0005180				36434476;33913039;32613234;32597809;30964957;30597596;29887161		False	3	100;0;0	21.664	False		ENSG00000197324	ENSG00000197324	HGNC:14553													
LRPPRC	gene	LRPPRC	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian) MIM#220111				32972427;26510951;21266382		False	3	100;0;0	21.664	True		ENSG00000138095	ENSG00000138095	HGNC:15714													
LRPPRC	gene	LRPPRC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian) (MIM#220111)				21266382;26510951;38046674;29152527		False	3	0;100;0	21.664	True		ENSG00000138095	ENSG00000138095	HGNC:15714													
LRRK2	gene	LRRK2	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted							False	3	100;0;0	21.664	False		ENSG00000188906	ENSG00000188906	HGNC:18618													
LRRK2	gene	LRRK2	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown							False	3	100;0;0	21.664	False		ENSG00000188906	ENSG00000188906	HGNC:18618													
LRSAM1	gene	LRSAM1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2P, MIM# 614436;MONDO:0013753;HMSN				20865121;22012984;22781092;27686364;33568173;33414056;30996334		False	3	100;0;0	21.664	False		ENSG00000148356	ENSG00000148356	HGNC:25135													
LSS	gene	LSS	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alopecia-intellectual disability syndrome 4, MIM#618840				PMID: 30723320;37157980		False	3	100;0;0	21.664	True		ENSG00000160285	ENSG00000160285	HGNC:6708													
LYRM7	gene	LYRM7	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	615838;Mitochondrial complex III deficiency, nuclear type 8;leukoencephalopathy and complex III deficiency;severe encephalopathy, lactic acidosis and profound, isolated cIII deficiency in skeletal muscle						False	3	0;0;0	21.664	False		ENSG00000186687	ENSG00000186687	HGNC:28072													
LYRM7	gene	LYRM7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 8 - MIM#615838						False	3	100;0;0	21.664	True		ENSG00000186687	ENSG00000186687	HGNC:28072													
LYSET	gene	LYSET	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dysostosis multiplex, Ain-Naz type 619345				33252156;40171858		False	3	50;50;0	21.664	True		ENSG00000153485	ENSG00000153485	HGNC:20218													
LYST	gene	LYST	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chediak-Higashi syndrome MONDO:0008963				23436631;23521865;20301751		False	3	100;0;0	21.664	True		ENSG00000143669	ENSG00000143669	HGNC:1968													
LYST	gene	LYST	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chediak-Higashi syndrome MIM#214500;MONDO:0008963				24521565;15790783;20301751		False	3	0;100;0	21.664	True		ENSG00000143669	ENSG00000143669	HGNC:1968													
MACF1	gene	MACF1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Lissencephaly 9 with complex brainstem malformation, MIM#	618325"				30471716		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000127603	ENSG00000127603	HGNC:13664													
MADD	gene	MADD	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	DEEAH syndrome, MIM#619004 (Developmental Delay With Endocrine, Exocrine, Autonomic, and Hematologic Abnormalities);Neurodevelopmental disorder with dysmorphic facies, impaired speech and hypotonia (NEDDISH), MIM# 619005				28940097;29302074;32761064		False	3	100;0;0	21.664	True		ENSG00000110514	ENSG00000110514	HGNC:6766													
MAF	gene	MAF	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ayme-Gripp syndrome (MIM#601088)				30160832;34643041		False	3	100;0;0	21.664	True		ENSG00000178573	ENSG00000178573	HGNC:6776													
MAG	gene	MAG	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 75, autosomal recessive, MIM#	616680;Cerebellar ataxia;Oculomotor apraxia"				32629324;32340215;32629324		False	3	100;0;0	21.664	True		ENSG00000105695	ENSG00000105695	HGNC:6783													
MAG	gene	MAG	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 75, autosomal recessive, 616680;Cerebellar ataxia				31402626;24482476;26179919;32629324		False	3	100;0;0	21.664	True		ENSG00000105695	ENSG00000105695	HGNC:6783													
MAGT1	gene	MAGT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Congenital disorder of glycosylation, type Icc  (MIM# 	301031);Immunodeficiency, X-linked, with magnesium defect, Epstein-Barr virus infection and neoplasia (MIM# 300853)"				31036665;31714901		False	3	100;0;0	21.664	True		ENSG00000102158	ENSG00000102158	HGNC:28880													
MAN1B1	gene	MAN1B1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 15, MIM#614202						False	3	100;0;0	21.664	True		ENSG00000177239	ENSG00000177239	HGNC:6823													
MAN2B1	gene	MAN2B1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mannosidosis, alpha-, types I and II, MIM# 248500;MONDO:0009561						False	3	100;0;0	21.664	True		ENSG00000104774	ENSG00000104774	HGNC:6826													
MAN2B1	gene	MAN2B1	Expert Review Green;Expert list;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alpha-mannosidosis MONDO:0009561				20301570		False	3	100;0;0	21.664	True		ENSG00000104774	ENSG00000104774	HGNC:6826													
MAN2B1	gene	MAN2B1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mannosidosis, alpha-, types I and II, MIM#248500						False	3	100;0;0	21.664	False		ENSG00000104774	ENSG00000104774	HGNC:6826													
MAN2B2	gene	MAN2B2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation type 1EE with or without immunodeficiency, MIM# 621140				38622837;35637269;31775018		False	3	50;50;0	21.664	True		ENSG00000013288	ENSG00000013288	HGNC:29623													
MANBA	gene	MANBA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mannosidosis, beta, MIM# 248510;MONDO:0009562						False	3	100;0;0	21.664	True		ENSG00000109323	ENSG00000109323	HGNC:6831													
MAOA	gene	MAOA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Brunner syndrome, MIM# 300615				25807999;24169519		False	3	100;0;0	21.664	True		ENSG00000189221	ENSG00000189221	HGNC:6833													
MAP1B	gene	MAP1B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual disability;seizures;PVNH;dysmorphic features;Periventricular nodular heterotopia 9, MIM# 618918				33772511		False	3	50;0;50	21.664	True		ENSG00000131711	ENSG00000131711	HGNC:6836													
MAP2K1	gene	MAP2K1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiofaciocutaneous syndrome 3, MIM# 615279				16439621;17551924;18042262;20301365		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000169032	ENSG00000169032	HGNC:6840													
MAP2K2	gene	MAP2K2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiofaciocutaneous syndrome 4, MIM# 615280				20358587;16439621;18042262		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000126934	ENSG00000126934	HGNC:6842													
MAP2K4	gene	MAP2K4	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092				41480045		False	3	100;0;0	21.664	False	Other	ENSG00000065559	ENSG00000065559	HGNC:6844													
MAPK8IP3	gene	MAPK8IP3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Neurodevelopmental disorder with or without variable brain abnormalities	618443"				PMID: 30612693;30945334		False	3	100;0;0	21.664	True		ENSG00000138834	ENSG00000138834	HGNC:6884													
MAPT	gene	MAPT	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Supranuclear palsy, progressive (MIM# 601104) AD;Supranuclear palsy, progressive atypical (MIM# 260540) AR				20838030;11220749		False	3	100;0;0	21.664	True		ENSG00000186868	ENSG00000186868	HGNC:6893													
MAPT	gene	MAPT	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	late-onset Parkinson disease MONDO:0008199				20301678		False	3	100;0;0	21.664	True		ENSG00000186868	ENSG00000186868	HGNC:6893													
MAPT	gene	MAPT	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"semantic dementia	MONDO:0010857"				33802612;36970046		False	3	100;0;0	21.664	False	Other	ENSG00000186868	ENSG00000186868	HGNC:6893													
MARK2	gene	MARK2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 76, MIM# 621285				PMID: 39419027, 39436150		False	3	100;0;0	21.664	True		ENSG00000072518	ENSG00000072518	HGNC:3332													
MARS2	gene	MARS2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 3, autosomal recessive MIM#611390				16672289;22448145		False	3	100;0;0	21.664	True		ENSG00000247626	ENSG00000247626	HGNC:25133													
MARS2	gene	MARS2	Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 3, autosomal recessive MIM#611390						False	3	100;0;0	21.664	True		ENSG00000247626	ENSG00000247626	HGNC:25133													
MARS2	gene	MARS2	Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 3, autosomal recessive MIM#611390				16672289;22448145		False	3	100;0;0	21.664	True		ENSG00000247626	ENSG00000247626	HGNC:25133													
MAST1	gene	MAST1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations;OMIM #618273				31721002;30449657;32198973		False	3	100;0;0	21.664	True		ENSG00000105613	ENSG00000105613	HGNC:19034													
MAST3	gene	MAST3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 108, MIM#620115				34185323		False	3	100;0;0	21.664	True		ENSG00000099308	ENSG00000099308	HGNC:19036													
MAST4	gene	MAST4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, MAST4-related				36910266;33057194		False	3	100;0;0	21.664	True		ENSG00000069020	ENSG00000069020	HGNC:19037													
MAT1A	gene	MAT1A	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850;Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850;Disorders of the metabolism of sulphur amino acids				27604308;7560086		False	3	100;0;0	21.664	True		ENSG00000151224	ENSG00000151224	HGNC:6903													
MATR3	gene	MATR3	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	distal myopathy with vocal cord weakness MONDO:0018951				19344878;34659085;25154462;31056746		False	3	100;0;0	21.664	True	Other	ENSG00000015479	ENSG00000015479	HGNC:6912													
MATR3	gene	MATR3	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted					19344878;24686783;35205163;34659085;34173818;26493020		False	3	100;0;0	21.664	False		ENSG00000015479	ENSG00000015479	HGNC:6912													
MB	gene	MB	Expert Review Green;Other;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myopathy, sarcoplasmic body MIM#620286				35527200;30918256		False	3	100;0;0	21.664	True		ENSG00000198125	ENSG00000198125	HGNC:6915													
MBD5	gene	MBD5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 1, MIM# 156200;MONDO:0007974				18812405;21981781;23708187;22726846;33912662		False	3	100;0;0	21.664	True		ENSG00000204406	ENSG00000204406	HGNC:20444													
MBOAT7	gene	MBOAT7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	intellectual disability MIM#617188				33335874;32645526;32744787;31852446;31282596;30701556		False	3	100;0;0	21.664	True		ENSG00000125505	ENSG00000125505	HGNC:15505													
MCCC1	gene	MCCC1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-Methylcrotonyl-CoA carboxylase 1 deficiency MIM#210200;Organic acidurias				36822454;31730530		False	3	100;0;0	21.664	True		ENSG00000078070	ENSG00000078070	HGNC:6936													
MCCC2	gene	MCCC2	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-Methylcrotonyl-CoA carboxylase 2 deficiency MIM#210210;Organic acidurias				27604308;11181649		False	3	100;0;0	21.664	True		ENSG00000131844	ENSG00000131844	HGNC:6937													
MCEE	gene	MCEE	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonyl-CoA epimerase deficiency MIM#251120;Organic acidurias				27604308;16752391;32521958;31146325;32719376;30682498		False	3	100;0;0	21.664	True		ENSG00000124370	ENSG00000124370	HGNC:16732													
MCM3AP	gene	MCM3AP	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development, 618124				24123876;28633435;28969388;29982295;32202298		False	3	100;0;0	21.664	True		ENSG00000160294	ENSG00000160294	HGNC:6946													
MCOLN1	gene	MCOLN1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucolipidosis IV, MIM# 252650;MONDO:0009653						False	3	100;0;0	21.664	True		ENSG00000090674	ENSG00000090674	HGNC:13356													
MCOLN1	gene	MCOLN1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mucolipidosis IV, MIM#	252650"				10973263;11030752		False	3	100;0;0	21.664	True		ENSG00000090674	ENSG00000090674	HGNC:13356													
MDGA2	gene	MDGA2	Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 122, MIM# 621608				https://doi.org/10.1101/2025.08.28.25330873;40168357;27608760		False	3	100;0;0	21.664	True		ENSG00000139915	ENSG00000139915	HGNC:19835													
MDH2	gene	MDH2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 51 MIM#617339				27989324;34766628		False	3	100;0;0	21.664	True		ENSG00000146701	ENSG00000146701	HGNC:6971													
MDH2	gene	MDH2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 51 MIM#617339				34766628;27989324		False	3	100;0;0	21.664	True		ENSG00000146701	ENSG00000146701	HGNC:6971													
MECP2	gene	MECP2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	MECP2-related disorders;Rett syndrome, MIM# 312750;Mental retardation, X-linked, syndromic 13, MIM# 300055				31970230;27050783		False	3	100;0;0	21.664	True		ENSG00000169057	ENSG00000169057	HGNC:6990													
MECP2	gene	MECP2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Rett syndrome, MIM# 312750;Intellectual developmental disorder, X-linked, syndromic 13, MIM# 300055;Encephalopathy, neonatal severe, MIM# 300673				32469049		False	3	100;0;0	21.664	True		ENSG00000169057	ENSG00000169057	HGNC:6990													
MECR	gene	MECR	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities, MIM# 617282;MONDO:0015003				27817865;33401012;31137067;31070877		False	3	100;0;0	21.664	True		ENSG00000116353	ENSG00000116353	HGNC:19691													
MECR	gene	MECR	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities, MIM# 617282;MONDO:0015003				27817865;33401012;31137067;31070877		False	3	100;0;0	21.664	True		ENSG00000116353	ENSG00000116353	HGNC:19691													
MED11	gene	MED11	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with developmental delay, early respiratory failure, myoclonic seizures, and brain abnormalities, MIM# 620327				36001086		False	3	100;0;0	21.664	True		ENSG00000161920	ENSG00000161920	HGNC:32687													
MED12	gene	MED12	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Ohdo syndrome, X-linked MIM#300895;Lujan-Fryns syndrome MIM#309520;Opitz-Kaveggia syndrome MIM#305450				33244166;32174975;30006928;27312080;33244166		False	3	100;0;0	21.664	True		ENSG00000184634	ENSG00000184634	HGNC:11957													
MED13L	gene	MED13L	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Impaired intellectual development and distinctive facial features with or without cardiac defects	MIM#616789"				32646507;29511999;25712080		False	3	100;0;0	21.664	True		ENSG00000123066	ENSG00000123066	HGNC:22962													
MED17	gene	MED17	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM#613668				30345598		False	3	100;0;0	21.664	True		ENSG00000042429	ENSG00000042429	HGNC:2375													
MED27	gene	MED27	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;cerebellar hypoplasia;dystonia				33443317		False	3	100;0;0	21.664	False		ENSG00000160563	ENSG00000160563	HGNC:2377													
MED27	gene	MED27	Expert Review Green;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia	MIM#619286"				33443317		False	3	100;0;0	21.664	True		ENSG00000160563	ENSG00000160563	HGNC:2377													
MED27	gene	MED27	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MIM# 619286				33443317		False	3	100;0;0	21.664	True		ENSG00000160563	ENSG00000160563	HGNC:2377													
MEF2C	gene	MEF2C	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, MIM#	613443"				27255693;20333642		False	3	100;0;0	21.664	True		ENSG00000081189	ENSG00000081189	HGNC:6996													
MEF2C	gene	MEF2C	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, MIM# 613443;MONDO:0013266				19876902;19471318;19592390;19592390;20513142;34055696;34022131		False	3	100;0;0	21.664	True		ENSG00000081189	ENSG00000081189	HGNC:6996													
MFF	gene	MFF	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086				22499341;26783368;32181496		False	3	100;0;0	21.664	True		ENSG00000168958	ENSG00000168958	HGNC:24858													
MFF	gene	MFF	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086				22499341;26783368;32181496		False	3	100;0;0	21.664	True		ENSG00000168958	ENSG00000168958	HGNC:24858													
MFN2	gene	MFN2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2A2A 609260;Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087;Hereditary motor and sensory neuropathy VIA, MIM# 601152				15064763;15549395;16437557;20008656		False	3	100;0;0	21.664	True		ENSG00000116688	ENSG00000116688	HGNC:16877													
MFN2	gene	MFN2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2A2A 609260;Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087;Hereditary motor and sensory neuropathy VIA, MIM# 601152				15064763;15549395;16437557;20008656		False	3	100;0;0	21.664	False		ENSG00000116688	ENSG00000116688	HGNC:16877													
MFSD8	gene	MFSD8	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 7 610951				30249282;30144815;30301600;28586915		False	3	100;0;0	21.664	True		ENSG00000164073	ENSG00000164073	HGNC:28486													
MFSD8	gene	MFSD8	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 7, MIM# 610951;MONDO:0012588;Macular dystrophy with central cone involvement, MIM# 616170;MONDO:0014515				17564970;19201763;25227500		False	3	100;0;0	21.664	True		ENSG00000164073	ENSG00000164073	HGNC:28486													
MGAT2	gene	MGAT2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIa, MIM# 212066;MGAT2-CDG, MONDO:0008908				8808595;11228641;22105986;33044030;31420886		False	3	100;0;0	21.664	True		ENSG00000168282	ENSG00000168282	HGNC:7045													
MGME1	gene	MGME1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 11, MIM# 615084				23313956;29572490;28711739		False	3	100;0;0	21.664	True		ENSG00000125871	ENSG00000125871	HGNC:16205													
MGME1	gene	MGME1	Expert Review Green;Other;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	mitochondrial DNA depletion syndrome 11 MONDO:0014039				23313956;29572490;28711739		False	3	100;0;0	21.664	True		ENSG00000125871	ENSG00000125871	HGNC:16205													
MICOS13	gene	MICOS13	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Combined oxidative phosphorylation deficiency 37, MIM#	618329"				29618761;27623147;27485409		False	3	100;0;0	21.664	True		ENSG00000174917	ENSG00000174917	HGNC:33702													
MICU1	gene	MICU1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy with extrapyramidal signs, MIM# 615673				24336167;29721912;32395406		False	3	100;0;0	21.664	True		ENSG00000107745	ENSG00000107745	HGNC:1530													
MICU1	gene	MICU1	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy with extrapyramidal signs, MIM# 615673				24336167;29721912;32395406;38219528;36115200;36054588		False	3	100;0;0	21.664	True		ENSG00000107745	ENSG00000107745	HGNC:1530													
MINPP1	gene	MINPP1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Pontocerebellar hypoplasia, type 16, MIM#	619527"				33257696		False	3	100;0;0	21.664	True		ENSG00000107789	ENSG00000107789	HGNC:7102													
MIPEP	gene	MIPEP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Combined oxidative phosphorylation deficiency 31, MIM#	617228"				27799064		False	3	100;0;0	21.664	True		ENSG00000027001	ENSG00000027001	HGNC:7104													
MKS1	gene	MKS1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 28						False	3	100;0;0	21.664	False		ENSG00000011143	ENSG00000011143	HGNC:7121													
MLC1	gene	MLC1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004)				11254442;18757878;16652334		False	3	100;0;0	21.664	True		ENSG00000100427	ENSG00000100427	HGNC:17082													
MLC1	gene	MLC1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Megalencephalic leukoencephalopathy with subcortical cysts, MIM#	604004"				11254442;21419380;21624973		False	3	100;0;0	21.664	True		ENSG00000100427	ENSG00000100427	HGNC:17082													
MLIP	gene	MLIP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy with myalgia, increased serum creatine kinase, and with or without episodic rhabdomyolysis, MIM# 620138				34581780		False	3	100;0;0	21.664	True		ENSG00000146147	ENSG00000146147	HGNC:21355													
MLYCD	gene	MLYCD	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Malonyl-CoA decarboxylase deficiency, MIM# 248360				12955715		False	3	100;0;0	21.664	True		ENSG00000103150	ENSG00000103150	HGNC:7150													
MMACHC	gene	MMACHC	NHS GMS;Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria and homocystinuria cblC type, 277400;Methylmalonic aciduria and homocystinuria, cblC type, 277400;Ataxia and hypogonadism						False	3	100;0;0	21.664	False		ENSG00000132763	ENSG00000132763	HGNC:24525													
MMACHC	gene	MMACHC	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria and homocystinuria, cblC type MIM#277400				27604308;16311595		False	3	100;0;0	21.664	True		ENSG00000132763	ENSG00000132763	HGNC:24525													
MMADHC	gene	MMADHC	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria, cblD type, variant 1 MIM#277410;Methylmalonic aciduria and homocystinuria, cblD type MIM#277410;Methylmalonic aciduria, cblD type, variant 2 MIM#277410				27604308;18385497		False	3	100;0;0	21.664	True		ENSG00000168288	ENSG00000168288	HGNC:25221													
MME	gene	MME	GeneReviews;Royal Melbourne Hospital;Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2T, MIM# 617017;MONDO:0014866				26991897;27588448;33144514;31429185		False	3	100;0;0	21.664	False		ENSG00000196549	ENSG00000196549	HGNC:7154													
MOCOS	gene	MOCOS	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of molybdenum cofactor metabolism;xanthinuria type II MONDO:0011346				25370766, 17368066, 34356852		False	3	0;0;0	21.664	False		ENSG00000075643	ENSG00000075643	HGNC:18234													
MOCS1	gene	MOCS1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency A MIM#252150;Disorders of molybdenum cofactor metabolism				27604308;9731530		False	3	100;0;0	21.664	True		ENSG00000124615	ENSG00000124615	HGNC:7190													
MOCS1	gene	MOCS1	NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency A, MIM# 252150				9921896;12754701;21031595		False	3	100;0;0	21.664	True		ENSG00000124615	ENSG00000124615	HGNC:7190													
MOCS1	gene	MOCS1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of molybdenum cofactor metabolism;sulfite oxidase deficiency due to molybdenum cofactor deficiency type A MONDO:0009643				27604308, 9731530		False	3	0;0;0	21.664	False		ENSG00000124615	ENSG00000124615	HGNC:7190													
MOCS2	gene	MOCS2	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency B MIM#252160						False	3	100;0;0	21.664	True		ENSG00000164172	ENSG00000164172	HGNC:7193													
MOCS2	gene	MOCS2	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency B MIM#252160;Disorders of molybdenum cofactor metabolism				27604308;10053004		False	3	100;0;0	21.664	True		ENSG00000164172	ENSG00000164172	HGNC:7193													
MOCS2	gene	MOCS2	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	sulfite oxidase deficiency due to molybdenum cofactor deficiency type B MONDO:0009644;Disorders of molybdenum cofactor metabolism				27604308, 10053004		False	3	0;0;0	21.664	False		ENSG00000164172	ENSG00000164172	HGNC:7193													
MOGS	gene	MOGS	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIb, MIM# 606056				31925597;30587846;33058492		False	3	100;0;0	21.664	True		ENSG00000115275	ENSG00000115275	HGNC:24862													
MOGS	gene	MOGS	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIb, MIM# 606056				31925597;30587846;33058492		False	3	100;0;0	21.664	True		ENSG00000115275	ENSG00000115275	HGNC:24862													
MORC2	gene	MORC2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Axonal type CMT disease type 2Z, 616688;Cerebellar ataxia				28402445		False	3	50;0;50	21.664	True		ENSG00000133422	ENSG00000133422	HGNC:23573													
MORC2	gene	MORC2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090;Charcot-Marie-Tooth disease, axonal, type 2Z, MIM# 616688.				PMID: 32693025		False	3	50;0;50	21.664	True		ENSG00000133422	ENSG00000133422	HGNC:23573													
MORC2	gene	MORC2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090				32693025;26497905;26659848		False	3	100;0;0	21.664	True		ENSG00000133422	ENSG00000133422	HGNC:23573													
MPC1	gene	MPC1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial pyruvate carrier deficiency, MIM# 614741				22628558;34873722		False	3	100;0;0	21.664	True		ENSG00000060762	ENSG00000060762	HGNC:21606													
MPDU1	gene	MPDU1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type If, MIM# 609180;MPDU1-CDG, MONDO:0012211				11733564;11733556;31741824;29721919		False	3	100;0;0	21.664	True		ENSG00000129255	ENSG00000129255	HGNC:7207													
MPDU1	gene	MPDU1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type If, MIM# 609180;MPDU1-CDG, MONDO:0012211				11733564;11733556;31741824;29721919		False	3	100;0;0	21.664	True		ENSG00000129255	ENSG00000129255	HGNC:7207													
MPI	gene	MPI	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ib, MIM# 602579;MPI-CDG MONDO:0011257				12414827;9585601;10980531;33098580;33204592;32905087;32266963;30242110		False	3	100;0;0	21.664	True		ENSG00000178802	ENSG00000178802	HGNC:7216													
MPV17	gene	MPV17	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMSN;Charcot-Marie-Tooth disease, axonal, type 2EE, MIM# 618400				22508010;26437932;30298599		False	3	100;0;0	21.664	False		ENSG00000115204	ENSG00000115204	HGNC:7224													
MPV17	gene	MPV17	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2EE, MIM# 618400				22508010;26437932;30298599		False	3	100;0;0	21.664	True		ENSG00000115204	ENSG00000115204	HGNC:7224													
MPZ	gene	MPZ	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot Marie Tooth disease, dominant intermediate D, 60779;Neuropathy, congenital hypomyelinating, 605253;Charcot Marie Tooth disease, type 2J, 607736;Dejerine Sottas disease, 145900;Charcot Marie Tooth disease, type 1B, 118200;Charcot Marie Tooth disease, type 2I, 607677;HMSN				19293842		False	3	100;0;0	21.664	False		ENSG00000158887	ENSG00000158887	HGNC:7225													
MRE11	gene	MRE11	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-Telangiectasia-Like Disorder;Ataxia-telangiectasia-like disorder 1, 604391						False	3	100;0;0	21.664	False		ENSG00000020922	ENSG00000020922	HGNC:7230													
MRM2	gene	MRM2	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial DNA depletion syndrome 17, MIM# 	618567"				28973171;36002240		False	3	100;0;0	21.664	True		ENSG00000122687	ENSG00000122687	HGNC:16352													
MRPL3	gene	MRPL3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 9;OMIM #614582				27815843;21786366		False	3	100;0;0	21.664	True		ENSG00000114686	ENSG00000114686	HGNC:10379													
MRPL39	gene	MRPL39	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-59 (COXPD59), MIM#620646				PMID: 37133451		False	3	100;0;0	21.664	True		ENSG00000154719	ENSG00000154719	HGNC:14027													
MRPL44	gene	MRPL44	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 16, MIM# 615395				23315540;25797485		False	3	100;0;0	21.664	True		ENSG00000135900	ENSG00000135900	HGNC:16650													
MRPL49	gene	MRPL49	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 60, MIM# 621195				39417135		False	3	100;0;0	21.664	True		ENSG00000149792	ENSG00000149792	HGNC:1176													
MRPS2	gene	MRPS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 36, MIM# 617950				29576219;34991560		False	3	100;0;0	21.664	True		ENSG00000122140	ENSG00000122140	HGNC:14495													
MRPS22	gene	MRPS22	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 5, MIM# 611719				17873122;25663021;28752220		False	3	100;0;0	21.664	True		ENSG00000175110	ENSG00000175110	HGNC:14508													
MRPS23	gene	MRPS23	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hepatic disease;Combined respiratory chain complex deficiencies;Cardiomyopathy;Tubulopathy;Lactic acidosis;Structural brain abnormalities;Combined oxidative phosphorylation deficiency 46, MIM618952				26741492;17873122;25663021;28752220		False	3	100;0;0	21.664	True		ENSG00000181610	ENSG00000181610	HGNC:14509													
MRPS34	gene	MRPS34	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 32, MIM# 617664				28777931		False	3	100;0;0	21.664	True		ENSG00000074071	ENSG00000074071	HGNC:16618													
MSMO1	gene	MSMO1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, congenital cataract, and psoriasiform dermatitis MIM#616834;Disorders of the metabolism of sterols;MONDO:0014793				27604308;21285510;24144731;33161406;28673550		False	3	100;0;0	21.664	True		ENSG00000052802	ENSG00000052802	HGNC:10545													
MSTO1	gene	MSTO1	Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Myopathy, mitochondrial, and ataxia, MIM#	617675"				28554942;28544275;31604776;31463572;31130378;30684668;29339779		False	3	100;0;0	21.664	True		ENSG00000125459	ENSG00000125459	HGNC:29678													
MSTO1	gene	MSTO1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Myopathy, mitochondrial, and ataxia MIM#617675						False	3	100;0;0	21.664	True		ENSG00000125459	ENSG00000125459	HGNC:29678													
MT-ATP6	gene	MT-ATP6	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related				40112238		False	3	100;0;0	21.664	True		ENSG00000198899	ENSG00000198899	HGNC:7414													
MT-ATP6	gene	MT-ATP6	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related				40112238		False	3	100;0;0	21.664	True		ENSG00000198899	ENSG00000198899	HGNC:7414													
MTCL1	gene	MTCL1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	slowly progressive cerebellar ataxia, mild intellectual disability, seizures in childhood and episodic pain in the lower limbs				30548255;28283581		False	3	100;0;0	21.664	True		ENSG00000168502	ENSG00000168502	HGNC:29121													
MT-CO1	gene	MT-CO1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related				30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519		False	3	100;0;0	21.664	True		ENSG00000198804	ENSG00000198804	HGNC:7419													
MT-CO1	gene	MT-CO1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related				30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519		False	3	100;0;0	21.664	True		ENSG00000198804	ENSG00000198804	HGNC:7419													
MT-CO1	gene	MT-CO1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related				30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519		False	3	100;0;0	21.664	True		ENSG00000198804	ENSG00000198804	HGNC:7419													
MT-CO2	gene	MT-CO2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related				34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519		False	3	100;0;0	21.664	True		ENSG00000198712	ENSG00000198712	HGNC:7421													
MT-CO2	gene	MT-CO2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related				34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519		False	3	100;0;0	21.664	True		ENSG00000198712	ENSG00000198712	HGNC:7421													
MT-CO2	gene	MT-CO2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related				34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519		False	3	100;0;0	21.664	True		ENSG00000198712	ENSG00000198712	HGNC:7421													
MT-CO2	gene	MT-CO2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related				34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519		False	3	100;0;0	21.664	True		ENSG00000198712	ENSG00000198712	HGNC:7421													
MT-CO3	gene	MT-CO3	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease MONDO:0044970, MT-CO3-related				20525945;11063732;33863631;34054915;8630495;9634511;12414820;21163656;16288875;8630495;9634511		False	3	100;0;0	21.664	True		ENSG00000198938	ENSG00000198938	HGNC:7422													
MT-CO3	gene	MT-CO3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease MONDO:0044970, MT-CO3-related				20525945;11063732;33863631;34054915;8630495;9634511;12414820;21163656;16288875;8630495;9634511		False	3	100;0;0	21.664	True		ENSG00000198938	ENSG00000198938	HGNC:7422													
MT-CYB	gene	MT-CYB	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related				39858655;34804306;26937408		False	3	100;0;0	21.664	True		ENSG00000198727	ENSG00000198727	HGNC:7427													
MT-CYB	gene	MT-CYB	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related				39858655;34804306;26937408		False	3	100;0;0	21.664	True		ENSG00000198727	ENSG00000198727	HGNC:7427													
MT-CYB	gene	MT-CYB	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related				39858655;34804306;26937408		False	3	100;0;0	21.664	True		ENSG00000198727	ENSG00000198727	HGNC:7427													
MTFMT	gene	MTFMT	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 15;22499348;23499752;614947						False	3	0;0;0	21.664	False		ENSG00000103707	ENSG00000103707	HGNC:29666													
MTFMT	gene	MTFMT	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 15, MIM# 614947;Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248				21907147;23499752;24461907;22499348		False	3	100;0;0	21.664	True		ENSG00000103707	ENSG00000103707	HGNC:29666													
MTFMT	gene	MTFMT	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 15 MIM#614947;Mitochondrial complex I deficiency, nuclear type 27 MIM#618248				26060307;24461907		False	3	100;0;0	21.664	True		ENSG00000103707	ENSG00000103707	HGNC:29666													
MTHFR	gene	MTHFR	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria due to MTHFR deficiency MIM#236250				27604308;7920641		False	3	100;0;0	21.664	True		ENSG00000177000	ENSG00000177000	HGNC:7436													
MTHFR	gene	MTHFR	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria due to MTHFR deficiency MIM#236250;Disorders of folate metabolism and transport				27604308;7920641		False	3	100;0;0	21.664	True		ENSG00000177000	ENSG00000177000	HGNC:7436													
MTHFR	gene	MTHFR	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria due to MTHFR deficiency, 236250				29391032		False	3	100;0;0	21.664	False		ENSG00000177000	ENSG00000177000	HGNC:7436													
MTHFS	gene	MTHFS	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, epilepsy, and hypomyelination, 618367				30031689;31844630;22303332		False	3	100;0;0	21.664	True		ENSG00000136371	ENSG00000136371	HGNC:7437													
MTM1	gene	MTM1	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Myotubular myopathy, X-linked, 310400						False	3	100;0;0	21.664	False		ENSG00000171100	ENSG00000171100	HGNC:7448													
MTMR2	gene	MTMR2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4B1, 601382;HMSN;MONDO:0011066				10802647;16249189;33653949;32586600;32488727;31680794		False	3	100;0;0	21.664	False		ENSG00000087053	ENSG00000087053	HGNC:7450													
MT-ND1	gene	MT-ND1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-ND1-related				39147111;36717040;34656796		False	3	100;0;0	21.664	True		ENSG00000198888	ENSG00000198888	HGNC:7455													
MT-ND2	gene	MT-ND2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND2-related				26258512;16738010;15781840;12192017		False	3	100;0;0	21.664	True		ENSG00000198763	ENSG00000198763	HGNC:7456													
MT-ND3	gene	MT-ND3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND3-related				1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403		False	3	100;0;0	21.664	True		ENSG00000198840	ENSG00000198840	HGNC:7458													
MT-ND3	gene	MT-ND3	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND3-related				1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403		False	3	100;0;0	21.664	False		ENSG00000198840	ENSG00000198840	HGNC:7458													
MT-ND3	gene	MT-ND3	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND3-related				1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403		False	3	100;0;0	21.664	False		ENSG00000198840	ENSG00000198840	HGNC:7458													
MT-ND4	gene	MT-ND4	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4-related				12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231		False	3	100;0;0	21.664	True		ENSG00000198886	ENSG00000198886	HGNC:7459													
MT-ND4	gene	MT-ND4	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4-related				12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231		False	3	100;0;0	21.664	True		ENSG00000198886	ENSG00000198886	HGNC:7459													
MT-ND4	gene	MT-ND4	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4-related				12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231		False	3	100;0;0	21.664	True		ENSG00000198886	ENSG00000198886	HGNC:7459													
MT-ND4	gene	MT-ND4	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4-related				12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231		False	3	100;0;0	21.664	True		ENSG00000198886	ENSG00000198886	HGNC:7459													
MT-ND4	gene	MT-ND4	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4-related				12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231		False	3	100;0;0	21.664	True		ENSG00000198886	ENSG00000198886	HGNC:7459													
MT-ND5	gene	MT-ND5	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND5-related				17400793;11938446;12624137;18495510;23918514;17535832;29506874;23034978;16816025;9299505;18977334		False	3	100;0;0	21.664	True		ENSG00000198786	ENSG00000198786	HGNC:7461													
MT-ND5	gene	MT-ND5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND5-related				17400793;11938446;12624137;18495510;23918514;17535832;29506874;23034978;16816025;9299505;18977334		False	3	100;0;0	21.664	True		ENSG00000198786	ENSG00000198786	HGNC:7461													
MT-ND5	gene	MT-ND5	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND5-related				17400793;11938446;12624137;18495510;23918514;17535832;29506874;23034978;16816025;9299505;18977334		False	3	100;0;0	21.664	True		ENSG00000198786	ENSG00000198786	HGNC:7461													
MT-ND6	gene	MT-ND6	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND6-related				5576045;20019223;21196529;10894222;14684687;17535832;19103152;21749722;23813926;25356405;14595656;19062322;11133798;30741831;21364701;2018041		False	3	100;0;0	21.664	True		ENSG00000198695	ENSG00000198695	HGNC:7462													
MTO1	gene	MTO1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 10, OMIM #614702				26061759;29331171;23929671		False	3	100;0;0	21.664	True		ENSG00000135297	ENSG00000135297	HGNC:19261													
MTOR	gene	MTOR	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Smith-Kingsmore syndrome, MIM# 616638;Focal cortical dysplasia, type II, somatic, MIM# 607341;Overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes, MONDO:0100283				28892148;25878179;26018084		False	3	100;0;0	21.664	True	Other	ENSG00000198793	ENSG00000198793	HGNC:3942													
MTPAP	gene	MTPAP	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 4, autosomal recessive 613672;Lethal encephalopathy				20970105;25008111;26319014;31779033		False	3	50;50;0	21.664	True		ENSG00000107951	ENSG00000107951	HGNC:25532													
MTR	gene	MTR	NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria-megaloblastic anemia, cblG complementation type, MIM#250940				25526710;9683607;28666289		False	3	100;0;0	21.664	True		ENSG00000116984	ENSG00000116984	HGNC:7468													
MTRFR	gene	MTRFR	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 55, autosomal recessive, MIM#615035;Combined oxidative phosphorylation deficiency 7, MIM# 613559				23188110;24080142;24198383;20598281;32808965;32478789;28804760		False	3	100;0;0	21.664	True		ENSG00000130921	ENSG00000130921	HGNC:26784													
MTRFR	gene	MTRFR	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 55, autosomal recessive, 615035;optic atrophy and spasticity, tibial muscle weakness and atrophy, peripheral neuropathy;Combined oxidative phosphorylation deficiency 7, 613559				23188110;24080142;24198383		False	3	100;0;0	21.664	True		ENSG00000130921	ENSG00000130921	HGNC:26784													
MTRFR	gene	MTRFR	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 55, autosomal recessive, MIM#615035;HMSN				20301682;23188110;3479531;24198383		False	3	100;0;0	21.664	True		ENSG00000130921	ENSG00000130921	HGNC:26784													
MT-RNR1	gene	MT-RNR1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-RNR1-related				20301595;7698299;16380089;12920080;24252789;9490575;8285309;9040738;7689389		False	3	100;0;0	21.664	True		ENSG00000211459	ENSG00000211459	HGNC:7470													
MTRR	gene	MTRR	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria-megaloblastic anemia, cbl E type MIM#236270;Disorders of the metabolism of sulphur amino acids				27604308;9501215		False	3	100;0;0	21.664	True		ENSG00000124275	ENSG00000124275	HGNC:7473													
MT-TA	gene	MT-TA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TA-related				11715067;17825557;14569122;27014581;20813205;25873012;16476954		False	3	100;0;0	21.664	True		ENSG00000210127	ENSG00000210127	HGNC:7475													
MT-TA	gene	MT-TA	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TA-related				11715067;17825557;14569122;27014581;20813205;25873012;16476954		False	3	100;0;0	21.664	True		ENSG00000210127	ENSG00000210127	HGNC:7475													
MT-TD	gene	MT-TD	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TD-related				9811342;10488907;16059939;18676632;23696415;25447692;27536005;30030363;3054486;19535463		False	3	100;0;0	21.664	True		ENSG00000210154	ENSG00000210154	HGNC:7478													
MT-TD	gene	MT-TD	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TD-related				9811342;10488907;16059939;18676632;23696415;25447692;27536005;30030363;3054486;19535463		False	3	100;0;0	21.664	True		ENSG00000210154	ENSG00000210154	HGNC:7478													
MT-TE	gene	MT-TE	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TE-related				8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256		False	3	100;0;0	21.664	True		ENSG00000210194	ENSG00000210194	HGNC:7479													
MT-TE	gene	MT-TE	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TE-related				8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256		False	3	100;0;0	21.664	True		ENSG00000210194	ENSG00000210194	HGNC:7479													
MT-TE	gene	MT-TE	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TE-related				8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256		False	3	100;0;0	21.664	True		ENSG00000210194	ENSG00000210194	HGNC:7479													
MT-TE	gene	MT-TE	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TE-related				8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256		False	3	100;0;0	21.664	True		ENSG00000210194	ENSG00000210194	HGNC:7479													
MT-TF	gene	MT-TF	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TF-related				14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334		False	3	100;0;0	21.664	True		ENSG00000210049	ENSG00000210049	HGNC:7481													
MT-TF	gene	MT-TF	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TF-related				14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334		False	3	100;0;0	21.664	True		ENSG00000210049	ENSG00000210049	HGNC:7481													
MT-TF	gene	MT-TF	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TF-related				14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334		False	3	100;0;0	21.664	True		ENSG00000210049	ENSG00000210049	HGNC:7481													
MT-TF	gene	MT-TF	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TF-related				14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334		False	3	100;0;0	21.664	True		ENSG00000210049	ENSG00000210049	HGNC:7481													
MT-TG	gene	MT-TG	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TG-related				8079988;9199564;11971101;16120360;32337339;35432167;10090480		False	3	100;0;0	21.664	True		ENSG00000210164	ENSG00000210164	HGNC:7486													
MT-TG	gene	MT-TG	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TG-related				8079988;9199564;11971101;16120360;32337339;35432167;10090480		False	3	100;0;0	21.664	True		ENSG00000210164	ENSG00000210164	HGNC:7486													
MT-TG	gene	MT-TG	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TG-related				8079988;9199564;11971101;16120360;32337339;35432167;10090480		False	3	100;0;0	21.664	True		ENSG00000210164	ENSG00000210164	HGNC:7486													
MT-TG	gene	MT-TG	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TG-related				8079988;9199564;11971101;16120360;32337339;35432167;10090480		False	3	100;0;0	21.664	True		ENSG00000210164	ENSG00000210164	HGNC:7486													
MT-TG	gene	MT-TG	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TG-related				8079988;9199564;11971101;16120360;32337339;35432167;10090480		False	3	100;0;0	21.664	True		ENSG00000210164	ENSG00000210164	HGNC:7486													
MT-TH	gene	MT-TH	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TH-related				12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194		False	3	100;0;0	21.664	True		ENSG00000210176	ENSG00000210176	HGNC:7487													
MT-TH	gene	MT-TH	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TH-related				12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194		False	3	100;0;0	21.664	True		ENSG00000210176	ENSG00000210176	HGNC:7487													
MT-TH	gene	MT-TH	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TH-related				12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194		False	3	100;0;0	21.664	True		ENSG00000210176	ENSG00000210176	HGNC:7487													
MT-TI	gene	MT-TI	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TI-related				15121771;21982779;23395828;16120360;9473477;12767666;10065021;7646516;20884012;21292040;1632786;23696415;34607911		False	3	100;0;0	21.664	True		ENSG00000210100	ENSG00000210100	HGNC:7488													
MT-TK	gene	MT-TK	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	MERRF;Encephalopathy;Deafness;Cardiomyopathy						False	3	100;0;0	21.664	True		ENSG00000210156	ENSG00000210156	HGNC:7489													
MT-TL1	gene	MT-TL1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TL1-related				9323566;12221518;20471262;23220830;23273904;24338029;23582502;11271374;23258140		False	3	100;0;0	21.664	True		ENSG00000209082	ENSG00000209082	HGNC:7490													
MT-TL2	gene	MT-TL2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TL2-related				8923013;12398839;19718780;18977334;21819490;15649400;15591266;23847141;20022607;29052516		False	3	100;0;0	21.664	True		ENSG00000210191	ENSG00000210191	HGNC:7491													
MT-TL2	gene	MT-TL2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TL2-related				8923013;12398839;19718780;18977334;21819490;15649400;15591266;23847141;20022607;29052516		False	3	100;0;0	21.664	True		ENSG00000210191	ENSG00000210191	HGNC:7491													
MT-TL2	gene	MT-TL2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TL2-related				8923013;12398839;19718780;18977334;21819490;15649400;15591266;23847141;20022607;29052516		False	3	100;0;0	21.664	True		ENSG00000210191	ENSG00000210191	HGNC:7491													
MT-TM	gene	MT-TM	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial disease (MONDO:0044970), MT-TM-related				9633749;24711008;25468263;30739820;11335700;31488384;31022467;29174468		False	3	100;0;0	21.664	True		ENSG00000210112	ENSG00000210112	HGNC:7492													
MT-TM	gene	MT-TM	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial disease (MONDO:0044970), MT-TM-related				9633749;24711008;25468263;30739820;11335700;31488384;31022467;29174468		False	3	100;0;0	21.664	True		ENSG00000210112	ENSG00000210112	HGNC:7492													
MT-TN	gene	MT-TN	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial disease MONDO:0044970, MT-TN related						False	3	100;0;0	21.664	True		ENSG00000210135	ENSG00000210135	HGNC:7493													
MT-TN	gene	MT-TN	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial disease MONDO:0044970, MT-TN related						False	3	100;0;0	21.664	True		ENSG00000210135	ENSG00000210135	HGNC:7493													
MT-TN	gene	MT-TN	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial disease MONDO:0044970, MT-TN related						False	3	100;0;0	21.664	True		ENSG00000210135	ENSG00000210135	HGNC:7493													
MTTP	gene	MTTP	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Abetalipoproteinemia, 200100;Abetalipoproteinemia						False	3	100;0;0	21.664	False		ENSG00000138823	ENSG00000138823	HGNC:7467													
MTTP	gene	MTTP	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Abetalipoproteinemia (MIM#200100);Young onset;Abetalipoproteinaemia;hypocholesterloaemia leading to malabsorption of fat-soluble vitamins (vitamin E), acanthocytes, retinitis pigmentosa, progressive sensory axonal neuropathy				33994405		False	3	100;0;0	21.664	True		ENSG00000138823	ENSG00000138823	HGNC:7467													
MT-TP	gene	MT-TP	Expert list;Expert Review Green;Expert Review Red;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TP-related				7689388;11196116;19223931;23696415;19273760;27536729;27816331;32305257;32419253		False	3	100;0;0	21.664	False		ENSG00000210196	ENSG00000210196	HGNC:7494													
MT-TP	gene	MT-TP	Expert Review Red;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TP-related				7689388;11196116;19223931;23696415;19273760;27536729;27816331;32305257;32419253		False	3	100;0;0	21.664	True		ENSG00000210196	ENSG00000210196	HGNC:7494													
MT-TR	gene	MT-TR	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial disease (MONDO:0044970), MT-TR-related				15286228;17588757;19809478;22781096		False	3	100;0;0	21.664	False		ENSG00000210174	ENSG00000210174	HGNC:7496													
MT-TR	gene	MT-TR	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial disease (MONDO:0044970), MT-TR-related				15286228;17588757;19809478;22781096		False	3	100;0;0	21.664	True		ENSG00000210174	ENSG00000210174	HGNC:7496													
MT-TR	gene	MT-TR	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial disease (MONDO:0044970), MT-TR-related				15286228;17588757;19809478;22781096		False	3	100;0;0	21.664	True		ENSG00000210174	ENSG00000210174	HGNC:7496													
MT-TS1	gene	MT-TS1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS1-related				7669057;9778262;14605505;23696415;33279600;7581383		False	3	100;0;0	21.664	True		ENSG00000210151	ENSG00000210151	HGNC:7497													
MT-TS1	gene	MT-TS1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS1-related				7669057;9778262;14605505;23696415;33279600;7581383		False	3	100;0;0	21.664	True		ENSG00000210151	ENSG00000210151	HGNC:7497													
MT-TS1	gene	MT-TS1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS1-related				7669057;9778262;14605505;23696415;33279600;7581383		False	3	100;0;0	21.664	True		ENSG00000210151	ENSG00000210151	HGNC:7497													
MT-TS2	gene	MT-TS2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS2-related				9792552;10090882;16950817;21257182;22369973;22378285		False	3	100;0;0	21.664	True		ENSG00000210184	ENSG00000210184	HGNC:7498													
MT-TS2	gene	MT-TS2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS2-related				9792552;10090882;16950817;21257182;22369973;22378285		False	3	100;0;0	21.664	True		ENSG00000210184	ENSG00000210184	HGNC:7498													
MT-TS2	gene	MT-TS2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS2-related				9792552;10090882;16950817;21257182;22369973;22378285		False	3	100;0;0	21.664	True		ENSG00000210184	ENSG00000210184	HGNC:7498													
MT-TT	gene	MT-TT	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TT-related				32083134;8769114;9367299;1645537;8511015;22638997;29760464;30236074;28187756;35808913		False	3	50;50;0	21.664	True		ENSG00000210195	ENSG00000210195	HGNC:7499													
MT-TT	gene	MT-TT	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TT-related				32083134;8769114;9367299;1645537;8511015;22638997;29760464;30236074;28187756;35808913		False	3	50;50;0	21.664	True		ENSG00000210195	ENSG00000210195	HGNC:7499													
MT-TT	gene	MT-TT	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TT-related				32083134;8769114;9367299;1645537;8511015;22638997;29760464;30236074;28187756;35808913		False	3	50;50;0	21.664	True		ENSG00000210195	ENSG00000210195	HGNC:7499													
MT-TV	gene	MT-TV	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related				9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	21.664	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TV	gene	MT-TV	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related				9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	21.664	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TV	gene	MT-TV	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related				9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	21.664	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TV	gene	MT-TV	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related				9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	21.664	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TV	gene	MT-TV	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related				9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	21.664	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TV	gene	MT-TV	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related				9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	21.664	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TW	gene	MT-TW	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related				7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	21.664	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
MT-TW	gene	MT-TW	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related				7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	21.664	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
MT-TW	gene	MT-TW	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related				7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	21.664	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
MT-TW	gene	MT-TW	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related				7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	21.664	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
MT-TW	gene	MT-TW	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related				7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	21.664	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
MT-TY	gene	MT-TY	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TY-related				11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411		False	3	100;0;0	21.664	True		ENSG00000210144	ENSG00000210144	HGNC:7502													
MT-TY	gene	MT-TY	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TY-related				11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411		False	3	100;0;0	21.664	True		ENSG00000210144	ENSG00000210144	HGNC:7502													
MT-TY	gene	MT-TY	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TY-related				11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411		False	3	100;0;0	21.664	True		ENSG00000210144	ENSG00000210144	HGNC:7502													
MT-TY	gene	MT-TY	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TY-related				11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411		False	3	100;0;0	21.664	True		ENSG00000210144	ENSG00000210144	HGNC:7502													
MT-TY	gene	MT-TY	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TY-related				11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411		False	3	100;0;0	21.664	True		ENSG00000210144	ENSG00000210144	HGNC:7502													
MTX2	gene	MTX2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mandibuloacral dysplasia progeroid syndrome, MIM# 619127				38250156;32917887		False	3	100;0;0	21.664	True		ENSG00000128654	ENSG00000128654	HGNC:7506													
MVK	gene	MVK	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mevalonic aciduria 610377				12563048;10401001;28095071		False	3	100;0;0	21.664	True		ENSG00000110921	ENSG00000110921	HGNC:7530													
MVK	gene	MVK	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mevalonic aciduria MIM#610377;Disorders of sterol biosynthesis				27604308;1377680		False	3	100;0;0	21.664	True		ENSG00000110921	ENSG00000110921	HGNC:7530													
MYH14	gene	MYH14	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Peripheral neuropathy, myopathy, hoarseness, and hearing loss MIM#614369				21480433;35274842;31231018;27875632		False	3	100;0;0	21.664	True		ENSG00000105357	ENSG00000105357	HGNC:23212													
MYH7	gene	MYH7	Expert Review Green;Expert Review;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Laing distal myopathy (MIM#160500);Scapuloperoneal syndrome, myopathic type (MIM#181430)				27387980;20733148		False	3	50;50;0	21.664	True	Other	ENSG00000092054	ENSG00000092054	HGNC:7577													
MYL2	gene	MYL2	Expert Review Green;Other;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, myofibrillar, 12, infantile-onset, with cardiomyopathy (MIM#619424)				23365102;9673982		False	3	100;0;0	21.664	True		ENSG00000111245	ENSG00000111245	HGNC:7583													
MYORG	gene	MYORG	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 7, MIM#618317				30656188;30649222;30460687;29910000;31951047		False	3	100;0;0	21.664	True		ENSG00000164976	ENSG00000164976	HGNC:19918													
MYORG	gene	MYORG	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317;Primary familial brain calcification;Atypical parkinsonism;Supranuclear gaze palsy				32211515;30656188;30649222;30460687;29910000;31951047		False	3	100;0;0	21.664	True		ENSG00000164976	ENSG00000164976	HGNC:19918													
MYOT	gene	MYOT	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Myopathy, myofibrillar, 3	(MIM#609200)"				30055862;21336781;15947064;10958653;15111675;16380616;33250842;32509353;29924655		False	3	0;100;0	21.664	True		ENSG00000120729	ENSG00000120729	HGNC:12399													
MYT1L	gene	MYT1L	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 39, MIM# 616521				32065501		False	3	100;0;0	21.664	True		ENSG00000186487	ENSG00000186487	HGNC:7623													
NAA10	gene	NAA10	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	NAA10-related syndrome MONDO:0100124				11426460;29957440;34200686;30842225;34075687;21700266;37130971		False	3	60;20;20	21.664	True		ENSG00000102030	ENSG00000102030	HGNC:18704													
NAA15	gene	NAA15	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787				38380600;36221186;35730864		False	3	100;0;0	21.664	True		ENSG00000164134	ENSG00000164134	HGNC:30782													
NAA60	gene	NAA60	Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 9, autosomal recessive, MIM# 620786						False	3	100;0;0	21.664	True		ENSG00000122390	ENSG00000122390	HGNC:25875													
NACC1	gene	NACC1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	chorea;dystonia;epilepsy;microcephaly;cataracts;dysautonomia;iron deficiency anemia;stereotypies				38698576		False	3	100;0;0	21.664	True		ENSG00000160877	ENSG00000160877	HGNC:20967													
NACC1	gene	NACC1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination - MIM#617393				28132692		False	3	100;0;0	21.664	True		ENSG00000160877	ENSG00000160877	HGNC:20967													
NADK2	gene	NADK2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"2,4-dienoyl-CoA reductase deficiency, MIM#	616034"				24847004;27940755;23212377;28923496		False	3	100;0;0	21.664	True		ENSG00000152620	ENSG00000152620	HGNC:26404													
NADK2	gene	NADK2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"2,4-dienoyl-CoA reductase deficiency, MIM#	616034"				24847004;29388319;27940755		False	3	100;0;0	21.664	True		ENSG00000152620	ENSG00000152620	HGNC:26404													
NAGA	gene	NAGA	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kanzaki disease, MIM#609242						False	3	100;0;0	21.664	True		ENSG00000198951	ENSG00000198951	HGNC:7631													
NAGA	gene	NAGA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kanzaki disease, MIM# 609242;Schindler disease, type I and type II 609241;alpha-N-acetylgalactosaminidase deficiency MONDO:0017779				11313741;31468281;15619430;8782044		False	3	100;0;0	21.664	True		ENSG00000198951	ENSG00000198951	HGNC:7631													
NAGLU	gene	NAGLU	Expert Review Green;Literature;Expert list;Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIIB (Sanfilippo B) - 252920;Seizures				34396902;25818867;8650226		False	3	67;33;0	21.664	True		ENSG00000108784	ENSG00000108784	HGNC:7632													
NAGLU	gene	NAGLU	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920;MONDO:0009656;Charcot-Marie-Tooth disease, axonal, type 2V MIM#616491;MONDO:0014665				25818867;8650226		False	3	100;0;0	21.664	True		ENSG00000108784	ENSG00000108784	HGNC:7632													
NALCN	gene	NALCN	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Congenital contractures of the limbs and face, hypotonia, and developmental delay - MIM#616266;Hypotonia, infantile, with psychomotor retardation and characteristic facies 1 - MIM#615419				30167850;25683120;35388452;28327206;27473021;27558372		False	3	100;0;0	21.664	True		ENSG00000102452	ENSG00000102452	HGNC:19082													
NAPB	gene	NAPB	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 107 MIM#620033				26235277;28097321;33189936		False	3	100;0;0	21.664	True		ENSG00000125814	ENSG00000125814	HGNC:15751													
NARS1	gene	NARS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091;Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092;Abnormal muscle tone;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Ataxia;Abnormality of the face;Demyelinating peripheral neuropathy				32738225		False	3	100;0;0	21.664	True		ENSG00000134440	ENSG00000134440	HGNC:7643													
NARS1	gene	NARS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091;Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092;Abnormal muscle tone;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Ataxia;Abnormality of the face;Demyelinating peripheral neuropathy				32738225		False	3	100;0;0	21.664	True		ENSG00000134440	ENSG00000134440	HGNC:7643													
NARS2	gene	NARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 24 - MIM#616239				25385316;25807530;30327238;28077841		False	3	100;0;0	21.664	True		ENSG00000137513	ENSG00000137513	HGNC:26274													
NARS2	gene	NARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 24 - MIM#616239;Deafness, autosomal recessive 94 - MIM#618434				25385316;25807530;30327238;28077841		False	3	100;0;0	21.664	True		ENSG00000137513	ENSG00000137513	HGNC:26274													
NAXD	gene	NAXD	Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 2 MIM#618321				30576410		False	3	100;0;0	21.664	True		ENSG00000213995	ENSG00000213995	HGNC:25576													
NAXD	gene	NAXD	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 2, 618321				30576410;31755961;32462209		False	3	100;0;0	21.664	True		ENSG00000213995	ENSG00000213995	HGNC:25576													
NAXE	gene	NAXE	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, MIM#617186				27122014;27616477;31758406		False	3	100;0;0	21.664	True		ENSG00000163382	ENSG00000163382	HGNC:18453													
NAXE	gene	NAXE	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain oedema and/or leukoencephalopathy, MIM# 617186				27122014;27616477;31758406		False	3	100;0;0	21.664	True		ENSG00000163382	ENSG00000163382	HGNC:18453													
NBEA	gene	NBEA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM# 619157;Intellectual disability;Seizures				30269351;28554332;12746398;12826745;11450821;3377648;23277425;22109531;23153818		False	3	100;0;0	21.664	True		ENSG00000172915	ENSG00000172915	HGNC:7648													
NCDN	gene	NCDN	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with infantile epileptic spasms (NEDIES), MIM#619373				33711248		False	3	100;0;0	21.664	True		ENSG00000020129	ENSG00000020129	HGNC:17597													
NCKAP1	gene	NCKAP1	Expert Review Green;Genetic Health Queensland;Genetic Health Queensland	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092) , NCKAP1-related				33157009		False	3	100;0;0	21.664	True		ENSG00000061676	ENSG00000061676	HGNC:7666													
NCOR1	gene	NCOR1	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	complex neurodevelopmental disorder, MONDO:0100038				32034166;31849593;30664766;30289594;29483668		False	3	100;0;0	21.664	False		ENSG00000141027	ENSG00000141027	HGNC:7672													
NDC1	gene	NDC1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328				39003500;19782045		False	3	100;0;0	21.664	True		ENSG00000058804	ENSG00000058804	HGNC:25525													
NDE1	gene	NDE1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly with lissencephaly and/or hydranencephaly, MONDO:0700116				30637988		False	3	100;0;0	21.664	True		ENSG00000072864	ENSG00000072864	HGNC:17619													
NDRG1	gene	NDRG1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMSN;Charcot Marie Tooth disease, type 4D, 601455;MONDO:0011085				10831399;24136616;33334662;29724652;29174527;28776325		False	3	100;0;0	21.664	False		ENSG00000104419	ENSG00000104419	HGNC:7679													
NDST1	gene	NDST1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 46 - MIM#616116				25125150;21937992;32878022;28211985		False	3	100;0;0	21.664	True		ENSG00000070614	ENSG00000070614	HGNC:7680													
NDUFA1	gene	NDUFA1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mitochondrial complex I deficiency, nuclear type 12 MIM#301020				29506883;19185523;17262856;21596602		False	3	100;0;0	21.664	True		ENSG00000125356	ENSG00000125356	HGNC:7683													
NDUFA1	gene	NDUFA1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mitochondrial complex I deficiency, nuclear type 12 MIM#301020				29506883;19185523;17262856;21596602		False	3	100;0;0	21.664	True		ENSG00000125356	ENSG00000125356	HGNC:7683													
NDUFA10	gene	NDUFA10	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 22 - MIM#618243				21150889;26741492;28247337		False	3	100;0;0	21.664	True		ENSG00000130414	ENSG00000130414	HGNC:7684													
NDUFA12	gene	NDUFA12	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 23 618244				21617257;33715266		False	3	50;0;50	21.664	True		ENSG00000184752	ENSG00000184752	HGNC:23987													
NDUFA13	gene	NDUFA13	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 28, MIM# 618249				25901006;32722639		False	3	50;50;0	21.664	True		ENSG00000186010	ENSG00000186010	HGNC:17194													
NDUFA2	gene	NDUFA2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 13 - MIM#618235				28857146;32154054;18513682		False	3	100;0;0	21.664	True		ENSG00000131495	ENSG00000131495	HGNC:7685													
NDUFA3	gene	NDUFA3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970,NDUFA3-related				41038977;39661167		False	3	100;0;0	21.664	True		ENSG00000170906	ENSG00000170906	HGNC:7686													
NDUFA5	gene	NDUFA5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, NDUFA5-related				41916321		False	3	100;0;0	21.664	True		ENSG00000128609	ENSG00000128609	HGNC:7688													
NDUFA6	gene	NDUFA6	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial complex I deficiency, nuclear type 33, MIM#	618253"				30245030		False	3	100;0;0	21.664	True		ENSG00000184983	ENSG00000184983	HGNC:7690													
NDUFA9	gene	NDUFA9	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 26				28671271		False	3	100;0;0	21.664	True		ENSG00000139180	ENSG00000139180	HGNC:7693													
NDUFAF1	gene	NDUFAF1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 11 - MIM#618234				17557076;21931170;16218961;24963768;34975718		False	3	100;0;0	21.664	True		ENSG00000137806	ENSG00000137806	HGNC:18828													
NDUFAF1	gene	NDUFAF1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000137806	ENSG00000137806	HGNC:18828													
NDUFAF2	gene	NDUFAF2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 10 - MIM#618233				33528536;34364746;16200211;19384974;20571988		False	3	100;0;0	21.664	True		ENSG00000164182	ENSG00000164182	HGNC:28086													
NDUFAF2	gene	NDUFAF2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 10 - MIM#618233				33528536;34364746;16200211;19384974;20571988		False	3	100;0;0	21.664	True		ENSG00000164182	ENSG00000164182	HGNC:28086													
NDUFAF3	gene	NDUFAF3	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency 252010						False	3	0;0;0	21.664	False		ENSG00000178057	ENSG00000178057	HGNC:29918													
NDUFAF3	gene	NDUFAF3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 18 - MIM#618240				27986404;29344937;19463981		False	3	100;0;0	21.664	True		ENSG00000178057	ENSG00000178057	HGNC:29918													
NDUFAF4	gene	NDUFAF4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 15 - MIM#618237				32949790;28853723		False	3	100;0;0	21.664	True		ENSG00000123545	ENSG00000123545	HGNC:21034													
NDUFAF5	gene	NDUFAF5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 3 MIM#618224				34797029		False	3	100;0;0	21.664	True		ENSG00000101247	ENSG00000101247	HGNC:15899													
NDUFAF5	gene	NDUFAF5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 3 MIM#618224				34797029		False	3	100;0;0	21.664	True		ENSG00000101247	ENSG00000101247	HGNC:15899													
NDUFAF6	gene	NDUFAF6	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 17 (MIM#618239)				30642748		False	3	100;0;0	21.664	True		ENSG00000156170	ENSG00000156170	HGNC:28625													
NDUFAF8	gene	NDUFAF8	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome				31866046		False	3	100;0;0	21.664	True		ENSG00000224877	ENSG00000224877	HGNC:33551													
NDUFB10	gene	NDUFB10	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	fatal infantile lactic acidosis;cardiomyopathy;Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003				28040730;32025618;33169436		False	3	50;50;0	21.664	True		ENSG00000140990	ENSG00000140990	HGNC:7696													
NDUFB11	gene	NDUFB11	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Linear skin defects with multiple congenital anomalies 3, XLD (MIM#300952);MONDO:0010494;Mitochondrial complex I deficiency, nuclear type 30, XLR (MIM#301021);MONDO:0026721				28050600;27488349;30423443;27488349		False	3	100;0;0	21.664	True		ENSG00000147123	ENSG00000147123	HGNC:20372													
NDUFB3	gene	NDUFB3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 25, MIM# 618246;MONDO:0032629				22499348;27091925		False	3	100;0;0	21.664	True		ENSG00000119013	ENSG00000119013	HGNC:7698													
NDUFB7	gene	NDUFB7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency nuclear type 39 (MC1DN39), MIM#620135				33502047;27626371;40025060		False	3	50;50;0	21.664	True		ENSG00000099795	ENSG00000099795	HGNC:7702													
NDUFB8	gene	NDUFB8	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 32 - MIM#618252				29429571		False	3	100;0;0	21.664	True		ENSG00000166136	ENSG00000166136	HGNC:7703													
NDUFS1	gene	NDUFS1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency;General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial complex I disorders;MITOCHONDRIAL RESPIRATORY CHAIN COMPLEX I DEFICIENCY;Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000023228	ENSG00000023228	HGNC:7707													
NDUFS1	gene	NDUFS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 5 - MIM#618226				33751534;24952175;20382551;21203893;20797884;15824269;25615419;11349233;22399432		False	3	100;0;0	21.664	True		ENSG00000023228	ENSG00000023228	HGNC:7707													
NDUFS2	gene	NDUFS2	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I disorders;Leigh syndrome;Mitochondrial Leukoencephalopathy;Leigh syndrome associated with mitochondrial complex I deficiency						False	3	0;0;0	21.664	False		ENSG00000158864	ENSG00000158864	HGNC:7708													
NDUFS2	gene	NDUFS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 6 - MIM#618228				28031252;31411514;22036843;20819849;11220739;23266820;31411514		False	3	100;0;0	21.664	True		ENSG00000158864	ENSG00000158864	HGNC:7708													
NDUFS3	gene	NDUFS3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 8 - MIM#618230				22499348;30140060;14729820;33097395		False	3	100;0;0	21.664	True		ENSG00000213619	ENSG00000213619	HGNC:7710													
NDUFS4	gene	NDUFS4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 1, 252010;Leigh syndrome, MIM#252010				10944442;27079373;19107570;12616398		False	3	100;0;0	21.664	True		ENSG00000164258	ENSG00000164258	HGNC:7711													
NDUFS4	gene	NDUFS4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 1 - MIM#252010				11181577;11165261;16478720;10944442;24295889;22326555;27079373;15975579;19364667;27671926;33093004;29264396;34484776		False	3	100;0;0	21.664	True		ENSG00000164258	ENSG00000164258	HGNC:7711													
NDUFS4	gene	NDUFS4	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency;Mitochondrial complex I disorders;MITOCHONDRIAL RESPIRATORY CHAIN COMPLEX I DEFICIENCY;Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000164258	ENSG00000164258	HGNC:7711													
NDUFS6	gene	NDUFS6	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 9 - MIM#618232				15372108;19259137;30948790		False	3	100;0;0	21.664	True		ENSG00000145494	ENSG00000145494	HGNC:7713													
NDUFS7	gene	NDUFS7	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial respiratory chain complex I deficiency;Leigh syndrome;Genetic leukoencephalopathies: mitochondrial disorders;Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000115286	ENSG00000115286	HGNC:7714													
NDUFS7	gene	NDUFS7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 3 (MIM# 618224)				22644603		False	3	100;0;0	21.664	True		ENSG00000115286	ENSG00000115286	HGNC:7714													
NDUFS8	gene	NDUFS8	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 2 MIM#618222				23430795;9837812;15159508;22499348;20818383;20819849		False	3	100;0;0	21.664	True		ENSG00000110717	ENSG00000110717	HGNC:7715													
NDUFS8	gene	NDUFS8	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 2 MIM#618222				23430795;9837812;15159508;22499348;20818383;20819849		False	3	100;0;0	21.664	True		ENSG00000110717	ENSG00000110717	HGNC:7715													
NDUFS8	gene	NDUFS8	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I disorders;Leigh syndrome due to mitochondrial complex I deficiency;Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000110717	ENSG00000110717	HGNC:7715													
NDUFV1	gene	NDUFV1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000167792	ENSG00000167792	HGNC:7716													
NDUFV1	gene	NDUFV1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 4 MIM#618225				34807224		False	3	100;0;0	21.664	True		ENSG00000167792	ENSG00000167792	HGNC:7716													
NDUFV1	gene	NDUFV1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 4 MIM#618225				34807224		False	3	100;0;0	21.664	True		ENSG00000167792	ENSG00000167792	HGNC:7716													
NDUFV2	gene	NDUFV2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 7 (MIM#618229)				12754703;19167255;26008862;30770271;33811136;34405929		False	3	67;33;0	21.664	True		ENSG00000178127	ENSG00000178127	HGNC:7717													
NDUFV2	gene	NDUFV2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial complex I deficiency, nuclear type 7	(MIM#618229)"				33811136		False	3	100;0;0	21.664	True		ENSG00000178127	ENSG00000178127	HGNC:7717													
NEB	gene	NEB	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	distal myopathy MONDO:0018949				21724397;17525139;33458580;25205138		False	3	75;25;0	21.664	True		ENSG00000183091	ENSG00000183091	HGNC:7720													
NEDD4L	gene	NEDD4L	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Periventricular nodular heterotopia 7, MIM#617201				28515470;23934111;28212375;27694961		False	3	100;0;0	21.664	True		ENSG00000049759	ENSG00000049759	HGNC:7728													
NEFH	gene	NEFH	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Charcot-Marie-Tooth disease, axonal, type 2CC, 616924;HMSN				30992180;27040688;28709447		False	3	100;0;0	21.664	False		ENSG00000100285	ENSG00000100285	HGNC:7737													
NEFL	gene	NEFL	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot Marie Tooth disease, type 2E, 607684;Charcot-Marie-Tooth disease, dominant intermediate G, 617882;HMSN;Charcot Marie Tooth disease, type 1F, 607734				10841809;12393795;14733962;24887401;25877835;20039262;12566280;29191368;28902413		False	3	100;0;0	21.664	False		-	ENSG00000277586	HGNC:7739													
NEK1	gene	NEK1	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis, susceptibility to, 24 MIM#617892				31768050;26945885;27455347;29929116		False	3	100;0;0	21.664	True		ENSG00000137601	ENSG00000137601	HGNC:7744													
NEMF	gene	NEMF	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual developmental disorder with speech delay and axonal peripheral neuropathy, MIM# 619099;Intellectual disability;neuropathy				32934225		False	3	100;0;0	21.664	True		ENSG00000165525	ENSG00000165525	HGNC:10663													
NEU1	gene	NEU1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sialidosis, type I and type II, MIM# 256550;MONDO:0009738				8985184;9054950;11063730		False	3	100;0;0	21.664	True		ENSG00000204386	ENSG00000204386	HGNC:7758													
NEU1	gene	NEU1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sialidosis, type I/II MIM#256550				25401298;14517945		False	3	100;0;0	21.664	True		ENSG00000204386	ENSG00000204386	HGNC:7758													
NEUROD2	gene	NEUROD2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 72, MIM#	618374"				30323019		False	3	100;0;0	21.664	True		ENSG00000171532	ENSG00000171532	HGNC:7763													
NEXMIF	gene	NEXMIF	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mental retardation, X-linked 98, MIM# 300912				27358180		False	3	100;0;0	21.664	True		ENSG00000050030	ENSG00000050030	HGNC:29433													
NF1	gene	NF1	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Moyamoya disease;Neurofibromatosis, type 1 162200				10754001		False	3	75;0;25	21.664	True		ENSG00000196712	ENSG00000196712	HGNC:7765													
NFE2L2	gene	NFE2L2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Immunodeficiency, developmental delay, and hypohomocysteinemia MONDO:0060591;Disorders of glutathione metabolism				29018201		False	3	100;0;0	21.664	True	Other	ENSG00000116044	ENSG00000116044	HGNC:7782													
NFS1	gene	NFS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 52, MIM#619386;Complex II/III deficiency;multisystem organ failure				24498631;33457206		False	3	50;0;50	21.664	True		ENSG00000244005	ENSG00000244005	HGNC:15910													
NFU1	gene	NFU1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 1, MIM#605711				29441221;21944046;22077971;32747156		False	3	100;0;0	21.664	True		ENSG00000169599	ENSG00000169599	HGNC:16287													
NFU1	gene	NFU1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 1, MIM# 605711				21944046;22077971;32747156;29441221		False	3	100;0;0	21.664	True		ENSG00000169599	ENSG00000169599	HGNC:16287													
NFU1	gene	NFU1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 1 (MIM#605711);Spastic paraplegia 93, autosomal recessive, MIM# 620938				36256512		False	3	100;0;0	21.664	True		ENSG00000169599	ENSG00000169599	HGNC:16287													
NGF	gene	NGF	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type V, 608654;HSAN 5;Congenital sensory neuropathy with selective loss of small myelinated fibers;Hereditary sensory neuropathy type V				26562335;20978020;14976160;15131306		False	3	0;0;0	21.664	False		ENSG00000134259	ENSG00000134259	HGNC:7808													
NGF	gene	NGF	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HSAN/SFN;Neuropathy, hereditary sensory and autonomic, type V, MIM# 608654;MONDO:0012092				14976160;20978020;33884296;32693191;31685654;30296891		False	3	100;0;0	21.664	False		ENSG00000134259	ENSG00000134259	HGNC:7808													
NGLY1	gene	NGLY1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of deglycosylation 1 (CDDG1) (MIM#615273);Developmental delay, choreoathetosis, alacrimia, seizures, microcephaly, transaminitis, neuropathy				22581936;27388694;29419975		False	3	100;0;0	21.664	True		ENSG00000151092	ENSG00000151092	HGNC:17646													
NGLY1	gene	NGLY1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of deglycosylation, MIM# 615273;alacrima, movement disorder, microcephaly, abnormal LFTs				24651605;27388694;32259258;29550355		False	3	100;0;0	21.664	True		ENSG00000151092	ENSG00000151092	HGNC:17646													
NGLY1	gene	NGLY1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of deglycosylation, MIM# 615273				32259258;24651605;27388694		False	3	100;0;0	21.664	True		ENSG00000151092	ENSG00000151092	HGNC:17646													
NHLRC1	gene	NHLRC1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2B (Lafora) 254780				21505799;12958597		False	3	100;0;0	21.664	True		ENSG00000187566	ENSG00000187566	HGNC:21576													
NHLRC1	gene	NHLRC1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2B (Lafora) 254780				21505799;12958597		False	3	100;0;0	21.664	True		ENSG00000187566	ENSG00000187566	HGNC:21576													
NHLRC1	gene	NHLRC1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780				28556688;34117373		False	3	100;0;0	21.664	True		ENSG00000187566	ENSG00000187566	HGNC:21576													
NHLRC1	gene	NHLRC1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive myoclonic epilepsy 2B, Lafora, 254780;Epilepsy, progressive myoclonic 2B (Lafora) 254780						False	3	100;0;0	21.664	False		ENSG00000187566	ENSG00000187566	HGNC:21576													
NIPA1	gene	NIPA1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spastic paraplegia 6				21419568		False	3	100;0;0	21.664	True		ENSG00000170113	ENSG00000170113	HGNC:17043													
NIPA1	gene	NIPA1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spastic paraplegia 6, autosomal dominant, MIM#	600363"				14508710;15711826		False	3	100;0;0	21.664	True		ENSG00000170113	ENSG00000170113	HGNC:17043													
NIT1	gene	NIT1	Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain small vessel disease 4, MIM# 621313				38430071		False	3	100;0;0	21.664	False		ENSG00000158793	ENSG00000158793	HGNC:7828													
NKX2-1	gene	NKX2-1	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Choreoathetosis, hypothyroidism, and neonatal respiratory distress 610978;Choreoathetosis, hypothyroidism and neonatal respiratory distress, 610978;Chorea, hereditary benign 118700;Hereditary bening chorea, 118700				10931427;27066577;26839702;26103969		False	3	100;0;0	21.664	True		ENSG00000136352	ENSG00000136352	HGNC:11825													
NKX2-1	gene	NKX2-1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chorea, hereditary benign MIM#118700;Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978				24714694;30186310		False	3	100;0;0	21.664	True		ENSG00000136352	ENSG00000136352	HGNC:11825													
NKX6-2	gene	NKX6-2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy MIM#617560				30285346;28575651;28969374		False	3	100;0;0	21.664	True		ENSG00000148826	ENSG00000148826	HGNC:19321													
NKX6-2	gene	NKX6-2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spastic ataxia 8 with hypomyelinating leukodystrophy, 617560;Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560						False	3	100;0;0	21.664	False		ENSG00000148826	ENSG00000148826	HGNC:19321													
NKX6-2	gene	NKX6-2	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560						False	3	0;0;0	21.664	False		ENSG00000148826	ENSG00000148826	HGNC:19321													
NKX6-2	gene	NKX6-2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy, 617560;MONDO:0033043				28575651;15601927;32246862;32004679		False	3	100;0;0	21.664	True		ENSG00000148826	ENSG00000148826	HGNC:19321													
NNT	gene	NNT	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glucocorticoid deficiency 4, with or without mineralocorticoid deficiency MIM#614736				26309815;22634753		False	3	67;33;0	21.664	True		ENSG00000112992	ENSG00000112992	HGNC:7863													
NOTCH1	gene	NOTCH1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related				35947102		False	3	100;0;0	21.664	True	Other	ENSG00000148400	ENSG00000148400	HGNC:7881													
NOTCH1	gene	NOTCH1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related				35947102		False	3	100;0;0	21.664	True	Other	ENSG00000148400	ENSG00000148400	HGNC:7881													
NOTCH1	gene	NOTCH1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related				35947102		False	3	100;0;0	21.664	True	Other	ENSG00000148400	ENSG00000148400	HGNC:7881													
NOTCH3	gene	NOTCH3	Expert Review Green;Literature;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, NOTCH3-related;Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 - 125310				33020014;30776699;21414809;30056822;17675836		False	3	50;0;50	21.664	True		ENSG00000074181	ENSG00000074181	HGNC:7883													
NOTCH3	gene	NOTCH3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310				31960911		False	3	100;0;0	21.664	True		ENSG00000074181	ENSG00000074181	HGNC:7883													
NOTCH3	gene	NOTCH3	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	neurodevelopmental disorder MONDO:0700092, NOTCH3-related;Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310						False	3	100;0;0	21.664	False		ENSG00000074181	ENSG00000074181	HGNC:7883													
NOVA2	gene	NOVA2	Expert Review Green;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, OMIM #618859				PMID: 32197073		False	3	100;0;0	21.664	True		ENSG00000104967	ENSG00000104967	HGNC:7887													
NOVA2	gene	NOVA2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, MIM# 618859				32197073;35607920		False	3	67;33;0	21.664	True		ENSG00000104967	ENSG00000104967	HGNC:7887													
NPC1	gene	NPC1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C1 and type D, MIM# 257220;MONDO:0009757				9211849;11333381		False	3	100;0;0	21.664	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC1	gene	NPC1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Niemann-Pick disease, MIM# 257220;Parkinsonism				24035292;30369906		False	3	100;0;0	21.664	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC1	gene	NPC1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C1 MONDO:0009757				12555942;20301473		False	3	100;0;0	21.664	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC1	gene	NPC1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease type C1, 257220;Niemann-Pick disease types C1 and D (#257220)				10480349;17003072;25497598;33228797		False	3	100;0;0	21.664	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC1	gene	NPC1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Niemann-Pick disease, type C1/D, MIM#	257220"				26910362;29406968		False	3	100;0;0	21.664	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC1	gene	NPC1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C1 (MIM#257220;MONDO:0009757)				20301473;11182931		False	3	0;100;0	21.664	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC2	gene	NPC2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann Pick C2, OMIM 607625;Parkinsonism				PMID: 35695805		False	3	100;0;0	21.664	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPC2	gene	NPC2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C2 MONDO:0011873;Dystonia				34993563;17470133		False	3	100;0;0	21.664	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPC2	gene	NPC2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-pick disease, type C2, MIM# 607625;MONDO:0011873				11125141;17470133		False	3	100;0;0	21.664	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPC2	gene	NPC2	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease type C2, 607625;Niemann-Pick disease type C2 (#607625)						False	3	100;0;0	21.664	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPC2	gene	NPC2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-pick disease, type C2 MIM#607625				27792009;20525256		False	3	100;0;0	21.664	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPHP1	gene	NPHP1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 4						False	3	100;0;0	21.664	False		ENSG00000144061	ENSG00000144061	HGNC:7905													
NPRL2	gene	NPRL2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epilepsy, familial focal, with variable foci 2	617116;focal seizures;frontal lobe epilepsy;nocturnal frontal lobe epilepsy;temporal lobe epilepsy;focal cortical dysplasia"				26505888;27173016;28199897;31594065		False	3	100;0;0	21.664	True		ENSG00000114388	ENSG00000114388	HGNC:24969													
NPRL3	gene	NPRL3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial focal, with variable foci 3- MIM#617118				27173016;26285051;33461085		False	3	100;0;0	21.664	True		ENSG00000103148	ENSG00000103148	HGNC:14124													
NPTX1	gene	NPTX1	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	cerebellar ataxia MONDO#0000437, NPTX1-related				34788392;35288776;35285082;35560436		False	3	100;0;0	21.664	False		ENSG00000171246	ENSG00000171246	HGNC:7952													
NR2F1	gene	NR2F1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722				32275123		False	3	100;0;0	21.664	True		ENSG00000175745	ENSG00000175745	HGNC:7975													
NR4A2	gene	NR4A2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911				31428396;32366965		False	3	100;0;0	21.664	True		ENSG00000153234	ENSG00000153234	HGNC:7981													
NR4A2	gene	NR4A2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911				31922365		False	3	100;0;0	21.664	True		ENSG00000153234	ENSG00000153234	HGNC:7981													
NR4A2	gene	NR4A2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911				31922365		False	3	100;0;0	21.664	True		ENSG00000153234	ENSG00000153234	HGNC:7981													
NRDC	gene	NRDC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, NRDC-related				41449824;28017472;34582790;19935654;41734767;41449824		False	3	50;50;0	21.664	True		ENSG00000078618	ENSG00000078618	HGNC:7995													
NRROS	gene	NRROS	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodegeneration;intracranial calcification;epilepsy				32100099;32197075		False	3	100;0;0	21.664	True		ENSG00000174004	ENSG00000174004	HGNC:24613													
NRROS	gene	NRROS	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodegeneration;intracranial calcification;epilepsy				32100099;32197075		False	3	100;0;0	21.664	True		ENSG00000174004	ENSG00000174004	HGNC:24613													
NRXN1	gene	NRXN1	Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Pitt-Hopkins-like syndrome 2 - MIM#614325;Complex neurodevelopmental disorder, MONDO:0100038, NRXN1-related				25486015;19896112;21964664;30873608;35101781;22337556;22670139		False	3	100;0;0	21.664	True		ENSG00000179915	ENSG00000179915	HGNC:8008													
NSD1	gene	NSD1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Sotos syndrome 1 (MIM#117550), AD				16010675;15942875		False	3	100;0;0	21.664	True		ENSG00000165671	ENSG00000165671	HGNC:14234													
NSDHL	gene	NSDHL	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	CHILD syndrome MIM#308050;Disorders of sterol biosynthesis				27604308;10710235		False	3	100;0;0	21.664	True		ENSG00000147383	ENSG00000147383	HGNC:13398													
NSDHL	gene	NSDHL	Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	CK syndrome (MIM#300831)				21129721;15689440;25900314		False	3	100;0;0	21.664	True		ENSG00000147383	ENSG00000147383	HGNC:13398													
NSF	gene	NSF	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 96, MIM# 619340;Seizures;EEG with burst suppression;Global developmental delay;Intellectual disability				31675180		False	3	100;0;0	21.664	True		ENSG00000073969	ENSG00000073969	HGNC:8016													
NSRP1	gene	NSRP1	Expert Review Green;Literature;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy;Cerebral palsy;microcephaly;Intellectual disability				34385670		False	3	50;50;0	21.664	True		ENSG00000126653	ENSG00000126653	HGNC:25305													
NSUN3	gene	NSUN3	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 48, MIM# 619012				27356879;32488845;40465263		False	3	33;67;0	21.664	True		ENSG00000178694	ENSG00000178694	HGNC:26208													
NT5C2	gene	NT5C2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 45, autosomal recessive, MIM# 613162;MONDO:0013165				24482476;32153630;29123918;28884889;28327087		False	3	100;0;0	21.664	True		ENSG00000076685	ENSG00000076685	HGNC:8022													
NT5C3A	gene	NT5C3A	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Anemia, hemolytic, due to UMPH1 deficiency MIM#266120;disorder of pyrimidine metabolism				11369620;11369620		False	3	100;0;0	21.664	True		ENSG00000122643	ENSG00000122643	HGNC:17820													
NTRK1	gene	NTRK1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary sensory and autonomic neuropathy type 4 MONDO:0009746				20301726;11310631		False	3	100;0;0	21.664	True		ENSG00000198400	ENSG00000198400	HGNC:8031													
NTRK1	gene	NTRK1	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HSAN 4;Insensitivity to pain, congenital, with anhidrosis, 256800;Hereditary sensory neuropathy type IV				11668614;8696348;18077166		False	3	0;0;0	21.664	False		ENSG00000198400	ENSG00000198400	HGNC:8031													
NTRK2	gene	NTRK2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 58, MIM#	617830"				29100083		False	3	100;0;0	21.664	True		ENSG00000148053	ENSG00000148053	HGNC:8032													
NUBPL	gene	NUBPL	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 21, OMIM # 618242				23553477;32518176		False	3	100;0;0	21.664	True		ENSG00000151413	ENSG00000151413	HGNC:20278													
NUBPL	gene	NUBPL	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency;Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000151413	ENSG00000151413	HGNC:20278													
NUBPL	gene	NUBPL	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 21 - MIM#618242				20818383;32518176;23553477;31917109;32518176;31787496;30897263;22826544		False	3	100;0;0	21.664	True		ENSG00000151413	ENSG00000151413	HGNC:20278													
NUDT2	gene	NUDT2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with or without peripheral neuropathy MIM#619844				27431290;30059600;33058507		False	3	100;0;0	21.664	True		ENSG00000164978	ENSG00000164978	HGNC:8049													
NUDT2	gene	NUDT2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular hypotonia;Global developmental delay;Intellectual disability;Polyneuropathy				33058507;27431290;30059600;33058507		False	3	100;0;0	21.664	True		ENSG00000164978	ENSG00000164978	HGNC:8049													
NUP214	gene	NUP214	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, acute, infection-induced, susceptibility to, 9, MIM# 618426;epileptic encephalopathy;developmental regression;microcephaly				31178128;30758658		False	3	100;0;0	21.664	True		ENSG00000126883	ENSG00000126883	HGNC:8064													
NUS1	gene	NUS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder, autosomal dominant 55, with seizures, MIM#	617831;Parkinsonism;Developmental delay;Intellectual disability;Ataxia;Myoclonus"				PMID: 32485575;30348779		False	3	100;0;0	21.664	True		ENSG00000153989	ENSG00000153989	HGNC:21042													
NUS1	gene	NUS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Epilepsy, myoclonus, ataxia and scoliosis;Mental retardation, autosomal dominant 55, with seizures, 617831				PMID: 31656175;29100083		False	3	100;0;0	21.664	True		ENSG00000153989	ENSG00000153989	HGNC:21042													
NUS1	gene	NUS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 55, with seizures, MIM# 617831				31656175;29100083		False	3	100;0;0	21.664	True		ENSG00000153989	ENSG00000153989	HGNC:21042													
OAT	gene	OAT	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Gyrate atrophy of choroid and retina with or without ornithinemia - MIM#258870				33068755;1618792;2220818;3339136;3417397;2916581;1737786;33463379		False	3	100;0;0	21.664	True		ENSG00000065154	ENSG00000065154	HGNC:8091													
OBSCN	gene	OBSCN	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Rhabdomyolysis, MONDO:0005290, OBSCN-related				PMID: 34957489		False	3	33;0;67	21.664	True		ENSG00000154358	ENSG00000154358	HGNC:15719													
OCLN	gene	OCLN	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pseudo-TORCH syndrome 1, MIM#251290				20727516;32240828;29192239;28386946		False	3	100;0;0	21.664	True		ENSG00000197822	ENSG00000197822	HGNC:8104													
OCLN	gene	OCLN	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pseudo-TORCH syndrome 1, MIM#251290				20727516;32240828;29192239;28386946		False	3	100;0;0	21.664	True		ENSG00000197822	ENSG00000197822	HGNC:8104													
OFD1	gene	OFD1	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 10						False	3	100;0;0	21.664	False		ENSG00000046651	ENSG00000046651	HGNC:2567													
OGDH	gene	OGDH	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Oxoglutarate dehydrogenase deficiency, MIM# 203740;Developmental delay;ataxia;seizure;raised lactate				32383294		False	3	50;50;0	21.664	True		ENSG00000105953	ENSG00000105953	HGNC:8124													
OGDHL	gene	OGDHL	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Yoon-Bellen neurodevelopmental syndrome, MIM# 619701;Neurodevelopmental disorder featuring epilepsy, hearing loss, visual impairment, and ataxia				34800363		False	3	100;0;0	21.664	True		ENSG00000197444	ENSG00000197444	HGNC:25590													
OGT	gene	OGT	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Mental retardation, X-linked 106, MIM#	300997"				28302723;28584052;31296563;31627256;29769320;29606577		False	3	100;0;0	21.664	True		ENSG00000147162	ENSG00000147162	HGNC:8127													
OPA1	gene	OPA1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Optic atrophy plus syndrome (MIM#125250)				16240368;18065439;20157015;21112924		False	3	100;0;0	21.664	True		ENSG00000198836	ENSG00000198836	HGNC:8140													
OPA1	gene	OPA1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	OPA1-related optic atrophy with or without extraocular features, MONDO:0800181				30165240		False	3	100;0;0	21.664	True		ENSG00000198836	ENSG00000198836	HGNC:8140													
OPA1	gene	OPA1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	OPA1-related optic atrophy with or without extraocular features, MONDO:0800181				30165240;28494813		False	3	100;0;0	21.664	True		ENSG00000198836	ENSG00000198836	HGNC:8140													
OPA1	gene	OPA1	Expert Review Green;Literature;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	optic atrophy with or without deafness, ophthalmoplegia, myopathy, ataxia, and neuropathy MONDO:0007429				30165240;20301426		False	3	50;50;0	21.664	True		ENSG00000198836	ENSG00000198836	HGNC:8140													
OPA3	gene	OPA3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"3-methylglutaconic aciduria, type III, MIM#	258501"						False	3	100;0;0	21.664	True		ENSG00000125741	ENSG00000125741	HGNC:8142													
OPA3	gene	OPA3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type III, MIM# 258501;developmental delay, hypotonia;dystonia and chorea;ataxia, optic atrophy;spastic paraplegia				20301646;7510656;2494568;11668429		False	3	100;0;0	21.664	True		ENSG00000125741	ENSG00000125741	HGNC:8142													
OPA3	gene	OPA3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR;Optic atrophy 3 with cataract (MIM#165300), AD				25159689;31119193;31928268		False	3	100;0;0	21.664	True		ENSG00000125741	ENSG00000125741	HGNC:8142													
OPA3	gene	OPA3	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type III, 258501;Optic atrophy 3 with cataract, 165300;3-methylglutaconic aciduria type III, 258501;Costeff syndrome						False	3	100;0;0	21.664	False		ENSG00000125741	ENSG00000125741	HGNC:8142													
OPA3	gene	OPA3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Optic atrophy 3 MONDO:0008133				31119193;28050599		False	3	100;0;0	21.664	True	Other	ENSG00000125741	ENSG00000125741	HGNC:8142													
OPHN1	gene	OPHN1	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, MIM#300486				20528889;9582072;12807966;16221952		False	3	100;0;0	21.664	True		ENSG00000079482	ENSG00000079482	HGNC:8148													
OPHN1	gene	OPHN1	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	X-linked mental retardation with cerebellar hypoplasia and distinctive facial appearance, 300486;Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486						False	3	100;0;0	21.664	True		ENSG00000079482	ENSG00000079482	HGNC:8148													
OPTN	gene	OPTN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435)				31838784;20428114;20301623		False	3	100;0;0	21.664	True		ENSG00000123240	ENSG00000123240	HGNC:17142													
OPTN	gene	OPTN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MONDO: 0013264, MIM#613435)				20428114;31838784;27493188		False	3	100;0;0	21.664	True		ENSG00000123240	ENSG00000123240	HGNC:17142													
ORAI1	gene	ORAI1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myopathy, tubular aggregate, 2 (MIM#615883)				31448844		False	3	33;67;0	21.664	True		-	ENSG00000276045	HGNC:25896													
OSGEP	gene	OSGEP	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway-Mowat syndrome 3, MIM#617729				PMID: 28805828;33333793		False	3	100;0;0	21.664	True		ENSG00000092094	ENSG00000092094	HGNC:18028													
OTUD6B	gene	OTUD6B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, OMIM #617452				28343629;32924626;31147255		False	3	100;0;0	21.664	True		ENSG00000155100	ENSG00000155100	HGNC:24281													
OTUD7A	gene	OTUD7A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia and seizures, MIM# 620790				31997314;29395075;29395074;33381903;36180924;41028987		False	3	25;50;25	21.664	True		ENSG00000169918	ENSG00000169918	HGNC:20718													
OXA1L	gene	OXA1L	Expert Review Green;NHS GMS;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	OXA1L-related combined oxidative phosphorylation deficiency MONDO:0000732				30201738;40551575;16435202		False	3	50;50;0	21.664	True		ENSG00000155463	ENSG00000155463	HGNC:8526													
OXCT1	gene	OXCT1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinyl CoA:3-oxoacid CoA transferase deficiency MIM#245050				8751852;10964512;28178565;11757586;8844009		False	3	100;0;0	21.664	True		ENSG00000083720	ENSG00000083720	HGNC:8527													
OXCT1	gene	OXCT1	Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinyl CoA:3-oxoacid CoA transferase deficiency MIM#245050				25778941;10964512;8751852;23420214		False	3	100;0;0	21.664	True		ENSG00000083720	ENSG00000083720	HGNC:8527													
OXR1	gene	OXR1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebellar hypoplasia/atrophy, epilepsy, and global developmental delay, MIM#	213000"				31785787;22028674		False	3	100;0;0	21.664	True		ENSG00000164830	ENSG00000164830	HGNC:15822													
P4HTM	gene	P4HTM	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, hypoventilation, impaired intellectual development, dysautonomia, epilepsy, and eye abnormalities;OMIM #618493				25078763;30940925		False	3	100;0;0	21.664	True		ENSG00000178467	ENSG00000178467	HGNC:28858													
PABPC1	gene	PABPC1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, PABPC1-related (MONDO#0700092)				35511136		False	3	100;0;0	21.664	True		ENSG00000070756	ENSG00000070756	HGNC:8554													
PABPN1	gene	PABPN1	Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	oculopharyngeal muscular dystrophy MONDO:0008116				19080757;33805441;16648376		False	3	100;0;0	21.664	True		ENSG00000100836	ENSG00000100836	HGNC:8565													
PACS1	gene	PACS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Schuurs-Hoeijmakers syndrome (MIM# 615009)				26842493;23159249		False	3	100;0;0	21.664	True		ENSG00000175115	ENSG00000175115	HGNC:30032													
PACS2	gene	PACS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 66 - MIM#618067				29656858;34894068;34859793		False	3	100;0;0	21.664	True		ENSG00000179364	ENSG00000179364	HGNC:23794													
PAFAH1B1	gene	PAFAH1B1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lissencephaly 1, MIM# 607432;Subcortical laminar heterotopia, MIM# 607432;MONDO:0011830				11754098;18285425		False	3	100;0;0	21.664	True		ENSG00000007168	ENSG00000007168	HGNC:8574													
PAFAH1B1	gene	PAFAH1B1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Lissencephaly 1, MIM#	607432;Subcortical laminar heterotopia, MIM#	607432;MONDO:0011830"				31370080;30568308;20301752		False	3	100;0;0	21.664	True		ENSG00000007168	ENSG00000007168	HGNC:8574													
PAH	gene	PAH	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phenylketonuria MIM#261600;Disorders of phenylalanine or tyrosine metabolism				27604308;3008810		False	3	100;0;0	21.664	True		ENSG00000171759	ENSG00000171759	HGNC:8582													
PAH	gene	PAH	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phenylketonuria, [Hyperphenylalaninemia, non-PKU mild], 261600				31636599;32141105		False	3	100;0;0	21.664	False		ENSG00000171759	ENSG00000171759	HGNC:8582													
PAH	gene	PAH	Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phenylketonuria, MIM#261600						False	3	100;0;0	21.664	True		ENSG00000171759	ENSG00000171759	HGNC:8582													
PAH	gene	PAH	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phenylketonuria MIM#261600				PMID: 25614310, PMID: 15390012, PMID: 30369906		False	3	100;0;0	21.664	True		ENSG00000171759	ENSG00000171759	HGNC:8582													
PAK1	gene	PAK1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with macrocephaly, seizures, and speech delay (MIM 618158)				30290153;31504246		False	3	100;0;0	21.664	True		ENSG00000149269	ENSG00000149269	HGNC:8590													
PAM16	gene	PAM16	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive spondylometaphyseal dysplasia, Megarbane type MONDO:0013223;Disorders of mitochondrial protein import				29884839;24786642;35385740;36438081;27354339		False	3	100;0;0	21.664	True		ENSG00000217930	ENSG00000217930	HGNC:29679													
PANK2	gene	PANK2	Expert Review Green;NHS GMS;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HARP syndrome MIM#607236;Neurodegeneration with brain iron accumulation 1 MIM#234200				25778941;11479594;12510040;28863176		False	3	100;0;0	21.664	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PANK2	gene	PANK2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	pantothenate kinase-associated neurodegeneration MONDO:0009319				23447832;20301663		False	3	0;0;0	21.664	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PANK2	gene	PANK2	GeneReviews;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pantothenate kinase-associated neurodegeneration (PKAN)						False	3	100;0;0	21.664	False		ENSG00000125779	ENSG00000125779	HGNC:15894													
PANK2	gene	PANK2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 1 (MIM#234200)				24600523;23447832;19480328		False	3	100;0;0	21.664	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PANK2	gene	PANK2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	pantothenate kinase-associated neurodegeneration MONDO:0009319;Dystonia				15911822		False	3	100;0;0	21.664	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PARK7	gene	PARK7	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive early-onset Parkinson disease 7 MONDO:0011658				20301402		False	3	100;0;0	21.664	True		ENSG00000116288	ENSG00000116288	HGNC:16369													
PARK7	gene	PARK7	Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Parkinson disease 7, autosomal recessive early-onset	MIM#606324"				29644727		False	3	100;0;0	21.664	False		ENSG00000116288	ENSG00000116288	HGNC:16369													
PARK7	gene	PARK7	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal							False	3	100;0;0	21.664	False		ENSG00000116288	ENSG00000116288	HGNC:16369													
PARP6	gene	PARP6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Epilepsy;Microcephaly				34067418		False	3	100;0;0	21.664	True		ENSG00000137817	ENSG00000137817	HGNC:26921													
PARS2	gene	PARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 75, MIM# 618437				29410512;28077841;25629079;29915213		False	3	100;0;0	21.664	True		ENSG00000162396	ENSG00000162396	HGNC:30563													
PARS2	gene	PARS2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 75, MIM#	618437"				29410512;28077841;25629079;29915213		False	3	100;0;0	21.664	True		ENSG00000162396	ENSG00000162396	HGNC:30563													
PC	gene	PC	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate carboxylase deficiency, MIM#266150						False	3	100;0;0	21.664	True		ENSG00000173599	ENSG00000173599	HGNC:8636													
PC	gene	PC	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Pyruvate carboxylase deficiency, MIM#	266150"						False	3	100;0;0	21.664	True		ENSG00000173599	ENSG00000173599	HGNC:8636													
PCCA	gene	PCCA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Propionicacidemia - MIM#606054				17966092;10101253;9887338		False	3	100;0;0	21.664	True		ENSG00000175198	ENSG00000175198	HGNC:8653													
PCCA	gene	PCCA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Propionicacidemia, MIM#	606054"				30879957		False	3	100;0;0	21.664	True		ENSG00000175198	ENSG00000175198	HGNC:8653													
PCCB	gene	PCCB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Propionicacidemia - MIM#606054				7386459;9683601;10502773		False	3	100;0;0	21.664	True		ENSG00000114054	ENSG00000114054	HGNC:8654													
PCCB	gene	PCCB	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Propionicacidemia, MIM#	606054"				30879957		False	3	100;0;0	21.664	True		ENSG00000114054	ENSG00000114054	HGNC:8654													
PCDH12	gene	PCDH12	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280				28804758;34773825;30178464		False	3	100;0;0	21.664	True		ENSG00000113555	ENSG00000113555	HGNC:8657													
PCDH12	gene	PCDH12	Expert Review Green;Royal Melbourne Hospital;GeneReviews;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280				27164683;30178464;30459466		False	3	50;0;50	21.664	True		ENSG00000113555	ENSG00000113555	HGNC:8657													
PCDH19	gene	PCDH19	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Other	Epileptic encephalopathy, early infantile, 9 300088;PCDH19-related epilepsy (early seizure onset, generalised or focused seizures);cognitive impairment				18469813;30287595		False	3	100;0;0	21.664	True		ENSG00000165194	ENSG00000165194	HGNC:14270													
PCDHGC4	gene	PCDHGC4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with poor growth and skeletal anomalies, MIM# 619880				34244665		False	3	100;0;0	21.664	True		ENSG00000242419	ENSG00000242419	HGNC:8717													
PCK1	gene	PCK1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phosphoenolpyruvate carboxykinase deficiency, cytosolic MIM#261680;Disorders of gluconeogenesis				24863970;28216384;26971250;27604308		False	3	100;0;0	21.664	True		ENSG00000124253	ENSG00000124253	HGNC:8724													
PCNT	gene	PCNT	Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephalic osteodysplastic primordial dwarfism, type II 210720;Moyamoya disease				15368497;34978779;19839044;37234811;34923567		False	3	50;50;0	21.664	True		ENSG00000160299	ENSG00000160299	HGNC:16068													
PCYT2	gene	PCYT2	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	intellectual disability;regression;spastic para-/tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy				31637422		False	3	50;0;50	21.664	True		ENSG00000185813	ENSG00000185813	HGNC:8756													
PCYT2	gene	PCYT2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy				31637422		False	3	100;0;0	21.664	True		ENSG00000185813	ENSG00000185813	HGNC:8756													
PDCD10	gene	PDCD10	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cerebral cavernous malformations-3 MIM#603285				25354366;26246098		False	3	50;50;0	21.664	True		ENSG00000114209	ENSG00000114209	HGNC:8761													
PDCD10	gene	PDCD10	Expert Review Green;Genomics England PanelApp;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cerebral Cavernous Malformations;Cerebral cavernous malformations 3;Cerebral cavernous malformations 3, 603285;Cerebral Cavernous Malformation;Familial Cerebral Cavernous Malformation				15543491;20301470		False	3	100;0;0	21.664	False	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000114209	ENSG00000114209	HGNC:8761													
PDE10A	gene	PDE10A	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Early onset chorea without epilepsy;infantile onset limb and orofacial dyskinesia (OMIM 616921)				PMID 27058447		False	3	100;0;0	21.664	False		ENSG00000112541	ENSG00000112541	HGNC:8772													
PDE12	gene	PDE12	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease MONDO:0044970, PDE12-related				PMID: 39567835		False	3	100;0;0	21.664	True		ENSG00000174840	ENSG00000174840	HGNC:25386													
PDE1B	gene	PDE1B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related				40492975		False	3	100;0;0	21.664	True		ENSG00000123360	ENSG00000123360	HGNC:8775													
PDE1B	gene	PDE1B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related				40492975		False	3	100;0;0	21.664	True		ENSG00000123360	ENSG00000123360	HGNC:8775													
PDE2A	gene	PDE2A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder with paroxysmal dyskinesia or seizures	MIM#619150"				32467598;32196122;37317634		False	3	50;50;0	21.664	True		ENSG00000186642	ENSG00000186642	HGNC:8777													
PDE8B	gene	PDE8B	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Striatal degeneration, autosomal dominant, MIM#609161				20085714;26769607;26475694		False	3	100;0;0	21.664	True		ENSG00000113231	ENSG00000113231	HGNC:8794													
PDGFB	gene	PDGFB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 5 , MIM#615483				23913003;30952898;30609140		False	3	100;0;0	21.664	True		ENSG00000100311	ENSG00000100311	HGNC:8800													
PDGFB	gene	PDGFB	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 5 615483						False	3	100;0;0	21.664	False		ENSG00000100311	ENSG00000100311	HGNC:8800													
PDGFB	gene	PDGFB	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 5, MIM# 615483				23913003		False	3	100;0;0	21.664	True		ENSG00000100311	ENSG00000100311	HGNC:8800													
PDGFRB	gene	PDGFRB	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	aneurysm;scoliosis;atrophic skin;stroke;infantile myofibromatosis						False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000113721	ENSG00000113721	HGNC:8804													
PDGFRB	gene	PDGFRB	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 4, MIM# 615007				23255827;30979360		False	3	100;0;0	21.664	True		ENSG00000113721	ENSG00000113721	HGNC:8804													
PDGFRB	gene	PDGFRB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 4, MIM# 615007;MONDO:0014004				31004414;30979360;32613555;34494111		False	3	100;0;0	21.664	True		ENSG00000113721	ENSG00000113721	HGNC:8804													
PDHA1	gene	PDHA1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Primary Pyruvate Dehydrogenase Complex Deficiency MIM 312170				36693417;33661577		False	3	100;0;0	21.664	True		ENSG00000131828	ENSG00000131828	HGNC:8806													
PDHA1	gene	PDHA1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Pyruvate dehydrogenase E1-alpha deficiency - MIM#312170				8504309		False	3	100;0;0	21.664	True		ENSG00000131828	ENSG00000131828	HGNC:8806													
PDHA1	gene	PDHA1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Pyruvate dehydrogenase E1-alpha deficiency - MIM#312170				8504309		False	3	100;0;0	21.664	True		ENSG00000131828	ENSG00000131828	HGNC:8806													
PDHA1	gene	PDHA1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Pyruvate dehydrogenase E1-alpha deficiency MIM#312170				20002125		False	3	100;0;0	21.664	True		ENSG00000131828	ENSG00000131828	HGNC:8806													
PDHB	gene	PDHB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase E1-beta deficiency - MIM#614111						False	3	100;0;0	21.664	True		ENSG00000168291	ENSG00000168291	HGNC:8808													
PDHX	gene	PDHX	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lacticacidemia due to PDX1 deficiency	MIM#245349"				20002125;16566017;17152059		False	3	100;0;0	21.664	True		ENSG00000110435	ENSG00000110435	HGNC:21350													
PDHX	gene	PDHX	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lactic acidaemia due to PDX1 deficiency MIM#245349				20002125;34873726;33092611;30981218;25087164;22766002		False	3	100;0;0	21.664	True		ENSG00000110435	ENSG00000110435	HGNC:21350													
PDHX	gene	PDHX	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lactic acidaemia due to PDX1 deficiency MIM#245349				20002125;34873726;33092611;30981218;25087164;22766002		False	3	100;0;0	21.664	True		ENSG00000110435	ENSG00000110435	HGNC:21350													
PDK3	gene	PDK3	Expert list;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Charcot-Marie-Tooth disease, X-linked dominant, 6, MIM# 300905				23297365;28902413;26801680		False	3	100;0;0	21.664	True		ENSG00000067992	ENSG00000067992	HGNC:8811													
PDK3	gene	PDK3	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Charcot-Marie-Tooth disease, X-linked dominant, 6 MIM#300905;HMSN				23297365;26801680;27388934;28902413		False	3	100;0;0	21.664	False		ENSG00000067992	ENSG00000067992	HGNC:8811													
PDP1	gene	PDP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase phosphatase deficiency - MIM#608782				31392110;19184109;15855260		False	3	100;0;0	21.664	True		ENSG00000164951	ENSG00000164951	HGNC:9279													
PDSS1	gene	PDSS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 2 MIM#614651				17332895;22494076;33285023		False	3	100;0;0	21.664	True		ENSG00000148459	ENSG00000148459	HGNC:17759													
PDSS2	gene	PDSS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 3 MIM#614652				29032433;25349199;17186472;21723727;10972372		False	3	100;0;0	21.664	True		ENSG00000164494	ENSG00000164494	HGNC:23041													
PDXK	gene	PDXK	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary motor and sensory, type VIC, with optic atrophy MIM#618511;Disorders of pyridoxine metabolism				32522499;31187503;27604308		False	3	100;0;0	21.664	True		ENSG00000160209	ENSG00000160209	HGNC:8819													
PDXK	gene	PDXK	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Axonal polyneuropathy;optic atrophy				32522499;31187503;27604308		False	3	50;50;0	21.664	True		ENSG00000160209	ENSG00000160209	HGNC:8819													
PDYN	gene	PDYN	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 23 (MIM#610245);Cerebellar ataxia, sensory-motor axonal neuropathy;Spinocerebellar ataxia 23				21035104		False	3	50;50;0	21.664	True		ENSG00000101327	ENSG00000101327	HGNC:8820													
PDYN	gene	PDYN	Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245						False	3	100;0;0	21.664	False		ENSG00000101327	ENSG00000101327	HGNC:8820													
PEPD	gene	PEPD	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Prolidase deficiency MIM#170100;disorders of peptide metabolism				27604308;2365824		False	3	100;0;0	21.664	True		ENSG00000124299	ENSG00000124299	HGNC:8840													
PET100	gene	PET100	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055				24462369;25293719;31406627		False	3	100;0;0	21.664	True		ENSG00000229833	ENSG00000229833	HGNC:40038													
PET100	gene	PET100	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055				24462369;25293719;31406627		False	3	100;0;0	21.664	True		ENSG00000229833	ENSG00000229833	HGNC:40038													
PEX1	gene	PEX1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 1B (NALD/IRD), 601539						False	3	0;0;0	21.664	False		ENSG00000127980	ENSG00000127980	HGNC:8850													
PEX1	gene	PEX1	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000127980	ENSG00000127980	HGNC:8850													
PEX1	gene	PEX1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 1A (Zellweger) 214100				26387595		False	3	100;0;0	21.664	True		ENSG00000127980	ENSG00000127980	HGNC:8850													
PEX10	gene	PEX10	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Failure to thrive, facial dimorphism, agenesis of the corpus callosum, death in first year of life, axonal motor neuropathy, progressive ataxia and sensory-motor axonal neuropathy in adulthood described				27230853;20695019		False	3	100;0;0	21.664	True		ENSG00000157911	ENSG00000157911	HGNC:8851													
PEX10	gene	PEX10	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 6B, 614871						False	3	0;0;0	21.664	False		ENSG00000157911	ENSG00000157911	HGNC:8851													
PEX10	gene	PEX10	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 6A (Zellweger),  MIM#614870				32069232		False	3	50;0;50	21.664	True		ENSG00000157911	ENSG00000157911	HGNC:8851													
PEX10	gene	PEX10	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000157911	ENSG00000157911	HGNC:8851													
PEX11B	gene	PEX11B	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 14B - MIM#614920				20301621;22581968;38423277;31724321;28129423		False	3	100;0;0	21.664	True		ENSG00000131779	ENSG00000131779	HGNC:8853													
PEX11B	gene	PEX11B	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Peroxisome biogenesis disorder 14B, 614920						False	3	0;0;0	21.664	False		ENSG00000131779	ENSG00000131779	HGNC:8853													
PEX12	gene	PEX12	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 3A, 614859;Peroxisome biogenesis disorder 3B, 266510						False	3	0;0;0	21.664	False		ENSG00000108733	ENSG00000108733	HGNC:8854													
PEX12	gene	PEX12	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 3A (Zellweger) - MIM#614859;Peroxisome biogenesis disorder 3B - MIM#266510						False	3	100;0;0	21.664	True		ENSG00000108733	ENSG00000108733	HGNC:8854													
PEX12	gene	PEX12	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000108733	ENSG00000108733	HGNC:8854													
PEX12	gene	PEX12	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 3A (Zellweger), 614859;HMSN				24627108;33123925		False	3	100;0;0	21.664	True		ENSG00000108733	ENSG00000108733	HGNC:8854													
PEX13	gene	PEX13	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 11A (Zellweger)				19449432;37962062;34055681;37962062;30919572;33547378;35854306		False	3	100;0;0	21.664	True		ENSG00000162928	ENSG00000162928	HGNC:8855													
PEX13	gene	PEX13	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000162928	ENSG00000162928	HGNC:8855													
PEX13	gene	PEX13	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 11B, 614885;Peroxisome biogenesis disorder 11A (Zellweger), 614883						False	3	0;0;0	21.664	False		ENSG00000162928	ENSG00000162928	HGNC:8855													
PEX14	gene	PEX14	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268				37493040		False	3	100;0;0	21.664	True		ENSG00000142655	ENSG00000142655	HGNC:8856													
PEX14	gene	PEX14	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 13A (Zellweger), 614887						False	3	0;0;0	21.664	False		ENSG00000142655	ENSG00000142655	HGNC:8856													
PEX16	gene	PEX16	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Zellweger syndrome (614876);Peroxisome biogenesis disorder 8B (#614877)  infantile progressive ataxia and spastic paresis;Peroxisome biogenesis disorder 8A, 614876;Peroxisome biogenesis disorder 8B, 614877						False	3	100;0;0	21.664	False		ENSG00000121680	ENSG00000121680	HGNC:8857													
PEX16	gene	PEX16	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000121680	ENSG00000121680	HGNC:8857													
PEX16	gene	PEX16	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 8A (Zellweger), 614876;Peroxisome biogenesis disorder 8B, 614877						False	3	0;0;0	21.664	False		ENSG00000121680	ENSG00000121680	HGNC:8857													
PEX19	gene	PEX19	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 12A (Zellweger) - MIM#614886				10051604;20683989;11883941;28391327;39757991;36931687;29282281		False	3	100;0;0	21.664	True		ENSG00000162735	ENSG00000162735	HGNC:9713													
PEX19	gene	PEX19	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 12A (Zellweger), 614886						False	3	0;0;0	21.664	False		ENSG00000162735	ENSG00000162735	HGNC:9713													
PEX19	gene	PEX19	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 12A (Zellweger) - MIM#614886				10051604;20683989;11883941;28391327		False	3	100;0;0	21.664	True		ENSG00000162735	ENSG00000162735	HGNC:9713													
PEX2	gene	PEX2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 5A (Zellweger), MIM#614866				14630978;23430938;17041890		False	3	50;50;0	21.664	True		ENSG00000164751	ENSG00000164751	HGNC:9717													
PEX2	gene	PEX2	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 5B, 614867;Peroxisome biogenesis disorder 5A (Zellweger) 614866						False	3	0;0;0	21.664	False		ENSG00000164751	ENSG00000164751	HGNC:9717													
PEX2	gene	PEX2	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000164751	ENSG00000164751	HGNC:9717													
PEX26	gene	PEX26	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 7A (Zellweger), MIM#614872				34430430;28823628		False	3	50;50;0	21.664	True		ENSG00000215193	ENSG00000215193	HGNC:22965													
PEX26	gene	PEX26	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 7A (Zellweger), 614872;Peroxisome biogenesis disorder 7B, 614873						False	3	0;0;0	21.664	False		ENSG00000215193	ENSG00000215193	HGNC:22965													
PEX26	gene	PEX26	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000215193	ENSG00000215193	HGNC:22965													
PEX3	gene	PEX3	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000034693	ENSG00000034693	HGNC:8858													
PEX3	gene	PEX3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882;Peroxisome biogenesis disorder 10B , MIM# 617370				10942428;10958759;10968777;27557811;33101983		False	3	100;0;0	21.664	True		ENSG00000034693	ENSG00000034693	HGNC:8858													
PEX3	gene	PEX3	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 10A (Zellweger), 614882;?Peroxisome biogenesis disorder 10B, 617370						False	3	0;0;0	21.664	False		ENSG00000034693	ENSG00000034693	HGNC:8858													
PEX5	gene	PEX5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 2A (Zellweger), MIM# 214110;Peroxisome biogenesis disorder 2B, MIM# 202370;Rhizomelic chondrodysplasia punctata, type 5, MIM# 616716				7719337;26220973;20301621		False	3	100;0;0	21.664	True		ENSG00000139197	ENSG00000139197	HGNC:9719													
PEX5	gene	PEX5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 2A (Zellweger), MIM# 214110;Peroxisome biogenesis disorder 2B, MIM# 202370				7719337;26220973;20301621		False	3	100;0;0	21.664	True		ENSG00000139197	ENSG00000139197	HGNC:9719													
PEX5	gene	PEX5	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 2A (Zellweger), 214110;Peroxisome biogenesis disorder 2B, 202370						False	3	0;0;0	21.664	False		ENSG00000139197	ENSG00000139197	HGNC:9719													
PEX6	gene	PEX6	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Peroxisome biogenesis disorder 4A (Zellweger), MIM#	614862"				29220678		False	3	50;0;50	21.664	True		ENSG00000124587	ENSG00000124587	HGNC:8859													
PEX6	gene	PEX6	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000124587	ENSG00000124587	HGNC:8859													
PEX6	gene	PEX6	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 4A (Zellweger), 614862;Peroxisome biogenesis disorder 4B, 614863						False	3	0;0;0	21.664	False		ENSG00000124587	ENSG00000124587	HGNC:8859													
PEX7	gene	PEX7	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 9B, 614879						False	3	0;0;0	21.664	False		ENSG00000112357	ENSG00000112357	HGNC:8860													
PEX7	gene	PEX7	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 9B, MIM# 614879;Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100				11781871;12522768;12325024		False	3	100;0;0	21.664	True		ENSG00000112357	ENSG00000112357	HGNC:8860													
PEX7	gene	PEX7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisome biogenesis disorder 9B, MIM# 614879				11781871;12522768;12325024		False	3	100;0;0	21.664	True		ENSG00000112357	ENSG00000112357	HGNC:8860													
PEX7	gene	PEX7	Expert Review Green;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Refsum disease;Peroxisome biogenesis disorder 9B, MIM#614879						False	3	100;0;0	21.664	True		ENSG00000112357	ENSG00000112357	HGNC:8860													
PFKM	gene	PFKM	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease VII (MIM#232800)				24427140;27066546;30792690		False	3	100;0;0	21.664	True		ENSG00000152556	ENSG00000152556	HGNC:8877													
PFKM	gene	PFKM	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease VII, MIM# 232800				2140573;8444874;7513946;7550225		False	3	100;0;0	21.664	True		ENSG00000152556	ENSG00000152556	HGNC:8877													
PFN1	gene	PFN1	Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	67;33;0	21.664	False		ENSG00000108518	ENSG00000108518	HGNC:8881													
PGAM2	gene	PGAM2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease X, MIM# 261670				8447317;34237446;30310767		False	3	100;0;0	21.664	True		ENSG00000164708	ENSG00000164708	HGNC:8889													
PGAM2	gene	PGAM2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease X, MIM# 261670				8447317		False	3	100;0;0	21.664	True		ENSG00000164708	ENSG00000164708	HGNC:8889													
PGAP2	gene	PGAP2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 3, MIM# 614207, MONDO:0013628				23561846;23561847;31805394;29119105;27871432		False	3	100;0;0	21.664	True		ENSG00000148985	ENSG00000148985	HGNC:17893													
PGAP3	gene	PGAP3	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 4, MIM# 615716, MONDO:0014318				24439110;29620724;30345601;30217754		False	3	100;0;0	21.664	True		ENSG00000161395	ENSG00000161395	HGNC:23719													
PGAP3	gene	PGAP3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 4, MIM# 615716, MONDO:0014318				24439110;29620724;30345601;30217754		False	3	100;0;0	21.664	True		ENSG00000161395	ENSG00000161395	HGNC:23719													
PGBD5	gene	PGBD5	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM#	621482"				41533792		False	3	100;0;0	21.664	True		ENSG00000177614	ENSG00000177614	HGNC:19405													
PGBD5	gene	PGBD5	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM#	621482"				41533792		False	3	100;0;0	21.664	True		ENSG00000177614	ENSG00000177614	HGNC:19405													
PGK1	gene	PGK1	Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Phosphoglycerate kinase 1 deficiency 300653;MONDO:0010392				6933565;1547346;7577653;9512313		False	3	100;0;0	21.664	True		ENSG00000102144	ENSG00000102144	HGNC:8896													
PGK1	gene	PGK1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Phosphoglycerate kinase 1 deficiency, MIM# 300653;Haemolytic anaemia;Rhabdomyolysis;Myopathy;Juvenile Parkinsonism;OMIM 300653				PMID: 30975619		False	3	100;0;0	21.664	True		ENSG00000102144	ENSG00000102144	HGNC:8896													
PGK1	gene	PGK1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Phosphoglycerate kinase 1 deficiency, MIM# 300653;MONDO:0010392				6933565;1547346;7577653;9512313		False	3	100;0;0	21.664	True		ENSG00000102144	ENSG00000102144	HGNC:8896													
PGM1	gene	PGM1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type It 614921				24499211		False	3	100;0;0	21.664	True		ENSG00000079739	ENSG00000079739	HGNC:8905													
PGM1	gene	PGM1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type It 614921;Glycogen storage disorder XIV				19625727;24499211		False	3	100;0;0	21.664	True		ENSG00000079739	ENSG00000079739	HGNC:8905													
PGM1	gene	PGM1	Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type It, MIM# 614921				31563034;26303607;24878975;27206562;29858906;32681750;19625727;24499211		False	3	100;0;0	21.664	True		ENSG00000079739	ENSG00000079739	HGNC:8905													
PGM2L1	gene	PGM2L1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, PGM2L1-related				33979636		False	3	100;0;0	21.664	True		ENSG00000165434	ENSG00000165434	HGNC:20898													
PGM3	gene	PGM3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 23, MIM# 615816;PGM3-CDG, MONDO:0014353				30578875;31231132;33098103;30157810;28704707		False	3	100;0;0	21.664	True		ENSG00000013375	ENSG00000013375	HGNC:8907													
PHACTR1	gene	PHACTR1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 70, MIM#	618298"				23033978;30256902		False	3	100;0;0	21.664	True		ENSG00000112137	ENSG00000112137	HGNC:20990													
PHF6	gene	PHF6	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Borjeson-Forssman-Lehmann syndrome	MIM#301900"				32399860		False	3	100;0;0	21.664	True		ENSG00000156531	ENSG00000156531	HGNC:18145													
PHGDH	gene	PHGDH	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neu-Laxova syndrome 1 256520;Phosphoglycerate dehydrogenase deficiency 601815				24836451;25152457;11055895;19235232		False	3	100;0;0	21.664	True		ENSG00000092621	ENSG00000092621	HGNC:8923													
PHGDH	gene	PHGDH	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neu-Laxova syndrome 1, MIM# 256520;Phosphoglycerate dehydrogenase deficiency, MIM# 601815				24836451;25152457;11055895;19235232		False	3	100;0;0	21.664	True		ENSG00000092621	ENSG00000092621	HGNC:8923													
PHKA1	gene	PHKA1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Muscle glycogenosis, MIM# 300559				7874115;12825073;9731190		False	3	100;0;0	21.664	True		ENSG00000067177	ENSG00000067177	HGNC:8925													
PHKA1	gene	PHKA1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Muscle glycogenosis, MIM# 300559				7874115;12825073;9731190		False	3	100;0;0	21.664	True		ENSG00000067177	ENSG00000067177	HGNC:8925													
PHKA2	gene	PHKA2	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	100;0;0	21.664	False		ENSG00000044446	ENSG00000044446	HGNC:8926													
PHKB	gene	PHKB	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phosphorylase kinase deficiency of liver and muscle, autosomal recessive 261750;Glycogen storage disease IXb, MONDO:0009868				9215682;25266922;30659246		False	3	100;0;0	21.664	True		ENSG00000102893	ENSG00000102893	HGNC:8927													
PHKG2	gene	PHKG2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease IXc, MIM# 613027				8896567;9384616;10905889		False	3	100;0;0	21.664	True		ENSG00000156873	ENSG00000156873	HGNC:8931													
PHYH	gene	PHYH	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Refsum Disease MIM#266500				2433405;20301527		False	3	50;50;0	21.664	True		ENSG00000107537	ENSG00000107537	HGNC:8940													
PHYH	gene	PHYH	Expert Review Green;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Refsum disease, MIM#	266500"						False	3	100;0;0	21.664	True		ENSG00000107537	ENSG00000107537	HGNC:8940													
PHYH	gene	PHYH	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Refsum disease, MIM# 266500				9326939;9326940		False	3	100;0;0	21.664	True		ENSG00000107537	ENSG00000107537	HGNC:8940													
PI4K2A	gene	PI4K2A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hyperkinetic movements, seizures and structural brain abnormalities, MIM# 620732				30564627;35880319;19581584		False	3	100;0;0	21.664	True		ENSG00000155252	ENSG00000155252	HGNC:30031													
PI4KA	gene	PI4KA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental syndrome with hypomyelinating leukodystrophy				PMID: 34415322		False	3	100;0;0	21.664	True		ENSG00000241973	ENSG00000241973	HGNC:8983													
PI4KA	gene	PI4KA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental syndrome with hypomyelinating leukodystrophy;Spastic paraplegia 84, autosomal recessive, MIM# 619621				PMID: 34415322		False	3	100;0;0	21.664	True		ENSG00000241973	ENSG00000241973	HGNC:8983													
PIDD1	gene	PIDD1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 75, with neuropsychiatric features and variant lissencephaly, MIM# 619827				28397838;29302074;33414379;34163010		False	3	100;0;0	21.664	True		ENSG00000177595	ENSG00000177595	HGNC:16491													
PIGA	gene	PIGA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466;Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072				22305531;24357517;24706016;26545172;33333793;32694024;34875027		False	3	100;0;0	21.664	True		ENSG00000165195	ENSG00000165195	HGNC:8957													
PIGA	gene	PIGA	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental disorder with epilepsy and hemochromatosis, MIM# 301072				34875027		False	3	100;0;0	21.664	True		ENSG00000165195	ENSG00000165195	HGNC:8957													
PIGA	gene	PIGA	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466				22305531;24357517;24706016;26545172;33333793;32694024		False	3	100;0;0	21.664	True		ENSG00000165195	ENSG00000165195	HGNC:8957													
PIGB	gene	PIGB	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Developmental and epileptic encephalopathy 80	618580"				31256876		False	3	100;0;0	21.664	True		ENSG00000069943	ENSG00000069943	HGNC:8959													
PIGB	gene	PIGB	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 80, MIM# 618580				31256876		False	3	100;0;0	21.664	True		ENSG00000069943	ENSG00000069943	HGNC:8959													
PIGC	gene	PIGC	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 16, MIM# 617816				27694521;32707268		False	3	100;0;0	21.664	True		ENSG00000135845	ENSG00000135845	HGNC:8960													
PIGG	gene	PIGG	Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with or without hypotonia, seizures, and cerebellar atrophy	MIM#616917"				26996948		False	3	100;0;0	21.664	True		ENSG00000174227	ENSG00000174227	HGNC:25985													
PIGH	gene	PIGH	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010				33156547;29573052;29603516		False	3	100;0;0	21.664	True		ENSG00000100564	ENSG00000100564	HGNC:8964													
PIGH	gene	PIGH	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010				29573052;29603516;33156547		False	3	100;0;0	21.664	True		ENSG00000100564	ENSG00000100564	HGNC:8964													
PIGK	gene	PIGK	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures, MIM#	618879"				32220290		False	3	100;0;0	21.664	True		ENSG00000142892	ENSG00000142892	HGNC:8965													
PIGK	gene	PIGK	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures, MIM# 618879				32220290		False	3	100;0;0	21.664	True		ENSG00000142892	ENSG00000142892	HGNC:8965													
PIGL	gene	PIGL	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	CHIME syndrome, MIM# 280000, MONDO:0010221				22444671;31535386;30023290;29473937;28371479;25706356		False	3	100;0;0	21.664	True		ENSG00000108474	ENSG00000108474	HGNC:8966													
PIGM	gene	PIGM	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol deficiency, MIM# 610293;portal vein thrombosis;persistent absence seizures;macrocephaly;infantile-onset cerebrovascular thrombotic events;portal vein thrombosis;persistent absence seizures;macrocephaly;infantile-onset cerebrovascular thrombotic events				31445883;16767100;41782195;39912323;39425582;39119839		False	3	33;67;0	21.664	True		ENSG00000143315	ENSG00000143315	HGNC:18858													
PIGM	gene	PIGM	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Glycosylphosphatidylinositol deficiency, MIM#	610293;portal vein thrombosis;persistent absence seizures;macrocephaly;infantile-onset cerebrovascular thrombotic events"				31445883;16767100;41782195;39912323;39425582;39119839		False	3	33;67;0	21.664	True		ENSG00000143315	ENSG00000143315	HGNC:18858													
PIGN	gene	PIGN	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple congenital anomalies-hypotonia-seizures syndrome 1, MIM# 614080, MONDO:0013563				21493957;24253414;26364997;26394714;33193741;32585529;29330547		False	3	100;0;0	21.664	True		ENSG00000197563	ENSG00000197563	HGNC:8967													
PIGN	gene	PIGN	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple congenital anomalies-hypotonia-seizures syndrome 1, MIM# 614080, MONDO:0013563				21493957;24253414;26364997;26394714;33193741;32585529;29330547		False	3	100;0;0	21.664	True		ENSG00000197563	ENSG00000197563	HGNC:8967													
PIGO	gene	PIGO	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 2, MIM# 614749, MONDO:0013882				22683086;31698102;28900819;28545593;28337824		False	3	100;0;0	21.664	True		ENSG00000165282	ENSG00000165282	HGNC:23215													
PIGO	gene	PIGO	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 2, MIM# 614749, MONDO:0013882				22683086;31698102;28900819;28545593;28337824		False	3	100;0;0	21.664	True		ENSG00000165282	ENSG00000165282	HGNC:23215													
PIGP	gene	PIGP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Developmental and epileptic encephalopathy 55, MIM#	617599"				31139695;32042915;28334793		False	3	100;0;0	21.664	True		ENSG00000185808	ENSG00000185808	HGNC:3046													
PIGP	gene	PIGP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 55, MIM# 617599				28334793;31139695;32042915		False	3	50;50;0	21.664	True		ENSG00000185808	ENSG00000185808	HGNC:3046													
PIGQ	gene	PIGQ	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Epileptic encephalopathy, early infantile, 77, MIM#	618548"				25558065;24463883;31148362;32588908		False	3	100;0;0	21.664	True		ENSG00000007541	ENSG00000007541	HGNC:14135													
PIGS	gene	PIGS	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Glycosylphosphatidylinositol biosynthesis defect 18	618143"				30269814		False	3	100;0;0	21.664	True		ENSG00000087111	ENSG00000087111	HGNC:14937													
PIGS	gene	PIGS	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Glycosylphosphatidylinositol biosynthesis defect 18	618143"				30269814,		False	3	100;0;0	21.664	True		ENSG00000087111	ENSG00000087111	HGNC:14937													
PIGS	gene	PIGS	Expert Review Green;Literature;Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 95, OMIM # 618143				30269814;33410539		False	3	100;0;0	21.664	True		ENSG00000087111	ENSG00000087111	HGNC:14937													
PIGT	gene	PIGT	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM#	615398, MONDO:0014165"				30976099;25943031;24906948;24906948;24906948;28728837;28728837;28728837		False	3	100;0;0	21.664	True		ENSG00000124155	ENSG00000124155	HGNC:14938													
PIGT	gene	PIGT	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165				30976099;25943031;24906948;24906948;24906948;28728837;28728837;28728837		False	3	100;0;0	21.664	True		ENSG00000124155	ENSG00000124155	HGNC:14938													
PIGV	gene	PIGV	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 1, MIM# 239300, MONDO:0009398				20802478;22315194;28817240;24129430		False	3	100;0;0	21.664	True		ENSG00000060642	ENSG00000060642	HGNC:26031													
PIGV	gene	PIGV	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 1, MIM# 239300, MONDO:0009398				20802478;22315194;28817240;24129430		False	3	100;0;0	21.664	True		ENSG00000060642	ENSG00000060642	HGNC:26031													
PIGW	gene	PIGW	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 11, MIM# 616025				24367057;27626616;30813920;32198969		False	3	100;0;0	21.664	True		-	ENSG00000277161	HGNC:23213													
PIGW	gene	PIGW	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Glycosylphosphatidylinositol biosynthesis defect 11, MIM#	616025"				24367057;27626616;30813920;32198969		False	3	100;0;0	21.664	True		-	ENSG00000277161	HGNC:23213													
PIK3CA	gene	PIK3CA	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cerebral cavernous malformations 4, MIM#619538				34496175		False	3	100;0;0	21.664	True		ENSG00000121879	ENSG00000121879	HGNC:8975													
PIK3CA	gene	PIK3CA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephaly-capillary malformation-polymicrogyria syndrome, somatic, MIM#602501						False	3	100;0;0	21.664	True	Other	ENSG00000121879	ENSG00000121879	HGNC:8975													
PIK3R2	gene	PIK3R2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 1, MIM# 603387				22729224;23745724;33604570		False	3	100;0;0	21.664	True		ENSG00000105647	ENSG00000105647	HGNC:8980													
PINK1	gene	PINK1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 6, early onset;Dystonia						False	3	0;0;0	21.664	False		ENSG00000158828	ENSG00000158828	HGNC:14581													
PINK1	gene	PINK1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 6, early onset, MIM# 605909				27604308;15087508;16207731;18003639;18524835		False	3	100;0;0	21.664	True		ENSG00000158828	ENSG00000158828	HGNC:14581													
PINK1	gene	PINK1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 6, early onset MIM#605909				28980524		False	3	100;0;0	21.664	True		ENSG00000158828	ENSG00000158828	HGNC:14581													
PINK1	gene	PINK1	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal							False	3	100;0;0	21.664	False		ENSG00000158828	ENSG00000158828	HGNC:14581													
PIP5K1C	gene	PIP5K1C	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with intellectual, visual, and language impairment MIM#621635				37451268		False	3	100;0;0	21.664	True		ENSG00000186111	ENSG00000186111	HGNC:8996													
PISD	gene	PISD	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Liberfarb syndrome, MIM# 618889;Intellectual disability;cataracts;retinal degeneration;microcephaly;deafness;short stature;white matter abnormalities				38801004;31263216;30858161		False	3	100;0;0	21.664	True		ENSG00000241878	ENSG00000241878	HGNC:8999													
PITRM1	gene	PITRM1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis				26697887;29764912		False	3	100;0;0	21.664	True		ENSG00000107959	ENSG00000107959	HGNC:17663													
PITRM1	gene	PITRM1	Expert Review Green;Literature;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis				26697887;29764912		False	3	100;0;0	21.664	True		ENSG00000107959	ENSG00000107959	HGNC:17663													
PKD1	gene	PKD1	Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Polycystic kidney disease, adult type I  173900						False	3	100;0;0	21.664	False		ENSG00000008710	ENSG00000008710	HGNC:9008													
PLA2G6	gene	PLA2G6	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 14, autosomal recessive 612953;PLA2G6-associated neurodegeneration;Neurodegeneration with brain iron accumulation 2B 610217;Infantile neuroaxonal dystrophy 1 256600						False	3	0;0;0	21.664	False		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLA2G6	gene	PLA2G6	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile neuroaxonal dystrophy 1 (MIM#256600);Neurodegeneration with brain iron accumulation 2B (MIM#610217)				29859652		False	3	100;0;0	21.664	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLA2G6	gene	PLA2G6	GeneReviews;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PLA2G6-associated neurodegeneration (PLAN)						False	3	100;0;0	21.664	False		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLA2G6	gene	PLA2G6	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Infantile neuroaxonal dystrophy 1 MIM#256600;Neurodegeneration with brain iron accumulation 2B	MIM#610217;Parkinson disease 14, autosomal recessive MIM#612953"				25348461;26001724;26506412;30528460;16783378		False	3	100;0;0	21.664	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLA2G6	gene	PLA2G6	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive Parkinson disease 14 MONDO:0013060				20301718		False	3	100;0;0	21.664	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLA2G6	gene	PLA2G6	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 2B MIM#610217				30340910		False	3	100;0;0	21.664	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLA2G6	gene	PLA2G6	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 14, autosomal recessive, MIM# 612953				25634434;26836416;22406380;20938027		False	3	0;100;0	21.664	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLA2G6	gene	PLA2G6	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive Parkinson disease 14, 612953;Parkinson disease 14 (#612953);Infantile neuroaxonal dystrophy 1 (#256600);Infantile neuroaxonal dystrophy 1, 256600;Neurodegeneration with brain iron accumulation 2B (#610217);Neurodegeneration with brain iron accumulation 2B, 610217						False	3	100;0;0	21.664	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLAA	gene	PLAA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, MIM# 617527				28007986;28413018;31322726		False	3	100;0;0	21.664	True		ENSG00000137055	ENSG00000137055	HGNC:9043													
PLAAT3	gene	PLAAT3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lipodystrophy, familial partial, type 9, MIM# 620683				PMID: 37919452		False	3	100;0;0	21.664	True		ENSG00000176485	ENSG00000176485	HGNC:17825													
PLCB1	gene	PLCB1	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 12 (MIM#613722)				24684524;20833646;22690784;26818157		False	3	100;0;0	21.664	True		ENSG00000182621	ENSG00000182621	HGNC:15917													
PLEC	gene	PLEC	Expert Review Green;Expert Review;Expert Review Green;Expert Review;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy with epidermolysis bullosa simplex, 226670				22144912		False	3	100;0;0	21.664	True		ENSG00000178209	ENSG00000178209	HGNC:9069													
PLEKHG5	gene	PLEKHG5	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary peripheral neuropathy MONDO:0020127, PLEKHG5-related				17564964;23777631;23844677;33492783;33275839;33220101;23777631		False	3	100;0;0	21.664	False		ENSG00000171680	ENSG00000171680	HGNC:29105													
PLK1	gene	PLK1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, PLK1-related, MONDO:0700092				33875846		False	3	100;0;0	21.664	True		ENSG00000166851	ENSG00000166851	HGNC:9077													
PLP1	gene	PLP1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Spastic paraplegia 2, X-linked, MIM#	312920"				15627202;8012387		False	3	100;0;0	21.664	True		ENSG00000123560	ENSG00000123560	HGNC:9086													
PLP1	gene	PLP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Pelizaeus-Merzbacher Disease, MIM#312080				7512350;11071483;21679407;28133555;29486744;35346287;37637647		False	3	100;0;0	21.664	True		ENSG00000123560	ENSG00000123560	HGNC:9086													
PLP1	gene	PLP1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Pelizaeus-Merzbacher disease, MIM#	312080"						False	3	100;0;0	21.664	True		ENSG00000123560	ENSG00000123560	HGNC:9086													
PLPBP	gene	PLPBP	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, early-onset, vitamin B6-dependent, MIM# 617290				27912044;31741821;30668673		False	3	100;0;0	21.664	True		ENSG00000147471	ENSG00000147471	HGNC:9457													
PLXNA1	gene	PLXNA1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dworschak-Punetha neurodevelopmental syndrome, MIM# 619955				34054129		False	3	100;0;0	21.664	True		ENSG00000114554	ENSG00000114554	HGNC:9099													
PMM2	gene	PMM2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ia 212065				21541725		False	3	100;0;0	21.664	True		ENSG00000140650	ENSG00000140650	HGNC:9115													
PMM2	gene	PMM2	Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Ia (MIM#212065);Hyperinsulinaemic Hypoglycaemia and Polycystic Kidney Disease (HIPKD), MONDO:0020642, PMM2-related				28108845;28373276;32595772		False	3	50;50;0	21.664	True		ENSG00000140650	ENSG00000140650	HGNC:9115													
PMM2	gene	PMM2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neonatal-onset, leukodystrophy, abnormal serum glycoproteins, mental retardation, hypotonia, ataxia, retinitis pigmentosa, seizures, slowly progressive neuropathy with SNCV, severe infections, hepatic insufficiency and cardiomyopathy				20301507;20301289		False	3	100;0;0	21.664	True		ENSG00000140650	ENSG00000140650	HGNC:9115													
PMP2	gene	PMP2	Expert Review Green;Royal Melbourne Hospital;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	HMSN;Charcot-Marie-Tooth disease, demyelinating, type 1G, 618279				26257172;26828946;27009151		False	3	67;33;0	21.664	False	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000147588	ENSG00000147588	HGNC:9117													
PMP22	gene	PMP22	Expert Review Green;Victorian Clinical Genetics Services;Royal Melbourne Hospital;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 1A, MIM# 118220;Charcot-Marie-Tooth disease, type 1E, MIM# 118300;Dejerine-Sottas disease, MIM# 145900;Neuropathy, recurrent, with pressure palsies 162500;Roussy-Levy syndrome 180800				32412171;31777123;32719652;32356557		False	3	100;0;0	21.664	True		ENSG00000109099	ENSG00000109099	HGNC:9118													
PMPCA	gene	PMPCA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200				25808372;26657514;33272776;30617178		False	3	100;0;0	21.664	True		ENSG00000165688	ENSG00000165688	HGNC:18667													
PMPCA	gene	PMPCA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200				25808372;26657514;33272776;30617178		False	3	100;0;0	21.664	True		ENSG00000165688	ENSG00000165688	HGNC:18667													
PMPCB	gene	PMPCB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 6, MIM# 617954				29576218		False	3	100;0;0	21.664	True		ENSG00000105819	ENSG00000105819	HGNC:9119													
PMPCB	gene	PMPCB	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Multiple mitochondrial dysfunctions syndrome 6, MIM#	617954"				29576218		False	3	100;0;0	21.664	True		ENSG00000105819	ENSG00000105819	HGNC:9119													
PMPCB	gene	PMPCB	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 6, 617954				29576218		False	3	100;0;0	21.664	True		ENSG00000105819	ENSG00000105819	HGNC:9119													
PNKD	gene	PNKD	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800				15496428		False	3	100;0;0	21.664	True		ENSG00000127838	ENSG00000127838	HGNC:9153													
PNKD	gene	PNKD	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800;MONDO:0007326				15262732;15496428;15824259;19124534;21487022		False	3	100;0;0	21.664	False		ENSG00000127838	ENSG00000127838	HGNC:9153													
PNKD	gene	PNKD	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Paroxysmal nonkinesigenic dyskinesia 1, 118800						False	3	100;0;0	21.664	True		ENSG00000127838	ENSG00000127838	HGNC:9153													
PNKP	gene	PNKP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ataxia-oculomotor apraxia 4, MIM#	616267"				28552035;25728773		False	3	100;0;0	21.664	True		ENSG00000039650	ENSG00000039650	HGNC:9154													
PNKP	gene	PNKP	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, seizures and developmental delay, 613402;Ataxia-oculomotor apraxia 4, 616267;Ataxia with oculomotor apraxia 4 (#616267)				31436889;31707899		False	3	100;0;0	21.664	True		ENSG00000039650	ENSG00000039650	HGNC:9154													
PNKP	gene	PNKP	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Microcephaly, seizures, and developmental delay, MIM#	613402"				31436889;31707899		False	3	100;0;0	21.664	True		ENSG00000039650	ENSG00000039650	HGNC:9154													
PNKP	gene	PNKP	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, axonal, type 2B2 (MIM#605589);Ataxia-oculomotor apraxia 4 (MIM#616267)				30039206;27066567;25728773		False	3	100;0;0	21.664	True		ENSG00000039650	ENSG00000039650	HGNC:9154													
PNP	gene	PNP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM#	613179"				3029074;1384322;11453975;32695102;32514656		False	3	100;0;0	21.664	True		ENSG00000198805	ENSG00000198805	HGNC:7892													
PNPLA2	gene	PNPLA2	Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neutral lipid storage disease with myopathy	MIM#610717"				18952067;25287355;25956450		False	3	67;0;33	21.664	True		ENSG00000177666	ENSG00000177666	HGNC:30802													
PNPLA2	gene	PNPLA2	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neutral lipid storage disease with myopathy	610717"				PMID: 32269696;21544567		False	3	100;0;0	21.664	True		ENSG00000177666	ENSG00000177666	HGNC:30802													
PNPLA6	gene	PNPLA6	Expert Review Green;Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Boucher-Neuhauser syndrome MIM#215470;Laurence-Moon syndrome MIM#245800;Oliver-McFarlane syndrome MIM#275400;Spastic paraplegia 39, autosomal recessive MIM#612020						False	3	100;0;0	21.664	True		ENSG00000032444	ENSG00000032444	HGNC:16268													
PNPLA6	gene	PNPLA6	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Laurence-Moon Syndrome (LMS) MIM#245800;Spastic Paraplegia Type 39 MIM#612020				25299038;18313024		False	3	100;0;0	21.664	True		ENSG00000032444	ENSG00000032444	HGNC:16268													
PNPLA8	gene	PNPLA8	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related				PMID: 39082157		False	3	100;0;0	21.664	True		ENSG00000135241	ENSG00000135241	HGNC:28900													
PNPLA8	gene	PNPLA8	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related				PMID: 39082157		False	3	100;0;0	21.664	True		ENSG00000135241	ENSG00000135241	HGNC:28900													
PNPLA8	gene	PNPLA8	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related				PMID: 39082157		False	3	100;0;0	21.664	True		ENSG00000135241	ENSG00000135241	HGNC:28900													
PNPLA8	gene	PNPLA8	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related;Mitochondrial myopathy with lactic acidosis (MIM#251950), AR				29681094;25512002		False	3	100;0;0	21.664	True		ENSG00000135241	ENSG00000135241	HGNC:28900													
PNPO	gene	PNPO	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyridoxamine 5'-phosphate oxidase deficiency, MIM# 610090				34769443;33981986;33748042;32888189		False	3	100;0;0	21.664	True		ENSG00000108439	ENSG00000108439	HGNC:30260													
PNPO	gene	PNPO	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyridoxamine 5'-phosphate oxidase deficiency, MIM# 610090						False	3	100;0;0	21.664	True		ENSG00000108439	ENSG00000108439	HGNC:30260													
PNPT1	gene	PNPT1	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 13 (MIM#614932);Deafness, autosomal recessive 70 (MIM#614934)				31752325;28645153		False	3	67;33;0	21.664	True		ENSG00000138035	ENSG00000138035	HGNC:23166													
PNPT1	gene	PNPT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 13, MIM# 614932				33158637;31752325		False	3	100;0;0	21.664	True		ENSG00000138035	ENSG00000138035	HGNC:23166													
PNPT1	gene	PNPT1	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 25, MIM#	608703"				35411967;37935417;39729134;39899068;39924761;40757543		False	3	60;40;0	21.664	False		ENSG00000138035	ENSG00000138035	HGNC:23166													
POGLUT1	gene	POGLUT1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, autosomal recessive 21 (MIM#617232)				27807076;29034878;31897643		False	3	67;33;0	21.664	True		ENSG00000163389	ENSG00000163389	HGNC:22954													
POGZ	gene	POGZ	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	White-Sutton syndrome MIM#616364				PMIS: 34645992;31136090;28490548;26739615;27824329		False	3	100;0;0	21.664	True		ENSG00000143442	ENSG00000143442	HGNC:18801													
POLA2	gene	POLA2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Telomere biology syndrome MONDO:0100137				39616267		False	3	100;0;0	21.664	True		ENSG00000014138	ENSG00000014138	HGNC:30073													
POLG	gene	POLG	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450				30451971		False	3	100;0;0	21.664	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLG	gene	POLG	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459				20301791		False	3	100;0;0	21.664	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLG	gene	POLG	Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4B (MNGIE type) 613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459;Progressive external ophthalmoplegia, autosomal dominant 1 157640;Mitochondrial DNA depletion syndrome 4A (Alpers type) 203700;Progressive external ophthalmoplegia, autosomal recessive 1 258450				30451971		False	3	100;0;0	21.664	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLG	gene	POLG	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450						False	3	100;0;0	21.664	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLG	gene	POLG	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM# 613662				30451971		False	3	100;0;0	21.664	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLG	gene	POLG	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	autosomal dominant progressive external ophthalmoplegia MONDO:0008003				20301791;15351195		False	3	100;0;0	21.664	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLG	gene	POLG	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM# 613662						False	3	100;0;0	21.664	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLG2	gene	POLG2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4, MIM# 610131;Mitochondrial DNA depletion syndrome 16 , MIM# 618528				16685652;21555342;27592148;31778857		False	3	100;0;0	21.664	True		ENSG00000256525	ENSG00000256525	HGNC:9180													
POLG2	gene	POLG2	Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4, MIM# 610131				16685652;21555342;27592148;31778857		False	3	50;50;0	21.664	True		ENSG00000256525	ENSG00000256525	HGNC:9180													
POLR1C	gene	POLR1C	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 11, MIM#	616494"				26151409;32042905		False	3	100;0;0	21.664	True		ENSG00000171453	ENSG00000171453	HGNC:20194													
POLR3A	gene	POLR3A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276				21855841		False	3	100;0;0	21.664	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3A	gene	POLR3A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276				32600288;32373668;31940116;31932101;29618326		False	3	100;0;0	21.664	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3A	gene	POLR3A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276				PMID: 33652360		False	3	100;0;0	21.664	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3A	gene	POLR3A	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276						False	3	100;0;0	21.664	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3A	gene	POLR3A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia				31637490		False	3	100;0;0	21.664	False		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3B	gene	POLR3B	Expert Review Green;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#614381				22036171;22036172		False	3	100;0;0	21.664	True		ENSG00000013503	ENSG00000013503	HGNC:30348													
POLR3B	gene	POLR3B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, demyelinating, type 1I, MIM# 619742				PMID: 33417887		False	3	100;0;0	21.664	True		ENSG00000013503	ENSG00000013503	HGNC:30348													
POLR3B	gene	POLR3B	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#	614381"				27512013;22036171;22036172		False	3	100;0;0	21.664	True		ENSG00000013503	ENSG00000013503	HGNC:30348													
POLR3B	gene	POLR3B	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	ataxia, spasticity, and demyelinating neuropathy				33417887		False	3	100;0;0	21.664	True		ENSG00000013503	ENSG00000013503	HGNC:30348													
POLR3K	gene	POLR3K	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3-related leukodystrophy MONDO:0700282				30584594;33659930;https://doi.org/10.1155/2024/8807171		False	3	50;50;0	21.664	True		ENSG00000161980	ENSG00000161980	HGNC:14121													
POLRMT	gene	POLRMT	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 55, MIM# 619743;intellectual disability;hypotonia				33602924		False	3	100;0;0	21.664	True		ENSG00000099821	ENSG00000099821	HGNC:9200													
POMGNT1	gene	POMGNT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy caused by variation in POMGNT1 MONDO:0700068						False	3	100;0;0	21.664	True		ENSG00000085998	ENSG00000085998	HGNC:19139													
POMGNT1	gene	POMGNT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 8 MIM#614830				27391550;26908613;30961548;30937090		False	3	100;0;0	21.664	True		ENSG00000085998	ENSG00000085998	HGNC:19139													
POMGNT1	gene	POMGNT1	Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (limb-girdle) type C, 8 MIM#618135				27391550;26908613;30961548;30937090		False	3	100;0;0	21.664	True		ENSG00000085998	ENSG00000085998	HGNC:19139													
POMGNT2	gene	POMGNT2	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 8, 614830						False	3	100;0;0	21.664	False		ENSG00000144647	ENSG00000144647	HGNC:25902													
POMGNT2	gene	POMGNT2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy caused by variation in POMGNT2 MONDO:0700069						False	3	100;0;0	21.664	True		ENSG00000144647	ENSG00000144647	HGNC:25902													
POMK	gene	POMK	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal							False	3	100;0;0	21.664	True		ENSG00000185900	ENSG00000185900	HGNC:26267													
POMT1	gene	POMT1	Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type						False	3	100;0;0	21.664	False		ENSG00000130714	ENSG00000130714	HGNC:9202													
POMT1	gene	POMT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, MIM# 236670						False	3	100;0;0	21.664	True		ENSG00000130714	ENSG00000130714	HGNC:9202													
POMT1	gene	POMT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy caused by variation in POMT1 MONDO:0700070						False	3	100;0;0	21.664	True		ENSG00000130714	ENSG00000130714	HGNC:9202													
POMT2	gene	POMT2	Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type						False	3	100;0;0	21.664	False		ENSG00000009830	ENSG00000009830	HGNC:19743													
POMT2	gene	POMT2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2 613150;Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 2 613156;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 2 613158						False	3	100;0;0	21.664	True		ENSG00000009830	ENSG00000009830	HGNC:19743													
POPDC1	gene	POPDC1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, autosomal recessive 25 616812				26642364 32528171 31119192		False	3	100;0;0	21.664	True		ENSG00000112276	ENSG00000112276	HGNC:1152													
POPDC3	gene	POPDC3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Muscular dystrophy, limb-girdle, autosomal recessive 26, MIM#	618848"				31610034		False	3	100;0;0	21.664	True		ENSG00000132429	ENSG00000132429	HGNC:17649													
POR	gene	POR	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis 201750;Disordered steroidogenesis due to cytochrome P450 oxidoreductase 613571				27604308;14758361;15793702;15220035;15483095;16470797		False	3	100;0;0	21.664	True		ENSG00000127948	ENSG00000127948	HGNC:9208													
POU4F1	gene	POU4F1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ataxia;intention tremor;hypotonia				33783914;8876243		False	3	100;0;0	21.664	True		ENSG00000152192	ENSG00000152192	HGNC:9218													
PPA2	gene	PPA2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sudden cardiac failure, alcohol-induced, 617223;Sudden cardiac failure, infantile, 617222				27523598;34400813		False	3	100;0;0	21.664	True		ENSG00000138777	ENSG00000138777	HGNC:28883													
PPCS	gene	PPCS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cardiomyopathy, dilated, 2C, MIM# 618189				29754768;35616428		False	3	50;50;0	21.664	True		ENSG00000127125	ENSG00000127125	HGNC:25686													
PPFIA3	gene	PPFIA3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paul-Chao neurodevelopmental syndrome, MIM# 621122				38723631		False	3	100;0;0	21.664	True		ENSG00000177380	ENSG00000177380	HGNC:9247													
PPFIBP1	gene	PPFIBP1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures, microcephaly, and brain abnormalities, MIM# 620024				35830857		False	3	100;0;0	21.664	True		ENSG00000110841	ENSG00000110841	HGNC:9249													
PPIL1	gene	PPIL1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 14, MIM# 619301;microcephaly;seizures				33220177		False	3	100;0;0	21.664	True		ENSG00000137168	ENSG00000137168	HGNC:9260													
PPOX	gene	PPOX	Expert Review Green;Expert Review Green;NHS GMS;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Porphyria variegata	MIM#176200"				25778941;9811936;12859407;30476629		False	3	100;0;0	21.664	True		ENSG00000143224	ENSG00000143224	HGNC:9280													
PPOX	gene	PPOX	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Porphyria variegata, MIM#	176200;Variegate porphyria, childhood-onset, MIM# 620483"				9811936;11286631;33159949		False	3	100;0;0	21.664	True		ENSG00000143224	ENSG00000143224	HGNC:9280													
PPP1R21	gene	PPP1R21	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, facial dysmorphism, and brain abnormalities, MIM# 619383;Hypotonia;intellectual disability;white matter abnormalities				30520571		False	3	100;0;0	21.664	True		ENSG00000162869	ENSG00000162869	HGNC:30595													
PPP2CA	gene	PPP2CA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder and language delay with or without structural brain abnormalities, MIM#618354				30595372		False	3	100;0;0	21.664	True		ENSG00000113575	ENSG00000113575	HGNC:9299													
PPP2R1A	gene	PPP2R1A	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Mental retardation, autosomal dominant 36, MIM#616362;Microcephaly-corpus callosum hypoplasia-intellectual disability-facial dysmorphism syndrome, MONDO:0014605				PMID: 33106617;26168268		False	3	100;0;0	21.664	True	Other	ENSG00000105568	ENSG00000105568	HGNC:9302													
PPP2R5D	gene	PPP2R5D	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Houge-Janssens syndrome 1 MIM#616355				26168268;29296277;26576547		False	3	100;0;0	21.664	True		ENSG00000112640	ENSG00000112640	HGNC:9312													
PPP2R5D	gene	PPP2R5D	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early onset Parkinsonism;Houge-Janssens syndrome 1, MIM#616355				33338668;32743835		False	3	100;0;0	21.664	True		ENSG00000112640	ENSG00000112640	HGNC:9312													
PPP3CA	gene	PPP3CA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 91, MIM#617711				29432562;32593294		False	3	100;0;0	21.664	True		ENSG00000138814	ENSG00000138814	HGNC:9314													
PPT1	gene	PPT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 1, MIM# 256730;MONDO:0009744				7637805;9425237;9664077		False	3	100;0;0	21.664	True		ENSG00000131238	ENSG00000131238	HGNC:9325													
PPT1	gene	PPT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 1, MIM# 256730;MONDO:0009744				7637805;9425237;9664077		False	3	100;0;0	21.664	True		ENSG00000131238	ENSG00000131238	HGNC:9325													
PRDM12	gene	PRDM12	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	insensitivity to pain;Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488;MONDO:0014662				26975306;25891934;26005867;33789102;33010785;32828702		False	3	100;0;0	21.664	True		ENSG00000130711	ENSG00000130711	HGNC:13997													
PRDM12	gene	PRDM12	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488;MONDO:0014662;HSAN/SFN				26005867;33789102;33010785;32828702		False	3	100;0;0	21.664	False		ENSG00000130711	ENSG00000130711	HGNC:13997													
PRDX3	gene	PRDX3	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia MONDO:0000437, PRDX3-related				33889951		False	3	100;0;0	21.664	True		ENSG00000165672	ENSG00000165672	HGNC:9354													
PRDX3	gene	PRDX3	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia MONDO:0000437, PRDX3-related				33889951		False	3	100;0;0	21.664	True		ENSG00000165672	ENSG00000165672	HGNC:9354													
PREPL	gene	PREPL	Expert Review Green;Victorian Clinical Genetics Services;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenic syndrome, congenital, 22 MIM#616224;hypotonia-cystinuria syndrome				28726805;27604308;24610330;34888501		False	3	100;0;0	21.664	True		ENSG00000138078	ENSG00000138078	HGNC:30228													
PREPL	gene	PREPL	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenic syndrome, congenital, 22 MIM#616224;hypotonia-cystinuria syndrome;Disorders of amino acid transport				28726805;27604308		False	3	100;0;0	21.664	True		ENSG00000138078	ENSG00000138078	HGNC:30228													
PRKAG2	gene	PRKAG2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Glycogen storage disease of heart, lethal congenital, MIM# 261740				15877279;17667862;32646569		False	3	100;0;0	21.664	True		ENSG00000106617	ENSG00000106617	HGNC:9386													
PRKAG2	gene	PRKAG2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Wolff-Parkinson-White syndrome        194200;Cardiomyopathy, hypertrophic 6        600858;Glycogen storage disease of heart, lethal congenital        261740				15766830;31049239		False	3	100;0;0	21.664	True		ENSG00000106617	ENSG00000106617	HGNC:9386													
PRKCG	gene	PRKCG	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 14, MIM# 605361;Myoclonus;Parkinsonism				PMID: 29603387		False	3	100;0;0	21.664	True		ENSG00000126583	ENSG00000126583	HGNC:9402													
PRKN	gene	PRKN	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of mitochondrial protein quality control;Parkinson disease MONDO:0005180				29884839;38069350		False	3	100;0;0	21.664	True		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRKN	gene	PRKN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease, juvenile, type 2 MIM#600116						False	3	100;0;0	21.664	True		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRKN	gene	PRKN	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile parkinsonism/dystonia;Parkinson disease, juvenile, type 2;Dystonia						False	3	0;0;0	21.664	False		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRKN	gene	PRKN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive juvenile Parkinson disease 2 MONDO:0010820						False	3	100;0;0	21.664	True		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRKRA	gene	PRKRA	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 16, MIM# 612067;MONDO:0012789				18243799;25142429;29279192		False	3	100;0;0	21.664	False		ENSG00000180228	ENSG00000180228	HGNC:9438													
PRKRA	gene	PRKRA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	dystonia 16 MONDO:0012789				33502045		False	3	100;0;0	21.664	True		ENSG00000180228	ENSG00000180228	HGNC:9438													
PRMT1	gene	PRMT1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, PRMT1-related				39937650		False	3	100;0;0	21.664	True		ENSG00000126457	ENSG00000126457	HGNC:5187													
PRMT7	gene	PRMT7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short stature, brachydactyly, intellectual developmental disability, and seizures, MIM# 617157				26437029;27718516;30513135		False	3	100;0;0	21.664	True		ENSG00000132600	ENSG00000132600	HGNC:25557													
PRMT9	gene	PRMT9	Literature;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, PRMT9-related				38561334;41260215		False	3	100;0;0	21.664	False		ENSG00000164169	ENSG00000164169	HGNC:25099													
PRNP	gene	PRNP	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Cerebral amyloid angiopathy, PRNP-related,	137440"				27716661;24224623;25287017;26768678		False	3	0;0;0	21.664	False		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRNP	gene	PRNP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	inherited Creutzfeldt-Jakob disease MONDO:0007403;Gerstmann-Straussler-Scheinker syndrome MONDO:0007656				20301407		False	3	100;0;0	21.664	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRNP	gene	PRNP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Prion Disease (MIM#176640);Creutzfeldt-Jakob disease (MIM#123400)				27910931;19571725, 20301407;6351815		False	3	100;0;0	21.664	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRNP	gene	PRNP	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Prion diseases;peripheral neuropathy;chronic diarrhea;dementia				31953922;31907995;29928661;27716661;26926995;24224623;26768678		False	3	50;0;50	21.664	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRNP	gene	PRNP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 1 MONDO:0011299				30713928;27400454		False	3	100;0;0	21.664	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRNP	gene	PRNP	Other;Expert Review Green;Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	fatal familial insomnia MONDO:0010808				25220284;24252267		False	3	100;0;0	21.664	False	Other	ENSG00000171867	ENSG00000171867	HGNC:9449													
PRNP	gene	PRNP	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease				2564168;34324063;20301407		False	3	100;0;0	21.664	False		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRODH	gene	PRODH	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hyperprolinemia, type I	239500;Proline oxidase deficiency"				17412540;12217952		False	3	100;0;0	21.664	True		ENSG00000100033	ENSG00000100033	HGNC:9453													
PRORP	gene	PRORP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Combined oxidative phosphorylation deficiency 54, MIM#	619737"				PMID: 34715011		False	3	100;0;0	21.664	True		ENSG00000100890	ENSG00000100890	HGNC:19958													
PRPF8	gene	PRPF8	Expert Review Green;Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, PRPF8-related;Retinitis pigmentosa 13 - MIM#600059				35543142		False	3	100;0;0	21.664	True		ENSG00000174231	ENSG00000174231	HGNC:17340													
PRPS1	gene	PRPS1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Arts syndrome 301835;Charcot-Marie-Tooth disease, X-linked recessive, 5 311070;Deafness, X-linked 1 304500;Gout, PRPS-related 300661;Phosphoribosylpyrophosphate synthetase superactivity 300661						False	3	100;0;0	21.664	True		ENSG00000147224	ENSG00000147224	HGNC:9462													
PRPS1	gene	PRPS1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Charcot Marie Tooth disease, X linked recessive, 5, 311070;HMSN				17701900;24285972;25491489;25182139		False	3	100;0;0	21.664	False		ENSG00000147224	ENSG00000147224	HGNC:9462													
PRRT2	gene	PRRT2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic kinesigenic dyskinesia 1, MIM# 128200;MONDO:0007494				22101681;22120146;22744660;22399141		False	3	100;0;0	21.664	False		ENSG00000167371	ENSG00000167371	HGNC:30500													
PRRT2	gene	PRRT2	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	PRRT2-associated paroxysmal movement disorder MONDO:0100556				26598494;31193310;30501978;30713971		False	3	100;0;0	21.664	True		ENSG00000167371	ENSG00000167371	HGNC:30500													
PRRT2	gene	PRRT2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	PRRT2-associated paroxysmal movement disorder MONDO:0100556				33126500		False	3	100;0;0	21.664	True		ENSG00000167371	ENSG00000167371	HGNC:30500													
PRRT2	gene	PRRT2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	PRRT2-associated paroxysmal movement disorder MONDO:0100556				30501978;30713971;27423591;25595153;33126500		False	3	100;0;0	21.664	True		ENSG00000167371	ENSG00000167371	HGNC:30500													
PRUNE1	gene	PRUNE1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies MIM#617481				PMID: 28334956;26539891;30556349;29940663;29797509		False	3	100;0;0	21.664	True		ENSG00000143363	ENSG00000143363	HGNC:13420													
PRX	gene	PRX	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease type 4 MONDO:0018995				11133365;11157804;15197604;21079185;22847150;10839370;32460404;31523542;31426691		False	3	100;0;0	21.664	False		ENSG00000105227	ENSG00000105227	HGNC:13797													
PSAP	gene	PSAP	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Combined SAP deficiency, MIM# 611721;Encephalopathy due to prosaposin deficiency, MONDO:0012719;Krabbe disease, atypical, MIM# 611722;MONDO:0012720;Metachromatic leukodystrophy due to SAP-b deficiency, MIM# 249900;MONDO:0009590;Gaucher disease, atypical, MIM# 610539;MONDO:0012517				32201884;10682309;1371116;15773042;31061751;30632081		False	3	100;0;0	21.664	True		ENSG00000197746	ENSG00000197746	HGNC:9498													
PSAP	gene	PSAP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491				32201884		False	3	100;0;0	21.664	True		ENSG00000197746	ENSG00000197746	HGNC:9498													
PSAP	gene	PSAP	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined SAP deficiency, MIM# 611721;Encephalopathy due to prosaposin deficiency, MONDO:0012719;Krabbe disease, atypical, MIM# 611722;MONDO:0012720;Metachromatic leukodystrophy due to SAP-b deficiency, MIM# 249900;MONDO:0009590;Gaucher disease, atypical, MIM# 610539;MONDO:0012517				10682309;1371116;15773042;31061751;30632081		False	3	100;0;0	21.664	True		ENSG00000197746	ENSG00000197746	HGNC:9498													
PSAP	gene	PSAP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Metachromatic leukodystrophy due to SAP-b deficiency, MIM#	249900"						False	3	100;0;0	21.664	True		ENSG00000197746	ENSG00000197746	HGNC:9498													
PSAT1	gene	PSAT1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phosphoserine aminotransferase deficiency MIM#610992;Neu-Laxova syndrome 2 MIM#616038				32077105		False	3	100;0;0	21.664	True		ENSG00000135069	ENSG00000135069	HGNC:19129													
PSEN1	gene	PSEN1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease, type 3, with spastic paraparesis and apraxia, MIM# 607822				33274538		False	3	100;0;0	21.664	False		ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN1	gene	PSEN1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease 3 MONDO:0011913				3548932;34843019;36825052		False	3	100;0;0	21.664	True		ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN1	gene	PSEN1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease, type 3 (MIM#607822;MONDO:0011913)				22503161;20301340		False	3	100;0;0	21.664	True		ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN1	gene	PSEN1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Frontotemporal dementia, MIM# 600274;Dystonia				28664294;12810495;15159497;29316780		False	3	100;0;0	21.664	True		ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN1	gene	PSEN1	Other;Expert Review Green;Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset autosomal dominant Alzheimer disease MONDO:0015140				36845656		False	3	100;0;0	21.664	False	Other	ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN2	gene	PSEN2	Other;Expert Review Green;Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset autosomal dominant Alzheimer disease MONDO:0015140				36845656		False	3	100;0;0	21.664	False	Other	ENSG00000143801	ENSG00000143801	HGNC:9509													
PSEN2	gene	PSEN2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease-4 (MIM#606889)				22503161;20301340;25323700;35491795		False	3	100;0;0	21.664	True		ENSG00000143801	ENSG00000143801	HGNC:9509													
PSMF1	gene	PSMF1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related				https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1		False	3	100;0;0	21.664	True		ENSG00000125818	ENSG00000125818	HGNC:9571													
PSPH	gene	PSPH	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phosphoserine phosphatase deficiency MIM#614023;Disorders of serine, glycine or glycerate metabolism				14673469;25080166;27604308;26888760;25152457		False	3	100;0;0	21.664	True		ENSG00000146733	ENSG00000146733	HGNC:9577													
PTCD3	gene	PTCD3	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-51, MIM#619057;Mental retardation;optic atrophy;Leigh-like syndrome				30607703;19427859;36450274		False	3	50;50;0	21.664	True		ENSG00000132300	ENSG00000132300	HGNC:24717													
PTEN	gene	PTEN	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cowden syndrome 1, MIM#158350				9832032;29033429;29444762		False	3	100;0;0	21.664	True		ENSG00000171862	ENSG00000171862	HGNC:9588													
PTEN	gene	PTEN	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cowden syndrome 1, MIM# 158350				29720545;29152901;30664625		False	3	100;0;0	21.664	True		ENSG00000171862	ENSG00000171862	HGNC:9588													
PTPMT1	gene	PTPMT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199				39279645;37672386		False	3	100;0;0	21.664	True		ENSG00000110536	ENSG00000110536	HGNC:26965													
PTPN23	gene	PTPN23	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890				31395947;29899372;29090338;27848944;25558065		False	3	100;0;0	21.664	True		ENSG00000076201	ENSG00000076201	HGNC:14406													
PTRH2	gene	PTRH2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile multisystem neurologic, endocrine, and pancreatic disease (IMNPED) (MIM#616263);Infantile-onset multisystem disease with intellectual disability, microcephaly, progressive ataxia, sensory neuronal hearing loss, hepatomegaly, pancreatic insufficiency, proximal placement of thumb, SNCV neuropathy				25574476;27129381;28328138		False	3	100;0;0	21.664	True		ENSG00000141378	ENSG00000141378	HGNC:24265													
PTRH2	gene	PTRH2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile multi-system neurologic, endocrine, and pancreatic disease, 616263				25558065;25574476;31057140;27129381		False	3	100;0;0	21.664	True		ENSG00000141378	ENSG00000141378	HGNC:24265													
PTRH2	gene	PTRH2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Miscellaneous disorders associated with mitochondrial dysfunction;neurologic, endocrine, and pancreatic disease, multisystem, infantile-onset 1 MONDO:8000012				29884839;37239392;25558065;25574476;31057140;27129381		False	3	100;0;0	21.664	True		ENSG00000141378	ENSG00000141378	HGNC:24265													
PTRHD1	gene	PTRHD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747				27753167;27134041;30398675;29143421		False	3	100;0;0	21.664	True		ENSG00000184924	ENSG00000184924	HGNC:33782													
PTS	gene	PTS	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, A, 261640;6-Pyruvoyltetrahydropterin Synthase Deficiency;Dystonia						False	3	0;0;0	21.664	False		ENSG00000150787	ENSG00000150787	HGNC:9689													
PTS	gene	PTS	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640						False	3	100;0;0	21.664	True		ENSG00000150787	ENSG00000150787	HGNC:9689													
PTS	gene	PTS	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal							False	3	100;0;0	21.664	True		ENSG00000150787	ENSG00000150787	HGNC:9689													
PTS	gene	PTS	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640				9222755		False	3	100;0;0	21.664	True		ENSG00000150787	ENSG00000150787	HGNC:9689													
PUM1	gene	PUM1	Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 47, 617931						False	3	100;0;0	21.664	False		ENSG00000134644	ENSG00000134644	HGNC:14957													
PUM1	gene	PUM1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719				29474920;25768905;30903679;31859446		False	3	100;0;0	21.664	True		ENSG00000134644	ENSG00000134644	HGNC:14957													
PURA	gene	PURA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158)				25439098;25342064;12972605		False	3	100;0;0	21.664	True		ENSG00000185129	ENSG00000185129	HGNC:9701													
PUS1	gene	PUS1	Expert Review Green;Expert Review;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	myopathy, lactic acidosis, and sideroblastic anemia 1 MONDO:0024553				25227147;17056637;15108122;32287105;31641589;28832011		False	3	100;0;0	21.664	True		ENSG00000177192	ENSG00000177192	HGNC:15508													
PUS1	gene	PUS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462				25227147;17056637;15108122;32287105;31641589;28832011		False	3	100;0;0	21.664	True		ENSG00000177192	ENSG00000177192	HGNC:15508													
PUS3	gene	PUS3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with microcephaly and gray sclerae, MIM#	617051"				36125428;30308082;28454995;27055666;30697592;31444731		False	3	100;0;0	21.664	True		ENSG00000110060	ENSG00000110060	HGNC:25461													
PYCR1	gene	PYCR1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cutis laxa, autosomal recessive, type IIB MIM#612940;Cutis laxa, autosomal recessive, type IIIB MIM#614438;Disorders of ornithine or proline metabolism				19576563;27604308		False	3	100;0;0	21.664	True		ENSG00000183010	ENSG00000183010	HGNC:9721													
PYCR2	gene	PYCR2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 10, MIM# 616420				25865492;27130255		False	3	100;0;0	21.664	True		ENSG00000143811	ENSG00000143811	HGNC:30262													
PYGL	gene	PYGL	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease VI, MIM# 232700				9529348;9536091;33505429;32961316;32892177		False	3	100;0;0	21.664	True		ENSG00000100504	ENSG00000100504	HGNC:9725													
PYGM	gene	PYGM	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	McArdle disease, MIM# 232600;Disorder of glycogen metabolism MONDO:0002412, PYGM-related, AD				32386344		False	3	100;0;0	21.664	True		ENSG00000068976	ENSG00000068976	HGNC:9726													
PYGM	gene	PYGM	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease V McArdle disease 232600 AR				32386344		False	3	100;0;0	21.664	True		ENSG00000068976	ENSG00000068976	HGNC:9726													
PYROXD1	gene	PYROXD1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, myofibrillar, 8, 617258;adult-onset limb girdle muscular dystrophy				30345904;30515627;27745833		False	3	0;100;0	21.664	True		ENSG00000121350	ENSG00000121350	HGNC:26162													
QARS1	gene	QARS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, progressive, seizures, and cerebral and cerebellar atrophy, MIM# 615760				28620870;25471517;25432320;25041233;24656866;32042906		False	3	100;0;0	21.664	True		ENSG00000172053	ENSG00000172053	HGNC:9751													
QARS1	gene	QARS1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, progressive, seizures, and cerebral and cerebellar atrophy, MIM# 615760				28620870;25471517;25432320;25041233;24656866;32042906		False	3	100;0;0	21.664	True		ENSG00000172053	ENSG00000172053	HGNC:9751													
QDPR	gene	QDPR	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630				11153907		False	3	100;0;0	21.664	True		ENSG00000151552	ENSG00000151552	HGNC:9752													
QDPR	gene	QDPR	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, C, 261630;Dihydropteridine reductase deficiency;Dystonia						False	3	0;0;0	21.664	False		ENSG00000151552	ENSG00000151552	HGNC:9752													
QDPR	gene	QDPR	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, C, MIM#261630;Dehydropteridin reductase deficiency, Infantile-onset dystonia;Parkinsonism;Epilepsy;Autonomic dysfunction;Hyperphenylalaninemia				PMID: 28413401		False	3	100;0;0	21.664	True		ENSG00000151552	ENSG00000151552	HGNC:9752													
QDPR	gene	QDPR	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, C, MIM#261630				26006720		False	3	100;0;0	21.664	True		ENSG00000151552	ENSG00000151552	HGNC:9752													
QRSL1	gene	QRSL1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 40 MIM#618835				26741492;29440775;30283131;30642647		False	3	100;0;0	21.664	True		ENSG00000130348	ENSG00000130348	HGNC:21020													
RAB11B	gene	RAB11B	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807				29106825		False	3	100;0;0	21.664	False		ENSG00000185236	ENSG00000185236	HGNC:9761													
RAB11B	gene	RAB11B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807				29106825		False	3	100;0;0	21.664	True		ENSG00000185236	ENSG00000185236	HGNC:9761													
RAB18	gene	RAB18	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Warburg micro syndrome 3, MIM# 614222				11237903;23420520		False	3	100;0;0	21.664	True		ENSG00000099246	ENSG00000099246	HGNC:14244													
RAB1A	gene	RAB1A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, RAB1A-related				37924809		False	3	100;0;0	21.664	False		ENSG00000138069	ENSG00000138069	HGNC:9758													
RAB32	gene	RAB32	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Parkinson disease 26, autosomal dominant, susceptibility to}, MIM# 620923				38858457;38614108;38293014;40118982;40568674;41103171		False	3	33;33;33	21.664	True	Other	ENSG00000118508	ENSG00000118508	HGNC:9772													
RAB39B	gene	RAB39B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 72 MIM#300271;Waisman syndrome MIM#311510				4025396;11050621;20159109		False	3	100;0;0	21.664	True		ENSG00000155961	ENSG00000155961	HGNC:16499													
RAB39B	gene	RAB39B	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Early-onset parkinsonism-intellectual disability syndrome MONDO:0010709				25434005;26399558;26739247		False	3	100;0;0	21.664	True		ENSG00000155961	ENSG00000155961	HGNC:16499													
RAB3A	gene	RAB3A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 52, MIM# 621535				40166812		False	3	100;0;0	21.664	True		ENSG00000105649	ENSG00000105649	HGNC:9777													
RAB3A	gene	RAB3A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092				40166812		False	3	100;0;0	21.664	True		ENSG00000105649	ENSG00000105649	HGNC:9777													
RAB3GAP2	gene	RAB3GAP2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Martsolf syndrome	212720"				PMID: 32376645		False	3	100;0;0	21.664	True		ENSG00000118873	ENSG00000118873	HGNC:17168													
RAB5C	gene	RAB5C	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, RAB5C-related				PMID: 37552066		False	3	100;0;0	21.664	True		ENSG00000108774	ENSG00000108774	HGNC:9785													
RAB7A	gene	RAB7A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, type 2B, MIM# 600882;MONDO:0010949				12545426;17060578;32326241;29130394;25614874		False	3	100;0;0	21.664	False		ENSG00000075785	ENSG00000075785	HGNC:9788													
RAB7A	gene	RAB7A	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Disorders of autophagy;Charcot-Marie-Tooth disease type 2 MONDO:0018993				35159308;36449254;29884839		False	3	0;0;0	21.664	False		ENSG00000075785	ENSG00000075785	HGNC:9788													
RAB7A	gene	RAB7A	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, type 2B, MIM# 600882;MONDO:0010949				17060578;15455439;12545426		False	3	100;0;0	21.664	True		ENSG00000075785	ENSG00000075785	HGNC:9788													
RAC3	gene	RAC3	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with structural brain anomalies and dysmorphic facies, MIM#618577				35851598		False	3	100;0;0	21.664	True		ENSG00000169750	ENSG00000169750	HGNC:9803													
RAI1	gene	RAI1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Smith-Magenis syndrome MIM#182290				36256819;11404004;12652298;15788730		False	3	100;0;0	21.664	True		ENSG00000108557	ENSG00000108557	HGNC:9834													
RALA	gene	RALA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hiatt-Neu-Cooper neurodevelopmental syndrome, MIM# 619311;Intellectual disability;Seizures				30500825		False	3	100;0;0	21.664	True		ENSG00000006451	ENSG00000006451	HGNC:9839													
RALGAPA1	gene	RALGAPA1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, neonatal respiratory insufficiency, and thermodysregulation MIM#618797				32004447		False	3	100;0;0	21.664	True		ENSG00000174373	ENSG00000174373	HGNC:17770													
RANBP2	gene	RANBP2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Encephalopathy, acute, infection-induced, 3, susceptibility to} MIM#608033						False	3	100;0;0	21.664	True		ENSG00000153201	ENSG00000153201	HGNC:9848													
RANBP2	gene	RANBP2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Encephalopathy, acute, infection-induced, 3, susceptibility to} MIM#608033				32426208;35485383;33777149;19118815;25128471;25522933;32048120		False	3	100;0;0	21.664	True		ENSG00000153201	ENSG00000153201	HGNC:9848													
RARS1	gene	RARS1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Australian Genomcis Health Alliance Leukodystrophy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 9 616140						False	3	100;0;0	21.664	False		ENSG00000113643	ENSG00000113643	HGNC:9870													
RARS1	gene	RARS1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 9 (# 616140)				31814314		False	3	100;0;0	21.664	True		ENSG00000113643	ENSG00000113643	HGNC:9870													
RARS2	gene	RARS2	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 6, MIM# 611523				17847012;25809939;20635367;31429931		False	3	50;0;50	21.664	True		ENSG00000146282	ENSG00000146282	HGNC:21406													
RARS2	gene	RARS2	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 6 MIM#611523				31536827		False	3	67;0;33	21.664	True		ENSG00000146282	ENSG00000146282	HGNC:21406													
RASA1	gene	RASA1	Genomics England PanelApp;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Parkes Weber syndrome;Capillary malformation-arteriovenous malformation, 608354;Parkes Weber Syndrome;Parkes Weber syndrome (PKWS);Parkes Weber syndrome, 608355;Capillary Malformation-Arteriovenous Malformation Syndrome				14639529		False	3	100;0;0	21.664	False		ENSG00000145715	ENSG00000145715	HGNC:9871													
RBCK1	gene	RBCK1	Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyglucosan body myopathy 1 with or without immunodeficiency 615895				29260357;29695863		False	3	100;0;0	21.664	True		ENSG00000125826	ENSG00000125826	HGNC:15864													
RBCK1	gene	RBCK1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyglucosan body myopathy 1 with or without immunodeficiency MIM#615895				23798481;23104095		False	3	100;0;0	21.664	True		ENSG00000125826	ENSG00000125826	HGNC:15864													
RBFOX1	gene	RBFOX1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), RBFOX1-related				PMID: 37962958		False	3	100;0;0	21.664	True		ENSG00000078328	ENSG00000078328	HGNC:18222													
RBP4	gene	RBP4	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Microphthalmia, isolated, with coloboma 10, MIM#	616428;Retinal dystrophy, iris coloboma, and comedogenic acne syndrome, MIM#	615147"				9888420;23189188;25910211;32323592;29847795;29178648;27892788		False	3	100;0;0	21.664	True		ENSG00000138207	ENSG00000138207	HGNC:9922													
RCC1	gene	RCC1	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infection-induced acute-onset axonal neuropathy, MIM# 621333				40683276		False	3	100;0;0	21.664	False		ENSG00000180198	ENSG00000180198	HGNC:1913													
REEP1	gene	REEP1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spastic paraplegia 31, autosomal dominant, MIM#	610250"				16826527;19034539		False	3	100;0;0	21.664	True		ENSG00000068615	ENSG00000068615	HGNC:25786													
REEP1	gene	REEP1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 31, autosomal dominant MIM#610250				23108492;22703882		False	3	100;0;0	21.664	True		ENSG00000068615	ENSG00000068615	HGNC:25786													
REEP1	gene	REEP1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Spinal muscular atrophy, distal, autosomal recessive, 6, MIM#620011;Neuronopathy, distal hereditary motor, type VB MIM#614751;Spastic paraplegia 31, autosomal dominant MIM#610250				27066569;31872057;22703882;29124833		False	3	100;0;0	21.664	False	Other	ENSG00000068615	ENSG00000068615	HGNC:25786													
REEP2	gene	REEP2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 72, dominant and recessive, MIM# 615625;MONDO:0014282				33526816;28491902;24388663		False	3	100;0;0	21.664	True		ENSG00000132563	ENSG00000132563	HGNC:17975													
RELN	gene	RELN	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Epilepsy, familial temporal lobe, 7}, MIM# 616436;MONDO:0014639				28142128		False	3	33;67;0	21.664	True		ENSG00000189056	ENSG00000189056	HGNC:9957													
RERE	gene	RERE	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart, MIM# 616975				30896913;27087320;23451234;30558068		False	3	100;0;0	21.664	True		ENSG00000142599	ENSG00000142599	HGNC:9965													
RETREG1	gene	RETREG1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type IIB, 613115;HSAN/SFN				19838196;24327336;31737055;31596031		False	3	100;0;0	21.664	False		ENSG00000154153	ENSG00000154153	HGNC:25964													
RETREG1	gene	RETREG1	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type IIB, MIM# 613115;MONDO:0013142				19838196;21115472;24327336;24327336;31737055;31596031		False	3	100;0;0	21.664	True		ENSG00000154153	ENSG00000154153	HGNC:25964													
RFC1	gene	RFC1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome OMIM 614575				30926972;33103729;35883251;36478048;36289003		False	3	67;33;0	21.664	True	Other	ENSG00000035928	ENSG00000035928	HGNC:9969													
RFC1	gene	RFC1	Literature;Expert list;Expert Review Green;Expert Review Green;Expert list;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575				30926972;33103729;35883251;36478048;36289003		False	3	67;33;0	21.664	False		ENSG00000035928	ENSG00000035928	HGNC:9969													
RFT1	gene	RFT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type In, MIM# 612015;RFT1-CDG, MONDO:0012783				18313027;19701946;19856127;23111317;30071302;29923091;27927990;26892341		False	3	100;0;0	21.664	True		ENSG00000163933	ENSG00000163933	HGNC:30220													
RFT1	gene	RFT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type In, MIM# 612015;RFT1-CDG, MONDO:0012783				18313027;19701946;19856127;23111317;30071302;29923091;27927990;26892341		False	3	100;0;0	21.664	True		ENSG00000163933	ENSG00000163933	HGNC:30220													
RHEB	gene	RHEB	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Other	Neurodevelopmental disorder MONDO:0700092, RHEB-related;Intellectual disability;Macrocephaly;Focal cortical dysplasia				31337748;29051493;39993836		False	3	100;0;0	21.664	True		ENSG00000106615	ENSG00000106615	HGNC:10011													
RHOBTB2	gene	RHOBTB2	Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 64, MIM#	618004;Dystonia, hypertonia, movement disorder;truncal hypotonia;hemiparesis;developmental and epileptic encephalopathy"				PMID: 29276004		False	3	0;0;0	21.664	True		ENSG00000008853	ENSG00000008853	HGNC:18756													
RHOBTB2	gene	RHOBTB2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 64, MIM#618004				29768694;29276004;37165955		False	3	100;0;0	21.664	True		ENSG00000008853	ENSG00000008853	HGNC:18756													
RING1	gene	RING1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	complex neurodevelopmental disorder, MONDO:0100038, RING1-related				29386386;41653922		False	3	100;0;0	21.664	True		ENSG00000204227	ENSG00000204227	HGNC:10018													
RINT1	gene	RINT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary spastic paraplegia, MONDO:0019064, RINT1-related				37463447;38990652		False	3	50;50;0	21.664	True		ENSG00000135249	ENSG00000135249	HGNC:21876													
RMND1	gene	RMND1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 11 MIM#614922				23022098;25604853;26395190		False	3	100;0;0	21.664	True		ENSG00000155906	ENSG00000155906	HGNC:21176													
RMND1	gene	RMND1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 11 MIM#614922				18835491;23022099;23022098;25604853;26395190		False	3	100;0;0	21.664	True		ENSG00000155906	ENSG00000155906	HGNC:21176													
RMND1	gene	RMND1	Expert Review Green;Other;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation defect type 11 MONDO:0013969				23022099;25604853;27843092		False	3	100;0;0	21.664	False		ENSG00000155906	ENSG00000155906	HGNC:21176													
RMRP	gene	RMRP	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of ribosomal biogenesis;cartilage-hair hypoplasia MONDO:0009595				29884839;38337186;16244706;21396580;22420014;11940090;16252239		False	3	100;0;0	21.664	True		-	ENSG00000277027	HGNC:10031													
RNASEH1	gene	RNASEH1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2 MIM#616479				26094573;31258551		False	3	100;0;0	21.664	True		ENSG00000171865	ENSG00000171865	HGNC:18466													
RNASEH2A	gene	RNASEH2A	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 4, MIM# 610333				17846997;16845400;23592335;27643693		False	3	100;0;0	21.664	True		ENSG00000104889	ENSG00000104889	HGNC:18518													
RNASEH2A	gene	RNASEH2A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 4 MIM#610333				15870678;25604658;23592335;20301648		False	3	100;0;0	21.664	True		ENSG00000104889	ENSG00000104889	HGNC:18518													
RNASEH2A	gene	RNASEH2A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 4, MIM#	610333"				16845400;23592335;17846997		False	3	100;0;0	21.664	True		ENSG00000104889	ENSG00000104889	HGNC:18518													
RNASEH2B	gene	RNASEH2B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 2, MIM# 610181				16845400;33307271;29239743		False	3	100;0;0	21.664	True		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2B	gene	RNASEH2B	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi Goutieres syndrome 2, MIM# 610181				29691679;30223285;29239743;28762473		False	3	100;0;0	21.664	True		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2B	gene	RNASEH2B	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 2, MIM# 610181				16845400;33307271;29239743		False	3	100;0;0	21.664	True		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2B	gene	RNASEH2B	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 2, MIM#	610181"				16845400		False	3	100;0;0	21.664	True		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2B	gene	RNASEH2B	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 2 MIM#610181				20131292;26860721		False	3	100;0;0	21.664	True		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2C	gene	RNASEH2C	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 3 (MIM# 610329)				24183309;23322642		False	3	100;0;0	21.664	True		ENSG00000172922	ENSG00000172922	HGNC:24116													
RNASEH2C	gene	RNASEH2C	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 3, MIM#	610329"				16845400;23322642		False	3	100;0;0	21.664	True		ENSG00000172922	ENSG00000172922	HGNC:24116													
RNASEH2C	gene	RNASEH2C	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 3, MIM# 610329				16845400;29239743;29150899;27643693		False	3	100;0;0	21.664	True		ENSG00000172922	ENSG00000172922	HGNC:24116													
RNASEH2C	gene	RNASEH2C	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 3 MIM#610329				20131292;23322642		False	3	100;0;0	21.664	True		ENSG00000172922	ENSG00000172922	HGNC:24116													
RNASET2	gene	RNASET2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy, cystic, without megalencephaly, MIM#	612951"				19525954		False	3	100;0;0	21.664	True		ENSG00000026297	ENSG00000026297	HGNC:21686													
RNASET2	gene	RNASET2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy, cystic, without megalencephaly, MIM#	612951"				19525954		False	3	100;0;0	21.664	True		ENSG00000026297	ENSG00000026297	HGNC:21686													
RNASET2	gene	RNASET2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, cystic, without megalencephaly MIM#612951				31349848;19525954;27091087;29336640;18545798;15851732		False	3	100;0;0	21.664	True		ENSG00000026297	ENSG00000026297	HGNC:21686													
RNF113A	gene	RNF113A	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Trichothiodystrophy 5, nonphotosensitive, MIM#300953				25612912;31880405;31793730;29133357;30506991;15256591;24026126;23555887		False	3	100;0;0	21.664	True		ENSG00000125352	ENSG00000125352	HGNC:12974													
RNF13	gene	RNF13	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 73, MIM#	618379"				30595371		False	3	100;0;0	21.664	True	Other	ENSG00000082996	ENSG00000082996	HGNC:10057													
RNF170	gene	RNF170	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 85, autosomal recessive, MIM# 619686				31636353		False	3	100;0;0	21.664	True		ENSG00000120925	ENSG00000120925	HGNC:25358													
RNF170	gene	RNF170	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ataxia, sensory, 1, autosomal dominant, MIM# 608984				32943585;21115467		False	3	100;0;0	21.664	False		ENSG00000120925	ENSG00000120925	HGNC:25358													
RNF2	gene	RNF2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lou-Schoch-Yamamoto syndrome , MIM#619460;epilepsy;intellectual disability;intrauterine growth retardation				33864376;40831499		False	3	50;50;0	21.664	True		ENSG00000121481	ENSG00000121481	HGNC:10061													
RNF213	gene	RNF213	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Moyamoya disease, MONDO:0016820;pediatric arterial ischemic stroke, MONDO:0018585				37924258		False	3	100;0;0	21.664	True		ENSG00000173821	ENSG00000173821	HGNC:14539													
RNF213	gene	RNF213	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	susceptibility to Moyamoya disease 2, (MIM# 607151)				21048783;28635953		False	3	100;0;0	21.664	True		ENSG00000173821	ENSG00000173821	HGNC:14539													
RNF216	gene	RNF216	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840						False	3	100;0;0	21.664	True		ENSG00000011275	ENSG00000011275	HGNC:21698													
RNF216	gene	RNF216	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840				23656588;25841028;27995769		False	3	100;0;0	21.664	True		ENSG00000011275	ENSG00000011275	HGNC:21698													
RNF220	gene	RNF220	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum				33964137;10881263		False	3	100;0;0	21.664	True		ENSG00000187147	ENSG00000187147	HGNC:25552													
RNF220	gene	RNF220	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum				33964137;10881263		False	3	100;0;0	21.664	True		ENSG00000187147	ENSG00000187147	HGNC:25552													
RNH1	gene	RNH1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, acute, infection-induced, susceptibility to, 12 MIM#620461				PMID: 36935417;37191094		False	3	33;0;67	21.664	True		ENSG00000023191	ENSG00000023191	HGNC:10074													
RNU2-2	gene	RNU2-2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 119, MIM# 621304				40210679;40442284;40950445		False	3	100;0;0	21.664	True		ENSG00000222328	ENSG00000222328	HGNC:10152													
RNU4-2	gene	RNU4-2	Expert Review Green;Expert list;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851				38991538;40297424		False	3	100;0;0	21.664	True		ENSG00000202538	ENSG00000202538	HGNC:10193													
RNU4ATAC	gene	RNU4ATAC	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710);Roifman syndrome (MIM# 616651);Lowry-Wood syndrome, MIM# 226960				23794361;26522830;30455926;29265708;12605445		False	3	100;0;0	21.664	True		ENSG00000264229	ENSG00000264229	HGNC:34016													
RNU6ATAC	gene	RNU6ATAC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mendez-Johnson immunoneurologic syndrome, MIM# 621585				41808409;40975062;41864208		False	3	33;33;33	21.664	True		ENSG00000221676	ENSG00000221676	HGNC:34017													
RNU7-1	gene	RNU7-1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 9, MIM# 619487				33230297		False	3	100;0;0	21.664	True		ENSG00000238923	ENSG00000238923	HGNC:34033													
RNU7-1	gene	RNU7-1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 9, MIM# 619487				33230297		False	3	100;0;0	21.664	True		ENSG00000238923	ENSG00000238923	HGNC:34033													
RNU7-1	gene	RNU7-1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 9, MIM# 619487				33230297		False	3	100;0;0	21.664	True		ENSG00000238923	ENSG00000238923	HGNC:34033													
ROGDI	gene	ROGDI	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kohlschutter-Tonz syndrome, MIM# 226750				22424600;23086778;33866847		False	3	100;0;0	21.664	True		ENSG00000067836	ENSG00000067836	HGNC:29478													
RORA	gene	RORA	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, 618060				29656859		False	3	100;0;0	21.664	True		ENSG00000069667	ENSG00000069667	HGNC:10258													
RORA	gene	RORA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, MIM# 618060				29656859		False	3	100;0;0	21.664	True		ENSG00000069667	ENSG00000069667	HGNC:10258													
RORB	gene	RORB	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Epilepsy, idiopathic generalized, susceptibility to, 15} (MIM#618357), AD;Genetic generalized epilepsy (GGE);Photosensitive generalized and occipital epilepsy				27352968;32162308		False	3	100;0;0	21.664	True		ENSG00000198963	ENSG00000198963	HGNC:10259													
RPGRIP1L	gene	RPGRIP1L	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 7, MIM#	611560"						False	3	100;0;0	21.664	True		ENSG00000103494	ENSG00000103494	HGNC:29168													
RPH3A	gene	RPH3A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO#0700092), RPH3A-related				37403762;29441694		False	3	100;0;0	21.664	True		ENSG00000089169	ENSG00000089169	HGNC:17056													
RPIA	gene	RPIA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ribose 5-phosphate isomerase deficiency, MIM#	608611;Leukoencephalopathy"				14988808;31056085;31247379		False	3	100;0;0	21.664	True		ENSG00000153574	ENSG00000153574	HGNC:10297													
RPIA	gene	RPIA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ribose 5-phosphate isomerase deficiency, MIM#	608611"				31247379;14988808;31056085		False	3	100;0;0	21.664	True		ENSG00000153574	ENSG00000153574	HGNC:10297													
RPS6KA3	gene	RPS6KA3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Coffin-Lowry syndrome MIM# 303600;Intellectual disability;short stature;delayed bone age;hearing deficit;hypotonia;tapering fingers;abnormal facies (hypertelorism, anteverted nares, prominent frontal region)				12210291;6879200		False	3	100;0;0	21.664	True		ENSG00000177189	ENSG00000177189	HGNC:10432													
RPS6KC1	gene	RPS6KC1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460				41130203		False	3	100;0;0	21.664	True		ENSG00000136643	ENSG00000136643	HGNC:10439													
RPS6KC1	gene	RPS6KC1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460				41130203		False	3	100;0;0	21.664	True		ENSG00000136643	ENSG00000136643	HGNC:10439													
RRM2B	gene	RRM2B	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy), 612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type), 612075;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 5, 613077				32827185;24741716		False	3	100;0;0	21.664	True		ENSG00000048392	ENSG00000048392	HGNC:17296													
RRM2B	gene	RRM2B	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075						False	3	0;0;0	21.664	False		ENSG00000048392	ENSG00000048392	HGNC:17296													
RRM2B	gene	RRM2B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075				32827185;24741716		False	3	100;0;0	21.664	True		ENSG00000048392	ENSG00000048392	HGNC:17296													
RRM2B	gene	RRM2B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075				24741716		False	3	100;0;0	21.664	True		ENSG00000048392	ENSG00000048392	HGNC:17296													
RTN2	gene	RTN2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 12, autosomal dominant, 604805;MONDO:0011489				22232211;27165006		False	3	100;0;0	21.664	True		ENSG00000125744	ENSG00000125744	HGNC:10468													
RTN2	gene	RTN2	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuronopathy, distal hereditary motor, autosomal recessive 11, with spasticity, MIM# 620854				38527963		False	3	100;0;0	21.664	False		ENSG00000125744	ENSG00000125744	HGNC:10468													
RTN4IP1	gene	RTN4IP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Optic atrophy 10 with or without ataxia, mental retardation, and seizures, MIM#616732				26593267;31077085		False	3	100;0;0	21.664	True		ENSG00000130347	ENSG00000130347	HGNC:18647													
RTN4IP1	gene	RTN4IP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Optic atrophy 10 with or without ataxia, mental retardation, and seizures, MIM#616732				26593267;31077085		False	3	100;0;0	21.664	True		ENSG00000130347	ENSG00000130347	HGNC:18647													
RTTN	gene	RTTN	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, short stature, and polymicrogyria with seizures, MIM# 614833				30879067		False	3	100;0;0	21.664	True		ENSG00000176225	ENSG00000176225	HGNC:18654													
RUBCN	gene	RUBCN	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Royal Melbourne Hospital Clinical Genetics Department	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 15, MIM#615705				20826435;23728897		False	3	100;0;0	21.664	True		ENSG00000145016	ENSG00000145016	HGNC:28991													
RXYLT1	gene	RXYLT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041, MONDO:0014022				23217329;23519211;30017359;27733679;27212206		False	3	100;0;0	21.664	True		ENSG00000118600	ENSG00000118600	HGNC:13530													
RYR1	gene	RYR1	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	calf predominant distal myopathy;distal myopathy MONDO:0018949				30842289;33458580		False	3	100;0;0	21.664	True		ENSG00000196218	ENSG00000196218	HGNC:10483													
RYR1	gene	RYR1	Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	{Malignant hyperthermia susceptibility 1}, 145600;Central core disease, 117000;King-Denborough syndrome, 145600;Neuromuscular disease, congenital, with uniform type 1 fiber, 117000;Minicore myopathy with external ophthalmoplegia, 255320				20301325;23553484		False	3	67;33;0	21.664	True		ENSG00000196218	ENSG00000196218	HGNC:10483													
SACS	gene	SACS	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charlevoix-Saguenay spastic ataxia (MONDO:0010041;MIM#270550)				20301432;20876471		False	3	100;0;0	21.664	True		ENSG00000151835	ENSG00000151835	HGNC:10519													
SACS	gene	SACS	Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic ataxia, Charlevoix-Saguenay type, MIM#	270550"				22307627;20876471		False	3	100;0;0	21.664	True		ENSG00000151835	ENSG00000151835	HGNC:10519													
SACS	gene	SACS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic ataxia, Charlevoix-Saguenay type, MIM@	270550"						False	3	100;0;0	21.664	True		ENSG00000151835	ENSG00000151835	HGNC:10519													
SACS	gene	SACS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia, Charlevoix-Saguenay type MIM#270550						False	3	100;0;0	21.664	True		ENSG00000151835	ENSG00000151835	HGNC:10519													
SAMD12	gene	SAMD12	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Epilepsy, familial adult myoclonic, 1, MIM# 601068				30194086;29507423		False	3	100;0;0	21.664	True	Other	ENSG00000177570	ENSG00000177570	HGNC:31750													
SAMD9L	gene	SAMD9L	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550				35310830;33884299;28570036		False	3	100;0;0	21.664	False		ENSG00000177409	ENSG00000177409	HGNC:1349													
SAMHD1	gene	SAMHD1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi Goutieres syndrome 5, MIM# 612952						False	3	100;0;0	21.664	True		ENSG00000101347	ENSG00000101347	HGNC:15925													
SAMHD1	gene	SAMHD1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 5, MIM# 612952				19525956;21102625;33307271;20301648		False	3	100;0;0	21.664	True		ENSG00000101347	ENSG00000101347	HGNC:15925													
SAMHD1	gene	SAMHD1	Genomics England PanelApp;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Moyamoya disease				20653736;21402907		False	3	100;0;0	21.664	False		ENSG00000101347	ENSG00000101347	HGNC:15925													
SAMHD1	gene	SAMHD1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 5, MIM# 612952				19525956;21102625;33307271		False	3	100;0;0	21.664	True		ENSG00000101347	ENSG00000101347	HGNC:15925													
SAMHD1	gene	SAMHD1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 5, MIM#	612952"				19525956		False	3	100;0;0	21.664	True		ENSG00000101347	ENSG00000101347	HGNC:15925													
SAR1B	gene	SAR1B	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Chylomicron retention disease, MIM#	246700"				12692552		False	3	100;0;0	21.664	True		ENSG00000152700	ENSG00000152700	HGNC:10535													
SARS1	gene	SARS1	Literature;Expert Review Green;Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Genetic peripheral neuropathy MONDO#0020127, SARS1-related				36088542		False	3	100;0;0	21.664	False		ENSG00000031698	ENSG00000031698	HGNC:10537													
SARS2	gene	SARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis, MIM#613845				33751860;24034276;21255763		False	3	100;0;0	21.664	True		ENSG00000104835	ENSG00000104835	HGNC:17697													
SART3	gene	SART3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO#0700092), SART3-related;46,XY disorder of sex development (MONDO:0020040), SART3-related				PMID: 37296101		False	3	100;0;0	21.664	True		ENSG00000075856	ENSG00000075856	HGNC:16860													
SATB1	gene	SATB1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Kohlschutter-Tonz syndrome-like, MIM# 619229;Neurodevelopmental disorder;Intellectual disability;Epilepsy;Microcephaly;Regression				PMID: 33513338;33057194		False	3	67;33;0	21.664	True	Other	ENSG00000182568	ENSG00000182568	HGNC:10541													
SATB2	gene	SATB2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Glass syndrome, MIM# 612313;MONDO:0100147				32446642		False	3	100;0;0	21.664	True		ENSG00000119042	ENSG00000119042	HGNC:21637													
SBF1	gene	SBF1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4B3 , MIM#615284;MONDO:0014117				23749797;23749797;32444983;30039846;28005197		False	3	100;0;0	21.664	True		ENSG00000100241	ENSG00000100241	HGNC:10542													
SBF2	gene	SBF2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMSN;Charcot Marie Tooth disease, type 4B2, MIM#604563				12554688;15477569;12687498;15304601;31772832;31070812		False	3	100;0;0	21.664	False		ENSG00000133812	ENSG00000133812	HGNC:2135													
SC5D	gene	SC5D	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lathosterolosis, MIM#	607330"				17853487;12189593;12812989;24142275		False	3	100;0;0	21.664	True		ENSG00000109929	ENSG00000109929	HGNC:10547													
SCAF4	gene	SCAF4	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Fliedner-Zweier syndrome, MIM#620511				32730804		False	3	100;0;0	21.664	True		ENSG00000156304	ENSG00000156304	HGNC:19304													
SCAMP5	gene	SCAMP5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SCAMP5-related				31439720;33390987		False	3	100;0;0	21.664	True	Other	ENSG00000198794	ENSG00000198794	HGNC:30386													
SCARB2	gene	SCARB2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive Myoclonus Epilepsy, MONDO:0020074;Epilepsy, progressive myoclonic 4, with or without renal failure, MIM #254900				18308289;18424452;23659519;19847901;18022370;19933215		False	3	100;0;0	21.664	True		ENSG00000138760	ENSG00000138760	HGNC:1665													
SCARB2	gene	SCARB2	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	action myoclonus-renal failure syndrome MONDO:0009699;Other disorders of complex molecule degradation				26677510;29884839		False	3	0;0;0	21.664	False		ENSG00000138760	ENSG00000138760	HGNC:1665													
SCN10A	gene	SCN10A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	HSAN/SFN;Episodic pain syndrome, familial, 2, 615551				23115331;33775738;30731422;30554136		False	3	100;0;0	21.664	False		ENSG00000185313	ENSG00000185313	HGNC:10582													
SCN10A	gene	SCN10A	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Small fibre neuropathy;Episodic pain syndrome, familial, 2, MIM# 615551				33775738;30731422;30554136;23115331;26711856;24776970;25316021;25250524;24006052;28665811;27598514;24813307		False	3	100;0;0	21.664	True		ENSG00000185313	ENSG00000185313	HGNC:10582													
SCN11A	gene	SCN11A	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic pain syndrome, familial, 3, MIM# 615552				30554136;28298626;24776970;25316021;24207120;27503742;24036948;28665811;24813307;26645915		False	3	100;0;0	21.664	True	Other	ENSG00000168356	ENSG00000168356	HGNC:10583													
SCN11A	gene	SCN11A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuropathy, hereditary sensory and autonomic, type VII, MIM# 615548;MONDO:0014244				24036948;25118027;30395542;33884296;32831372;30046661		False	3	100;0;0	21.664	False		ENSG00000168356	ENSG00000168356	HGNC:10583													
SCN1A	gene	SCN1A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dravet syndrome, MIM# 607208;Epilepsy, Paekinsonism				PMID: 28186331;24850485		False	3	100;0;0	21.664	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN1A	gene	SCN1A	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dravet syndrome 607208;Epilepsy, generalized, with febrile seizures plus, type 2 604403;Febrile seizures, familial, 3A 604403;Migraine, familial hemiplegic, 3 609634						False	3	100;0;0	21.664	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN1A	gene	SCN1A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 6 (Dravet syndrome), MIM# 607208				27264139;27817982;28732259		False	3	67;33;0	21.664	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN1A	gene	SCN1A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epilepsy, generalized, with febrile seizures plus, type 2 604403;Epileptic encephalopathy, early infantile, 6 (Dravet syndrome) 607208;Developmental and epileptic encephalopathy 6B, non-Dravet, MIM# 619317;Febrile seizures, familial, 3A 604403				30368457;12754708;25754450;32928894		False	3	67;33;0	21.664	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN1B	gene	SCN1B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy (MONDO:0100062);generalized epilepsy with febrile seizures plus (MONDO:0018214)				19710327;28218389;23148524		False	3	100;0;0	21.664	True		ENSG00000105711	ENSG00000105711	HGNC:10586													
SCN2A	gene	SCN2A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Early infantile epileptic encephalopathy 11, MIM# 613721						False	3	100;0;0	21.664	True		ENSG00000136531	ENSG00000136531	HGNC:10588													
SCN2A	gene	SCN2A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Seizures, benign familial infantile, 3, MIM# 607745;Developmental and epileptic encephalopathy 11, MIM# 613721				19786696;23662938;15028761;30185235;20956790;24650168;23935176;22495306		False	3	100;0;0	21.664	True		ENSG00000136531	ENSG00000136531	HGNC:10588													
SCN3A	gene	SCN3A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial focal, with variable foci 4, MIM# 617935;Epileptic encephalopathy, early infantile, 62, MIM# 617938;Intellectual disability;Malformations of cortical development				32515017		False	3	100;0;0	21.664	True	Other	ENSG00000153253	ENSG00000153253	HGNC:10590													
SCN4A	gene	SCN4A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Paramyotonia congenita, 168300;Myotonia congenita, atypical, acetazolamide-responsive, 608390;Hypokalemic periodic paralysis, type 2, 613345;Myasthenic syndrome, congenital, 16, 614198;Hyperkalemic periodic paralysis, type 2, 170500				23801527;28779239;32978841		False	3	100;0;0	21.664	True		ENSG00000007314	ENSG00000007314	HGNC:10591													
SCN8A	gene	SCN8A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy 13, 614558;Cognitive impairment with or without cerebellar ataxia, 614306				31904124;31887642;31675620		False	3	100;0;0	21.664	True		ENSG00000196876	ENSG00000196876	HGNC:10596													
SCN8A	gene	SCN8A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 13, MIM# 614558;dominant and recessive				31625145;30842224;24888894		False	3	67;33;0	21.664	True	Other	ENSG00000196876	ENSG00000196876	HGNC:10596													
SCN8A	gene	SCN8A	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myoclonus, familial, 2, MIM# 618364;epilepsy;paroxysmal kinesigenic dyskinesias				29726066;27098556		False	3	100;0;0	21.664	True		ENSG00000196876	ENSG00000196876	HGNC:10596													
SCN9A	gene	SCN9A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Erythermalgia, primary, MIM# 133020;Insensitivity to pain, congenital, MIM# 243000;Neuropathy, hereditary sensory and autonomic, type IID, MIM# 243000;Paroxysmal extreme pain disorder, MIM# 167400;Small fiber neuropathy,MIM# 133020						False	3	100;0;0	21.664	False		ENSG00000169432	ENSG00000169432	HGNC:10597													
SCN9A	gene	SCN9A	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	HSAN2D, autosomal recessive, AR, 243000;Erythermalgia, primary, AD, 133020;Small fiber neuropathy, AD,133020;Insensitivity to pain, congenital, AR, 243000;Paroxysmal extreme pain disorder, AD, 167400				16392115;17167479;17470132;17145499;17679678;25316021;15958509;28665811;23596073;24817410;28235406;16216943;24813307;14985375;1536168		False	3	0;0;0	21.664	False		ENSG00000169432	ENSG00000169432	HGNC:10597													
SCO1	gene	SCO1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency 220110						False	3	0;0;0	21.664	False		ENSG00000133028	ENSG00000133028	HGNC:10603													
SCO1	gene	SCO1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 4, MIM# 619048				11013136;19295170;31352446;23878101		False	3	100;0;0	21.664	True		ENSG00000133028	ENSG00000133028	HGNC:10603													
SCO2	gene	SCO2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377				10545952;11673586;18924171;20159436;29351582;26427993;31844624		False	3	67;33;0	21.664	True		-	ENSG00000284194	HGNC:10604													
SCO2	gene	SCO2	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1 604377						False	3	0;0;0	21.664	False		-	ENSG00000284194	HGNC:10604													
SCO2	gene	SCO2	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377						False	3	67;33;0	21.664	True		-	ENSG00000284194	HGNC:10604													
SCO2	gene	SCO2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive axonal charcot-marie-tooth disease due to copper metabolism defect MONDO:0033850				29351582;31844624;35112411		False	3	100;0;0	21.664	False		-	ENSG00000284194	HGNC:10604													
SCO2	gene	SCO2	Expert Review Green;Other;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1 MONDO:0011451				23719228		False	3	100;0;0	21.664	True		-	ENSG00000284194	HGNC:10604													
SCYL1	gene	SCYL1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 21 (MIM#616719);acute infantile liver failure-cerebellar ataxia-peripheral sensory motor neuropathy syndrome (MONDO:0014744);Spinocerebellar ataxia, autosomal recessive 21;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy				26581903;30531813		False	3	100;0;0	21.664	True		ENSG00000142186	ENSG00000142186	HGNC:14372													
SCYL1	gene	SCYL1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 21, 616719;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy				29419818;17571074;26581903;30531813		False	3	100;0;0	21.664	True		ENSG00000142186	ENSG00000142186	HGNC:14372													
SCYL2	gene	SCYL2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Arthrogryposis multiplex congenita 4, neurogenic, with agenesis of the corpus callosum, MIM# 618766				31960134;26203146;40243816;39169672		False	3	100;0;0	21.664	True		ENSG00000136021	ENSG00000136021	HGNC:19286													
SDHA	gene	SDHA	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial respiratory chain complex II deficiency, MIM#252011						False	3	100;0;0	21.664	False		ENSG00000073578	ENSG00000073578	HGNC:10680													
SDHA	gene	SDHA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial complex II deficiency, nuclear type 1, MIM# 252011;Cardiomyopathy, dilated, 1GG, MIM# 613642;Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259				10976639;27683074;7550341;22972948;20551992;21752896		False	3	100;0;0	21.664	True		ENSG00000073578	ENSG00000073578	HGNC:10680													
SDHAF1	gene	SDHAF1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex II deficiency 252011						False	3	0;0;0	21.664	False		ENSG00000205138	ENSG00000205138	HGNC:33867													
SDHAF1	gene	SDHAF1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex II deficiency, nuclear type 2, MIM# 619166				19465911;26749241;22995659		False	3	100;0;0	21.664	True		ENSG00000205138	ENSG00000205138	HGNC:33867													
SDHB	gene	SDHB	Expert Review Green;Royal Melbourne Hospital;Australian Genomcis Health Alliance Leukodystrophy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinate dehydrogenase-deficient leukoencephalopathy;Mitochondrial complex II deficiency, nuclear type 4, MIM# 619224;Complex II deficiency;mitochondrial leucoencephalopathy				22972948;26925370;27604842		False	3	100;0;0	21.664	True		ENSG00000117118	ENSG00000117118	HGNC:10681													
SDHB	gene	SDHB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex II deficiency, nuclear type 4, MIM# 619224;Complex II deficiency;mitochondrial leucoencephalopathy				22972948;26925370;27604842		False	3	100;0;0	21.664	True		ENSG00000117118	ENSG00000117118	HGNC:10681													
SDHD	gene	SDHD	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex II deficiency, nuclear type 3, MIM# 619167				24367056;26008905		False	3	100;0;0	21.664	True		ENSG00000204370	ENSG00000204370	HGNC:10683													
SEC23B	gene	SEC23B	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dyserythropoietic anemia, congenital, type II 224100;COPII component SEC23B (Disorders of multiple glycosylation and other glycosylation pathways, V-ATPase deficiencies)				19561605;19621418		False	3	100;0;0	21.664	True		ENSG00000101310	ENSG00000101310	HGNC:10702													
SEC31A	gene	SEC31A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with spastic quadriplegia, optic atrophy, seizures, and structural brain anomalies, MIM#	618651;congenital neurodevelopmental syndrome;spastic paraplegia;multiple contractures;profound developmental delay;epilepsy;failure to thrive"				30464055;40508110;39725565		False	3	100;0;0	21.664	True		ENSG00000138674	ENSG00000138674	HGNC:17052													
SEC31A	gene	SEC31A	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Halperin-Birk syndrome, MIM# 	618651"				30464055;40508110		False	3	100;0;0	21.664	True		ENSG00000138674	ENSG00000138674	HGNC:17052													
SECISBP2	gene	SECISBP2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thyroid hormone metabolism, abnormal, 1, MIM# 609698				39315526		False	3	100;0;0	21.664	True		ENSG00000187742	ENSG00000187742	HGNC:30972													
SECISBP2	gene	SECISBP2	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	thyroid hormone metabolism, abnormal 1 MONDO:0800046;Other disorders of trace element metabolism				16228000, 19602558, 21084748, 22247018		False	3	0;0;0	21.664	False		ENSG00000187742	ENSG00000187742	HGNC:30972													
SELENOI	gene	SELENOI	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 81, autosomal recessive, MIM# 618768				28052917;39806532;29500230;33454747		False	3	100;0;0	21.664	True		ENSG00000138018	ENSG00000138018	HGNC:29361													
SELENOI	gene	SELENOI	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 81, autosomal recessive 618768				28052917;29500230;39806532;33454747		False	3	100;0;0	21.664	True		ENSG00000138018	ENSG00000138018	HGNC:29361													
SEMA6B	gene	SEMA6B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive myoclonic epilepsy				32169168		False	3	100;0;0	21.664	True	Other	ENSG00000167680	ENSG00000167680	HGNC:10739													
SEPSECS	gene	SEPSECS	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	pontocerebellar hypoplasia type 2D MONDO:0013438;Other disorders of trace element metabolism				20920667, 25044680, 31748115, 29464431		False	3	0;0;0	21.664	False		ENSG00000109618	ENSG00000109618	HGNC:30605													
SEPSECS	gene	SEPSECS	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2D, MIM# 613811				20920667;25044680;31748115;29464431		False	3	50;0;50	21.664	True		ENSG00000109618	ENSG00000109618	HGNC:30605													
SEPTIN9	gene	SEPTIN9	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophy, hereditary neuralgic, 162100;Hereditary neuralgic amyotrophy				21556032;16186812;19451530		False	3	100;0;0	21.664	True		ENSG00000184640	ENSG00000184640	HGNC:7323													
SEPTIN9	gene	SEPTIN9	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophy, hereditary neuralgic, MIM# 162100;HMSN				16186812;19451530;19939853;19139049		False	3	100;0;0	21.664	False		ENSG00000184640	ENSG00000184640	HGNC:7323													
SERAC1	gene	SERAC1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739						False	3	100;0;0	21.664	True		ENSG00000122335	ENSG00000122335	HGNC:21061													
SERAC1	gene	SERAC1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome	MIM#614739"				PMID: 27186703;24997715		False	3	0;100;0	21.664	True		ENSG00000122335	ENSG00000122335	HGNC:21061													
SERAC1	gene	SERAC1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739;Parkinsonism				PMID: 29332177;16527507		False	3	100;0;0	21.664	True		ENSG00000122335	ENSG00000122335	HGNC:21061													
SERAC1	gene	SERAC1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-MEthylGlutaconic aciduria, Dystonia-Deafness, Hepatopathy, Encephalopathy, Leigh-like syndrome;3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, 614739;Lesions in the basal ganglia						False	3	0;0;0	21.664	False		ENSG00000122335	ENSG00000122335	HGNC:21061													
SERAC1	gene	SERAC1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739				29205472;32684373;24741715		False	3	100;0;0	21.664	True		ENSG00000122335	ENSG00000122335	HGNC:21061													
SERPINI1	gene	SERPINI1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Encephalopathy, familial, with neuroserpin inclusion bodies MIM#604218				28631894;25401298;12103288		False	3	100;0;0	21.664	True		ENSG00000163536	ENSG00000163536	HGNC:8943													
SETBP1	gene	SETBP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Schinzel-Giedion midface retraction syndrome, MIM# 269150;Intellectual disability, autosomal dominant 29, MIM# 616078				20436468;25217958;34807554		False	3	100;0;0	21.664	True		ENSG00000152217	ENSG00000152217	HGNC:15573													
SETD1A	gene	SETD1A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, early-onset, with or without developmental delay, MIM# 618832;Neurodevelopmental disorder with speech impairment and dysmorphic facies, MIM# 619056				31197650;32346159		False	3	100;0;0	21.664	True		ENSG00000099381	ENSG00000099381	HGNC:29010													
SETD1B	gene	SETD1B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy with myoclonic absences;intellectual disability;Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000				29322246;31440728;31685013		False	3	100;0;0	21.664	True		ENSG00000139718	ENSG00000139718	HGNC:29187													
SETD5	gene	SETD5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability, autosomal dominant 23 (MIM # 615761)				29484850		False	3	0;0;0	21.664	True		ENSG00000168137	ENSG00000168137	HGNC:25566													
SETX	gene	SETX	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2, MIM#	606002"				19696032		False	3	100;0;0	21.664	True		ENSG00000107290	ENSG00000107290	HGNC:445													
SETX	gene	SETX	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	dHMN/dSMA;Amyotrophic lateral sclerosis 4, juvenile MIM# 602433;Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2				23129421;16644229;30052327		False	3	100;0;0	21.664	True		ENSG00000107290	ENSG00000107290	HGNC:445													
SETX	gene	SETX	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic Lateral Sclerosis 4, juvenile (MIM#602433)				15106121;9497266		False	3	100;0;0	21.664	True		ENSG00000107290	ENSG00000107290	HGNC:445													
SETX	gene	SETX	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002						False	3	100;0;0	21.664	True		ENSG00000107290	ENSG00000107290	HGNC:445													
SFXN4	gene	SFXN4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 18, MIM#615578				24119684;31059822		False	3	100;0;0	21.664	True		ENSG00000183605	ENSG00000183605	HGNC:16088													
SGCA	gene	SGCA	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, autosomal recessive 3 MIM#608099				27297959;26453141;23989969		False	3	100;0;0	21.664	True		ENSG00000108823	ENSG00000108823	HGNC:10805													
SGCA	gene	SGCA	Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Limb-girdle muscular dystrophy;Muscular dystrophy, limb-girdle, type 2D, 608099;autosomal recessive limb-girdle muscular dystrophy, MONDO:0015152				30007747;9192266;34404573		False	3	100;0;0	21.664	True		ENSG00000108823	ENSG00000108823	HGNC:10805													
SGCB	gene	SGCB	Expert Review;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, type 2E, 604286						False	3	100;0;0	21.664	False		ENSG00000163069	ENSG00000163069	HGNC:10806													
SGCD	gene	SGCD	Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, type 2F, 601287						False	3	67;0;33	21.664	False		ENSG00000170624	ENSG00000170624	HGNC:10807													
SGCE	gene	SGCE	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	Dystonia-11, myoclonic, MIM# 159900				15389977;12821748;24297365		False	3	100;0;0	21.664	True		ENSG00000127990	ENSG00000127990	HGNC:10808													
SGCE	gene	SGCE	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	Dystonia-11, myoclonic, MIM# 159900;MONDO:0008044				11528394;12821748;16227522		False	3	100;0;0	21.664	False		ENSG00000127990	ENSG00000127990	HGNC:10808													
SGCG	gene	SGCG	Expert Review Green;Expert Review;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, type 2C, 253700				30838351;25802879		False	3	100;0;0	21.664	True		ENSG00000102683	ENSG00000102683	HGNC:10809													
SGSH	gene	SGSH	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIIA (Sanfilippo A), MIM# 252900;MONDO:0009655				7493035;9158154;9401012;9554748		False	3	100;0;0	21.664	True		ENSG00000181523	ENSG00000181523	HGNC:10818													
SGSH	gene	SGSH	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIIA (Sanfilippo A), 252900				21061399;30593151		False	3	100;0;0	21.664	True		ENSG00000181523	ENSG00000181523	HGNC:10818													
SH3TC2	gene	SH3TC2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	HMSN;Charcot Marie Tooth disease, type 4C, 601596;Mononeuropathy of the median nerve, mild, 613353				19744956;20220177;19744956;20028792		False	3	100;0;0	21.664	False		ENSG00000169247	ENSG00000169247	HGNC:29427													
SHANK3	gene	SHANK3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Phelan-McDermid syndrome MIM#606232				PMID: 37655421		False	3	100;0;0	21.664	True		ENSG00000251322	ENSG00000251322	HGNC:14294													
SHH	gene	SHH	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Other	Hypothalamic hamartoma						False	3	100;0;0	21.664	True		ENSG00000164690	ENSG00000164690	HGNC:10848													
SHMT2	gene	SHMT2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121;Congenital microcephaly;Infantile axial hypotonia;Spastic paraparesis;Global developmental delay;Intellectual disability;Abnormality of the corpus callosum;Abnormal cortical gyration;Hypertrophic cardiomyopathy;Abnormality of the face;Proximal placement of thumb;2-3 toe syndactyly				33015733		False	3	100;0;0	21.664	True		ENSG00000182199	ENSG00000182199	HGNC:10852													
SHMT2	gene	SHMT2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121;Congenital microcephaly;Infantile axial hypotonia;Spastic paraparesis;Global developmental delay;Intellectual disability;Abnormality of the corpus callosum;Abnormal cortical gyration;Hypertrophic cardiomyopathy;Abnormality of the face;Proximal placement of thumb;2-3 toe syndactyly				33015733		False	3	100;0;0	21.664	True		ENSG00000182199	ENSG00000182199	HGNC:10852													
SHQ1	gene	SHQ1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 35, childhood-onset , MIM# 619921;Neurodevelopmental disorder with dystonia and seizures, MIM# 619922				34542157;29178645;36847845;37475611		False	3	100;0;0	21.664	True		ENSG00000144736	ENSG00000144736	HGNC:25543													
SHROOM4	gene	SHROOM4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	epilepsy, idiopathic generalised, SHROOM4-related, MONDO:0005579				35663265		False	3	100;0;0	21.664	True		ENSG00000158352	ENSG00000158352	HGNC:29215													
SI	gene	SI	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Sucrase-isomaltase deficiency, congenital, MIM#	222900"						False	3	100;0;0	21.664	True		ENSG00000090402	ENSG00000090402	HGNC:10856													
SIGMAR1	gene	SIGMAR1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Distal spinal muscular atrophy, autosomal recessive 2;dHMN/dSMA;Distal hereditary motor neuropathy of Jerash type (HMNJ)				31511340		False	3	100;0;0	21.664	False		ENSG00000147955	ENSG00000147955	HGNC:8157													
SIGMAR1	gene	SIGMAR1	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	67;33;0	21.664	False		ENSG00000147955	ENSG00000147955	HGNC:8157													
SIK1	gene	SIK1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 30, MIM#616341;developmental and epileptic encephalopathy, MONDO#0100062				25839329;27966542;35267137		False	3	100;0;0	21.664	True		ENSG00000142178	ENSG00000142178	HGNC:11142													
SIL1	gene	SIL1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Marinesco-Sjogren syndrome, 248800						False	3	100;0;0	21.664	False		ENSG00000120725	ENSG00000120725	HGNC:24624													
SIL1	gene	SIL1	Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Marinesco-Sjogren syndrome 248800						False	3	100;0;0	21.664	False		ENSG00000120725	ENSG00000120725	HGNC:24624													
SKOR2	gene	SKOR2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Valence-Farazi cerebellar ataxia syndrome, MIM# 621386				40890458;29997391;21937600		False	3	100;0;0	21.664	True		ENSG00000215474	ENSG00000215474	HGNC:32695													
SLC10A1	gene	SLC10A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Familial hypercholanemia-2, MIM#619256				24867799;27882152;28835676;29290974;31201272		False	3	100;0;0	21.664	True		ENSG00000100652	ENSG00000100652	HGNC:10905													
SLC10A7	gene	SLC10A7	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Short stature, amelogenesis imperfecta, and skeletal dysplasia with scoliosis, MIM# 618363				30082715;29878199;31191616		False	3	100;0;0	21.664	True		ENSG00000120519	ENSG00000120519	HGNC:23088													
SLC11A2	gene	SLC11A2	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	AHMIO1;206100 Anemia, hypochromic microcytic, with iron overload 1;AHMIO1 DMT1-related anemia;206100 ANEMIA, HYPOCHROMIC MICROCYTIC, WITH IRON OVERLOAD 1;DMT1-related anemia				16439678;15459009;16160008		False	3	100;0;0	21.664	False		ENSG00000110911	ENSG00000110911	HGNC:10908													
SLC12A3	gene	SLC12A3	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of magnesium metabolism;Gitelman syndrome MONDO:0009904				34604137, 35170241		False	3	0;0;0	21.664	False		ENSG00000070915	ENSG00000070915	HGNC:10912													
SLC12A5	gene	SLC12A5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 34, MIM# 616645;{Epilepsy, idiopathic generalized, susceptibility to, 14}, MIM# 616685				26333769;27436767;24928908;30763027;24668262		False	3	50;50;0	21.664	True		ENSG00000124140	ENSG00000124140	HGNC:13818													
SLC12A6	gene	SLC12A6	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Andermann syndrome;Hereditary Motor and Sensory Neuropathy with Agenesis of the Corpus Callosum;Charcot-Marie-Tooth disease, axonal, type 2II , MIM#620068				31439721		False	3	100;0;0	21.664	True		ENSG00000140199	ENSG00000140199	HGNC:10914													
SLC13A3	gene	SLC13A3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384)				30635937;35527102;https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID)		False	3	100;0;0	21.664	True		ENSG00000158296	ENSG00000158296	HGNC:14430													
SLC13A3	gene	SLC13A3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384)				https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID)		False	3	100;0;0	21.664	True		ENSG00000158296	ENSG00000158296	HGNC:14430													
SLC13A3	gene	SLC13A3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384)				30635937;35527102;https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID)		False	3	100;0;0	21.664	True		ENSG00000158296	ENSG00000158296	HGNC:14430													
SLC13A5	gene	SLC13A5	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 25, with amelogenesis imperfecta MIM#615905;MONDO:0014392				24995870;26384929		False	3	100;0;0	21.664	True		ENSG00000141485	ENSG00000141485	HGNC:23089													
SLC16A1	gene	SLC16A1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Monocarboxylate transporter 1 deficiency, MIM#	616095"				25390740		False	3	100;0;0	21.664	True		ENSG00000155380	ENSG00000155380	HGNC:10922													
SLC16A2	gene	SLC16A2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Allan-Herndon-Dudley syndrome, MIM# 300523				15980113;31410843;20301789		False	3	100;0;0	21.664	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC16A2	gene	SLC16A2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Allan-Herndon-Dudley syndrome, 300523, XL				15980113;31410843;20301789		False	3	100;0;0	21.664	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC16A2	gene	SLC16A2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Allan-Herndon-Dudley syndrome, MIM# 300523;Hypomyelination				15980113;31410843;20301789		False	3	100;0;0	21.664	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC16A2	gene	SLC16A2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Allan-Herndon-Dudley syndrome, MIM# 300523				15980113;31410843;20301789		False	3	100;0;0	21.664	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC16A2	gene	SLC16A2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Allan-Herndon-Dudley syndrome, MONDO:0010354				41144879;40088079		False	3	100;0;0	21.664	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC17A5	gene	SLC17A5	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Salla disease	604369;Sialic acid storage disorder, infantile	269920"				16417876		False	3	100;0;0	21.664	True		ENSG00000119899	ENSG00000119899	HGNC:10933													
SLC17A5	gene	SLC17A5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Salla disease 604369;MONDO:0011449;Sialic acid storage disorder, infantile 269920;MONDO:0010027				10581036;10947946		False	3	100;0;0	21.664	True		ENSG00000119899	ENSG00000119899	HGNC:10933													
SLC17A5	gene	SLC17A5	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Salla disease;Sialic acid storage disease, severe infantile type, MIM# 269920				26171070		False	3	100;0;0	21.664	True		ENSG00000119899	ENSG00000119899	HGNC:10933													
SLC18A2	gene	SLC18A2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia, infantile, 2 , MIM# 618049;Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism				33983693;23363473;31240161;26497564		False	3	100;0;0	21.664	True		ENSG00000165646	ENSG00000165646	HGNC:10935													
SLC18A2	gene	SLC18A2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Parkinsonism-dystonia, infantile, 2, MIM#	618049"				23363473;31240161;26497564;9427250;11463816;9427251		False	3	100;0;0	21.664	True		ENSG00000165646	ENSG00000165646	HGNC:10935													
SLC18A2	gene	SLC18A2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Parkinsonism-dystonia, infantile, 2, MIM#	618049"				23363473;31240161;26497564		False	3	100;0;0	21.664	True		ENSG00000165646	ENSG00000165646	HGNC:10935													
SLC19A2	gene	SLC19A2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine-responsive megaloblastic anaemia syndrome, MIM# 249270				10391221;10978358		False	3	100;0;0	21.664	True		ENSG00000117479	ENSG00000117479	HGNC:10938													
SLC19A3	gene	SLC19A3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2) MIM#607483				PMID: 37670342;23269594;26863430		False	3	100;0;0	21.664	True		ENSG00000135917	ENSG00000135917	HGNC:16266													
SLC19A3	gene	SLC19A3	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2) 607483;Dystonia						False	3	0;0;0	21.664	False		ENSG00000135917	ENSG00000135917	HGNC:16266													
SLC19A3	gene	SLC19A3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483				15871139;20065143;23482991;24878502;23589815;24166474;26975589;27896110		False	3	100;0;0	21.664	True		ENSG00000135917	ENSG00000135917	HGNC:16266													
SLC19A3	gene	SLC19A3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483;Childhood onset Dystonia and Parkinsonism				PMID: 24260777		False	3	100;0;0	21.664	True		ENSG00000135917	ENSG00000135917	HGNC:16266													
SLC1A2	gene	SLC1A2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 41, MIM# 617105				27476654;28777935;30937933;23934111		False	3	100;0;0	21.664	True	Other	ENSG00000110436	ENSG00000110436	HGNC:10940													
SLC1A3	gene	SLC1A3	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Episodic ataxia, type 6;Episodic ataxia type 6, 612656						False	3	100;0;0	21.664	False		ENSG00000079215	ENSG00000079215	HGNC:10941													
SLC1A3	gene	SLC1A3	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 6, MIM# 612656				19139306;16116111;29208948;27829685;32741053		False	3	100;0;0	21.664	True		ENSG00000079215	ENSG00000079215	HGNC:10941													
SLC1A3	gene	SLC1A3	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 6 MIM#612656				16116111;23107647;19139306;29741614;25497598;29208948;29062094		False	3	100;0;0	21.664	True		ENSG00000079215	ENSG00000079215	HGNC:10941													
SLC1A4	gene	SLC1A4	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM#	616657;MONDO:0014725"				29989513;27193218;26138499;26041762;25930971		False	3	100;0;0	21.664	True		ENSG00000115902	ENSG00000115902	HGNC:10942													
SLC1A4	gene	SLC1A4	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, 616657;MONDO:0014725				25930971;26138499;26041762;27193218;29989513		False	3	100;0;0	21.664	True		ENSG00000115902	ENSG00000115902	HGNC:10942													
SLC20A2	gene	SLC20A2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 1, MIM# 213600				22327515;23334463;28162874;31267306;35850697;34025715		False	3	100;0;0	21.664	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC20A2	gene	SLC20A2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 1, MIM# 213600				22327515;23334463		False	3	100;0;0	21.664	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC20A2	gene	SLC20A2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 1 213600;Dystonia				22327515;23334463;24411498		False	3	100;0;0	21.664	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC22A5	gene	SLC22A5	Expert Review Green;Literature;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carnitine deficiency, systemic primary MIM#212140				9916797;25778941;17884651		False	3	100;0;0	21.664	True		ENSG00000197375	ENSG00000197375	HGNC:10969													
SLC22A5	gene	SLC22A5	Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carnitine deficiency, systemic primary 212140				9916797;10072434;10051646;10425211;10480371;10679939;9837751;23379544;31399326		False	3	100;0;0	21.664	True		ENSG00000197375	ENSG00000197375	HGNC:10969													
SLC22A5	gene	SLC22A5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carnitine deficiency, systemic primary, MIM# 212140						False	3	100;0;0	21.664	True		ENSG00000197375	ENSG00000197375	HGNC:10969													
SLC25A1	gene	SLC25A1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072				26870663;31527857;31808147;23561848;23393310		False	3	100;0;0	21.664	True		ENSG00000100075	ENSG00000100075	HGNC:10979													
SLC25A1	gene	SLC25A1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072;Myasthenic syndrome, congenital, 23, presynaptic, MIM#618197, MONDO:0032596				26870663;31527857;31808147;23561848;23393310		False	3	100;0;0	21.664	True		ENSG00000100075	ENSG00000100075	HGNC:10979													
SLC25A12	gene	SLC25A12	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 39, MIM# 612949				19641205;24515575;35008954;32700846;31766059;31514314		False	3	100;0;0	21.664	True		ENSG00000115840	ENSG00000115840	HGNC:10982													
SLC25A12	gene	SLC25A12	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelination, global cerebral 612949						False	3	0;0;0	21.664	False		ENSG00000115840	ENSG00000115840	HGNC:10982													
SLC25A12	gene	SLC25A12	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 39, MIM# 612949				19641205;24515575;35008954;32700846;31766059;31514314		False	3	100;0;0	21.664	True		ENSG00000115840	ENSG00000115840	HGNC:10982													
SLC25A15	gene	SLC25A15	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome MIM#238970				16376511;22465082;28592010		False	3	100;0;0	21.664	False		ENSG00000102743	ENSG00000102743	HGNC:10985													
SLC25A19	gene	SLC25A19	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive demyelinating neuropathy with bilateral striatal necrosis MONDO:0013382				20301539		False	3	100;0;0	21.664	True		ENSG00000125454	ENSG00000125454	HGNC:14409													
SLC25A19	gene	SLC25A19	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, Amish type, MIM#607196;Thiamine metabolism dysfunction syndrome 4 (progressive polyneuropathy type), MIM#613710				31506564;31295743;12185364;19798730		False	3	100;0;0	21.664	True		ENSG00000125454	ENSG00000125454	HGNC:14409													
SLC25A20	gene	SLC25A20	Expert Review Green;Expert Review Green;NHS GMS;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carnitine-acylcarnitine translocase deficiency MIM#212138				9399886;31108048;25778941		False	3	100;0;0	21.664	True		ENSG00000178537	ENSG00000178537	HGNC:1421													
SLC25A20	gene	SLC25A20	Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carnitine-acylcarnitine translocase deficiency MIM#212138				24088670		False	3	100;0;0	21.664	True		ENSG00000178537	ENSG00000178537	HGNC:1421													
SLC25A20	gene	SLC25A20	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Carnitine-acylcarnitine translocase deficiency, MIM# 212138				15363639;15365988;24088670		False	3	100;0;0	21.664	True		ENSG00000178537	ENSG00000178537	HGNC:1421													
SLC25A22	gene	SLC25A22	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 3, MIM# 609304				15592994;19780765;24596948;33821742;33342683;31285529		False	3	100;0;0	21.664	True		ENSG00000177542	ENSG00000177542	HGNC:19954													
SLC25A24	gene	SLC25A24	Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Fontaine progeroid syndrome	MIM#612289"				29100094;29100093		False	3	100;0;0	21.664	True		ENSG00000085491	ENSG00000085491	HGNC:20662													
SLC25A26	gene	SLC25A26	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 28, MIM# 616794				26522469		False	3	100;0;0	21.664	True		ENSG00000144741	ENSG00000144741	HGNC:20661													
SLC25A3	gene	SLC25A3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial phosphate carrier deficiency, MIM# 610773				17273968;21763135;25681081		False	3	100;0;0	21.664	True		ENSG00000075415	ENSG00000075415	HGNC:10989													
SLC25A32	gene	SLC25A32	Expert Review Green;Literature;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Exercise intolerance, riboflavin-responsive MONDO:0014795				26933868;35727412;34764427;28443623		False	3	100;0;0	21.664	True		ENSG00000164933	ENSG00000164933	HGNC:29683													
SLC25A32	gene	SLC25A32	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Exercise intolerance, riboflavin-responsive, MIM# 616839				26933868;28443623		False	3	100;0;0	21.664	True		ENSG00000164933	ENSG00000164933	HGNC:29683													
SLC25A36	gene	SLC25A36	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperinsulinemic hypoglycemia, familial, 8 - MIM#620211				34971397;34576089;31036718		False	3	100;0;0	21.664	True		ENSG00000114120	ENSG00000114120	HGNC:25554													
SLC25A38	gene	SLC25A38	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	205950 Anemia, sideroblastic, 2, pyridoxine-refractory;Sideroblastic anaemia - increased serum ferritin				21393332;19412178;24323989		False	3	0;0;0	21.664	False		ENSG00000144659	ENSG00000144659	HGNC:26054													
SLC25A38	gene	SLC25A38	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Anemia, sideroblastic, 2, pyridoxine-refractory, MIM#	205950"				19412178		False	3	100;0;0	21.664	True		ENSG00000144659	ENSG00000144659	HGNC:26054													
SLC25A4	gene	SLC25A4	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000151729	ENSG00000151729	HGNC:10990													
SLC25A4	gene	SLC25A4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 12A (cardiomyopathic type) AD, MIM#617184;Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type) AR, MIM#615418;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 2, MIM#609283				30046662;30013777;29654543;28823815		False	3	100;0;0	21.664	True		ENSG00000151729	ENSG00000151729	HGNC:10990													
SLC25A4	gene	SLC25A4	Expert Review Green;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type) AR MIM#615418				28823815		False	3	100;0;0	21.664	True		ENSG00000151729	ENSG00000151729	HGNC:10990													
SLC25A42	gene	SLC25A42	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metabolic crises, recurrent, with variable encephalomyopathic features and neurologic regression , MIM#618416				26541337;29327420;29923093;34258143		False	3	100;0;0	21.664	True		ENSG00000181035	ENSG00000181035	HGNC:28380													
SLC25A46	gene	SLC25A46	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary motor and sensory, type VIB, MIM# 616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303				30178502;26168012;27543974;27430653;27390132;28934388;28558379		False	3	100;0;0	21.664	True		ENSG00000164209	ENSG00000164209	HGNC:25198													
SLC25A46	gene	SLC25A46	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neuropathy, hereditary motor and sensory, type VIB, MIM#	616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303"				26168012;27543974		False	3	100;0;0	21.664	True		ENSG00000164209	ENSG00000164209	HGNC:25198													
SLC25A46	gene	SLC25A46	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary motor and sensory neuropathy type VIB, MIM#616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303				30178502;26168012;27543974;27430653;27390132;28934388;28558379		False	3	100;0;0	21.664	True		ENSG00000164209	ENSG00000164209	HGNC:25198													
SLC2A1	gene	SLC2A1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	GLUT1 deficiency syndrome 1, infantile onset, severe, MIM# 606777;Developmental delay;autosomal dominant, complicated hereditary spastic paraplegia (HSP);paroxysmal choreoathetosis;spastic paraplegia;seizure						False	3	100;0;0	21.664	True		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC2A1	gene	SLC2A1	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	GLUT1 deficiency syndrome 1, infantile onset, severe, 606777;GLUT1 deficiency syndrome 2, childhood onset, 612126				18451999;20129935;10980529;20221955;31196579		False	3	100;0;0	21.664	True		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC2A1	gene	SLC2A1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	GLUT1-deficiency syndrome, MONDO:0000188;Dystonia 9 601042;GLUT1 deficiency syndrome 1, infantile onset, severe 606777;GLUT1 deficiency syndrome 2, childhood onset 612126;Stomatin-deficient cryohydrocytosis with neurologic defects 608885				32913944		False	3	100;0;0	21.664	True		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC2A1	gene	SLC2A1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 9, MIM# 601042;MONDO:0010983						False	3	100;0;0	21.664	False		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC2A1	gene	SLC2A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	GLUT1 deficiency syndrome 1, infantile onset, severe, 606777;GLUT1 deficiency syndrome 2, childhood onset, 612126;Disorders of glucose transport						False	3	100;0;0	21.664	True		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC2A1	gene	SLC2A1	Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	dystonia 9;GLUT1 deficiency syndrome 2, 612126;GLUT1 DEFICIENCY SYNDROME 1;paroxysmal exertion-induced dyskinesia with or without epilepsy and/or hemolytic anemia;GLUT1 deficiency syndrome 1, 606777;Dystonia 9, 601042;EPILEPSY, IDIOPATHIC GENERALIZED						False	3	100;0;0	21.664	False		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC2A10	gene	SLC2A10	Expert Review Green;Genomics England PanelApp;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	208050;Moyamoya disease;Arterial tortuosity syndrome				16550171		False	3	100;0;0	21.664	False		ENSG00000197496	ENSG00000197496	HGNC:13444													
SLC2A2	gene	SLC2A2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fanconi-Bickel syndrome (MIM#227810)				30950137;22145468		False	3	100;0;0	21.664	True		ENSG00000163581	ENSG00000163581	HGNC:11006													
SLC30A10	gene	SLC30A10	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hypermanganesemia syndrome MONDO:0013208;Disorders of magnesium metabolism				22341972, 22341971, 29193034		False	3	0;0;0	21.664	False		ENSG00000196660	ENSG00000196660	HGNC:25355													
SLC30A10	gene	SLC30A10	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia/Parkinsonism, Hypermanganesemia, Polycythemia, and Chronic Liver Disease;Hypermanganesemia with dystonia, polycythemia, and cirrhosis, 613280						False	3	0;0;0	21.664	False		ENSG00000196660	ENSG00000196660	HGNC:25355													
SLC30A10	gene	SLC30A10	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hypermanganesemia with dystonia 1, MIM#	613280"				22341972		False	3	100;0;0	21.664	True		ENSG00000196660	ENSG00000196660	HGNC:25355													
SLC30A10	gene	SLC30A10	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome MONDO:0013208				22341971;22341972		False	3	100;0;0	21.664	True		ENSG00000196660	ENSG00000196660	HGNC:25355													
SLC30A2	gene	SLC30A2	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Zinc deficiency, transient neonatal , MIM#608118;Disorders of zinc metabolism				17065149, 22733820, 32278324, 30450693, 28665435		False	3	0;0;0	21.664	False		ENSG00000158014	ENSG00000158014	HGNC:11013													
SLC30A9	gene	SLC30A9	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Birk-Landau-Perez syndrome (MIM#617595);Disorders of zinc metabolism				37041080		False	3	0;0;0	21.664	False		ENSG00000014824	ENSG00000014824	HGNC:1329													
SLC30A9	gene	SLC30A9	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Birk-Landau-Perez syndrome	(MIM#617595)"				37041080		False	3	100;0;0	21.664	True		ENSG00000014824	ENSG00000014824	HGNC:1329													
SLC31A1	gene	SLC31A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration and seizures due to copper transport defect, MIM# 620306				PMID: 35913762;36562171;41040850		False	3	33;67;0	21.664	True		ENSG00000136868	ENSG00000136868	HGNC:11016													
SLC31A1	gene	SLC31A1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration and seizures due to copper transport defect, MIM# 620306				35913762;36562171;41040850		False	3	67;33;0	21.664	True		ENSG00000136868	ENSG00000136868	HGNC:11016													
SLC32A1	gene	SLC32A1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Generalized epilepsy with febrile seizures plus, type 12, MIM# 620755;Developmental and epileptic encephalopathy 114, MIM# 620774				34038384;36073542		False	3	100;0;0	21.664	True		ENSG00000101438	ENSG00000101438	HGNC:11018													
SLC33A1	gene	SLC33A1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of copper metabolism;Huppke-Brendel syndrome MONDO:0013772				31194315		False	3	0;0;0	21.664	False		ENSG00000169359	ENSG00000169359	HGNC:95													
SLC35A1	gene	SLC35A1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIf, MIM# 603585				28856833;23873973;11157507		False	3	100;0;0	21.664	True		ENSG00000164414	ENSG00000164414	HGNC:11021													
SLC35A2	gene	SLC35A2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854;Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE)				23561849;24115232;27743886;25778940;33407896		False	3	100;0;0	21.664	True		ENSG00000102100	ENSG00000102100	HGNC:11022													
SLC35A2	gene	SLC35A2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Congenital disorder of glycosylation, type IIm (MIM #300896)				23561849;24115232;27743886;25778940;30817854		False	3	100;0;0	21.664	True		ENSG00000102100	ENSG00000102100	HGNC:11022													
SLC35A3	gene	SLC35A3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Arthrogryposis, mental retardation, and seizures OMIM #615553;Skeletal dysplasia;Congenital disorder of glycosylation				28328131;24031089;28777481		False	3	100;0;0	21.664	True		ENSG00000117620	ENSG00000117620	HGNC:11023													
SLC35C1	gene	SLC35C1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIc, MIM# 266265, MONDO:0009953				11326279;12116250;33098347;32313197;24403049		False	3	100;0;0	21.664	True		ENSG00000181830	ENSG00000181830	HGNC:20197													
SLC35D1	gene	SLC35D1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Schneckenbecken dysplasia 269250, MONDO:0010013;O-xylosyl/N-acetylgalactosaminylglycan synthesis deficiencies (Disorders of protein O-glycosylation)				17952091;19508970;31423530		False	3	100;0;0	21.664	True		ENSG00000116704	ENSG00000116704	HGNC:20800													
SLC37A4	gene	SLC37A4	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease Ib (MIM#232220);Glycogen storage disease Ic (MIM#232240)				28224773;31508908;32005221		False	3	100;0;0	21.664	True		ENSG00000137700	ENSG00000137700	HGNC:4061													
SLC37A4	gene	SLC37A4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital disorder of glycosylation, type IIw, MIM# 619525				32884905;33728255;33964207		False	3	50;25;25	21.664	True		ENSG00000137700	ENSG00000137700	HGNC:4061													
SLC38A3	gene	SLC38A3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 102, MIM# 619881				34605855		False	3	100;0;0	21.664	True		ENSG00000188338	ENSG00000188338	HGNC:18044													
SLC39A13	gene	SLC39A13	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ehlers-Danlos syndrome, spondylocheirodysplastic type MONDO:0012873;Disorders of zinc metabolism				18985159, 18513683		False	3	0;0;0	21.664	False		ENSG00000165915	ENSG00000165915	HGNC:20859													
SLC39A14	gene	SLC39A14	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermanganesemia with dystonia 2 617013						False	3	0;0;0	21.664	False		ENSG00000104635	ENSG00000104635	HGNC:20858													
SLC39A14	gene	SLC39A14	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hypermanganesemia with dystonia 2, MIM#	617013"				27231142;29685658		False	3	100;0;0	21.664	True		ENSG00000104635	ENSG00000104635	HGNC:20858													
SLC39A14	gene	SLC39A14	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hypermanganesemia with dystonia 2 MONDO:0014864;Disorders of magnesium metabolism				27231142, 29685658		False	3	0;0;0	21.664	False		ENSG00000104635	ENSG00000104635	HGNC:20858													
SLC39A14	gene	SLC39A14	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermanganesemia with dystonia 2 (MIM# 617013)				27231142;32626807;29685658;30232769		False	3	100;0;0	21.664	True		ENSG00000104635	ENSG00000104635	HGNC:20858													
SLC39A4	gene	SLC39A4	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	acrodermatitis enteropathica MONDO:0008713;Disorders of zinc metabolism				19370757		False	3	0;0;0	21.664	False		ENSG00000147804	ENSG00000147804	HGNC:17129													
SLC39A4	gene	SLC39A4	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acrodermatitis enteropathica MIM#201100;(Disorder of zinc metabolism)				27604308;12068297		False	3	100;0;0	21.664	True		ENSG00000147804	ENSG00000147804	HGNC:17129													
SLC39A8	gene	SLC39A8	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIn , MIM#616721				26637978;26637979		False	3	100;0;0	21.664	True		ENSG00000138821	ENSG00000138821	HGNC:20862													
SLC39A8	gene	SLC39A8	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIn , MIM#616721				26637978;26637979		False	3	100;0;0	21.664	True		ENSG00000138821	ENSG00000138821	HGNC:20862													
SLC39A8	gene	SLC39A8	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	SLC39A8-CDG MONDO:0014746;Other disorders of trace element metabolism				26637978, 26637979		False	3	0;0;0	21.664	False		ENSG00000138821	ENSG00000138821	HGNC:20862													
SLC40A1	gene	SLC40A1	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	606069 HEMOCHROMATOSIS, TYPE 4;HFE4;606069 Hemochromatosis, type 4				16351644;11431687		False	3	0;0;0	21.664	False		ENSG00000138449	ENSG00000138449	HGNC:10909													
SLC44A1	gene	SLC44A1	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset neurodegeneration;progressive ataxia tremor cognitive decline dysphagia optic atrophy dysarthria				31855247		False	3	100;0;0	21.664	True		ENSG00000070214	ENSG00000070214	HGNC:18798													
SLC46A1	gene	SLC46A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Folate malabsorption, hereditary, MIM#	229050"				17446347;17129779;21333572		False	3	100;0;0	21.664	True		ENSG00000076351	ENSG00000076351	HGNC:30521													
SLC46A1	gene	SLC46A1	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Folate malabsorption, hereditary MIM# 229050;Decreased Ig levels;megaloblastic anaemia;failure to thrive;Immunodeficiency;if untreated for prolonged periods results in intellectual disability;oral mucositis;hypoimmunoglobulinaemia;recurrent infections;seizures;motor impairment;leukopaenia;thrombocytopaenia				20301716		False	3	100;0;0	21.664	True		ENSG00000076351	ENSG00000076351	HGNC:30521													
SLC46A1	gene	SLC46A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Folate malabsorption, hereditary, MIM# 229050				33146883;28685492;24534056;27938595		False	3	100;0;0	21.664	True		ENSG00000076351	ENSG00000076351	HGNC:30521													
SLC52A2	gene	SLC52A2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Brown-Vialetto-Van Laere syndrome 2, MIM#	614707"						False	3	100;0;0	21.664	True		ENSG00000185803	ENSG00000185803	HGNC:30224													
SLC52A2	gene	SLC52A2	Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	100;0;0	21.664	False		ENSG00000185803	ENSG00000185803	HGNC:30224													
SLC52A2	gene	SLC52A2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brown-Vialetto-van Laere syndrome 2 (BVVLS2) (MONDO:0013867)				22740598;24253200		False	3	100;0;0	21.664	True		ENSG00000185803	ENSG00000185803	HGNC:30224													
SLC52A2	gene	SLC52A2	Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brown-Vialetto-Van Laere syndrome 2 MIM#614707				29053833;29193829		False	3	100;0;0	21.664	True		ENSG00000185803	ENSG00000185803	HGNC:30224													
SLC52A2	gene	SLC52A2	Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brown-Vialetto-van Laere syndrome 2 MONDO:0013867				29193829;31868069;29053833;26072523		False	3	100;0;0	21.664	True		ENSG00000185803	ENSG00000185803	HGNC:30224													
SLC52A2	gene	SLC52A2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bwon-Vialetto-Van Laere syndrome 2, 614707						False	3	100;0;0	21.664	True		ENSG00000185803	ENSG00000185803	HGNC:30224													
SLC52A3	gene	SLC52A3	Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brown-Vialetto-Van Laere syndrome 1 MIM#211530				29053833;29193829		False	3	100;0;0	21.664	True		ENSG00000101276	ENSG00000101276	HGNC:16187													
SLC52A3	gene	SLC52A3	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Amytrophic Lateral Sclerosis (ALS);Brown-Vialetto-van Laere syndrome 1 (MIM# 211530)				26072523		False	3	100;0;0	21.664	True		ENSG00000101276	ENSG00000101276	HGNC:16187													
SLC52A3	gene	SLC52A3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Brown-Vialetto-Van Laere syndrome 1, MIM#	211530"						False	3	100;0;0	21.664	True		ENSG00000101276	ENSG00000101276	HGNC:16187													
SLC52A3	gene	SLC52A3	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brown-Vialetto-Van Laere syndrome 1 (MIM#211530);dHMN;Brown-Vialetto-Van Laere syndrome 1;Fazio-Londe disease				20206331		False	3	100;0;0	21.664	True		ENSG00000101276	ENSG00000101276	HGNC:16187													
SLC52A3	gene	SLC52A3	Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brown-Vialetto-van Laere syndrome 1 MONDO:0024537				29193829;31868069;29053833;26072523		False	3	100;0;0	21.664	True		ENSG00000101276	ENSG00000101276	HGNC:16187													
SLC5A1	gene	SLC5A1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glucose/galactose malabsorption MIM# 606824;(Disorders of glucose transport)				27604308;2008213;8195156;20486940		False	3	100;0;0	21.664	True		ENSG00000100170	ENSG00000100170	HGNC:11036													
SLC5A6	gene	SLC5A6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peripheral motor neuropathy, childhood-onset, biotin-responsive, MIM# 619903				35013551		False	3	100;0;0	21.664	True		ENSG00000138074	ENSG00000138074	HGNC:11041													
SLC5A6	gene	SLC5A6	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, infantile-onset, biotin-responsive, MIM# 618973				29669219;23104561;31754459;27904971;31392107		False	3	100;0;0	21.664	True		ENSG00000138074	ENSG00000138074	HGNC:11041													
SLC5A6	gene	SLC5A6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Developmental delay;epilepsy;neurodegeneration;Neurodegeneration, infantile-onset, biotin-responsive, MIM#	618973"				31754459;27904971		False	3	100;0;0	21.664	True		ENSG00000138074	ENSG00000138074	HGNC:11041													
SLC5A7	gene	SLC5A7	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronopathy, distal hereditary motor, type VIIA, MIM# 158580;MONDO:0008024				23141292;15173594;29782645;29582019		False	3	100;0;0	21.664	False		ENSG00000115665	ENSG00000115665	HGNC:14025													
SLC6A1	gene	SLC6A1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myoclonic-atonic epilepsy, MIM#616421				29315614		False	3	100;0;0	21.664	True		ENSG00000157103	ENSG00000157103	HGNC:11042													
SLC6A1	gene	SLC6A1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myoclonic-atonic epilepsy MONDO:0014633				34028503		False	3	0;0;0	21.664	False		ENSG00000157103	ENSG00000157103	HGNC:11042													
SLC6A19	gene	SLC6A19	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hartnup disorder, MIM# 234500						False	3	100;0;0	21.664	True		ENSG00000174358	ENSG00000174358	HGNC:27960													
SLC6A19	gene	SLC6A19	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Hartnup disorder, MIM#	234500;Hyperglycinuria, MIM#	138500;Iminoglycinuria, MIM# 242600"						False	3	100;0;0	21.664	True		ENSG00000174358	ENSG00000174358	HGNC:27960													
SLC6A3	gene	SLC6A3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia, infantile, 1, MIM# 613135				21112253		False	3	100;0;0	21.664	True		ENSG00000142319	ENSG00000142319	HGNC:11049													
SLC6A3	gene	SLC6A3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia, infantile, 1, MIM# 613135				21112253		False	3	100;0;0	21.664	True		ENSG00000142319	ENSG00000142319	HGNC:11049													
SLC6A3	gene	SLC6A3	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dopamine transporter deficiency;Parkinsonism-dystonia, infantile, 613135						False	3	0;0;0	21.664	False		ENSG00000142319	ENSG00000142319	HGNC:11049													
SLC6A5	gene	SLC6A5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperekplexia 3, MIM# 614618				31604777;30847549;29859229;16751771		False	3	100;0;0	21.664	True		ENSG00000165970	ENSG00000165970	HGNC:11051													
SLC6A5	gene	SLC6A5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperekplexia 3, MIM# 614618				16751771		False	3	100;0;0	21.664	True		ENSG00000165970	ENSG00000165970	HGNC:11051													
SLC6A8	gene	SLC6A8	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Cerebral creatine deficiency syndrome 1, MIM# 300352				27604308;16738945		False	3	100;0;0	21.664	True		ENSG00000130821	ENSG00000130821	HGNC:11055													
SLC6A8	gene	SLC6A8	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Cerebral creatine deficiency syndrome 1, MIM#	300352"				27604308;16738945		False	3	100;0;0	21.664	True		ENSG00000130821	ENSG00000130821	HGNC:11055													
SLC6A9	gene	SLC6A9	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Atypical glycine encephalopathy MONDO:0015010;Glycine neurotransmitter disorders				27481395;27773429;14622582;33269555		False	3	0;0;0	21.664	False		ENSG00000196517	ENSG00000196517	HGNC:11056													
SLC9A1	gene	SLC9A1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lichtenstein-Knorr Syndrome, MIM#	616291"				25205112;30018422;25760855		False	3	50;50;0	21.664	True		ENSG00000090020	ENSG00000090020	HGNC:11071													
SLC9A6	gene	SLC9A6	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mental retardation, X-linked syndromic, Christianson type, 300243						False	3	100;0;0	21.664	False		ENSG00000198689	ENSG00000198689	HGNC:11079													
SLC9A6	gene	SLC9A6	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked syndromic, Christianson type, MIM# 300243;MONDO:0010278				18342287;19377476;25044251;33278113;32569089;31879735		False	3	100;0;0	21.664	True		ENSG00000198689	ENSG00000198689	HGNC:11079													
SLC9A6	gene	SLC9A6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142				35198730;39810750;35198730;31192222		False	3	100;0;0	21.664	True		ENSG00000198689	ENSG00000198689	HGNC:11079													
SLC9A6	gene	SLC9A6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM#	301142"				35198730;39810750;35198730;31192222		False	3	100;0;0	21.664	True		ENSG00000198689	ENSG00000198689	HGNC:11079													
SLITRK2	gene	SLITRK2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked 111, MIM# 301107				35840571		False	3	100;0;0	21.664	True		ENSG00000185985	ENSG00000185985	HGNC:13449													
SMAD4	gene	SMAD4	Expert Review Green;Genomics England PanelApp;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome  175050						False	3	100;0;0	21.664	False		ENSG00000141646	ENSG00000141646	HGNC:6770													
SMARCA2	gene	SMARCA2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Nicolaides-Baraitser syndrome, MIM# 601358				22366787;22426308;27665729		False	3	100;0;0	21.664	True		ENSG00000080503	ENSG00000080503	HGNC:11098													
SMARCB1	gene	SMARCB1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 3, MIM# 614608;Epilepsy				33006724;22426308;23906836;23929686		False	3	50;0;50	21.664	True		ENSG00000099956	ENSG00000099956	HGNC:11103													
SMARCC2	gene	SMARCC2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Coffin-Siris syndrome 8;OMIM #618362				30580808		False	3	100;0;0	21.664	True		ENSG00000139613	ENSG00000139613	HGNC:11105													
SMC1A	gene	SMC1A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Other	Epileptic encephalopathy, early infantile, 85, with or without midline brain defects, MIM# 301044				31334757;28166369		False	3	100;0;0	21.664	True		ENSG00000072501	ENSG00000072501	HGNC:11111													
SMCHD1	gene	SMCHD1	Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Facioscapulohumeral muscular dystrophy MONDO:0001347				20301616		False	3	100;0;0	21.664	True		ENSG00000101596	ENSG00000101596	HGNC:29090													
SMN1	gene	SMN1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinal muscular atrophy-1, MIM# 253300;Spinal muscular atrophy-2, MIM# 253550;Spinal muscular atrophy-3, MIM# 253400;Spinal muscular atrophy-4, MIM# 271150						False	3	100;0;0	21.664	False		ENSG00000172062	ENSG00000172062	HGNC:11117													
SMN1	gene	SMN1	Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinal muscular atrophy-1, MIM# 253300				20301623		False	3	100;0;0	21.664	True		ENSG00000172062	ENSG00000172062	HGNC:11117													
SMPD1	gene	SMPD1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type A, MIM# 257200;MONDO:0009756;Niemann-Pick disease, type B, MIM# 607616;MONDO:0011871				32292456;32280632;28164782		False	3	100;0;0	21.664	True		ENSG00000166311	ENSG00000166311	HGNC:11120													
SMPX	gene	SMPX	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Myopathy, distal, 7, adult-onset, X-linked, MIM# 301075				33974137		False	3	100;0;0	21.664	True	Other	ENSG00000091482	ENSG00000091482	HGNC:11122													
SMS	gene	SMS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation X-linked Snyder-Robinson type, 309583				30237987		False	3	100;0;0	21.664	True		ENSG00000102172	ENSG00000102172	HGNC:11123													
SNAP25	gene	SNAP25	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SNAP25-related				25003006;29100083;28135719;29491473;25381298;17283335		False	3	100;0;0	21.664	True		ENSG00000132639	ENSG00000132639	HGNC:11132													
SNAP25	gene	SNAP25	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Myasthenic syndrome, congenital, 18, 616330;cerebellar ataxia and seizures				29491473;25381298;17283335		False	3	100;0;0	21.664	True		ENSG00000132639	ENSG00000132639	HGNC:11132													
SNAP29	gene	SNAP29	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (CEDNIK) Syndrome (MONDO:0012290) (MIM#609528);Cerebral Dysgenesis and severe psychomotor retardation, axonal sensory-motor Neuropathy, Ichthyosis, palmoplantar Keratoderma, fatal by second decade of life				33977139		False	3	0;100;0	21.664	True		ENSG00000099940	ENSG00000099940	HGNC:11133													
SNAP29	gene	SNAP29	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome MIM#609528				PMID: 33977139		False	3	100;0;0	21.664	True		ENSG00000099940	ENSG00000099940	HGNC:11133													
SNAPC4	gene	SNAPC4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with motor regression, progressive spastic paraplegia, and oromotor dysfunction, MIM# 620515				36965478		False	3	100;0;0	21.664	True		ENSG00000165684	ENSG00000165684	HGNC:11137													
SNCA	gene	SNCA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543)				32849182;26858591;32740728		False	3	100;0;0	21.664	True		ENSG00000145335	ENSG00000145335	HGNC:11138													
SNCA	gene	SNCA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543)				32849182;26858591;32740728		False	3	100;0;0	21.664	True		ENSG00000145335	ENSG00000145335	HGNC:11138													
SNF8	gene	SNF8	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 115, MIM#620783				38423010		False	3	50;50;0	21.664	True		ENSG00000159210	ENSG00000159210	HGNC:17028													
SNORD118	gene	SNORD118	Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, brain calcifications, and cysts, MIM#614561				27571260		False	3	100;0;0	21.664	True		ENSG00000200463	ENSG00000200463	HGNC:32952													
SNORD118	gene	SNORD118	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, brain calcifications, and cysts MIM#614561				27571260		False	3	100;0;0	21.664	True		ENSG00000200463	ENSG00000200463	HGNC:32952													
SNORD118	gene	SNORD118	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy, brain calcifications, and cysts	614561"				27571260		False	3	100;0;0	21.664	True		ENSG00000200463	ENSG00000200463	HGNC:32952													
SNORD118	gene	SNORD118	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, brain calcifications, and cysts, MIM#614561				27571260;34220662;28177126;34986804		False	3	100;0;0	21.664	True		ENSG00000200463	ENSG00000200463	HGNC:32952													
SNUPN	gene	SNUPN	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, autosomal recessive 29, MIM# 620793				PMID: 38413582;PMID: 38366623		False	3	100;0;0	21.664	True		ENSG00000169371	ENSG00000169371	HGNC:14245													
SNW1	gene	SNW1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), SNW1-related				40608414		False	3	100;0;0	21.664	True		ENSG00000100603	ENSG00000100603	HGNC:16696													
SNX14	gene	SNX14	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia 20, 616354;Autosomal recessive spinocerebellar ataxia (#616354)						False	3	100;0;0	21.664	False		ENSG00000135317	ENSG00000135317	HGNC:14977													
SNX14	gene	SNX14	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of autophagy;autosomal recessive spinocerebellar ataxia 20 MONDO:0014601				34130600;29884839		False	3	0;0;0	21.664	False		ENSG00000135317	ENSG00000135317	HGNC:14977													
SNX27	gene	SNX27	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Damseh-Danson neurodevelopmental disorder, MIM# 621591				25894286;31721175;21300787;23524343		False	3	100;0;0	21.664	True		ENSG00000143376	ENSG00000143376	HGNC:20073													
SOD1	gene	SOD1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 1 (105400 AD, AR);Spastic tetraplegia and axial hypotonia, progressive (618598 AR)				8625408;21545237;16503123		False	3	100;0;0	21.664	True		ENSG00000142168	ENSG00000142168	HGNC:11179													
SOD1	gene	SOD1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic tetraplegia and axial hypotonia, progressive, MIM#618598				PMID: 31314961;31332433;34788402		False	3	100;0;0	21.664	True		ENSG00000142168	ENSG00000142168	HGNC:11179													
SOD1	gene	SOD1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary peripheral neuropathy, MONDO:0020127, SOD1-related				39932579		False	3	100;0;0	21.664	False		ENSG00000142168	ENSG00000142168	HGNC:11179													
SON	gene	SON	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	ZTTK syndrome MIM#617140				PMID: 37488749;27545680		False	3	100;0;0	21.664	True		ENSG00000159140	ENSG00000159140	HGNC:11183													
SORD	gene	SORD	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	isolated hereditary neuropathy;Sorbitol dehydrogenase deficiency with peripheral neuropathy (SORDDPN), MIM#618912				32367058		False	3	100;0;0	21.664	False		ENSG00000140263	ENSG00000140263	HGNC:11184													
SOX10	gene	SOX10	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	PCWH Syndrome (MIM#609136;MONDO:0012198);Waardenburg syndrome, type 4C, 613266;Hypopigmentation of the hair and skin, sensory hearing loss, demyelinating neuropathy, dysmyelinating leukodystrophy, developmental delay, spasticity, ataxia, Hirschsprung disease;Waardenburg syndrome, type 2E, with or without neurologic involvement, 611584;HMSN				15004559		False	3	0;100;0	21.664	True		ENSG00000100146	ENSG00000100146	HGNC:11190													
SOX10	gene	SOX10	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	PCWH syndrome MIM#609136				29792164;35725288		False	3	100;0;0	21.664	True		ENSG00000100146	ENSG00000100146	HGNC:11190													
SOX10	gene	SOX10	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy;PERIPHERAL DEMYELINATING NEUROPATHY, CENTRAL DYSMYELINATING LEUKODYSTROPHY, WAARDENBURG SYNDROME, AND HIRSCHSPRUNG DISEASE;General Leukodystrophy & Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000100146	ENSG00000100146	HGNC:11190													
SOX6	gene	SOX6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Tolchin-Le Caignec syndrome, MIM#	618971;Developmental delay;ID;ASD;ADHD;Parkinsonism;Syringomyelia"				24453155;25127144		False	3	100;0;0	21.664	True		ENSG00000110693	ENSG00000110693	HGNC:16421													
SP9	gene	SP9	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, SP9-related				PMID: 38288683		False	3	100;0;0	21.664	True		ENSG00000217236	ENSG00000217236	HGNC:30690													
SPART	gene	SPART	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Troyer syndrome, MIM# 275900;SPG20;MONDO:0010156				12134148;20437587;26003402;27112432;31535723;31535723;28875386;28679690		False	3	100;0;0	21.664	True		ENSG00000133104	ENSG00000133104	HGNC:18514													
SPART	gene	SPART	Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	100;0;0	21.664	False		ENSG00000133104	ENSG00000133104	HGNC:18514													
SPART	gene	SPART	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Troyer syndrome 275900				28875386;15372254		False	3	100;0;0	21.664	False		ENSG00000133104	ENSG00000133104	HGNC:18514													
SPAST	gene	SPAST	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 4, autosomal dominant, MIM# 182601;Cerebral Palsy MONDO:0006497, SPAST-related, AR				41000004		False	3	100;0;0	21.664	True		ENSG00000021574	ENSG00000021574	HGNC:11233													
SPAST	gene	SPAST	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spastic paraplegia 4, autosomal dominant;Spasticity;Hereditary Neuropathies						False	3	100;0;0	21.664	True		ENSG00000021574	ENSG00000021574	HGNC:11233													
SPAST	gene	SPAST	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted					16765570;19364936		False	3	100;0;0	21.664	True		ENSG00000021574	ENSG00000021574	HGNC:11233													
SPG11	gene	SPG11	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary spastic paraplegia 11 MONDO:0011445				35036589;23121729;21381113;27217339		False	3	100;0;0	21.664	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG11	gene	SPG11	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 11, autosomal recessive, MIM#	604360"				18067136		False	3	100;0;0	21.664	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG11	gene	SPG11	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMSN;Hereditary Neuropathies;axonal Charcot-Marie-Tooth disease type 2X;MONDO:0014726				26556829;33581793		False	3	100;0;0	21.664	False		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG11	gene	SPG11	Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 5, juvenile, MIM# 602099				20110243		False	3	100;0;0	21.664	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG11	gene	SPG11	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 11, autosomal recessive MIM#604360;Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668;Amyotrophic lateral sclerosis 5, juvenile MIM#602099				27318863;28237315;18079167		False	3	100;0;0	21.664	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG11	gene	SPG11	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 11, autosomal recessive, MIM#	604360"				18067136		False	3	100;0;0	21.664	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG11	gene	SPG11	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of autophagy;hereditary spastic paraplegia 11 MONDO:0011445				37871017;37709208;29884839		False	3	0;0;0	21.664	False		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG21	gene	SPG21	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mast syndrome 248900				14564668		False	3	100;0;0	21.664	False		ENSG00000090487	ENSG00000090487	HGNC:20373													
SPG21	gene	SPG21	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mast syndrome, 248900;Spastic Paraplegia, autosomal recessive				14564668;24451228;28752238;26978163		False	3	100;0;0	21.664	False		ENSG00000090487	ENSG00000090487	HGNC:20373													
SPG21	gene	SPG21	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mast syndrome, MIM# 248900				14564668;24451228;28752238;26978163		False	3	100;0;0	21.664	True		ENSG00000090487	ENSG00000090487	HGNC:20373													
SPG7	gene	SPG7	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 7, autosomal recessive, MIM#	607259"				22571692		False	3	100;0;0	21.664	True		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPG7	gene	SPG7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 7, autosomal recessive, MIM# 607259;Autosomal dominant optic atrophy, MONDO:0020250				9635427;9635427;16534102;18799786;22571692;34500365;33598982;32548275;24727571		False	3	100;0;0	21.664	True		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPG7	gene	SPG7	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 7, autosomal recessive MIM#607259				16765570;19364936		False	3	100;0;0	21.664	True		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPG7	gene	SPG7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 7, autosomal recessive, MIM#	607259;Ataxia;Progressive external opthalmoplegia;Parkinsonism"				PMID: 31433872		False	3	100;0;0	21.664	True		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPG7	gene	SPG7	Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259						False	3	100;0;0	21.664	False		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPNS1	gene	SPNS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysosomal disorder, SPNS1-related, MONDO:0002561				40608416;38451736		False	3	50;50;0	21.664	True		ENSG00000169682	ENSG00000169682	HGNC:30621													
SPOUT1	gene	SPOUT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154				39962046		False	3	100;0;0	21.664	True		ENSG00000198917	ENSG00000198917	HGNC:26933													
SPR	gene	SPR	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716				22522443;16650784;21431957;28189489		False	3	100;0;0	21.664	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPR	gene	SPR	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994				22522443;11920285;14663042;16443856;21782285;32813147		False	3	0;100;0	21.664	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPR	gene	SPR	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716;MONDO:0012994				11443547;18502672;22522443;16532389;31777525;29147684;28189489		False	3	100;0;0	21.664	False		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPR	gene	SPR	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dopa-responsive dystonia due to sepiaterin reductase deficiency, 612716;Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716						False	3	100;0;0	21.664	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPR	gene	SPR	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716				22522443;16650784;21431957;28189489		False	3	100;0;0	21.664	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPR	gene	SPR	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716				22522443		False	3	100;0;0	21.664	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPTAN1	gene	SPTAN1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 5, MIM# 613477				20493457;22258530;32811770		False	3	100;0;0	21.664	True		ENSG00000197694	ENSG00000197694	HGNC:11273													
SPTAN1	gene	SPTAN1	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronopathy, distal hereditary motor, 11, autosomal dominant, MIM# 620528				33578420;31332438		False	3	100;0;0	21.664	False		ENSG00000197694	ENSG00000197694	HGNC:11273													
SPTAN1	gene	SPTAN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia MONDO:0957813				36331550		False	3	100;0;0	21.664	True	Other	ENSG00000197694	ENSG00000197694	HGNC:11273													
SPTAN1	gene	SPTAN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	distal myopathy MONDO:0018949				40023774		False	3	100;0;0	21.664	True		ENSG00000197694	ENSG00000197694	HGNC:11273													
SPTAN1	gene	SPTAN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic Paraplegia MONDO:0019064, SPTAN1-related;Autosomal dominant spastic paraplegia-91, with or without cerebellar ataxia (SPG91), MIM#620538				PMID: 35150594;34526651;31515523		False	3	100;0;0	21.664	True		ENSG00000197694	ENSG00000197694	HGNC:11273													
SPTBN1	gene	SPTBN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475				PMID: 34211179 PMID: 33847457		False	3	100;0;0	21.664	True		ENSG00000115306	ENSG00000115306	HGNC:11275													
SPTBN2	gene	SPTBN2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 14, MIM#	615386;Spinocerebellar ataxia 5, MIM#	600224"				23236289;23838597;22781464;31617442;31066025		False	3	100;0;0	21.664	True		ENSG00000173898	ENSG00000173898	HGNC:11276													
SPTBN4	gene	SPTBN4	Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, neuropathy, and deafness MIM#617519				28540413;28940097;29861105;31230720;31857255		False	3	100;0;0	21.664	True		ENSG00000160460	ENSG00000160460	HGNC:14896													
SPTBN4	gene	SPTBN4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hypotonia, neuropathy, and deafness MIM#617519				28540413;29861105		False	3	100;0;0	21.664	False		ENSG00000160460	ENSG00000160460	HGNC:14896													
SPTLC1	gene	SPTLC1	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hereditary sensory neuropathy type IA;HSAN 1;Neuropathy, hereditary sensory and autonomic, type IA, 162400				11242114;11242106;15037712		False	3	0;0;0	21.664	False		ENSG00000090054	ENSG00000090054	HGNC:11277													
SPTLC1	gene	SPTLC1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Neuropathy, hereditary sensory and autonomic, type IA, MIM#	162400;Serine palmitoyl transferase deficiency (Disorders of complex lipid synthesis)"				27604308;20097765;21618344;20097765;30420926		False	3	100;0;0	21.664	True		ENSG00000090054	ENSG00000090054	HGNC:11277													
SPTLC1	gene	SPTLC1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Juvenile amyotrophic lateral sclerosis-27, MIM#620285;HSAN/SFN;Hereditary Sensory and Autonomic Neuropathy, Type II;Neuropathy, hereditary sensory and autonomic, type IA, 162400				11242114;11242106;15037712;26681808		False	3	100;0;0	21.664	False		ENSG00000090054	ENSG00000090054	HGNC:11277													
SPTLC1	gene	SPTLC1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	juvenile amyotrophic lateral sclerosis MONDO:0017593				34059824;35900868;34459874		False	3	100;0;0	21.664	True	Other	ENSG00000090054	ENSG00000090054	HGNC:11277													
SPTLC2	gene	SPTLC2	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hereditary sensory and autonomic neuropathy type IC;HSAN 1;Neuropathy, hereditary sensory and autonomic, type IC, 613640				26681808;23658386;12207934;27025386;20920666		False	3	0;0;0	21.664	False		ENSG00000100596	ENSG00000100596	HGNC:11278													
SPTLC2	gene	SPTLC2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Neuropathy, hereditary sensory and autonomic, type IC, MIM#	613640;Serine palmitoyl transferase deficiency (Disorders of complex lipid synthesis)"				27604308;20920666		False	3	100;0;0	21.664	True		ENSG00000100596	ENSG00000100596	HGNC:11278													
SPTLC2	gene	SPTLC2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuropathy, hereditary sensory and autonomic, type IC, 613640;MONDO:0013337;HSAN/SFN				20920666;23658386;31509666;30866134		False	3	100;0;0	21.664	False		ENSG00000100596	ENSG00000100596	HGNC:11278													
SQSTM1	gene	SQSTM1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145				27545679		False	3	100;0;0	21.664	True		ENSG00000161011	ENSG00000161011	HGNC:11280													
SQSTM1	gene	SQSTM1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145				PMID: 27545679		False	3	100;0;0	21.664	True		ENSG00000161011	ENSG00000161011	HGNC:11280													
SRCAP	gene	SRCAP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental delay, hypotonia, musculoskeletal defects, and behavioral abnormalities MIM#619595;Floating-Harbor syndrome MIM#136140				23193612;23621943		False	3	0;100;0	21.664	True		ENSG00000080603	ENSG00000080603	HGNC:16974													
SRD5A3	gene	SRD5A3	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kahrizi syndrome, 612713;Congenital disorder of glycosylation, type Iq, 612379;Congenital disorder of glycosylation type Iq, 612379						False	3	100;0;0	21.664	True		ENSG00000128039	ENSG00000128039	HGNC:25812													
SRD5A3	gene	SRD5A3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Iq, MIM# 612379;Kahrizi syndrome, MIM# 612713				32424323		False	3	100;0;0	21.664	True		ENSG00000128039	ENSG00000128039	HGNC:25812													
SRRM4	gene	SRRM4	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SRRM4-related				41958152		False	3	100;0;0	21.664	True	Other	ENSG00000139767	ENSG00000139767	HGNC:29389													
SRRM4	gene	SRRM4	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SRRM4-related				41958152		False	3	100;0;0	21.664	True	Other	ENSG00000139767	ENSG00000139767	HGNC:29389													
SSBP1	gene	SSBP1	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Optic atrophy with or without extraocular phenotypes;Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510				31298765;31479473;31550237;31550240		False	3	100;0;0	21.664	True		ENSG00000106028	ENSG00000106028	HGNC:11317													
SSPOP	gene	SSPOP	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SSPOP-related				PMID: 41077560		False	3	100;0;0	21.664	True		ENSG00000197558	ENSG00000197558	HGNC:21998													
SSR4	gene	SSR4	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Congenital disorder of glycosylation, type Iy, MIM#300934						False	3	100;0;0	21.664	True		ENSG00000180879	ENSG00000180879	HGNC:11326													
ST3GAL3	gene	ST3GAL3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability, autosomal recessive 12 MIM# 611090				23252400;21907012;31584066		False	3	50;50;0	21.664	True		ENSG00000126091	ENSG00000126091	HGNC:10866													
ST3GAL5	gene	ST3GAL5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Salt and pepper developmental regression syndrome 609056;GM3 synthase deficiency, MONDO:0018274;Lactosylceramide alpha-2,3-sialyltransferase deficiency (Disorders of glycosphingolipid and glycosylphosphatidylinositol anchor glycosylation)				23436467;22990144;15502825;27232954;30691927;30688114;30576498		False	3	100;0;0	21.664	True		ENSG00000115525	ENSG00000115525	HGNC:10872													
ST3GAL5	gene	ST3GAL5	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Salt and pepper developmental regression syndrome 609056;GM3 synthase deficiency, MONDO:0018274;Lactosylceramide alpha-2,3-sialyltransferase deficiency (Disorders of glycosphingolipid and glycosylphosphatidylinositol anchor glycosylation)				23436467;22990144;15502825;27232954;30691927;30688114;30576498		False	3	100;0;0	21.664	True		ENSG00000115525	ENSG00000115525	HGNC:10872													
STAB1	gene	STAB1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperferritinemia, MIM# 620729				37490907;28052375		False	3	100;0;0	21.664	True		ENSG00000010327	ENSG00000010327	HGNC:18628													
STAG1	gene	STAG1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability, autosomal dominant 47, MIM# 617635				28119487;34440290		False	3	100;0;0	21.664	True		ENSG00000118007	ENSG00000118007	HGNC:11354													
STAMBP	gene	STAMBP	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly-capillary malformation syndrome, MIM# 614261;MONDO:0013659				23542699;31638258;29907875;27531570;25692795;25266620		False	3	100;0;0	21.664	True		ENSG00000124356	ENSG00000124356	HGNC:16950													
STAT2	gene	STAT2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 44, MIM# 616636				23391734;26122121		False	3	100;0;0	21.664	True		ENSG00000170581	ENSG00000170581	HGNC:11363													
STEEP1	gene	STEEP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked 107, MIM# 301013				29374277;31822863		False	3	100;0;0	21.664	True		ENSG00000018610	ENSG00000018610	HGNC:26239													
STIM1	gene	STIM1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Myopathy, tubular aggregate, 1 (MIM#160565);Stormorken syndrome	(MIM#185070)"				31448844		False	3	67;33;0	21.664	True	Other	ENSG00000167323	ENSG00000167323	HGNC:11386													
STN1	gene	STN1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebroretinal microangiopathy with calcifications and cysts 2, MIM#	617341"				27432940;32627942;34110109		False	3	100;0;0	21.664	True		ENSG00000107960	ENSG00000107960	HGNC:26200													
STRADA	gene	STRADA	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyhydramnios, megalencephaly, and symptomatic epilepsy, OMIM:611087;Polyhydramnios, megalencephaly, and symptomatic epilepsy, MONDO:0012611				17522105;27170158;28688840		False	3	100;0;0	21.664	True		ENSG00000266173	ENSG00000266173	HGNC:30172													
STS	gene	STS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Ichthyosis, X-linked	308100;Sterol metabolism disorder"						False	3	100;0;0	21.664	True		ENSG00000101846	ENSG00000101846	HGNC:11425													
STT3A	gene	STT3A	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Iw, AR, OMIM #615596;Congenital disorder of glycosylation, type Iw, autosomal dominant, MIM# 619714				23842455;30701557;28424003;34653363		False	3	100;0;0	21.664	True		ENSG00000134910	ENSG00000134910	HGNC:6172													
STUB1	gene	STUB1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar Ataxia 48, OMIM 618093;Parkinsonism				30381368;32285148;32337344		False	3	100;0;0	21.664	True		ENSG00000103266	ENSG00000103266	HGNC:11427													
STUB1	gene	STUB1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 16, MIM#	615768"				25258038;24742043		False	3	100;0;0	21.664	True		ENSG00000103266	ENSG00000103266	HGNC:11427													
STUB1	gene	STUB1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 16, MIM#	615768"				32342324;32337344		False	3	100;0;0	21.664	False		ENSG00000103266	ENSG00000103266	HGNC:11427													
STUB1	gene	STUB1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Spinocerebellar ataxia 48 MIM#618093;cognitive impairment;Spinocerebellar ataxia, autosomal recessive 16	MIM#615768"				32713943		False	3	100;0;0	21.664	False		ENSG00000103266	ENSG00000103266	HGNC:11427													
STX1A	gene	STX1A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	neurodevelopmental disorder MONDO#0700092, STX1A-related				37029317;36564538		False	3	100;0;0	21.664	True		ENSG00000106089	ENSG00000106089	HGNC:11433													
STX1B	gene	STX1B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Generalized epilepsy with febrile seizures plus, type 9, MIM# 616172				25362483;33677401		False	3	100;0;0	21.664	True		ENSG00000099365	ENSG00000099365	HGNC:18539													
STXBP1	gene	STXBP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 4, MIM# 612164				31855252		False	3	67;33;0	21.664	True	Other	ENSG00000136854	ENSG00000136854	HGNC:11444													
STXBP1	gene	STXBP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 4, MIM# 612164;Juvenile onset Parkinsonism				25418441;32643187;29929108		False	3	100;0;0	21.664	True		ENSG00000136854	ENSG00000136854	HGNC:11444													
SUCLA2	gene	SUCLA2	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5;Mitochondrial Leukoencephalopathy;Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria)						False	3	0;0;0	21.664	False		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUCLA2	gene	SUCLA2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria), MIM# 612073, MONDO:0012791				15877282;17287286;17301081;23759946;33231368;33230181;28243576;27913098;27651038		False	3	100;0;0	21.664	True		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUCLA2	gene	SUCLA2	Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria) 612073				15877282;17287286;17301081;23759946;33231368;33230181;28243576;27913098;27651038		False	3	100;0;0	21.664	True		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUCLA2	gene	SUCLA2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria), MIM# 612073, MONDO:0012791				15877282;17287286;17301081;23759946;33231368;33230181;28243576;27913098;27651038		False	3	100;0;0	21.664	True		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUCLA2	gene	SUCLA2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria);Dystonia						False	3	0;0;0	21.664	False		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUCLG1	gene	SUCLG1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400				33230783;28358460		False	3	100;0;0	21.664	True		ENSG00000163541	ENSG00000163541	HGNC:11449													
SUCLG1	gene	SUCLG1	Expert Review Green;Other;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	mitochondrial DNA depletion syndrome 9 MONDO:0009504				30560055;29217198		False	3	100;0;0	21.664	True		ENSG00000163541	ENSG00000163541	HGNC:11449													
SUFU	gene	SUFU	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Joubert syndrome 32, MIM#617757;Neurodevelopmental disorder, MONDO:0700092, SUFU-related				33024317		False	3	100;0;0	21.664	True		ENSG00000107882	ENSG00000107882	HGNC:16466													
SUMF1	gene	SUMF1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple sulfatase deficiency (MIM#272200)				17360554;25885655;28566233		False	3	100;0;0	21.664	True		ENSG00000144455	ENSG00000144455	HGNC:20376													
SUMF1	gene	SUMF1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	General Leukodystrophy & Mitochondrial Leukoencephalopathy;Multiple sulfatase deficiency						False	3	0;0;0	21.664	False		ENSG00000144455	ENSG00000144455	HGNC:20376													
SUOX	gene	SUOX	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sulfite oxidase deficiency, MIM# 272300				27289259;23250141;24384336		False	3	100;0;0	21.664	True		ENSG00000139531	ENSG00000139531	HGNC:11460													
SUOX	gene	SUOX	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Sulfite oxidase deficiency, MIM#	272300"				9428520;15952210;31127934]		False	3	100;0;0	21.664	True		ENSG00000139531	ENSG00000139531	HGNC:11460													
SUOX	gene	SUOX	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sulfite oxidase deficiency, MIM# 272300				9428520;15952210;31127934		False	3	100;0;0	21.664	True		ENSG00000139531	ENSG00000139531	HGNC:11460													
SUOX	gene	SUOX	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sulfite oxidase deficiency MIM#272300				9600976;28933809;16140720		False	3	100;0;0	21.664	True		ENSG00000139531	ENSG00000139531	HGNC:11460													
SURF1	gene	SURF1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome, due to COX IV deficiency;Mitochondrial Leukoencephalopathy;Mitochondrial complex IV disorder						False	3	0;0;0	21.664	False		ENSG00000148290	ENSG00000148290	HGNC:11474													
SURF1	gene	SURF1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome, due to COX IV deficiency, 256000;HMSN;Leigh syndrome (early onset progressive neurodegeneration of the brain stem, basal ganglia and spinal cord), neuropathy with SNCV						False	3	100;0;0	21.664	False		ENSG00000148290	ENSG00000148290	HGNC:11474													
SURF1	gene	SURF1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 4K MIM#616684;Mitochondrial complex IV deficiency, nuclear type 1 MIM#220110				9843204;9837813;24027061		False	3	100;0;0	21.664	True		ENSG00000148290	ENSG00000148290	HGNC:11474													
SURF1	gene	SURF1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leigh syndrome, due to COX IV deficiency, MIM#	256000"				19780766		False	3	100;0;0	21.664	True		ENSG00000148290	ENSG00000148290	HGNC:11474													
SURF1	gene	SURF1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 1, MIM# 220110				9843204;9837813;24027061		False	3	100;0;0	21.664	True		ENSG00000148290	ENSG00000148290	HGNC:11474													
SVBP	gene	SVBP	Expert Review Green;Expert list;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, 618569				31363758;30607023		False	3	100;0;0	21.664	True		ENSG00000177868	ENSG00000177868	HGNC:29204													
SYN1	gene	SYN1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Epilepsy, X-linked, with variable learning disabilities and behaviour disorders, MIM# 300491;Intellectual developmental disorder, X-linked 50, MIM# 300115				14985377;21441247;28973667;21441247;34243774		False	3	100;0;0	21.664	True		ENSG00000008056	ENSG00000008056	HGNC:11494													
SYNE1	gene	SYNE1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 8, MIM#	610743"				23325900;27086870		False	3	100;0;0	21.664	True		ENSG00000131018	ENSG00000131018	HGNC:17089													
SYNE1	gene	SYNE1	Expert Review;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Emery-Dreifuss muscular dystrophy 4, autosomal dominant 612998						False	3	100;0;0	21.664	False		ENSG00000131018	ENSG00000131018	HGNC:17089													
SYNGAP1	gene	SYNGAP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability, autosomal dominant 5, MIM # 612621				26079862		False	3	100;0;0	21.664	True		ENSG00000197283	ENSG00000197283	HGNC:11497													
SYNJ1	gene	SYNJ1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 20, early-onset, MIM# 615530				23804563;23804577;27496670;33841314		False	3	100;0;0	21.664	True		ENSG00000159082	ENSG00000159082	HGNC:11503													
SYNJ1	gene	SYNJ1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile Parkinsonism;Parkinson disease 20, early-onset						False	3	0;0;0	21.664	False		ENSG00000159082	ENSG00000159082	HGNC:11503													
SYNJ1	gene	SYNJ1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 53, MIM# 617389				32435303;27435091;23804563;23804577;27496670;33841314		False	3	100;0;0	21.664	True		ENSG00000159082	ENSG00000159082	HGNC:11503													
SYT1	gene	SYT1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Baker-Gordon syndrome MIM#618218				30107533		False	3	100;0;0	21.664	True		ENSG00000067715	ENSG00000067715	HGNC:11509													
SYT2	gene	SYT2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myasthenic syndrome, congenital, 7, presynaptic;HMSN				25192047;30533528;26519543		False	3	100;0;0	21.664	False		ENSG00000143858	ENSG00000143858	HGNC:11510													
SZT2	gene	SZT2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 18, OMIM #615476				23932106;30560016;30359774;28556953;32402703		False	3	100;0;0	21.664	True		ENSG00000198198	ENSG00000198198	HGNC:29040													
TACO1	gene	TACO1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000136463	ENSG00000136463	HGNC:24316													
TACO1	gene	TACO1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial complex IV deficiency, nuclear type 8, MIM#	619052"				19503089;20727754;25044680;27319982		False	3	100;0;0	21.664	True		ENSG00000136463	ENSG00000136463	HGNC:24316													
TAF1C	gene	TAF1C	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder, TAF1C-related, MONDO:0100038				40371665;32779182		False	3	100;0;0	21.664	True		ENSG00000103168	ENSG00000103168	HGNC:11534													
TAF8	gene	TAF8	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with severe motor impairment, absent language, cerebral hypomyelination, and brain atrophy, MIM# 619972				29648665;35759269		False	3	100;0;0	21.664	True		ENSG00000137413	ENSG00000137413	HGNC:17300													
TAFAZZIN	gene	TAFAZZIN	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Barth syndrome, MIM# 302060						False	3	100;0;0	21.664	True		ENSG00000102125	ENSG00000102125	HGNC:11577													
TAFAZZIN	gene	TAFAZZIN	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Barth syndrome, MIM# 302060						False	3	100;0;0	21.664	True		ENSG00000102125	ENSG00000102125	HGNC:11577													
TAFAZZIN	gene	TAFAZZIN	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Barth syndrome MIM#302060				26845103		False	3	100;0;0	21.664	True		ENSG00000102125	ENSG00000102125	HGNC:11577													
TALDO1	gene	TALDO1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Transaldolase deficiency	, MIM#606003"						False	3	100;0;0	21.664	True		ENSG00000177156	ENSG00000177156	HGNC:11559													
TAMM41	gene	TAMM41	Expert Review Green;Other;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-56 (COXPD56), MIM#620139				35321494;29253589		False	3	100;0;0	21.664	True		ENSG00000144559	ENSG00000144559	HGNC:25187													
TAMM41	gene	TAMM41	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency-56 (COXPD56), MIM#620139;hypotonia;developmental delay;myopathy;ptosis				35321494;29253589		False	3	100;0;0	21.664	True		ENSG00000144559	ENSG00000144559	HGNC:25187													
TANC2	gene	TANC2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual developmental disorder with autistic features and language delay, with or without seizures MIM#618906				PMID: 31616000		False	3	100;0;0	21.664	True		ENSG00000170921	ENSG00000170921	HGNC:30212													
TANGO2	gene	TANGO2	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, 616878				26805781		False	3	100;0;0	21.664	True		ENSG00000183597	ENSG00000183597	HGNC:25439													
TANGO2	gene	TANGO2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, MIM#	616878"						False	3	100;0;0	21.664	True		ENSG00000183597	ENSG00000183597	HGNC:25439													
TANGO2	gene	TANGO2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metabolic encephalomyopathic crises recurrent with rhabdomyolysis cardiac arrhythmias and neurodegeneration, 616878				26805782;30245509		False	3	100;0;0	21.664	True		ENSG00000183597	ENSG00000183597	HGNC:25439													
TARDBP	gene	TARDBP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 10, with or without FTD;Frontotemporal lobar degeneration, TARDBP-related (MIM#612069;MONDO: 0012790)				20301761;18309045;19609911		False	3	100;0;0	21.664	True		ENSG00000120948	ENSG00000120948	HGNC:11571													
TARDBP	gene	TARDBP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069)				20301761;21803454		False	3	100;0;0	21.664	True		ENSG00000120948	ENSG00000120948	HGNC:11571													
TARDBP	gene	TARDBP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia with motor neuron disease MONDO:0017161				36247987		False	3	100;0;0	21.664	True		ENSG00000120948	ENSG00000120948	HGNC:11571													
TARS2	gene	TARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 21, MIM# 615918				24827421;26811336;33153448;34508595		False	3	50;50;0	21.664	True		ENSG00000143374	ENSG00000143374	HGNC:30740													
TARS2	gene	TARS2	Expert Review Green;Expert Review Green;Literature;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 21 - 615918;Epilepsy				33153448;24827421;34508595		False	3	50;50;0	21.664	True		ENSG00000143374	ENSG00000143374	HGNC:30740													
TAT	gene	TAT	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Tyrosinemia, type II, MIM#	276600"						False	3	100;0;0	21.664	True		ENSG00000198650	ENSG00000198650	HGNC:11573													
TBC1D23	gene	TBC1D23	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 11, 617695				28823707;28823706		False	3	100;0;0	21.664	True		ENSG00000036054	ENSG00000036054	HGNC:25622													
TBC1D24	gene	TBC1D24	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 16, MIM# 615338;Intellectual disability;Parkinsonism;Seizures;Psychosis				PMID: 28663785;21087195		False	3	100;0;0	21.664	True		ENSG00000162065	ENSG00000162065	HGNC:29203													
TBC1D24	gene	TBC1D24	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 16 MIM#615338;DOORS syndrome MIM#220500;Epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer's cramp MIM#608105;Myoclonic epilepsy, infantile, familial MIM#605021						False	3	100;0;0	21.664	True		ENSG00000162065	ENSG00000162065	HGNC:29203													
TBC1D2B	gene	TBC1D2B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with seizures and gingival overgrowth (NEDSGO), MIM#619323;Global developmental delay;Intellectual disability;Seizures;Gingival overgrowth;Behavioral abnormality;Abnormality of the mandible;Abnormality of brain morphology;Abnormality of the eye;Hearing abnormality				32623794		False	3	100;0;0	21.664	True		ENSG00000167202	ENSG00000167202	HGNC:29183													
TBCD	gene	TBCD	Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193				27666370;27666374		False	3	100;0;0	21.664	True		ENSG00000141556	ENSG00000141556	HGNC:11581													
TBCE	gene	TBCE	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Encephalopathy, progressive, with amyotrophy and optic atrophy	617207"				PMID: 27666369		False	3	100;0;0	21.664	True		-	ENSG00000284770	HGNC:11582													
TBCE	gene	TBCE	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypoparathyroidism-retardation-dysmorphism syndrome, MIM# 241410				28138323;35935360		False	3	50;50;0	21.664	True		-	ENSG00000284770	HGNC:11582													
TBCE	gene	TBCE	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, with amyotrophy and optic atrophy, OMIM #617207				PubMed: 27666369		False	3	100;0;0	21.664	True		-	ENSG00000284770	HGNC:11582													
TBCK	gene	TBCK	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, MIM# 616900				27040692;30103036;27040691		False	3	100;0;0	21.664	True		ENSG00000145348	ENSG00000145348	HGNC:28261													
TBK1	gene	TBK1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 4, MIM# 616439				20301623		False	3	100;0;0	21.664	True		ENSG00000183735	ENSG00000183735	HGNC:11584													
TBK1	gene	TBK1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 4 (MIM#616439;MONDO:0011223)				20301623;25803835		False	3	100;0;0	21.664	True		ENSG00000183735	ENSG00000183735	HGNC:11584													
TBK1	gene	TBK1	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia with motor neuron disease MONDO:0017161;Disorders of autophagy				38168426;38517332;29884839		False	3	0;0;0	21.664	False		ENSG00000183735	ENSG00000183735	HGNC:11584													
TBL1XR1	gene	TBL1XR1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability, autosomal dominant 41, MIM# 616944;Pierpont syndrome, MIM# 602342				26769062;30365874;25425123;9450851;23160955;28687524;23176139;16007632		False	3	100;0;0	21.664	True		ENSG00000177565	ENSG00000177565	HGNC:29529													
TBX19	gene	TBX19	Expert Review Green;Literature;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adrenocorticotropic hormone deficiency - 201400				31998673		False	3	100;0;0	21.664	True		ENSG00000143178	ENSG00000143178	HGNC:11596													
TCAP	gene	TCAP	Expert Review Green;Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, type 2G, 601954				25055047;22029105;18948002		False	3	100;0;0	21.664	True		ENSG00000173991	ENSG00000173991	HGNC:11610													
TCF4	gene	TCF4	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Pitt-Hopkins syndrome, MIM# 610954				18728071;22934316		False	3	100;0;0	21.664	True		ENSG00000196628	ENSG00000196628	HGNC:11634													
TCP1	gene	TCP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021				39480921		False	3	100;0;0	21.664	True		ENSG00000120438	ENSG00000120438	HGNC:11655													
TCTN1	gene	TCTN1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 13, MIM#	614173"				31302911;28631893;21725307;26477546;26489806		False	3	100;0;0	21.664	True		ENSG00000204852	ENSG00000204852	HGNC:26113													
TCTN2	gene	TCTN2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 24, MIM#	616654"				25118024;21565611		False	3	100;0;0	21.664	True		ENSG00000168778	ENSG00000168778	HGNC:25774													
TCTN3	gene	TCTN3	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 18, MIM# 614815;Orofaciodigital syndrome IV, MIM# 258860				22883145;25118024		False	3	100;0;0	21.664	True		ENSG00000119977	ENSG00000119977	HGNC:24519													
TDP2	gene	TDP2	Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 23				31410782;30109272;24658003		False	3	100;0;0	21.664	True		ENSG00000111802	ENSG00000111802	HGNC:17768													
TDP2	gene	TDP2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 23, 616949				24658003;30109272;31410782		False	3	100;0;0	21.664	True		ENSG00000111802	ENSG00000111802	HGNC:17768													
TECPR2	gene	TECPR2	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of autophagy;hereditary spastic paraplegia 49 MONDO:0014016				33213269;34130600;29884839		False	3	0;0;0	21.664	False		ENSG00000196663	ENSG00000196663	HGNC:19957													
TECPR2	gene	TECPR2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 49, autosomal recessive, 615031;Autonomic-sensory neuropathy				23176824;26542466		False	3	100;0;0	21.664	True		ENSG00000196663	ENSG00000196663	HGNC:19957													
TECPR2	gene	TECPR2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 49, autosomal recessive;HSAN/SFN						False	3	100;0;0	21.664	False		ENSG00000196663	ENSG00000196663	HGNC:19957													
TEFM	gene	TEFM	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 58, MIM# 620451				36823193		False	3	100;0;0	21.664	True		ENSG00000172171	ENSG00000172171	HGNC:26223													
TEFM	gene	TEFM	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 58, MIM# 620451				36823193		False	3	100;0;0	21.664	True		ENSG00000172171	ENSG00000172171	HGNC:26223													
TET3	gene	TET3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Beck-Fahrner syndrome MIM#618798				36192301		False	3	50;50;0	21.664	True		ENSG00000187605	ENSG00000187605	HGNC:28313													
TF	gene	TF	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	209300 Atransferrinemia;209300 Atransferrinemia, Hypoferritinaemia				15466165;11110675		False	3	100;0;0	21.664	False		ENSG00000091513	ENSG00000091513	HGNC:11740													
TFAM	gene	TFAM	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial DNA depletion syndrome 15 (hepatocerebral type)	MIM#617156"				27448789;29021295;9500544;32399598;34647195;34647195		False	3	50;50;0	21.664	True		ENSG00000108064	ENSG00000108064	HGNC:11741													
TFE3	gene	TFE3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Intellectual developmental disorder, X-linked, syndromic, with pigmentary mosaicism and coarse facies, MIM# 301066;Intellectual disability;Epilepsy;Coarse facial features				30595499;31833172;32409512		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000068323	ENSG00000068323	HGNC:11752													
TFG	gene	TFG	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary motor and sensory neuropathy, Okinawa type, MIM# 604484				25098539;23553329;22883144;31449671;31111683		False	3	100;0;0	21.664	False		ENSG00000114354	ENSG00000114354	HGNC:11758													
TFG	gene	TFG	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 57, autosomal recessive, MIM# 615658				30467354;30157421;28124177;27601211;27492651;23479643		False	3	100;0;0	21.664	True		ENSG00000114354	ENSG00000114354	HGNC:11758													
TFR2	gene	TFR2	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	604250 Hemochromatosis, type 3;HFE3;604250 HEMOCHROMATOSIS, TYPE 3				11313241;10802645		False	3	0;0;0	21.664	False		ENSG00000106327	ENSG00000106327	HGNC:11762													
TH	gene	TH	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Tyrosine hydroxylase deficiency MONDO:0100064				20301334;20301610		False	3	100;0;0	21.664	True		ENSG00000180176	ENSG00000180176	HGNC:11782													
TH	gene	TH	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Segawa syndrome, recessive, MIM# 605407;MONDO:0011551						False	3	100;0;0	21.664	False		ENSG00000180176	ENSG00000180176	HGNC:11782													
TH	gene	TH	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Segawa syndrome, recessive , MIM#605407				17696123;11246459;10585338		False	3	100;0;0	21.664	True		ENSG00000180176	ENSG00000180176	HGNC:11782													
THAP1	gene	THAP1	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Dystonia 6, torsion, 602629;Dystonia;MONDO:0011264				21793105;22377579;36205328;21425335;20211909		False	3	100;0;0	21.664	False		ENSG00000131931	ENSG00000131931	HGNC:20856													
TIAM1	gene	TIAM1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with language delay and seizures, MIM# 619908						False	3	100;0;0	21.664	True		ENSG00000156299	ENSG00000156299	HGNC:11805													
TIMM50	gene	TIMM50	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type IX, MIM#617698				27573165;30190335;31058414		False	3	100;0;0	21.664	True		ENSG00000105197	ENSG00000105197	HGNC:23656													
TIMM50	gene	TIMM50	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type IX, MIM# 617698				27573165;32369862;30190335;31058414		False	3	100;0;0	21.664	True		ENSG00000105197	ENSG00000105197	HGNC:23656													
TIMM8A	gene	TIMM8A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Deafness-Dystonia-Optic Neuronopathy Syndrome;Mohr-Tranebjaerg syndrome, MIM# 304700				11803487;11405816;32820032		False	3	100;0;0	21.664	True		ENSG00000126953	ENSG00000126953	HGNC:11817													
TIMM8A	gene	TIMM8A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mohr-Tranebjaerg syndrome, MIM# 304700				11803487;11405816;32820032		False	3	100;0;0	21.664	True		ENSG00000126953	ENSG00000126953	HGNC:11817													
TIMMDC1	gene	TIMMDC1	Expert Review Green;Expert Review Green;NHS GMS;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 31 MIM#618251				28604674;30981218		False	3	33;67;0	21.664	True		ENSG00000113845	ENSG00000113845	HGNC:1321													
TINF2	gene	TINF2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant dyskeratosis congenita 3, 613990;Revesz syndrome, 268130				18252230;21477109;18979121		False	3	100;0;0	21.664	True		ENSG00000092330	ENSG00000092330	HGNC:11824													
TINF2	gene	TINF2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Revesz syndrome, MIM#	268130"				21477109;18252230		False	3	100;0;0	21.664	True		ENSG00000092330	ENSG00000092330	HGNC:11824													
TK2	gene	TK2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 2 (myopathic type), 609560				33457207		False	3	100;0;0	21.664	True		ENSG00000166548	ENSG00000166548	HGNC:11831													
TK2	gene	TK2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 2 (myopathic type), MIM# 609560;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 3, MIM# 617069				11687801;12391347;12873860;35286480;35280287;35094997		False	3	100;0;0	21.664	True		ENSG00000166548	ENSG00000166548	HGNC:11831													
TK2	gene	TK2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 2 (myopathic type), MIM#609560;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 3, MIM# 617069				25446393;16504786		False	3	100;0;0	21.664	True		ENSG00000166548	ENSG00000166548	HGNC:11831													
TMEM106B	gene	TMEM106B	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Australian Genomcis Health Alliance Leukodystrophy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, hypomyelinating 16, MIM#617964						False	3	100;0;0	21.664	False		ENSG00000106460	ENSG00000106460	HGNC:22407													
TMEM106B	gene	TMEM106B	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypomyelinating leukodystrophy 16, 617964				29186371;29444210		False	3	100;0;0	21.664	True		ENSG00000106460	ENSG00000106460	HGNC:22407													
TMEM126A	gene	TMEM126A	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of complex I subunits and assembly factors;autosomal recessive optic atrophy, OPA7 type MONDO:0013069				29884839;33879611;31119195;30961538;19327736;20405026		False	3	100;0;0	21.664	True		ENSG00000171202	ENSG00000171202	HGNC:25382													
TMEM126B	gene	TMEM126B	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	mitochondrial complex 1 deficiency, nuclear type 29 MONDO:0032633				27374774;27374773		False	3	100;0;0	21.664	True		ENSG00000171204	ENSG00000171204	HGNC:30883													
TMEM126B	gene	TMEM126B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 29, MIM# 618250				27374774;27374773		False	3	100;0;0	21.664	True		ENSG00000171204	ENSG00000171204	HGNC:30883													
TMEM161B	gene	TMEM161B	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, TMEM161B-related				37486637;36669109;36669111		False	3	100;0;0	21.664	True		ENSG00000164180	ENSG00000164180	HGNC:28483													
TMEM163	gene	TMEM163	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hypomyelinating leukodystrophy, MONDO:0019046				PMID: 35953447;35455965		False	3	100;0;0	21.664	True		ENSG00000152128	ENSG00000152128	HGNC:25380													
TMEM163	gene	TMEM163	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hypomyelinating leukodystrophy, MONDO:0019046				PMID: 35953447		False	3	100;0;0	21.664	True		ENSG00000152128	ENSG00000152128	HGNC:25380													
TMEM165	gene	TMEM165	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIk, MIM# 614727;TMEM165-CDG, MONDO:0013870				22683087;28323990;27401145;27008884;26238249;25609749		False	3	100;0;0	21.664	True		ENSG00000134851	ENSG00000134851	HGNC:30760													
TMEM167A	gene	TMEM167A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related				PMID: 40924476		False	3	100;0;0	21.664	True		ENSG00000174695	ENSG00000174695	HGNC:28330													
TMEM184B	gene	TMEM184B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO:0700092), TMEM184B-related				39006436		False	3	100;0;0	21.664	True		ENSG00000198792	ENSG00000198792	HGNC:1310													
TMEM216	gene	TMEM216	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 2, MIM#	608091"				20036350;20512146		False	3	100;0;0	21.664	True		ENSG00000187049	ENSG00000187049	HGNC:25018													
TMEM222	gene	TMEM222	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470;Motor delay;Delayed speech and language development;Intellectual disability;Generalized hypotonia;Broad-based gait;Abnormality of nervous system morphology;Seizures;Microcephaly;Behavioral abnormality				33824500		False	3	50;50;0	21.664	True		ENSG00000186501	ENSG00000186501	HGNC:25363													
TMEM237	gene	TMEM237	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 14, MIM#	614424"						False	3	100;0;0	21.664	True		ENSG00000155755	ENSG00000155755	HGNC:14432													
TMEM240	gene	TMEM240	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 21, MIM#	607454"				25070513		False	3	100;0;0	21.664	True		ENSG00000205090	ENSG00000205090	HGNC:25186													
TMEM63A	gene	TMEM63A	Expert Review Green;Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukodystrophy, hypomyelinating, 19, transient infantile 618688				31587869		False	3	100;0;0	21.664	False		ENSG00000196187	ENSG00000196187	HGNC:29118													
TMEM63B	gene	TMEM63B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 118, MIM# 621250				37421948		False	3	100;0;0	21.664	True		ENSG00000137216	ENSG00000137216	HGNC:17735													
TMEM63C	gene	TMEM63C	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 87, autosomal recessive, MIM# 619966				PMID: 35718349		False	3	100;0;0	21.664	True		ENSG00000165548	ENSG00000165548	HGNC:23787													
TMEM67	gene	TMEM67	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 6, MIM#	610688"						False	3	100;0;0	21.664	True		ENSG00000164953	ENSG00000164953	HGNC:28396													
TMEM70	gene	TMEM70	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2, MIM# 614052				18953340;21147908;30950220		False	3	100;0;0	21.664	True		ENSG00000175606	ENSG00000175606	HGNC:26050													
TMPRSS6	gene	TMPRSS6	NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	IRIDA;206200 Iron-refractory iron deficiency anemia;206200 IRON-REFRACTORY IRON DEFICIENCY ANEMIA				19357398;18408718		False	3	100;0;0	21.664	False		ENSG00000187045	ENSG00000187045	HGNC:16517													
TMTC3	gene	TMTC3	Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lissencephaly 8, MIM#617255				27773428;28973161;32973946		False	3	100;0;0	21.664	True		ENSG00000139324	ENSG00000139324	HGNC:26899													
TMX2	gene	TMX2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly;ID;brain malformations;seizures				31735293;31586943		False	3	100;0;0	21.664	True		ENSG00000213593	ENSG00000213593	HGNC:30739													
TNPO2	gene	TNPO2	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM# 619556				34314705		False	3	100;0;0	21.664	True	Other	ENSG00000105576	ENSG00000105576	HGNC:19998													
TNPO2	gene	TNPO2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM#	619556"				34314705		False	3	100;0;0	21.664	True		ENSG00000105576	ENSG00000105576	HGNC:19998													
TNPO3	gene	TNPO3	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Muscular dystrophy, limb-girdle, autosomal dominant 2, 608423				23667635;23543484;31071488;31192305		False	3	100;0;0	21.664	True	Other	ENSG00000064419	ENSG00000064419	HGNC:17103													
TOMM7	gene	TOMM7	Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Garg-Mishra progeroid syndrome, MIM# 620601				36299998;36282599;39615461		False	3	50;50;0	21.664	True		ENSG00000196683	ENSG00000196683	HGNC:21648													
TOP3A	gene	TOP3A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, growth restriction, and increased sister chromatid exchange 2, MIM# 618097;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 5, MIM#618098				30057030;33631320;29290614		False	3	100;0;0	21.664	True		ENSG00000177302	ENSG00000177302	HGNC:11992													
TOR1A	gene	TOR1A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant or sporadic dystonia (DYT1);Early-Onset Primary Dystonia;Dystonia-1, torsion, 128100				9288096;19955557;18477710;32243914;31583275;31347572		False	3	100;0;0	21.664	False		ENSG00000136827	ENSG00000136827	HGNC:3098													
TPK1	gene	TPK1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type), MIM# 614458				22152682;33626592;33231275;33086386		False	3	100;0;0	21.664	True		ENSG00000196511	ENSG00000196511	HGNC:17358													
TPK1	gene	TPK1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type);Dystonia						False	3	0;0;0	21.664	False		ENSG00000196511	ENSG00000196511	HGNC:17358													
TPK1	gene	TPK1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type) MIM#614458				PMID: 37622082		False	3	100;0;0	21.664	True		ENSG00000196511	ENSG00000196511	HGNC:17358													
TPP1	gene	TPP1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia 7, 609270;Neuronal ceroid lipofuscinosis, 204500;Spinocerebellar ataxia, autosomal recessive 7, 609270;Ceroid lipofuscinosis, neuronal, 2, 204500						False	3	100;0;0	21.664	False		ENSG00000166340	ENSG00000166340	HGNC:2073													
TPP1	gene	TPP1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;MONDO:0008769				9295267;18684116;23418007;26224725;31283065		False	3	100;0;0	21.664	True		ENSG00000166340	ENSG00000166340	HGNC:2073													
TPP1	gene	TPP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;Parkinsonism				PMID: 21940688		False	3	100;0;0	21.664	True		ENSG00000166340	ENSG00000166340	HGNC:2073													
TPP1	gene	TPP1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;MONDO:0008769;Spinocerebellar ataxia, autosomal recessive 7, MIM# 609270;MONDO:0012235				9295267;18684116;23418007;26224725;31283065		False	3	100;0;0	21.664	True		ENSG00000166340	ENSG00000166340	HGNC:2073													
TPP2	gene	TPP2	Expert Review;Expert Review Green;Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220				25414442		False	3	100;0;0	21.664	False		ENSG00000134900	ENSG00000134900	HGNC:12016													
TRA2B	gene	TRA2B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Ramond-Elliott neurodevelopmental syndrome, MIM# 621421				PMID: 36549593		False	3	100;0;0	21.664	True		ENSG00000136527	ENSG00000136527	HGNC:10781													
TRAF7	gene	TRAF7	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cardiac, facial, and digital anomalies with developmental delay, MIM#618164				29961569;27479843;28135719;25363760;25961944;38569228		False	3	50;50;0	21.664	True		ENSG00000131653	ENSG00000131653	HGNC:20456													
TRAK1	gene	TRAK1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 68, MIM# 618201				28940097;28364549;29846532;28924745		False	3	100;0;0	21.664	True		ENSG00000182606	ENSG00000182606	HGNC:29947													
TRAK1	gene	TRAK1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 68, MIM# 618201				28940097;28364549;29846532;28924745		False	3	100;0;0	21.664	True		ENSG00000182606	ENSG00000182606	HGNC:29947													
TRAPPC10	gene	TRAPPC10	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, short stature, and speech delay, MIM# 620027				PMID: 35298461;30167849		False	3	100;0;0	21.664	True		ENSG00000160218	ENSG00000160218	HGNC:11868													
TRAPPC11	gene	TRAPPC11	Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, type 2S, 615356				23830518;26322222;29855340;30105108		False	3	100;0;0	21.664	True		ENSG00000168538	ENSG00000168538	HGNC:25751													
TRAPPC12	gene	TRAPPC12	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM#617669				28777934		False	3	0;100;0	21.664	True		ENSG00000171853	ENSG00000171853	HGNC:24284													
TRAPPC4	gene	TRAPPC4	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with epilepsy, spasticity, and brain atrophy, MIM# 618741				31794024		False	3	100;0;0	21.664	True		ENSG00000196655	ENSG00000196655	HGNC:19943													
TRAPPC6B	gene	TRAPPC6B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862				28626029;28397838;31687267		False	3	100;0;0	21.664	True		ENSG00000182400	ENSG00000182400	HGNC:23066													
TRAPPC9	gene	TRAPPC9	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder, autosomal recessive 13	MIM#613192"				PMID: 35042660		False	3	50;50;0	21.664	True		ENSG00000167632	ENSG00000167632	HGNC:30832													
TREM2	gene	TREM2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM#	618193"				12080485;15883308		False	3	100;0;0	21.664	True		ENSG00000095970	ENSG00000095970	HGNC:17761													
TREM2	gene	TREM2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, 618193				12080485;15883308		False	3	100;0;0	21.664	False		ENSG00000095970	ENSG00000095970	HGNC:17761													
TREM2	gene	TREM2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193;{Alzhieimer disease 17, susceptibility to}, MIM# 615080				12080485;15883308		False	3	100;0;0	21.664	True		ENSG00000095970	ENSG00000095970	HGNC:17761													
TREM2	gene	TREM2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2 MIM#618193				PMID: 36820836;24910390		False	3	100;0;0	21.664	True		ENSG00000095970	ENSG00000095970	HGNC:17761													
TREX1	gene	TREX1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 1, dominant and recessive, MIM#	225750;Disorder of nucleotide metabolism"						False	3	100;0;0	21.664	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TREX1	gene	TREX1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 1, dominant and recessive MIM#225750				20131292		False	3	100;0;0	21.664	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TREX1	gene	TREX1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations	MONDO:0008641"				29380913;35699195;36586737;35307828		False	3	100;0;0	21.664	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TREX1	gene	TREX1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Aicardi-Goutieres syndrome 1, dominant and recessive;Chilblain lupus;{Systemic lupus erythematosus, susceptibility to};Vasculopathy, retinal, with cerebral leukodystrophy				21937424		False	3	100;0;0	21.664	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TREX1	gene	TREX1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 1, dominant and recessive, MIM# 225750				17846997		False	3	100;0;0	21.664	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TREX1	gene	TREX1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Aicardi-Goutieres syndrome 1, dominant and recessive, MIM#	225750"						False	3	100;0;0	21.664	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TRIM2	gene	TRIM2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 2R, MIM# 615490;MONDO:0014208;HMSN				23562820;25893792;18687884;32815244;32205255;25893792		False	3	100;0;0	21.664	False		ENSG00000109654	ENSG00000109654	HGNC:15974													
TRIM32	gene	TRIM32	Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, type 2H, 254110						False	3	50;0;50	21.664	False		ENSG00000119401	ENSG00000119401	HGNC:16380													
TRIM37	gene	TRIM37	Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	21.664	False		ENSG00000108395	ENSG00000108395	HGNC:7523													
TRIM8	gene	TRIM8	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Focal segmental glomerulosclerosis and neurodevelopmental syndrome, MIM# 619428;Intellectual disability;Seizures				30244534;27346735;23934111		False	3	100;0;0	21.664	True		ENSG00000171206	ENSG00000171206	HGNC:15579													
TRIO	gene	TRIO	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 44, with microcephaly MIM#617061;Intellectual developmental disorder, autosomal dominant 63, with macrocephaly MIM#618825						False	3	100;0;0	21.664	True		ENSG00000038382	ENSG00000038382	HGNC:12303													
TRIP4	gene	TRIP4	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinal muscular atrophy with congenital bone fractures 1, MIM# 616866				26924529		False	3	100;0;0	21.664	True		ENSG00000103671	ENSG00000103671	HGNC:12310													
TRIT1	gene	TRIT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 35, MIM#617873				32088416;24901367;28185376;30977854		False	3	100;0;0	21.664	True		ENSG00000043514	ENSG00000043514	HGNC:20286													
TRIT1	gene	TRIT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 35 MIM#617873				PMID: 36047296;36049610		False	3	100;0;0	21.664	True		ENSG00000043514	ENSG00000043514	HGNC:20286													
TRMT1	gene	TRMT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Intellectual developmental disorder, autosomal recessive 68	MIM#618302"				PMID: 31898845;26308914;30289604		False	3	100;0;0	21.664	True		ENSG00000104907	ENSG00000104907	HGNC:25980													
TRMT10A	gene	TRMT10A	Expert Review Green;Expert list;Expert Review;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, short stature, and impaired glucose metabolism 1, MIM# 616033				26535115;4995728		False	3	100;0;0	21.664	True		ENSG00000145331	ENSG00000145331	HGNC:28403													
TRMT10C	gene	TRMT10C	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 30, MIM# 616974				27132592;33886802		False	3	100;0;0	21.664	True		ENSG00000174173	ENSG00000174173	HGNC:26022													
TRMT5	gene	TRMT5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 26, MIM# 616539				26189817;35342985;35109800;29021354		False	3	100;0;0	21.664	True		ENSG00000126814	ENSG00000126814	HGNC:23141													
TRMU	gene	TRMU	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Liver failure, transient infantile, MIM# 613070				19732863		False	3	100;0;0	21.664	True		ENSG00000100416	ENSG00000100416	HGNC:25481													
TRNT1	gene	TRNT1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Retinitis pigmentosa and erythrocytic microcytosis, MIM# 616959;Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084				25193871;23553769;29170023;27389523;26494905		False	3	100;0;0	21.664	True		ENSG00000072756	ENSG00000072756	HGNC:17341													
TRPM3	gene	TRPM3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224				31278393;35146895		False	3	100;0;0	21.664	True		ENSG00000083067	ENSG00000083067	HGNC:17992													
TRPM3	gene	TRPM3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224				31278393		False	3	100;0;0	21.664	True		ENSG00000083067	ENSG00000083067	HGNC:17992													
TRPM6	gene	TRPM6	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomagnesemia 1, intestinal, MIM#602014						False	3	100;0;0	21.664	True		ENSG00000119121	ENSG00000119121	HGNC:17995													
TRPM6	gene	TRPM6	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomagnesemia 1, intestinal MONDO:0011176, Disorders of magnesium metabolism				23942199		False	3	0;0;0	21.664	False		ENSG00000119121	ENSG00000119121	HGNC:17995													
TRPM7	gene	TRPM7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Familial primary hypomagnesaemia, MONDO:0018100, TRPM7-related				35561741;35712613;39099563;37188671		False	3	100;0;0	21.664	True		ENSG00000092439	ENSG00000092439	HGNC:17994													
TRPV4	gene	TRPV4	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	HMSN, dHMN/dSMA;Hereditary motor and sensory neuropathy, type IIc, MIM# 606071;Neuronopathy, distal hereditary motor, type VIII, MIM# 600175						False	3	100;0;0	21.664	False		ENSG00000111199	ENSG00000111199	HGNC:18083													
TRRAP	gene	TRRAP	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay with or without dysmorphic facies and autism, MIM#618454				30827496;28628100		False	3	100;0;0	21.664	True		ENSG00000196367	ENSG00000196367	HGNC:12347													
TSC1	gene	TSC1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tuberous sclerosis 1, MIM# 191100						False	3	100;0;0	21.664	True		ENSG00000165699	ENSG00000165699	HGNC:12362													
TSC1	gene	TSC1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tuberous sclerosis 1, MIM# 191100						False	3	100;0;0	21.664	True		ENSG00000165699	ENSG00000165699	HGNC:12362													
TSC2	gene	TSC2	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tuberous sclerosis 2, MIM# 613254				21175459;30628968;19258292;28786492		False	3	100;0;0	21.664	True		ENSG00000103197	ENSG00000103197	HGNC:12363													
TSC2	gene	TSC2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Tuberous sclerosis 2, MIM# 613254						False	3	100;0;0	21.664	True		ENSG00000103197	ENSG00000103197	HGNC:12363													
TSEN2	gene	TSEN2	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 2F, MIM#617026				23562994;18711368;20952379		False	3	50;0;50	21.664	True		ENSG00000154743	ENSG00000154743	HGNC:28422													
TSEN54	gene	TSEN54	Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2A, MIM# 277470						False	3	50;0;50	21.664	True		ENSG00000182173	ENSG00000182173	HGNC:27561													
TSFM	gene	TSFM	Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 3 610505				31267352;17033963		False	3	100;0;0	21.664	True		ENSG00000123297	ENSG00000123297	HGNC:12367													
TSFM	gene	TSFM	Expert Review Green;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 3						False	3	100;0;0	21.664	True		ENSG00000123297	ENSG00000123297	HGNC:12367													
TSFM	gene	TSFM	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 3, MIM# 610505				25037205;22499341		False	3	100;0;0	21.664	True		ENSG00000123297	ENSG00000123297	HGNC:12367													
TSFM	gene	TSFM	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 3, MIM#610505						False	3	100;0;0	21.664	True		ENSG00000123297	ENSG00000123297	HGNC:12367													
TSPOAP1	gene	TSPOAP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 22, MIM# 620453				33539324		False	3	100;0;0	21.664	True		ENSG00000005379	ENSG00000005379	HGNC:16831													
TSPOAP1	gene	TSPOAP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, intellectual disability and cerebellar atrophy				33539324		False	3	100;0;0	21.664	True		ENSG00000005379	ENSG00000005379	HGNC:16831													
TSPYL1	gene	TSPYL1	Expert Review Green;Literature;Expert list;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sudden infant death with dysgenesis of the testes syndrome - 608800;sudden infant death-dysgenesis of the testes syndrome MONDO:0012124				32885560;15273283;33075815;36082874		False	3	75;25;0	21.664	True		ENSG00000189241	ENSG00000189241	HGNC:12382													
TTBK2	gene	TTBK2	Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11						False	3	50;50;0	21.664	False		ENSG00000128881	ENSG00000128881	HGNC:19141													
TTC19	gene	TTC19	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency nuclear type II, 615157;Mitochondrial complex III deficiency, nuclear type 2, 615157						False	3	100;0;0	21.664	True		ENSG00000011295	ENSG00000011295	HGNC:26006													
TTC19	gene	TTC19	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 2, MIM#615157				21278747;23532514;24368687;24397319		False	3	100;0;0	21.664	True		ENSG00000011295	ENSG00000011295	HGNC:26006													
TTC19	gene	TTC19	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 2, MIM#615157				40946707;37927170;25652355		False	3	100;0;0	21.664	True		ENSG00000011295	ENSG00000011295	HGNC:26006													
TTI1	gene	TTI1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445				26539891;30315573;36724785		False	3	50;25;25	21.664	True		ENSG00000101407	ENSG00000101407	HGNC:29029													
TTN	gene	TTN	Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	dilated cardiomyopathy;Distal myopathy;HMERF;Myofibrillar myopathy;Congenital myopathy;Muscular dystrophy, limb-girdle, type 2J, 608807;arthrogryposis						False	3	100;0;0	21.664	False		ENSG00000155657	ENSG00000155657	HGNC:12403													
TTPA	gene	TTPA	Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia with vitamin E deficiency;Early-onset ataxia and sensory axonal neuropathy similar to Friedreich s ataxia, head titubation, normal fat absorption unlike abetalipoproteinemia, rarely retinitis pigmentosa						False	3	100;0;0	21.664	False		ENSG00000137561	ENSG00000137561	HGNC:12404													
TTPA	gene	TTPA	Expert Review Green;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia with isolated vitamin E deficiency MIM#277460;disorders of vitamins and cofactors				27604308;7719340		False	3	100;0;0	21.664	True		ENSG00000137561	ENSG00000137561	HGNC:12404													
TTPA	gene	TTPA	NHS GMS;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ataxia with isolated vitamin E deficiency, MIM#	277460"						False	3	100;0;0	21.664	True		ENSG00000137561	ENSG00000137561	HGNC:12404													
TTR	gene	TTR	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyloidosis, hereditary, transthyretin-related, MIM# 105210				20301373		False	3	100;0;0	21.664	True		ENSG00000118271	ENSG00000118271	HGNC:12405													
TTR	gene	TTR	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hereditary amyloidosis;Amyloidosis, hereditary, transthyretin-related, 105210;Familial amyloid polyneuropathy;Carpal tunnel syndrome, familial, 115430				14640030;26800456;12771253;30120737;16433699;25069833;30878017;31111153;31118583;28678039;19365058;31131842;8309582;The Metabolic and Molecular Bases of Inherited Disease. Vol. IV. 8th ed.Benson, M. D. Amyloidosis. In: Scriver, C. R et al.: New York: McGraw-Hill . 2001;3011930		False	3	0;0;0	21.664	False		ENSG00000118271	ENSG00000118271	HGNC:12405													
TTR	gene	TTR	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyloidosis, hereditary, transthyretin-related MIM#105210;Cardiomyopathy;Amyloidogenic transthyretin amyloidosis;HSAN/SFN				20301373;8071954;19180884;24101130		False	3	100;0;0	21.664	True		ENSG00000118271	ENSG00000118271	HGNC:12405													
TUBA1A	gene	TUBA1A	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lissencephaly 3, MIM# 611603						False	3	67;0;33	21.664	True		ENSG00000167552	ENSG00000167552	HGNC:20766													
TUBA4A	gene	TUBA4A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic ataxia 11, autosomal dominant, MIM# 621226				38884572;37418012		False	3	100;0;0	21.664	True	Other	ENSG00000127824	ENSG00000127824	HGNC:12407													
TUBA4A	gene	TUBA4A	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208				25374358;28069311;35327632;34169147;38884572;33760283;26675813		False	3	50;50;0	21.664	True		ENSG00000127824	ENSG00000127824	HGNC:12407													
TUBA4A	gene	TUBA4A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary ataxia MONDO:0100309, TUBA4A-related				38884572;37418012		False	3	100;0;0	21.664	True	Other	ENSG00000127824	ENSG00000127824	HGNC:12407													
TUBA4A	gene	TUBA4A	Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208				25374358;25893256;28069311;38463699;38884572;26675813		False	3	50;50;0	21.664	True		ENSG00000127824	ENSG00000127824	HGNC:12407													
TUBB	gene	TUBB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 6, MIM# 615771				23246003;32085672		False	3	100;0;0	21.664	True		ENSG00000196230	ENSG00000196230	HGNC:20778													
TUBB2A	gene	TUBB2A	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 5, MIM#615763				24702957;25326637		False	3	50;0;50	21.664	True		ENSG00000137267	ENSG00000137267	HGNC:12412													
TUBB2B	gene	TUBB2B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 7, MIM# 610031				19465910;22333901;26732629;33082561		False	3	100;0;0	21.664	True		ENSG00000137285	ENSG00000137285	HGNC:30829													
TUBB3	gene	TUBB3	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Fibrosis of extraocular muscles, congenital, 3A (MIM#600638);Neuropathy				20074521;34652576		False	3	50;50;0	21.664	True		ENSG00000258947	ENSG00000258947	HGNC:20772													
TUBB3	gene	TUBB3	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 1, MIM# 614039				20829227;25059107;33318778		False	3	100;0;0	21.664	True		ENSG00000258947	ENSG00000258947	HGNC:20772													
TUBB4A	gene	TUBB4A	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukodystrophy, hypomyelinating, 6, 612438;Dystonia 4, 128101, Hypomyelinating leukodystrophy 6, 612438;Dystonia 4, torsion, autosomal dominant, 128101						False	3	100;0;0	21.664	False		ENSG00000104833	ENSG00000104833	HGNC:20774													
TUBB4A	gene	TUBB4A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, hypomyelinating, 6, OMIM # 612438				24850488;23582646;23424103;23595291;33084096;32943487		False	3	100;0;0	21.664	True		ENSG00000104833	ENSG00000104833	HGNC:20774													
TUBB4A	gene	TUBB4A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	hereditary whispering dysphonia;Dystonia 4, torsion, autosomal dominant, 128101;Dystonia				23424103;23595291;33084096;32943487		False	3	100;0;0	21.664	False		ENSG00000104833	ENSG00000104833	HGNC:20774													
TUBB4A	gene	TUBB4A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Leukodystrophy, hypomyelinating, 6, MIM#	612438"				23582646;24850488		False	3	100;0;0	21.664	True		ENSG00000104833	ENSG00000104833	HGNC:20774													
TUBB4A	gene	TUBB4A	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Leukodystrophy, hypomyelinating, 6, MIM#	612438"				24850488;23582646		False	3	100;0;0	21.664	True		ENSG00000104833	ENSG00000104833	HGNC:20774													
TUBG1	gene	TUBG1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Cortical dysplasia, complex, with other brain malformations 4, MIM# 615412				23603762;31086189		False	3	100;0;0	21.664	True		ENSG00000131462	ENSG00000131462	HGNC:12417													
TUBGCP2	gene	TUBGCP2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pachygyria, microcephaly, developmental delay, and dysmorphic facies, with or without seizures, OMIM # 618737				31630790		False	3	100;0;0	21.664	True		ENSG00000130640	ENSG00000130640	HGNC:18599													
TUBGCP6	gene	TUBGCP6	Expert Review Green;Literature;Expert list;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly and chorioretinopathy, autosomal recessive, 1 - 251270;Epilepsy				22279524;33453472		False	3	100;0;0	21.664	True		ENSG00000128159	ENSG00000128159	HGNC:18127													
TUFM	gene	TUFM	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 4, OMIM #610678;MONDO:0012534				28132884;26741492;17160893;30903008		False	3	100;0;0	21.664	True		ENSG00000178952	ENSG00000178952	HGNC:12420													
TUFM	gene	TUFM	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 4, MIM# 610678;Mitochondrial Leukoencephalopathy				28132884;26741492;17160893		False	3	100;0;0	21.664	True		ENSG00000178952	ENSG00000178952	HGNC:12420													
TUSC3	gene	TUSC3	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation, autosomal recessive 7, MIM# 611093, MONDO:0012615;TUSC3-CDG (Disorders of protein N-glycosylation)				18452889;18455129;21739581;27148795;31606977		False	3	100;0;0	21.664	True		ENSG00000104723	ENSG00000104723	HGNC:30242													
TWNK	gene	TWNK	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 7, 271245;Ataxia Neuropathy Spectrum Disorders, Dominant;Progressive external ophthalmoplegia with mitochondrial DNA deletions, 609286;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, 609286;Perrault syndrome 5, 616138;Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), 271245;Spinocerebellar Ataxia, Recessive						False	3	100;0;0	21.664	False		ENSG00000107815	ENSG00000107815	HGNC:1160													
TWNK	gene	TWNK	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Perrault syndrome (MIM#616138);Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, MIM# 609286				25254289;25355836;27650058;28178980;35011763		False	3	100;0;0	21.664	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
TWNK	gene	TWNK	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 7 (hepatocerebral type) 271245;Perrault syndrome 5 616138;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 609286				32234020;18593709		False	3	100;0;0	21.664	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
TWNK	gene	TWNK	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286				24076137;22949510;22580846;19353676		False	3	100;0;0	21.664	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
TWNK	gene	TWNK	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 7 (hepatocerebral type) MIM#271245;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286				PMID: 19304794		False	3	100;0;0	21.664	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
TWNK	gene	TWNK	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286				20880070		False	3	100;0;0	21.664	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
TYMP	gene	TYMP	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 1 (MNGIE type);HMSN						False	3	0;100;0	21.664	True		ENSG00000025708	ENSG00000025708	HGNC:3148													
TYMP	gene	TYMP	Royal Melbourne Hospital;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 1 (MNGIE type);Mitochondrial Leukoencephalopathy						False	3	0;0;0	21.664	False		ENSG00000025708	ENSG00000025708	HGNC:3148													
TYMP	gene	TYMP	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM# 603041				9924029;14757860;21933806		False	3	100;0;0	21.664	True		ENSG00000025708	ENSG00000025708	HGNC:3148													
TYROBP	gene	TYROBP	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, 221770						False	3	100;0;0	21.664	False		ENSG00000011600	ENSG00000011600	HGNC:12449													
TYROBP	gene	TYROBP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770)				20301376		False	3	100;0;0	21.664	True		ENSG00000011600	ENSG00000011600	HGNC:12449													
TYROBP	gene	TYROBP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, MIM#	221770"				30242731;11402114		False	3	100;0;0	21.664	True		ENSG00000011600	ENSG00000011600	HGNC:12449													
U2AF2	gene	U2AF2	Expert Review Green;Literature;Expert list;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay, dysmorphic facies, and brain anomalies, MIM# 620535				34112922;37092751;36747105;37134193		False	3	33;33;33	21.664	True		ENSG00000063244	ENSG00000063244	HGNC:23156													
UBA1	gene	UBA1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	dHMN/dSMA;Spinal muscular atrophy, X-linked 2, MIM# 301830				18179898;32181232;31932168;29034082;27699224;26028276;23518311		False	3	100;0;0	21.664	False		ENSG00000130985	ENSG00000130985	HGNC:12469													
UBA5	gene	UBA5	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 44 (MIM#617132)				28965491;27545674;27545681		False	3	100;0;0	21.664	True		ENSG00000081307	ENSG00000081307	HGNC:23230													
UBAP1	gene	UBAP1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Childhood-onset hereditary spastic paraplegia;Spastic paraplegia 80, autosomal dominant	618418"				31696996		False	3	100;0;0	21.664	True	Other	ENSG00000165006	ENSG00000165006	HGNC:12461													
UBAP2L	gene	UBAP2L	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with impaired language, behavioral abnormalities, and dysmorphic facies, MIM# 620494;Delayed speech and language development;Motor delay;Intellectual disability;Autistic behavior;Seizures;Microcephaly;Abnormality of head or neck;Short stature;Abnormality of the skeletal system				35977029		False	3	50;50;0	21.664	True		ENSG00000143569	ENSG00000143569	HGNC:29877													
UBE2A	gene	UBE2A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked syndromic, Nascimento type 300860				24053514;16909393		False	3	100;0;0	21.664	True		ENSG00000077721	ENSG00000077721	HGNC:12472													
UBE3A	gene	UBE3A	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed)	Angelman syndrome, MIM#105830				30842224		False	3	50;50;0	21.664	True		ENSG00000114062	ENSG00000114062	HGNC:12496													
UBQLN2	gene	UBQLN2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857)				20301623;31319884;21857683;30348461		False	3	0;100;0	21.664	True		ENSG00000188021	ENSG00000188021	HGNC:12509													
UBQLN2	gene	UBQLN2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Amyotrophic lateral sclerosis type 15 (MONDO:0010459;MIM#300857)				20301623;21857683		False	3	100;0;0	21.664	True		ENSG00000188021	ENSG00000188021	HGNC:12509													
UBR5	gene	UBR5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with speech delay and behavioral abnormalities, MIM# 621372				39721588		False	3	100;0;0	21.664	True		ENSG00000104517	ENSG00000104517	HGNC:16806													
UBR7	gene	UBR7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Li-Campeau syndrome, MIM# 619189;Intellectual disability;epilepsy;hypothyroidism;congenital anomalies;dysmorphic features				33340455		False	3	100;0;0	21.664	True		ENSG00000012963	ENSG00000012963	HGNC:20344													
UBTF	gene	UBTF	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;Parkinsonism;Dystonia;Chorea;Brain atrophy				PubMed: 28777933;29300972		False	3	100;0;0	21.664	True		ENSG00000108312	ENSG00000108312	HGNC:12511													
UBTF	gene	UBTF	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701				29300972		False	3	100;0;0	21.664	True		ENSG00000108312	ENSG00000108312	HGNC:12511													
UBTF	gene	UBTF	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701				28777933;29300972		False	3	100;0;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000108312	ENSG00000108312	HGNC:12511													
UCHL1	gene	UCHL1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 79A, autosomal dominant, MIM# 620221;Spastic paraplegia 79, autosomal recessive, 615491;MONDO:0014209;Neurodegenerative disease, MONDO:0005559, UCHL1-related				23359680;3340629;28007905;32656641;29735986;28007905;35986737		False	3	100;0;0	21.664	True		ENSG00000154277	ENSG00000154277	HGNC:12513													
UCHL1	gene	UCHL1	Expert Review Green;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 79, autosomal recessive, MIM#615491;Neurodegenerative disease, MONDO:0005559, UCHL1-related				28007905;23359680;11555633;35986737		False	3	100;0;0	21.664	True		ENSG00000154277	ENSG00000154277	HGNC:12513													
UCHL1	gene	UCHL1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegenerative disease, MONDO:0005559, UCHL1-related				35986737		False	3	100;0;0	21.664	True		ENSG00000154277	ENSG00000154277	HGNC:12513													
UFM1	gene	UFM1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 14, MIM# 617899				28931644;29868776		False	3	100;0;0	21.664	True		ENSG00000120686	ENSG00000120686	HGNC:20597													
UFM1	gene	UFM1	Expert Review Green;Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 14 617899				29868776		False	3	100;0;0	21.664	True		ENSG00000120686	ENSG00000120686	HGNC:20597													
UFSP2	gene	UFSP2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 106, MIM# 620028;Abnormal muscle tone;Seizures;Global developmental delay;Delayed speech and language development;Intellectual disability;Strabismus				33473208		False	3	50;50;0	21.664	True		ENSG00000109775	ENSG00000109775	HGNC:25640													
UGDH	gene	UGDH	Expert Review Green;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 84 - MIM #618792				32001716		False	3	100;0;0	21.664	True		ENSG00000109814	ENSG00000109814	HGNC:12525													
UGGT1	gene	UGGT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IICC, MIM# 621381				PMID: 40267907		False	3	100;0;0	21.664	True		ENSG00000136731	ENSG00000136731	HGNC:15663													
UGGT1	gene	UGGT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IICC, MIM# 621381				40267907		False	3	67;0;33	21.664	True		ENSG00000136731	ENSG00000136731	HGNC:15663													
UGP2	gene	UGP2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy;intellectual disability;microcephaly				31820119		False	3	100;0;0	21.664	True		ENSG00000169764	ENSG00000169764	HGNC:12527													
UGT1A1	gene	UGT1A1	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bilirubin UDP-glucuronosyltransferase 1 deficiency (Disorders of bile acid metabolism and transport);Crigler-Najjar syndrome, type I 218800;Crigler-Najjar syndrome, type II 606785						False	3	100;0;0	21.664	True		ENSG00000241635	ENSG00000241635	HGNC:12530													
UMPS	gene	UMPS	Expert Review Green;Literature;Expert list;Expert Review Green;Expert Review;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Orotic aciduria - 258900;Epilepsy				25757096;33489760		False	3	100;0;0	21.664	True		ENSG00000114491	ENSG00000114491	HGNC:12563													
UMPS	gene	UMPS	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Orotic aciduria, MIM#	258900"						False	3	100;0;0	21.664	True		ENSG00000114491	ENSG00000114491	HGNC:12563													
UNC13A	gene	UNC13A	Expert Review Green;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456;Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455;Intellectual development disorder with seizures and dysmorphic facies, MIM# 621457				27648472;28192369;41125872		False	3	100;0;0	21.664	True		ENSG00000130477	ENSG00000130477	HGNC:23150													
UNC13A	gene	UNC13A	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456				27648472;28192369;41125872		False	3	100;0;0	21.664	True	Other	ENSG00000130477	ENSG00000130477	HGNC:23150													
UNC45B	gene	UNC45B	Expert Review Green;Other;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myofibrillar myopathy 11 (MIM#619178)				33217308;31852522		False	3	100;0;0	21.664	True		ENSG00000141161	ENSG00000141161	HGNC:14304													
UNC79	gene	UNC79	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), UNC79-related				PMID:37183800		False	3	0;100;0	21.664	True		ENSG00000133958	ENSG00000133958	HGNC:19966													
UNC80	gene	UNC80	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, infantile, with psychomotor retardation and characteristic facies 2, MIM# 616801;MONDO:0014777				26708751;26708753;26545877;32620897;30167850;30167850		False	3	100;0;0	21.664	True		ENSG00000144406	ENSG00000144406	HGNC:26582													
UPB1	gene	UPB1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Beta-ureidopropionase deficiency, MIM#	613161"				27604308;24526388;25638458;22525402;15385443;17964839		False	3	100;0;0	21.664	True		ENSG00000100024	ENSG00000100024	HGNC:16297													
UQCC2	gene	UQCC2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 7 - MIM#615824				24385928;28804536		False	3	100;0;0	21.664	True		ENSG00000137288	ENSG00000137288	HGNC:21237													
UQCRB	gene	UQCRB	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 3, MIM# 615158				23281071;28275242;12709789;25446085;23454382		False	3	100;0;0	21.664	True		ENSG00000156467	ENSG00000156467	HGNC:12582													
UQCRC2	gene	UQCRC2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 5, MIM# 615160				28275242;23281071;33865955		False	3	50;50;0	21.664	True		ENSG00000140740	ENSG00000140740	HGNC:12586													
UQCRFS1	gene	UQCRFS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Complex III deficiency;lactic acidosis;fetal bradycardia;hypertrophic cardiomyopathy;alopecia totalis				31883641		False	3	100;0;0	21.664	True		ENSG00000169021	ENSG00000169021	HGNC:12587													
USP18	gene	USP18	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pseudo-TORCH syndrome 2, MIM#617397				12833411;27325888;31940699		False	3	100;0;0	21.664	True		ENSG00000184979	ENSG00000184979	HGNC:12616													
USP18	gene	USP18	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pseudo-TORCH syndrome 2, MIM# 617397				31940699;27325888		False	3	100;0;0	21.664	True		ENSG00000184979	ENSG00000184979	HGNC:12616													
VAC14	gene	VAC14	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Striatonigral degeneration, childhood-onset, MIM# 617054;Dystonia;Parkinsonism				PMID: 31392254;28502045		False	3	100;0;0	21.664	True		ENSG00000103043	ENSG00000103043	HGNC:25507													
VAC14	gene	VAC14	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Striatonigral degeneration, childhood-onset 617054						False	3	0;0;0	21.664	False		ENSG00000103043	ENSG00000103043	HGNC:25507													
VAMP2	gene	VAMP2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760;Dystonia;Cortical visual impairment;Seizures;Stereotypic behaviour;Generalized hypotonia;Intellectual disability				30929742		False	3	100;0;0	21.664	True		ENSG00000220205	ENSG00000220205	HGNC:12643													
VAMP2	gene	VAMP2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements	618760;Cortical visual impairment;Seizures;Stereotypic behaviour;Generalized hypotonia;Intellectual disability"				30929742		False	3	100;0;0	21.664	True		ENSG00000220205	ENSG00000220205	HGNC:12643													
VAPB	gene	VAPB	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Adult proximal spinal muscular atrophy, autosomal dominant;dHMN/dSMA;Spinal muscular atrophy, late-onset, Finkel type, MIM# 182980				15372378;32162544;28993872;28173107;26566915		False	3	100;0;0	21.664	False		ENSG00000124164	ENSG00000124164	HGNC:12649													
VAPB	gene	VAPB	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinal muscular atrophy, late-onset, Finkel type (MIM# 182980);Amyotrophic lateral sclerosis 8				20301623;15372378		False	3	100;0;0	21.664	True		ENSG00000124164	ENSG00000124164	HGNC:12649													
VARS1	gene	VARS1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy;OMIM #617802				30755616;30755602;26539891;29691655;30275004		False	3	100;0;0	21.664	True		ENSG00000204394	ENSG00000204394	HGNC:12651													
VARS2	gene	VARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 20;OMIM #615917				24827421;25058219;29137650;29314548;31064326;31623496		False	3	100;0;0	21.664	True		ENSG00000137411	ENSG00000137411	HGNC:21642													
VARS2	gene	VARS2	Expert Review Green;Expert Review Green;Literature;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 20, 615917;Epilepsy				27502409;29137650;31064326;31623496		False	3	100;0;0	21.664	True		ENSG00000137411	ENSG00000137411	HGNC:21642													
VCP	gene	VCP	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 167320						False	3	0;0;0	21.664	False		ENSG00000165280	ENSG00000165280	HGNC:12666													
VCP	gene	VCP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320);Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954)				15034582;30103325;21145000		False	3	100;0;0	21.664	True		ENSG00000165280	ENSG00000165280	HGNC:12666													
VCP	gene	VCP	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, type 2Y, MIM# 616687				25125609;25878907;32165109		False	3	50;50;0	21.664	False	Other	ENSG00000165280	ENSG00000165280	HGNC:12666													
VCP	gene	VCP	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507;Disorders of mitochondrial protein quality control				29884839;35273561;37678339;15034582;30103325;21145000		False	3	100;0;0	21.664	True		ENSG00000165280	ENSG00000165280	HGNC:12666													
VCP	gene	VCP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (ALS) (MIM#613954)				20301649;20301623;21145000		False	3	100;0;0	21.664	True		ENSG00000165280	ENSG00000165280	HGNC:12666													
VCP	gene	VCP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507				38283104;38145206		False	3	100;0;0	21.664	True	Other	ENSG00000165280	ENSG00000165280	HGNC:12666													
VIPAS39	gene	VIPAS39	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Arthrogryposis, renal dysfunction, and cholestasis 2, MIM#	613404"				22753090;26808426		False	3	100;0;0	21.664	True		ENSG00000151445	ENSG00000151445	HGNC:20347													
VLDLR	gene	VLDLR	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, mental retardation and dysequilibirum syndrome 1, 224050;Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, 224050						False	3	100;0;0	21.664	False		ENSG00000147852	ENSG00000147852	HGNC:12698													
VMA12	gene	VMA12	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Congenital disorder of glycosylation, type IIp	MIM# 616829"				26833330;29321044		False	3	100;0;0	21.664	True		ENSG00000244045	ENSG00000244045	HGNC:18085													
VMA21	gene	VMA21	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Myopathy, X-linked, with excessive autophagy (MIM#310440)				27916343;25809233;23315026		False	3	100;0;0	21.664	True		ENSG00000160131	ENSG00000160131	HGNC:22082													
VMA21	gene	VMA21	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Myopathy, X-linked, with excessive autophagy (MIM#310440)				27916343;25809233;23315026		False	3	0;100;0	21.664	True		ENSG00000160131	ENSG00000160131	HGNC:22082													
VMA22	gene	VMA22	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Congenital disorder of glycosylation, type IIo (MIM# 	616828)"				26833332		False	3	100;0;0	21.664	True		ENSG00000136710	ENSG00000136710	HGNC:28178													
VPS11	gene	VPS11	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 12, MIM#616683				27120463;26307567;27473128		False	3	100;0;0	21.664	True		ENSG00000160695	ENSG00000160695	HGNC:14583													
VPS11	gene	VPS11	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 12, MIM#616683				27120463;26307567;27473128		False	3	100;0;0	21.664	True		ENSG00000160695	ENSG00000160695	HGNC:14583													
VPS13A	gene	VPS13A	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	chorea-acanthocytosis MONDO:0008695				20301561;37636221		False	3	100;0;0	21.664	True		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13A	gene	VPS13A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Choreoacanthocytosis MIM#200150				26813249;30140251;31192303		False	3	100;0;0	21.664	True		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13A	gene	VPS13A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	chorea-acanthocytosis MONDO:0008695				33652783;20301561		False	3	100;0;0	21.664	True		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13A	gene	VPS13A	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex parkinsonism;Choreoacanthocytosis 200150						False	3	0;0;0	21.664	False		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13A	gene	VPS13A	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Choreoacanthocytosis MIM#200150						False	3	100;0;0	21.664	False		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13C	gene	VPS13C	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Early-onset Parkinson disease-23, MIM# 616840				26942284		False	3	100;0;0	21.664	True		ENSG00000129003	ENSG00000129003	HGNC:23594													
VPS13C	gene	VPS13C	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"autosomal recessive early-onset Parkinson disease 23	MONDO:0014796"				33579389;37330543;34875562		False	3	100;0;0	21.664	True		ENSG00000129003	ENSG00000129003	HGNC:23594													
VPS13C	gene	VPS13C	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 23, autosomal recessive, early onset MIM#616840				26942284;30452786;28862745		False	3	100;0;0	21.664	True		ENSG00000129003	ENSG00000129003	HGNC:23594													
VPS13D	gene	VPS13D	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 4, MIM#	607317"				29604224;29518281		False	3	100;0;0	21.664	True		ENSG00000048707	ENSG00000048707	HGNC:23595													
VPS13D	gene	VPS13D	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317				29604224;29518281		False	3	100;0;0	21.664	True		ENSG00000048707	ENSG00000048707	HGNC:23595													
VPS13D	gene	VPS13D	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 4, MIM#	607317"				29604224;29518281		False	3	100;0;0	21.664	True		ENSG00000048707	ENSG00000048707	HGNC:23595													
VPS16	gene	VPS16	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	mucopolysaccharidosis-like disorder, VPS16-related MONDO#0100365				33938619;34013567;34901436		False	3	100;0;0	21.664	True		ENSG00000215305	ENSG00000215305	HGNC:14584													
VPS16	gene	VPS16	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 30, MIM#619291				32808683		False	3	100;0;0	21.664	True		ENSG00000215305	ENSG00000215305	HGNC:14584													
VPS33A	gene	VPS33A	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis-plus syndrome (MIM#617303)				28013294;27547915		False	3	50;50;0	21.664	True		ENSG00000139719	ENSG00000139719	HGNC:18179													
VPS33B	gene	VPS33B	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Arthrogryposis, renal dysfunction, and cholestasis 1, MIM#	208085"				16896922		False	3	100;0;0	21.664	True		ENSG00000184056	ENSG00000184056	HGNC:12712													
VPS35	gene	VPS35	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 17, MIM# 614203				21763482;21763483;22801713;34704029		False	3	100;0;0	21.664	True		ENSG00000069329	ENSG00000069329	HGNC:13487													
VPS35	gene	VPS35	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	{Parkinson disease 17} MIM#614203;Cognitive decline						False	3	0;0;0	21.664	False		ENSG00000069329	ENSG00000069329	HGNC:13487													
VPS41	gene	VPS41	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay				32808683;33764426		False	3	100;0;0	21.664	True		ENSG00000006715	ENSG00000006715	HGNC:12713													
VPS41	gene	VPS41	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay				32808683;33764426		False	3	100;0;0	21.664	True		ENSG00000006715	ENSG00000006715	HGNC:12713													
VPS4A	gene	VPS4A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CIMDAG syndrome MIM# 619273				33186543;33186545		False	3	100;0;0	21.664	True	Other	ENSG00000132612	ENSG00000132612	HGNC:13488													
VPS4A	gene	VPS4A	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CIMDAG syndrome MIM# 619273				33186543;33186545		False	3	100;0;0	21.664	True	Other	ENSG00000132612	ENSG00000132612	HGNC:13488													
VPS50	gene	VPS50	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis , MIM#619685;Neonatal cholestatic liver disease;Failure to thrive;Profound global developmental delay;Postnatal microcephaly;Seizures;Abnormality of the corpus callosum				34037727;38876772		False	3	33;67;0	21.664	True		ENSG00000004766	ENSG00000004766	HGNC:25956													
VPS51	gene	VPS51	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Pontocerebellar hypoplasia, type 13, MIM#	618606"				40565173;30624672;31207318;40176246		False	3	100;0;0	21.664	True		ENSG00000149823	ENSG00000149823	HGNC:1172													
VRK1	gene	VRK1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuronopathy, distal hereditary motor, autosomal recessive 10, MIM# 620542				31560180;32242460;31178479;31837156;30847374		False	3	100;0;0	21.664	False		ENSG00000100749	ENSG00000100749	HGNC:12718													
VWA1	gene	VWA1	Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary motor neuropathy				33459760;33693694;33559681		False	3	0;0;0	21.664	False		ENSG00000179403	ENSG00000179403	HGNC:30910													
VWA3B	gene	VWA3B	Expert Review Green;GeneReviews;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 22 MIM#616948				26157035		False	3	50;0;50	21.664	True		ENSG00000168658	ENSG00000168658	HGNC:28385													
WAC	gene	WAC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Desanto-Shinawi syndrome MIM#616708				PMID: 36420948		False	3	100;0;0	21.664	True		ENSG00000095787	ENSG00000095787	HGNC:17327													
WARS1	gene	WARS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities,MIM# 620317				PMID: 35815345 PMID: 35790048		False	3	100;0;0	21.664	True		ENSG00000140105	ENSG00000140105	HGNC:12729													
WARS2	gene	WARS2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738				PMID: 29120065;34890876;31970218		False	3	100;0;0	21.664	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WARS2	gene	WARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710				29120065;31970218;34890876;28236339;28650581;28905505;30920170		False	3	100;0;0	21.664	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WARS2	gene	WARS2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710				29120065;31970218;34890876;28236339;28650581;28905505;30920170		False	3	100;0;0	21.664	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WARS2	gene	WARS2	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM#617710				31282308;28650581;30920170		False	3	100;0;0	21.664	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WARS2	gene	WARS2	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM#617710				29783990;28236339;29120065;28650581;28905505		False	3	100;0;0	21.664	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WARS2	gene	WARS2	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710				29120065;31970218;34890876;28236339;28650581;28905505;30920170		False	3	100;0;0	21.664	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WASF1	gene	WASF1	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with absent language and variable seizures , MIM#618707				29961568;34845217;34478686;34356165		False	3	100;0;0	21.664	True		ENSG00000112290	ENSG00000112290	HGNC:12732													
WASHC5	gene	WASHC5	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 8, autosomal dominant, 603563;MONDO:0011339				23455931;17160902;31814071;26572744		False	3	100;0;0	21.664	False		ENSG00000164961	ENSG00000164961	HGNC:28984													
WDR26	gene	WDR26	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Skraban-Deardorff syndrome MIM# 617616				28686853;33675273		False	3	100;0;0	21.664	True		ENSG00000162923	ENSG00000162923	HGNC:21208													
WDR37	gene	WDR37	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurooculocardiogenitourinary syndrome, MIM# 618652				31327508;31327508		False	3	100;0;0	21.664	True		ENSG00000047056	ENSG00000047056	HGNC:31406													
WDR45	gene	WDR45	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	"Neurodegeneration with brain iron accumulation 5, MIM#	300894"				23176820		False	3	100;0;0	21.664	True		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR45	gene	WDR45	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	X-linked complex neurodevelopmental disorder MONDO:0100148				28211668		False	3	100;0;0	21.664	True		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR45	gene	WDR45	GeneReviews;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Beta-propeller protein-associated neurodegeneration (BPAN)						False	3	100;0;0	21.664	False		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR45	gene	WDR45	Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegeneration with brain iron accumulation 5, MIM# 300894;Rett syndrome;Rett-like phenotypes				23176820;30842224		False	3	100;0;0	21.664	True		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR45	gene	WDR45	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Disorders of autophagy;X-linked complex neurodevelopmental disorder MONDO:0100148				38465922;29884839		False	3	0;0;0	21.664	False		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR45	gene	WDR45	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegeneration with brain iron accumulation 5 MIM#300894				23435086		False	3	100;0;0	21.664	False		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR45	gene	WDR45	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegeneration with brain iron accumulation 5 300894;beta-propeller protein-associated neurodegeneration;Dystonia						False	3	0;0;0	21.664	False		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR45B	gene	WDR45B	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Profound developmental delay, early-onset refractory epilepsy, progressive spastic quadriplegia and contractures, and brain malformations;Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM#617977				21937992;28503735;27431290		False	3	100;0;0	21.664	True		ENSG00000141580	ENSG00000141580	HGNC:25072													
WDR45B	gene	WDR45B	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM# 617977				21937992;28503735;27431290		False	3	100;0;0	21.664	True		ENSG00000141580	ENSG00000141580	HGNC:25072													
WDR47	gene	WDR47	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder MONDO:0100038, WDR47-related				39609633		False	3	100;0;0	21.664	True		ENSG00000085433	ENSG00000085433	HGNC:29141													
WDR62	gene	WDR62	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 2, primary, autosomal recessive, with or without cortical malformations, MIM# 604317;MONDO:0011435				21834044;20890278;20729831		False	3	100;0;0	21.664	True		ENSG00000075702	ENSG00000075702	HGNC:24502													
WDR73	gene	WDR73	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway Mowat syndrome, when patients are ambulant ataxia is a recognisednfeature;Galloway-Mowat Syndrome 1, 251300						False	3	100;0;0	21.664	False		ENSG00000177082	ENSG00000177082	HGNC:25928													
WDR73	gene	WDR73	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway-Mowat syndrome 1 MIM#251300				25466283;26123727;25873735;26070982;30315938		False	3	100;0;0	21.664	True		ENSG00000177082	ENSG00000177082	HGNC:25928													
WDR73	gene	WDR73	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway-Mowat syndrome 1, 251300						False	3	0;0;0	21.664	False		ENSG00000177082	ENSG00000177082	HGNC:25928													
WDR81	gene	WDR81	Expert Review Red;Expert Review Red;Expert list;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital hydrocephalus 3 with brain anomalies, 617967;Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Cerebellar ataxia, mental retardation and dysequilibrium syndrome 2, 610185				21885617;28556411;28969387		False	3	33;0;67	21.664	True		ENSG00000167716	ENSG00000167716	HGNC:26600													
WFS1	gene	WFS1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wolfram syndrome 1, 222300				25211237		False	3	100;0;0	21.664	True		ENSG00000109501	ENSG00000109501	HGNC:12762													
WNK1	gene	WNK1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HSAN/SFN;Neuropathy, hereditary sensory and autonomic, type II, MIM# 201300;MONDO:0024309				15060842;15911806;15455397;16534117		False	3	100;0;0	21.664	False		ENSG00000060237	ENSG00000060237	HGNC:14540													
WNK1	gene	WNK1	Expert Review Green;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type II, 201300;HSAN 2;Hereditary sensory and autonomic neuropathy type IIA				15911806;16636245;16946995;21625937;15455397;18521183;15060842		False	3	0;0;0	21.664	False		ENSG00000060237	ENSG00000060237	HGNC:14540													
WNK3	gene	WNK3	Expert Review Green;Literature;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Prieto syndrome, MIM# 309610				35678782		False	3	100;0;0	21.664	True		ENSG00000196632	ENSG00000196632	HGNC:14543													
WSB2	gene	WSB2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Luo-Agrawal neurodevelopmental syndrome, MIM# 621552				PMID: 40374945		False	3	100;0;0	21.664	True		ENSG00000176871	ENSG00000176871	HGNC:19222													
WWOX	gene	WWOX	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 28, MIM# 616211				24456803;25411445;32051108;32037574;30356099;29808465		False	3	100;0;0	21.664	True		ENSG00000186153	ENSG00000186153	HGNC:12799													
WWOX	gene	WWOX	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia 12, 6143232;Early infantile epileptic encephalopathy 28, 616211;Autosomal recessive spinocerebellar ataxia 12, 614322						False	3	100;0;0	21.664	False		ENSG00000186153	ENSG00000186153	HGNC:12799													
XK	gene	XK	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	McLeod syndrome with or without chronic granulomatous disease (MIM#300842)				11761473		False	3	100;0;0	21.664	True		ENSG00000047597	ENSG00000047597	HGNC:12811													
XK	gene	XK	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	McLeod syndrome with or without chronic granulomatous disease MIM#300842				11761473		False	3	100;0;0	21.664	True		ENSG00000047597	ENSG00000047597	HGNC:12811													
XK	gene	XK	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	McLeod syndrome with or without chronic granulomatous disease (MIM#300842)				12899725		False	3	100;0;0	21.664	True		ENSG00000047597	ENSG00000047597	HGNC:12811													
XPR1	gene	XPR1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 6, MIM# 616413				25938945;27230854;29955172;33433330		False	3	100;0;0	21.664	True		ENSG00000143324	ENSG00000143324	HGNC:12827													
XPR1	gene	XPR1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 6, MIM# 616413				25938945		False	3	100;0;0	21.664	True		ENSG00000143324	ENSG00000143324	HGNC:12827													
XRCC1	gene	XRCC1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 26 MIM#617633				28002403;29472272		False	3	100;0;0	21.664	False		ENSG00000073050	ENSG00000073050	HGNC:12828													
XRCC1	gene	XRCC1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 26 MIM#617633				28002403;29472272		False	3	100;0;0	21.664	True		ENSG00000073050	ENSG00000073050	HGNC:12828													
XYLT1	gene	XYLT1	Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Desbuquois dysplasia 2, MIM# 615777;Baratela-Scott syndrome				30554721;24581741;23982343		False	3	100;0;0	21.664	True		ENSG00000103489	ENSG00000103489	HGNC:15516													
XYLT2	gene	XYLT2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spondyloocular syndrome MIM# 605822				26027496;26987875;30891060;28484880		False	3	100;0;0	21.664	True		ENSG00000015532	ENSG00000015532	HGNC:15517													
YARS1	gene	YARS1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, dominant intermediate C, MIM# 608323;MONDO:0012012				16429158;24354524;31587308;26725087		False	3	100;0;0	21.664	False		ENSG00000134684	ENSG00000134684	HGNC:12840													
YARS2	gene	YARS2	Expert Review Green;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, lactic acidosis, and sideroblastic anemia 2 MIM#613561				28395030		False	3	100;0;0	21.664	True		ENSG00000139131	ENSG00000139131	HGNC:24249													
YARS2	gene	YARS2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561;sideroblastic anaemia;muscle atrophy;myopathy;lactic acidosis;Hypertrophic cardiomyopathy;Hepatomegaly;Decreased cytochrome C oxidase activity				24430573;24344687		False	3	100;0;0	21.664	True		ENSG00000139131	ENSG00000139131	HGNC:24249													
YIF1B	gene	YIF1B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement				32006098		False	3	50;50;0	21.664	True		ENSG00000167645	ENSG00000167645	HGNC:30511													
YIF1B	gene	YIF1B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement				32006098;26077767		False	3	100;0;0	21.664	True		ENSG00000167645	ENSG00000167645	HGNC:30511													
YIPF5	gene	YIPF5	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, epilepsy, and diabetes syndrome 2 , MIM#619278				33164986		False	3	100;0;0	21.664	True		ENSG00000145817	ENSG00000145817	HGNC:24877													
YWHAG	gene	YWHAG	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 56, (MIMI#617665)				33393734;33590706;31926053;33767733		False	3	100;0;0	21.664	True		ENSG00000170027	ENSG00000170027	HGNC:12852													
YY1	gene	YY1	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Gabriele-de Vries syndrome 617557						False	3	0;0;0	21.664	False		ENSG00000100811	ENSG00000100811	HGNC:12856													
YY1AP1	gene	YY1AP1	Genomics England PanelApp;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Grange syndrome, 602531						False	3	100;0;0	21.664	False		ENSG00000163374	ENSG00000163374	HGNC:30935													
ZBTB18	gene	ZBTB18	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 22, MIM# 612337				29573576		False	3	100;0;0	21.664	True		ENSG00000179456	ENSG00000179456	HGNC:13030													
ZBTB20	gene	ZBTB20	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Primrose syndrome, MIM# 259050				32734340;25017102		False	3	100;0;0	21.664	True		ENSG00000181722	ENSG00000181722	HGNC:13503													
ZBTB47	gene	ZBTB47	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO#0700092), ZBTB47-related				37743782		False	3	100;0;0	21.664	True		ENSG00000114853	ENSG00000114853	HGNC:26955													
ZDHHC9	gene	ZDHHC9	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mental retardation, X-linked syndromic, Raymond type, MIM#300799				26000327		False	3	100;0;0	21.664	True		ENSG00000188706	ENSG00000188706	HGNC:18475													
ZEB2	gene	ZEB2	Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mowat-Wilson syndrome, MIM# 235730;MONDO:0009341				29300384;27831545;24715670;19215041;17958891		False	3	100;0;0	21.664	True		ENSG00000169554	ENSG00000169554	HGNC:14881													
ZFHX3	gene	ZFHX3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	{Epilepsy, idiopathic generalized, susceptibility to}, MIM#621500				38508705		False	3	100;0;0	21.664	True		ENSG00000140836	ENSG00000140836	HGNC:777													
ZFYVE26	gene	ZFYVE26	Expert Review Green	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of autophagy;hereditary spastic paraplegia 15 MONDO:0010044				36029068;34130600;29884839		False	3	0;0;0	21.664	False		ENSG00000072121	ENSG00000072121	HGNC:20761													
ZFYVE26	gene	ZFYVE26	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 15, autosomal recessive, MIM# 270700				19084844		False	3	100;0;0	21.664	True		ENSG00000072121	ENSG00000072121	HGNC:20761													
ZFYVE26	gene	ZFYVE26	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 15, autosomal recessive, MIM#	270700"						False	3	100;0;0	21.664	True		ENSG00000072121	ENSG00000072121	HGNC:20761													
ZFYVE26	gene	ZFYVE26	Expert Review Green;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 15 MIM#270700				17661097;19438933		False	3	100;0;0	21.664	True		ENSG00000072121	ENSG00000072121	HGNC:20761													
ZFYVE26	gene	ZFYVE26	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 15, autosomal recessive, MIM#	270700;Spastic paraplegia and retinal degeneration;Kjellin syndrome;Parkinsonism"				PMID: 33033739;21462267		False	3	100;0;0	21.664	True		ENSG00000072121	ENSG00000072121	HGNC:20761													
ZMYND11	gene	ZMYND11	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 30 MIM# 616083				32097528;34216016		False	3	100;0;0	21.664	True		ENSG00000015171	ENSG00000015171	HGNC:16966													
ZMYND8	gene	ZMYND8	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ZMYND8-related;Delayed speech and language development;Motor delay;Intellectual disability;Abnormality of cardiovascular system morphology;Hearing abnormality;Abnormality of vision;Abnormality of the face;Seizures				35916866;32530565		False	3	100;0;0	21.664	True		ENSG00000101040	ENSG00000101040	HGNC:9397													
ZNF142	gene	ZNF142	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with impaired speech and hyperkinetic movements, MIM#618425				31036918		False	3	100;0;0	21.664	True		ENSG00000115568	ENSG00000115568	HGNC:12927													
ZNF335	gene	ZNF335	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly 10, primary, autosomal recessive (MIM#615095)				23178126;27540107;29652087		False	3	100;0;0	21.664	True		ENSG00000198026	ENSG00000198026	HGNC:15807													
ZNF526	gene	ZNF526	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dentici-Novelli neurodevelopmental syndrome, MIM# 619877				21937992;25558065;33397746		False	3	100;0;0	21.664	True		ENSG00000167625	ENSG00000167625	HGNC:29415													
ZNF526	gene	ZNF526	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dentici-Novelli neurodevelopmental syndrome, MIM# 619877				21937992;25558065;33397746		False	3	100;0;0	21.664	True		ENSG00000167625	ENSG00000167625	HGNC:29415													
ZNHIT3	gene	ZNHIT3	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PEHO syndrome, MIM# 260565				28335020;28335020;31048081		False	3	100;0;0	21.664	True		-	ENSG00000273611	HGNC:12309													
ZSWIM6	gene	ZSWIM6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Acromelic frontonasal dysostosis MIM#603671;Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features MIM#617865				PMID: 29198722;33958584		False	3	100;0;0	21.664	True		ENSG00000130449	ENSG00000130449	HGNC:29316													
AAAS	gene	AAAS	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Achalasia-addisonianism-alacrimia syndrome MIM#231550;complicated hereditary spastic paraplegia				30381913		False	2	0;100;0	21.664	True		ENSG00000094914	ENSG00000094914	HGNC:13666													
AARS2	gene	AARS2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 8, 614096;Leukoencephalopathy progressive with ovarian failure, 615889				21549344;25817015;32571458;24808023		False	2	0;100;0	21.664	True		ENSG00000124608	ENSG00000124608	HGNC:21022													
AASS	gene	AASS	Expert Review Amber;NHS GMS;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperlysinemia, MIM# 238700				23570448		False	2	0;100;0	21.664	True		ENSG00000008311	ENSG00000008311	HGNC:17366													
ABCC9	gene	ABCC9	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability and myopathy syndrome, MIM# 619719				31575858		False	2	0;100;0	21.664	True		ENSG00000069431	ENSG00000069431	HGNC:60													
ABHD16A	gene	ABHD16A	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 86, autosomal recessive, MIM# 619735;seizures;myoclonic seizures;developmental delay				(PMID: 34587489,34489854;32462874)		False	2	0;50;50	21.664	True		ENSG00000204427	ENSG00000204427	HGNC:13921													
ABI2	gene	ABI2	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, ABI2-related				40475134		False	2	0;100;0	21.664	True		ENSG00000138443	ENSG00000138443	HGNC:24011													
ACADS	gene	ACADS	Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acyl-CoA dehydrogenase, short-chain, deficiency of, MIM# 201470;MONDO:0008722						False	2	0;100;0	21.664	True		ENSG00000122971	ENSG00000122971	HGNC:90													
ACADS	gene	ACADS	Expert Review Amber;Literature;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Acyl-CoA dehydrogenase, short-chain, deficiency of, MIM# 201470;MONDO:0008722				25778941;2808706;29678161		False	2	50;50;0	21.664	True		ENSG00000122971	ENSG00000122971	HGNC:90													
ACADVL	gene	ACADVL	Expert Review Amber;Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"VLCAD deficiency	201475"				PMID: 9546340;32558070;22097235;24305961		False	2	50;50;0	21.664	True		ENSG00000072778	ENSG00000072778	HGNC:92													
ACBD5	gene	ACBD5	Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy;syndromic cleft palate;ataxia;retinal dystrophy				27799409;23105016		False	2	50;50;0	21.664	True		ENSG00000107897	ENSG00000107897	HGNC:23338													
ACSF3	gene	ACSF3	Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined malonic and methylmalonic aciduria MIM#614265				21841779;30740739		False	2	0;100;0	21.664	True		ENSG00000176715	ENSG00000176715	HGNC:27288													
ADA2	gene	ADA2	Expert Review Green;Expert Review Green;Literature;Genomics England PanelApp;Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sneddon syndrome  182410;Polyarteritis nodosa				3471198, 25528372		False	2	67;33;0	21.664	False		ENSG00000093072	ENSG00000093072	HGNC:1839													
ADAM23	gene	ADAM23	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neonatal-onset developmental and epileptic encephalopathy, MONDO:0100455, ADAM23-related				PMID: 40455867		False	2	0;100;0	21.664	True		ENSG00000114948	ENSG00000114948	HGNC:202													
ADAT3	gene	ADAT3	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mental retardation autosomal recessive 36, 615286				26842963;23620220;30296593		False	2	0;100;0	21.664	True		ENSG00000213638	ENSG00000213638	HGNC:25151													
ADGRL1	gene	ADGRL1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental delay, behavioral abnormalities, and neuropsychiatric disorders, MIM# 620065				PMID: 35907405		False	2	0;100;0	21.664	True		ENSG00000072071	ENSG00000072071	HGNC:20973													
AFG3L2	gene	AFG3L2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic ataxia 5, autosomal recessive MIM#614487;Early-onset dystonia				22964162;16541453;32219868;36110148		False	2	33;0;67	21.664	True		ENSG00000141385	ENSG00000141385	HGNC:315													
AFG3L2	gene	AFG3L2	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 28, MIM# 610246;optic atrophy;spastic ataxia;L-dopa-responsive parkinsonism				30252181;36110148		False	2	33;33;33	21.664	True		ENSG00000141385	ENSG00000141385	HGNC:315													
ALK	gene	ALK	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic-dystonic diplegia				PMID: 32989326		False	2	0;100;0	21.664	True		ENSG00000171094	ENSG00000171094	HGNC:427													
ALK	gene	ALK	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic-dystonic diplegia				PMID: 32989326		False	2	0;100;0	21.664	True		ENSG00000171094	ENSG00000171094	HGNC:427													
ANG	gene	ANG	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic Lateral Sclerosis 9 (MONDO: 0012753;MIM#611895)				17886298;16501576;18087731;20301623		False	2	100;0;0	21.664	True		ENSG00000214274	ENSG00000214274	HGNC:483													
ANO1	gene	ANO1	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Moyamoya disease 7, MIM# 620687				PMID: 37253099		False	2	33;67;0	21.664	True		ENSG00000131620	ENSG00000131620	HGNC:21625													
ANXA11	gene	ANXA11	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy and brain white matter abnormalities, MIM# 619733				34048612		False	2	0;100;0	21.664	True		ENSG00000122359	ENSG00000122359	HGNC:535													
ANXA11	gene	ANXA11	Expert Review;Expert Review Amber;Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy and brain white matter abnormalities, MIM# 619733				34048612		False	2	0;100;0	21.664	False		ENSG00000122359	ENSG00000122359	HGNC:535													
AP1S2	gene	AP1S2	Expert Review Amber;Literature;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Pettigrew syndrome, MIM# 304340				23756445		False	2	50;50;0	21.664	True		ENSG00000182287	ENSG00000182287	HGNC:560													
AP3D1	gene	AP3D1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hermansky-Pudlak syndrome 10, MIM# 617050				(PMID: 26744459;30472485;19032734;36445457		False	2	0;100;0	21.664	True		ENSG00000065000	ENSG00000065000	HGNC:568													
AP4M1	gene	AP4M1	Expert Review Amber;Expert list;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 50, autosomal recessive, MIM# 612936				29473051		False	2	50;50;0	21.664	True		ENSG00000221838	ENSG00000221838	HGNC:574													
APOE	gene	APOE	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease 2, MIM# 104310						False	2	0;100;0	21.664	True		ENSG00000130203	ENSG00000130203	HGNC:613													
APOO	gene	APOO	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Mitochondrial disease, MONDO:0044970, APOO-related;Developmental delay;Lactic acidosis;Muscle weakness;Hypotonia;Repetitive infections;Cognitive impairment;Autistic behaviour				32439808;37649161		False	2	0;67;33	21.664	True		ENSG00000184831	ENSG00000184831	HGNC:28727													
APP	gene	APP	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease 1, familial, MIM# 104300						False	2	0;100;0	21.664	True		ENSG00000142192	ENSG00000142192	HGNC:620													
AQP4	gene	AQP4	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Megalencephalic leukoencephalopathy with subcortical cysts 4, remitting MIM#620448				PMID: 37143309		False	2	0;100;0	21.664	True		ENSG00000171885	ENSG00000171885	HGNC:637													
AQP4	gene	AQP4	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Megalencephalic leukoencephalopathy with subcortical cysts 4, remitting MIM#620448				37143309		False	2	0;100;0	21.664	True		ENSG00000171885	ENSG00000171885	HGNC:637													
ARFGEF3	gene	ARFGEF3	Literature;Expert Review Amber;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia, MONDO:0044807, ARFGEF3-related				PMID: 33098801		False	2	50;50;0	21.664	False		ENSG00000112379	ENSG00000112379	HGNC:21213													
ARHGEF10	gene	ARHGEF10	Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	?Slowed nerve conduction velocity, AD, 608236;HMSN				14508709;21719701;25025039;25275565;25091364		False	2	50;50;0	21.664	False		ENSG00000104728	ENSG00000104728	HGNC:14103													
ARPC3	gene	ARPC3	Literature;Expert Review Amber;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease MONDO:0015626				36928819;26166300;40011789		False	2	0;100;0	21.664	False		ENSG00000111229	ENSG00000111229	HGNC:706													
ASPH	gene	ASPH	Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Exertional heat illness;malignant hyperthermia susceptibility, MONDO:0018493, ASPH-related				35697689		False	2	50;50;0	21.664	True		ENSG00000198363	ENSG00000198363	HGNC:757													
ATG5	gene	ATG5	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Spinocerebellar ataxia, autosomal recessive 25				16625204;26812546		False	2	0;100;0	21.664	True		ENSG00000057663	ENSG00000057663	HGNC:589													
ATM	gene	ATM	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-telangiectasia, MIM#208900;Childhood-onset progressive ataxia, conjunctival telangiectasia, sensory axonal neuropathy, chorea and dystonia, immunodeficiency and increased risk of malignancy, elevated  -fetoprotein;Ataxia-telangiectasia syndrome				32259893;20301790		False	2	0;50;50	21.664	True		ENSG00000149311	ENSG00000149311	HGNC:795													
ATP2A2	gene	ATP2A2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Congenital myopathy, MONDO:0019952, ATP2A2-related;{Rhabdomyolysis, susceptibility to, 2}, MIM# 621236				39970126		False	2	0;100;0	21.664	True		ENSG00000174437	ENSG00000174437	HGNC:812													
ATP2B4	gene	ATP2B4	Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Pure and complicated hereditary spastic paraplegia				29691679;25798335;25119969		False	2	0;100;0	21.664	False		ENSG00000058668	ENSG00000058668	HGNC:817													
ATP5F1A	gene	ATP5F1A	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A MIM#620358;Combined oxidative phosphorylation deficiency 22 616045;Mitochondrial complex V (ATP synthase) deficiency nuclear type 4, 615228				23599390;23596069;34954817		False	2	0;100;0	21.664	True		ENSG00000152234	ENSG00000152234	HGNC:823													
ATP5F1B	gene	ATP5F1B	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 38, susceptibility to, MIM# 621502;Hypermetabolism due to uncoupled mitochondrial oxidative phosphorylation 2, MIM# 620085				36860166;36239646;40276935		False	2	0;100;0	21.664	True		ENSG00000110955	ENSG00000110955	HGNC:830													
ATP5F1B	gene	ATP5F1B	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Dystonia 38, susceptibility to, MIM# 621502				36860166;40276935		False	2	50;50;0	21.664	True		ENSG00000110955	ENSG00000110955	HGNC:830													
ATP5F1E	gene	ATP5F1E	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 3 MIM#614053				PMID: 34954817, PMID: 22231385		False	2	0;100;0	21.664	True		ENSG00000124172	ENSG00000124172	HGNC:838													
ATP5MK	gene	ATP5MK	Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 6 MIM#618683				29917077;30240627;40014158		False	2	0;100;0	21.664	True		ENSG00000173915	ENSG00000173915	HGNC:30889													
ATP7B	gene	ATP7B	Expert list;Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease, 277900				16966556;12020274		False	2	0;100;0	21.664	False		ENSG00000123191	ENSG00000123191	HGNC:870													
ATP7B	gene	ATP7B	Expert Review Amber;Expert list;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease, MIM# 277900				27543917;28376267		False	2	50;50;0	21.664	True		ENSG00000123191	ENSG00000123191	HGNC:870													
B4GALNT1	gene	B4GALNT1	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 26, autosomal recessive (MIM#609195;MONDO:0012213)				20301682;23746551		False	2	0;100;0	21.664	True		ENSG00000135454	ENSG00000135454	HGNC:4117													
B4GAT1	gene	B4GAT1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13 MIM#615287				PMID 23877401, PMID: 23359570		False	2	0;100;0	21.664	True		ENSG00000174684	ENSG00000174684	HGNC:15685													
BAG3	gene	BAG3	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myopathy, myofibrillar, 6 (MIM#612954;MONDO:0013061)				19085932		False	2	0;100;0	21.664	True		ENSG00000151929	ENSG00000151929	HGNC:939													
BICD2	gene	BICD2	Expert list;Expert Review Amber;Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM#615290;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, MIM#618291				23664120;25497877;24482476		False	2	0;100;0	21.664	False		ENSG00000185963	ENSG00000185963	HGNC:17208													
BICD2	gene	BICD2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Neurodevelopmental disorder, BICD2-related (MONDO#0700092)				PMID: 35896821, PMID: 28635954, PMID: 32057122, PMID: 25497877, PMID: 35338243		False	2	0;100;0	21.664	True		ENSG00000185963	ENSG00000185963	HGNC:17208													
BMP6	gene	BMP6	Expert Review Amber;NHS Genomic Medicine Service;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	{Iron overload, susceptibility to} 620121				26582087		False	2	100;0;0	21.664	True		ENSG00000153162	ENSG00000153162	HGNC:1073													
BRCC3	gene	BRCC3	Expert Review Amber;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	MoyaMoya Disease, syndromic, MONDO:0016820				21596366;33868155		False	2	0;100;0	21.664	True		ENSG00000185515	ENSG00000185515	HGNC:24185													
CACNA2D1	gene	CACNA2D1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 110, MIM# 620149				35293990		False	2	33;33;33	21.664	True		ENSG00000153956	ENSG00000153956	HGNC:1399													
CACNB4	gene	CACNB4	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"{Epilepsy, idiopathic generalized, susceptibility to, 9}	607682;{Epilepsy, juvenile myoclonic, susceptibility to, 6}	607682"				10762541;35813387;31056551;22892567		False	2	0;100;0	21.664	True		ENSG00000182389	ENSG00000182389	HGNC:1404													
CACNB4	gene	CACNB4	Expert Review Red;Expert list;Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 5, MIM#613855				10762541;9628818;27003325		False	2	0;50;50	21.664	True		ENSG00000182389	ENSG00000182389	HGNC:1404													
CAMK2D	gene	CAMK2D	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO#0700092), CAMK2D-related				38272033		False	2	0;100;0	21.664	True		ENSG00000145349	ENSG00000145349	HGNC:1462													
CAPN1	gene	CAPN1	Expert list;Expert Review Amber;Expert list;Expert Review Green;Expert Review Green;Expert list;Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 76, autosomal recessive, 616907;MONDO:0014827				27320912;29678961;30572172;31023339;31104286		False	2	50;50;0	21.664	False		ENSG00000014216	ENSG00000014216	HGNC:1476													
CCDC88C	gene	CCDC88C	Victorian Clinical Genetics Services;GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	autosomal dominant spinocerebellar ataxia;?Spinocerebellar ataxia 40, 616053				25062847;30398676		False	2	33;67;0	21.664	False		ENSG00000015133	ENSG00000015133	HGNC:19967													
CCDC88C	gene	CCDC88C	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early-onset pure hereditary spastic paraplegia				33602173		False	2	0;100;0	21.664	True		ENSG00000015133	ENSG00000015133	HGNC:19967													
CCNF	gene	CCNF	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141				29102476;31577344;27080313;28105640;31445393;28852778		False	2	0;100;0	21.664	True		ENSG00000162063	ENSG00000162063	HGNC:1591													
CCNF	gene	CCNF	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141				27080313		False	2	0;100;0	21.664	True		ENSG00000162063	ENSG00000162063	HGNC:1591													
CCT5	gene	CCT5	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory, with spastic paraplegia, 256840;HMSN				16399879;25124038;25345891;33076433;37237456		False	2	0;100;0	21.664	True		ENSG00000150753	ENSG00000150753	HGNC:1618													
CCT5	gene	CCT5	Expert Review Amber;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory, with spastic paraplegia, 256840;HSAN with spastic paraplegia				12874111;16399879;25124038;28623285		False	2	0;100;0	21.664	True		ENSG00000150753	ENSG00000150753	HGNC:1618													
CCT6A	gene	CCT6A	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, CCT6A-related				39480921		False	2	0;100;0	21.664	True		ENSG00000146731	ENSG00000146731	HGNC:1620													
CD320	gene	CD320	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria, transient, due to transcobalamin receptor defect MIM#613646;Disorders of cobalamin absorption, transport and metabolism				29663633;27604308;30303736		False	2	100;0;0	21.664	True		ENSG00000167775	ENSG00000167775	HGNC:16692													
CDC42BPB	gene	CDC42BPB	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chilton-Okur-Chung neurodevelopmental syndrome, MIM# 619841				32031333		False	2	0;100;0	21.664	True		ENSG00000198752	ENSG00000198752	HGNC:1738													
CEP89	gene	CEP89	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency				23575228		False	2	0;0;100	21.664	True		ENSG00000121289	ENSG00000121289	HGNC:25907													
CFAP276	gene	CFAP276	Literature;Literature;Expert Review Amber;Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, intermediate or demyelinating				31199454;32592472		False	2	0;100;0	21.664	False		ENSG00000179902	ENSG00000179902	HGNC:32331													
CHD4	gene	CHD4	Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Moya Moya;Sifrim-Hitz-Weiss syndrome, MIM#	617159"				31474762		False	2	50;25;25	21.664	True		ENSG00000111642	ENSG00000111642	HGNC:1919													
CHD8	gene	CHD8	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, CHD8-related, MIM#615032;Dystonia				34415117		False	2	0;100;0	21.664	True		ENSG00000100888	ENSG00000100888	HGNC:20153													
CHKB	gene	CHKB	Expert Review Amber;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	megaconial type congenital muscular dystrophy MONDO:0011246;recurrent rhabdomyolysis;CHKB-Related Muscular Dystrophy				26782016;37011121;21665002;23692895;24997086		False	2	50;50;0	21.664	True		ENSG00000100288	ENSG00000100288	HGNC:1938													
CHKB	gene	CHKB	Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	megaconial type congenital muscular dystrophy MONDO:0011246;CHKB-Related Muscular Dystrophy				37011121		False	2	50;50;0	21.664	True		ENSG00000100288	ENSG00000100288	HGNC:1938													
CHMP3	gene	CHMP3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary spastic paraplegia (MONDO:0019064), CHMP3-related				PMID: 35710109		False	2	0;100;0	21.664	True		ENSG00000115561	ENSG00000115561	HGNC:29865													
CHP1	gene	CHP1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 9, autosomal recessive, OMIM #618438				29379881;32787936		False	2	50;50;0	21.664	True		ENSG00000187446	ENSG00000187446	HGNC:17433													
CIZ1	gene	CIZ1	Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Dystonia 23, 614860				27163549;29154038;22447717		False	2	0;100;0	21.664	False		ENSG00000148337	ENSG00000148337	HGNC:16744													
CLCC1	gene	CLCC1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis MONDO:0004976				37916886;37142673		False	2	0;100;0	21.664	False		ENSG00000121940	ENSG00000121940	HGNC:29675													
CLCN7	gene	CLCN7	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypopigmentation, organomegaly, and delayed myelination and development, MIM# 618541				31155284		False	2	0;100;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000103249	ENSG00000103249	HGNC:2025													
CLTCL1	gene	CLTCL1	Expert Review Amber;Literaure;Review;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown	Congenital insensitivity to pain				26068709;29402896		False	2	0;100;0	21.664	True		ENSG00000070371	ENSG00000070371	HGNC:2093													
CMPK2	gene	CMPK2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	bilateral striopallidodentate calcinosis, MONDO:0008947, CMPK2-related				36443312		False	2	0;100;0	21.664	True		ENSG00000134326	ENSG00000134326	HGNC:27015													
CMPK2	gene	CMPK2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	bilateral striopallidodentate calcinosis, MONDO:0008947, CMPK2-related				36443312		False	2	0;100;0	21.664	True		ENSG00000134326	ENSG00000134326	HGNC:27015													
CNOT3	gene	CNOT3	Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Moya Moya;Intellectual developmental disorder with speech delay, autism, and dysmorphic facies, MIM#	618672"				31474762		False	2	50;50;0	21.664	True		ENSG00000088038	ENSG00000088038	HGNC:7879													
COASY	gene	COASY	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 6, MIM# 615643				28489334;24360804		False	2	0;100;0	21.664	True		ENSG00000068120	ENSG00000068120	HGNC:29932													
COG3	gene	COG3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIbb, MIM# 620546				37711075		False	2	0;100;0	21.664	True		ENSG00000136152	ENSG00000136152	HGNC:18619													
COG3	gene	COG3	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIbb, MIM# 620546				PMID: 37711075		False	2	0;100;0	21.664	True		ENSG00000136152	ENSG00000136152	HGNC:18619													
COG4	gene	COG4	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIj, MIM#613489						False	2	0;100;0	21.664	True		ENSG00000103051	ENSG00000103051	HGNC:18620													
COG6	gene	COG6	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 6, MIM#614650						False	2	0;100;0	21.664	True		ENSG00000133103	ENSG00000133103	HGNC:18621													
COG8	gene	COG8	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIh, 611182				28619360;17220172;17331980		False	2	50;50;0	21.664	True		ENSG00000213380	ENSG00000213380	HGNC:18623													
COL4A2	gene	COL4A2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Familial porencephaly MONDO:0020496				35699195;37272523;36300346		False	2	0;100;0	21.664	True		ENSG00000134871	ENSG00000134871	HGNC:2203													
COL6A3	gene	COL6A3	Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 27, MIM#616411				26004199;32037012;26872670;32037012		False	2	50;50;0	21.664	False		ENSG00000163359	ENSG00000163359	HGNC:2213													
COLGALT1	gene	COLGALT1	Expert Review Amber;Expert Review;Expert Review Green;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain small vessel disease 3 MIM#618360				30412317;33709034;31759980		False	2	50;50;0	21.664	True		ENSG00000130309	ENSG00000130309	HGNC:26182													
COQ2	gene	COQ2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	multiple system atrophy, MONDO:0007803				39152783;30242188;25672683;23758206		False	2	0;100;0	21.664	True		ENSG00000173085	ENSG00000173085	HGNC:25223													
COQ6	gene	COQ6	Expert Review Green;Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 6, MIM#614650				21540551		False	2	50;50;0	21.664	True		ENSG00000119723	ENSG00000119723	HGNC:20233													
COX10	gene	COX10	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 3 (MIM#619046)				10767350		False	2	0;100;0	21.664	True		ENSG00000006695	ENSG00000006695	HGNC:2260													
COX10	gene	COX10	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, MIM#220110				10767350		False	2	0;100;0	21.664	True		ENSG00000006695	ENSG00000006695	HGNC:2260													
COX14	gene	COX14	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial complex IV deficiency, nuclear type 10, MIM#	619053"				22243966		False	2	0;100;0	21.664	True		ENSG00000178449	ENSG00000178449	HGNC:28216													
COX15	gene	COX15	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 2;MIM#615119 and Leigh syndrome #256000				21412973;12474143;15863660;15235026		False	2	0;100;0	21.664	True		ENSG00000014919	ENSG00000014919	HGNC:2263													
COX16	gene	COX16	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 22, MIM# 619355;Hypertrophic cardiomyopathy;encephalopathy;severe fatal lactic acidosis				33169484		False	2	0;100;0	21.664	True		ENSG00000133983	ENSG00000133983	HGNC:20213													
COX5A	gene	COX5A	Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 20, MIM#619064;pulmonary arterial hypertension;lactic acidemia;failure to thrive;isolated complex IV deficiency				28247525;35246835		False	2	0;50;50	21.664	True		ENSG00000178741	ENSG00000178741	HGNC:2267													
CP	gene	CP	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Hemosiderosis, systemic, due to aceruloplasminemia	MIM#604290"				PMID: 32741407, PMID: 18200628		False	2	0;100;0	21.664	True		ENSG00000047457	ENSG00000047457	HGNC:2295													
CPT1C	gene	CPT1C	Expert Review Amber;Royal Melbourne Hospital;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 73, autosomal dominant, MIM#616282;MONDO:0014568				25751282;30911584;30564185;23973755;41312619		False	2	50;50;0	21.664	True		ENSG00000169169	ENSG00000169169	HGNC:18540													
CRAT	gene	CRAT	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodegeneration with brain iron accumulation 8, MIM#	617917;Leigh syndrome"				29395073;31448845		False	2	0;100;0	21.664	True		ENSG00000095321	ENSG00000095321	HGNC:2342													
CRYAB	gene	CRYAB	Expert Review Green;Expert Review Amber;Expert list;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myopathy, myofibrillar, 2, MIM# 608810				PMID: 21337604;32420686		False	2	25;75;0	21.664	True		ENSG00000109846	ENSG00000109846	HGNC:2389													
CSNK1A1	gene	CSNK1A1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Infantile spasms, MONDO:0018097, CSNK1A1-related				40156289		False	2	0;100;0	21.664	True		ENSG00000113712	ENSG00000113712	HGNC:2451													
CTH	gene	CTH	Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cystathioninuria MIM#219500				12574942;20584029;24761004;15151507		False	2	100;0;0	21.664	True		ENSG00000116761	ENSG00000116761	HGNC:2501													
CUL3	gene	CUL3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with or without autism or seizures, MIM# 619239;Global developmental delay;Intellectual disability;Seizures;Abnormality of cardiovascular system morphology;Abnormality of the palate				32341456		False	2	0;100;0	21.664	True		ENSG00000036257	ENSG00000036257	HGNC:2553													
CYLD	gene	CYLD	Expert Review Amber;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132				32666117;32666099;32185393		False	2	25;50;25	21.664	True	Other	ENSG00000083799	ENSG00000083799	HGNC:2584													
CYLD	gene	CYLD	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132				32185393		False	2	0;50;50	21.664	True		ENSG00000083799	ENSG00000083799	HGNC:2584													
CYP2U1	gene	CYP2U1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 56, autosomal recessive 615030				27292318		False	2	0;100;0	21.664	False		ENSG00000155016	ENSG00000155016	HGNC:20582													
DALRD3	gene	DALRD3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy, 86 MONDO:0030054				32427860;39482881		False	2	0;100;0	21.664	True		ENSG00000178149	ENSG00000178149	HGNC:25536													
DARS2	gene	DARS2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM#	611105"				17384640;15002045;16788019;30352563;34104671		False	2	0;50;50	21.664	True		ENSG00000117593	ENSG00000117593	HGNC:25538													
DCAF8	gene	DCAF8	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	?Giant axonal neuropathy 2, autosomal dominant, 610100;HMSN				24500646		False	2	0;100;0	21.664	True		ENSG00000132716	ENSG00000132716	HGNC:24891													
DCXR	gene	DCXR	Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pentosuria MIM#260800;Disorders of pentose metabolism				22042873		False	2	100;0;0	21.664	True		ENSG00000169738	ENSG00000169738	HGNC:18985													
DENR	gene	DENR	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, DENR-related				27239039		False	2	0;100;0	21.664	True		ENSG00000139726	ENSG00000139726	HGNC:2769													
DGAT2	gene	DGAT2	Royal Melbourne Hospital;Expert Review;Expert Review Amber;Expert Review Amber;Expert Review Amber;Expert Review Amber;Expert Review;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease, MONDO:0015626, DGAT2-related				26786738		False	2	0;100;0	21.664	False		ENSG00000062282	ENSG00000062282	HGNC:16940													
DHDDS	gene	DHDDS	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental delay and seizures with or without movement abnormalities, MIM# 617836;Myoclonic Epilepsy;Parkinsonism;Ataxia;Intellectual disability				PMID: 34837344;29100083		False	2	50;50;0	21.664	True		ENSG00000117682	ENSG00000117682	HGNC:20603													
DHFR	gene	DHFR	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Megaloblastic anemia due to dihydrofolate reductase deficiency, MIM# 613839				21310276;21310277		False	2	0;100;0	21.664	True		ENSG00000228716	ENSG00000228716	HGNC:2861													
DHRS9	gene	DHRS9	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Genetic epilepsy, MONDO:0100575, DHRS9				40945732;32752300;38256219		False	2	0;100;0	21.664	True		ENSG00000073737	ENSG00000073737	HGNC:16888													
DHTKD1	gene	DHTKD1	NHS GMS;Expert Review Amber;Expert Review Green;Literature;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Charcot-Marie-Tooth disease axonal type 2Q MONDO:0014012				23141294, 29661920, 28902413		False	2	0;100;0	21.664	False		ENSG00000181192	ENSG00000181192	HGNC:23537													
DNAJA3	gene	DNAJA3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, DNAJA3-related				34750646;30770860;41354729		False	2	0;100;0	21.664	True		ENSG00000103423	ENSG00000103423	HGNC:11808													
DNAJA3	gene	DNAJA3	Expert Review Amber;Literature;Literature;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, DNAJA3-related				34750646;30770860;41354729		False	2	0;100;0	21.664	True		ENSG00000103423	ENSG00000103423	HGNC:11808													
DNAJC6	gene	DNAJC6	Expert list;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 19a, juvenile-onset - MIM#615528;Parkinson disease 19b, early-onset - MIM#615528				22563501, 23211418, 26528954, 33983693		False	2	50;50;0	21.664	True		ENSG00000116675	ENSG00000116675	HGNC:15469													
DNAJC7	gene	DNAJC7	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	amyotrophic lateral sclerosis				31768050;40802071;35039179;34233860;32897108;37870677;35456894		False	2	33;67;0	21.664	True		ENSG00000168259	ENSG00000168259	HGNC:12392													
DNMT3B	gene	DNMT3B	Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Facioscapulohumeral muscular dystrophy MONDO:0001347				27153398;33004076		False	2	50;50;0	21.664	True		ENSG00000088305	ENSG00000088305	HGNC:2979													
DPM2	gene	DPM2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type Iu, MIM#615042				23109149		False	2	0;100;0	21.664	True		ENSG00000136908	ENSG00000136908	HGNC:3006													
DROSHA	gene	DROSHA	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO#0700092), DROSHA-related				35405010		False	2	0;100;0	21.664	True		ENSG00000113360	ENSG00000113360	HGNC:17904													
DSTYK	gene	DSTYK	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 23, MIM#270750				28157540;23862974		False	2	0;100;0	21.664	True		ENSG00000133059	ENSG00000133059	HGNC:29043													
DTYMK	gene	DTYMK	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, with progressive microcephaly (MIM# 619847)						False	2	0;100;0	21.664	True		ENSG00000168393	ENSG00000168393	HGNC:3061													
EBP	gene	EBP	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Chondrodysplasia punctata, X-linked dominant (MIM#302960)				12509714		False	2	0;100;0	21.664	True		ENSG00000147155	ENSG00000147155	HGNC:3133													
EMILIN1	gene	EMILIN1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronopathy, distal hereditary motor, type X, MIM# 620080;Peripheral neuropathy;aortic aneurysm				31978608;26462740		False	2	50;50;0	21.664	True		ENSG00000138080	ENSG00000138080	HGNC:19880													
EPM2A	gene	EPM2A	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780;Progressive Myoclonic Epilepsy;Parkinsonism				27574708;28818698		False	2	50;50;0	21.664	True		ENSG00000112425	ENSG00000112425	HGNC:3413													
ERAL1	gene	ERAL1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Perrault syndrome 6, MIM#	617565"				28449065		False	2	0;100;0	21.664	True		ENSG00000132591	ENSG00000132591	HGNC:3424													
ERCC2	gene	ERCC2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Trichothiodystrophy 1, photosensitive 601675				29451896		False	2	0;100;0	21.664	False		ENSG00000104884	ENSG00000104884	HGNC:3434													
ETFB	gene	ETFB	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric acidemia IIB 231680				12815589;7912128		False	2	0;100;0	21.664	True		ENSG00000105379	ENSG00000105379	HGNC:3482													
ETFDH	gene	ETFDH	Expert Review Green;Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Glutaric acidemia IIC	231680"				PMID: 19592060;17412732		False	2	50;50;0	21.664	True		ENSG00000171503	ENSG00000171503	HGNC:3483													
EXOSC3	gene	EXOSC3	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 1b;dHMN/dSMA						False	2	0;100;0	21.664	True		ENSG00000107371	ENSG00000107371	HGNC:17944													
EXOSC3	gene	EXOSC3	Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Pontocerebellar hypoplasia, type 1B	614678;Intellectual disability;Microcephaly;Hypotonia;Mitochondrial dysfunction"				28687512		False	2	0;100;0	21.664	True		ENSG00000107371	ENSG00000107371	HGNC:17944													
EXOSC3	gene	EXOSC3	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 1b;Complicated hereditary spastic paraplegia				25149867;23975261		False	2	0;100;0	21.664	True		ENSG00000107371	ENSG00000107371	HGNC:17944													
FAM50A	gene	FAM50A	Expert Review Green;Literature;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mental retardation syndrome, X-linked, Armfield type (MIM #300261)				32703943		False	2	0;100;0	21.664	True		ENSG00000071859	ENSG00000071859	HGNC:18786													
FAR1	gene	FAR1	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM#616154				25439727		False	2	0;100;0	21.664	True		ENSG00000197601	ENSG00000197601	HGNC:26222													
FAT3	gene	FAT3	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peripheral neuropathy MONDO:0005244, FAT3-related				41937739;35853984;31486992;26559152		False	2	0;100;0	21.664	True		ENSG00000165323	ENSG00000165323	HGNC:23112													
FBP2	gene	FBP2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Leukodystrophy, childhood-onset, remitting, MIM# 	619864"				33977262		False	2	0;100;0	21.664	True		ENSG00000130957	ENSG00000130957	HGNC:3607													
FBXL4	gene	FBXL4	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) MIM#615471						False	2	0;100;0	21.664	True		ENSG00000112234	ENSG00000112234	HGNC:13601													
FBXO38	gene	FBXO38	Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronopathy, distal hereditary motor, type IID, 615575;dHMN/dSMA						False	2	0;100;0	21.664	False		ENSG00000145868	ENSG00000145868	HGNC:28844													
FDX2	gene	FDX2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy MIM#251900				30010796		False	2	0;100;0	21.664	True		ENSG00000267673	ENSG00000267673	HGNC:30546													
FDX2	gene	FDX2	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy	(MIM#251900)"				30010796;24281368;28803783		False	2	0;100;0	21.664	True		ENSG00000267673	ENSG00000267673	HGNC:30546													
FECH	gene	FECH	NHS Genomic Medicine Service;Expert Review Amber;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	EPP1;177000 PROTOPORPHYRIA, ERYTHROPOIETIC, 1				20857522;26387792;28614581		False	2	0;0;0	21.664	False		ENSG00000066926	ENSG00000066926	HGNC:3647													
FIG4	gene	FIG4	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic Lateral Sclerosis Type 11 (MONDO: 0012945;MIM#612577)						False	2	100;0;0	21.664	True		ENSG00000112367	ENSG00000112367	HGNC:16873													
FKRP	gene	FKRP	Expert Review Green;Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5, MIM#613153						False	2	50;50;0	21.664	True		ENSG00000181027	ENSG00000181027	HGNC:17997													
FOXJ3	gene	FOXJ3	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Focal epilepsy, MONDO:0005384, FOXJ3-related				41803108		False	2	0;100;0	21.664	True		ENSG00000198815	ENSG00000198815	HGNC:29178													
FOXM1	gene	FOXM1	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Moyamoya disease MONDO:0016820				38969938		False	2	0;100;0	21.664	True		ENSG00000111206	ENSG00000111206	HGNC:3818													
FRA10AC1	gene	FRA10AC1	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neurodevelopmental disorder with growth retardation, dysmorphic facies, and corpus callosum abnormalities, MIM#	620113"				34694367;35871492;35821753		False	2	0;100;0	21.664	True		ENSG00000148690	ENSG00000148690	HGNC:1162													
FXYD2	gene	FXYD2	Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Renal hypomagnesemia 2 MONDO:0007937, Disorders of magnesium metabolism				17980699, 12763862, 18448590, 11062458, 25765846, 27014088		False	2	0;0;0	21.664	False		ENSG00000137731	ENSG00000137731	HGNC:4026													
GALC	gene	GALC	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Krabbe Disease MIM#245200				20301416;21070211		False	2	0;100;0	21.664	True		ENSG00000054983	ENSG00000054983	HGNC:4115													
GATAD2B	gene	GATAD2B	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 18, OMIM # 615074				32688057		False	2	0;100;0	21.664	True		ENSG00000143614	ENSG00000143614	HGNC:30778													
GATB	gene	GATB	Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	inborn mitochondrial metabolism disorder MONDO:0004069				30283131;38703036		False	2	0;50;50	21.664	True		ENSG00000059691	ENSG00000059691	HGNC:8849													
GATM	gene	GATM	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral creatine deficiency syndrome 3, MIM# 612718				36856349;12468279;20682460;22386973		False	2	0;100;0	21.664	True		ENSG00000171766	ENSG00000171766	HGNC:4175													
GBA1	gene	GBA1	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Other	{Lewy body dementia, susceptibility to} (MIM# 127750)				23588557;32439597;31010158		False	2	0;100;0	21.664	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GCDH	gene	GCDH	Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric aciduria, type I, MIM#231670						False	2	0;100;0	21.664	False		ENSG00000105607	ENSG00000105607	HGNC:4189													
GFPT1	gene	GFPT1	Expert Review Amber;Expert list;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myasthenia, congenital, 12, with tubular aggregates 610542;Leukoencephalopathy				30635494		False	2	50;50;0	21.664	False		ENSG00000198380	ENSG00000198380	HGNC:4241													
GGT1	gene	GGT1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Glutathioninuria MIM#231950;Disorders of the gamma-glutamyl cycle				31520399;27604308;23615310;29483667		False	2	0;100;0	21.664	True		ENSG00000100031	ENSG00000100031	HGNC:4250													
GJC2	gene	GJC2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 44, autosomal recessive, MIM#	613206"				19056803;31431325;25059390		False	2	0;100;0	21.664	True		ENSG00000198835	ENSG00000198835	HGNC:17494													
GLA	gene	GLA	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Fabry disease, MIM# 301500				32734340;24372060;30532363		False	2	0;100;0	21.664	True		ENSG00000102393	ENSG00000102393	HGNC:4296													
GLT8D1	gene	GLT8D1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis				30811981		False	2	50;50;0	21.664	True		ENSG00000016864	ENSG00000016864	HGNC:24870													
GMPPA	gene	GMPPA	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Alacrima, achalasia, and impaired intellectual development syndrome (MIM# 615510)				24035193;28574218		False	2	0;100;0	21.664	True		ENSG00000144591	ENSG00000144591	HGNC:22923													
GPSM2	gene	GPSM2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chudley-McCullough syndrome, MIM# 604213				20602914;22578326;28387217;27180139;27064331		False	2	0;100;0	21.664	True		ENSG00000121957	ENSG00000121957	HGNC:29501													
GTPBP2	gene	GTPBP2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Jaberi-Elahi syndrome, MIM# 617988				26675814;29449720		False	2	50;50;0	21.664	True		ENSG00000172432	ENSG00000172432	HGNC:4670													
H6PD	gene	H6PD	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease MONDO:0005180				40959972		False	2	0;100;0	21.664	True		ENSG00000049239	ENSG00000049239	HGNC:4795													
HACE1	gene	HACE1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia and psychomotor retardation with or without seizures MIM#616756				26424145;26437029		False	2	0;100;0	21.664	True		ENSG00000085382	ENSG00000085382	HGNC:21033													
HADHB	gene	HADHB	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial Trifunctional Protein Deficiency 2 with Myopathy and Neuropathy MIM#320300				37388542;36063482;24664533		False	2	0;50;50	21.664	True		ENSG00000138029	ENSG00000138029	HGNC:4803													
HAL	gene	HAL	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Histidinemia MIM#235800;Disorders of histidine, tryptophan or lysine metabolism				27604308;15806399;20156889		False	2	100;0;0	21.664	True		ENSG00000084110	ENSG00000084110	HGNC:4806													
HARS1	gene	HARS1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	multisystem ataxic syndrome				32333447		False	2	33;67;0	21.664	True		ENSG00000170445	ENSG00000170445	HGNC:4816													
HBB	gene	HBB	Genomics England PanelApp;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sickle cell anemia  603903				20301551		False	2	50;0;50	21.664	False		ENSG00000244734	ENSG00000244734	HGNC:4827													
HCCS	gene	HCCS	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Other	Linear skin defects with multiple congenital anomalies 1, 309801				17033964		False	2	0;100;0	21.664	True		ENSG00000004961	ENSG00000004961	HGNC:4837													
HDAC8	gene	HDAC8	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Cornelia de Lange syndrome 5, MIM# 300882						False	2	0;100;0	21.664	True		ENSG00000147099	ENSG00000147099	HGNC:13315													
HEATR5B	gene	HEATR5B	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia MONDO:0020135, HEATR5B-related				33824466		False	2	0;100;0	21.664	True		ENSG00000008869	ENSG00000008869	HGNC:29273													
HNRNPA1	gene	HNRNPA1	Expert Review Amber;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy with early-onset Paget disease without frontotemporal dementia 3 MIM#615424;Amyotrophic lateral sclerosis 20 MIM#615426				24612671;24119545;23455423		False	2	0;0;100	21.664	True		ENSG00000135486	ENSG00000135486	HGNC:5031													
HNRNPA2B1	gene	HNRNPA2B1	Expert Review Amber;ClinGen	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis MONDO:0004976				25299611		False	2	0;0;100	21.664	True		ENSG00000122566	ENSG00000122566	HGNC:5033													
HNRNPA2B1	gene	HNRNPA2B1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 2 MIM#615422				23455423;30279180;29358076;26744327;23635965		False	2	0;100;0	21.664	True		ENSG00000122566	ENSG00000122566	HGNC:5033													
HNRNPK	gene	HNRNPK	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Au-Kline syndrome MIM#616580				30998304;26173930;29904177;26954065;28771707		False	2	0;100;0	21.664	True		ENSG00000165119	ENSG00000165119	HGNC:5044													
HOXA1	gene	HOXA1	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bosley-Salih-Alorainy syndrome, MIM#601536 and Athabaskan brainstem dysgenesis syndrome, MIM#601536						False	2	0;100;0	21.664	True		ENSG00000105991	ENSG00000105991	HGNC:5099													
HPRT1	gene	HPRT1	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Lesch-Nyhan syndrome				27858372		False	2	50;50;0	21.664	True		ENSG00000165704	ENSG00000165704	HGNC:5157													
HYAL1	gene	HYAL1	Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mucopolysaccharidosis type IX, MIM# 601492;MONDO:0011093				10339581;18344557;21559944		False	2	0;100;0	21.664	True		ENSG00000114378	ENSG00000114378	HGNC:5320													
HYCC1	gene	HYCC1	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	HMSN;Congenital cataracts, global developmental delay from 1 year, diffuse cerebral hypomyelination on MRI, neuropathy with SNCV;Leukodystrophy, hypomyelinating, 5, 610532						False	2	0;0;100	21.664	True		ENSG00000122591	ENSG00000122591	HGNC:24587													
IDH3B	gene	IDH3B	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Retinitis pigmentosa 46, MIM# 612572				18806796;31736247		False	2	0;100;0	21.664	True		ENSG00000101365	ENSG00000101365	HGNC:5385													
IRF2BPL	gene	IRF2BPL	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures	618088"				PMID: 30057031;30166628		False	2	0;100;0	21.664	True		ENSG00000119669	ENSG00000119669	HGNC:14282													
IRF8	gene	IRF8	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Immunodeficiency 32B, monocyte and dendritic cell deficiency, autosomal recessive, MIM#	226990"				29128673;35338423		False	2	0;100;0	21.664	True		ENSG00000140968	ENSG00000140968	HGNC:5358													
ITM2B	gene	ITM2B	Other;Expert Review Amber;Expert Review Amber;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ABri amyloidosis MONDO:0008306				10775542		False	2	0;100;0	21.664	False	Other	ENSG00000136156	ENSG00000136156	HGNC:6174													
JAKMIP1	gene	JAKMIP1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder (MONDO#0700092), JAKMIP1-related				29158550;26627310;27799067		False	2	0;100;0	21.664	True		ENSG00000152969	ENSG00000152969	HGNC:26460													
JMJD1C	gene	JMJD1C	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual disability (MONDO#0001071), JMJD1C-related				PMID: 32996679;26181491;31954878		False	2	0;100;0	21.664	True		ENSG00000171988	ENSG00000171988	HGNC:12313													
KARS1	gene	KARS1	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, recessive intermediate, B (MIM#613641;MONDO:0013338)				20920668		False	2	0;100;0	21.664	True		ENSG00000065427	ENSG00000065427	HGNC:6215													
KCNB2	gene	KCNB2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodevelopmental disorder MONDO:0700092, KCNB2-related				38503299		False	2	0;100;0	21.664	True		ENSG00000182674	ENSG00000182674	HGNC:6232													
KCNJ3	gene	KCNJ3	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy (MONDO#0005027), KCNJ3-related				PMID: 37963718		False	2	0;100;0	21.664	True		ENSG00000162989	ENSG00000162989	HGNC:6264													
KCNQ2	gene	KCNQ2	Expert Review Amber;Expert list;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early infantile encephalopathy 7, 613720;Myokymia, 121200				22169383;20962009;10575255		False	2	33;67;0	21.664	True		ENSG00000075043	ENSG00000075043	HGNC:6296													
KCNQ2	gene	KCNQ2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 7 MIM#613720				12742592;32585800		False	2	0;100;0	21.664	True		ENSG00000075043	ENSG00000075043	HGNC:6296													
KGD4	gene	KGD4	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related				PMID: 41018056;38685873		False	2	0;100;0	21.664	True		ENSG00000134056	ENSG00000134056	HGNC:16631													
KGD4	gene	KGD4	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related				PMID: 41018056;38685873		False	2	0;100;0	21.664	True		ENSG00000134056	ENSG00000134056	HGNC:16631													
KHK	gene	KHK	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fructosuria MIM#229800;Disorders of fructose metabolism				7833921;27604308;29870677		False	2	0;100;0	21.664	True		ENSG00000138030	ENSG00000138030	HGNC:6315													
KIF1C	gene	KIF1C	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic ataxia 2, autosomal recessive, MIM#	611302"				31413903		False	2	0;100;0	21.664	True		ENSG00000129250	ENSG00000129250	HGNC:6317													
KIF4A	gene	KIF4A	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 100 MIM#300923				24812067;34346154;36482480		False	2	0;100;0	21.664	True		ENSG00000090889	ENSG00000090889	HGNC:13339													
KIF5A	gene	KIF5A	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 10, autosomal dominant MIM#604187				18853458		False	2	0;100;0	21.664	True		ENSG00000155980	ENSG00000155980	HGNC:6323													
KIF5A	gene	KIF5A	Expert Review Amber;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis, susceptibility to, 25 MONDO:0060670				33077544;36604770		False	2	0;100;0	21.664	True	Other	ENSG00000155980	ENSG00000155980	HGNC:6323													
KLHL9	gene	KLHL9	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	distal myopathy MONDO:0018949				20554658;40818927;33458580		False	2	0;100;0	21.664	True		ENSG00000198642	ENSG00000198642	HGNC:18732													
LAMP2	gene	LAMP2	Expert Review Green;Expert Review Amber;Expert Review;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Danon disease (MIM#300257)				27179547;22541782		False	2	50;50;0	21.664	True		ENSG00000005893	ENSG00000005893	HGNC:6501													
LARGE1	gene	LARGE1	Expert Review Green;Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM#613154;Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 6 MIM#608840						False	2	50;50;0	21.664	True		ENSG00000133424	ENSG00000133424	HGNC:6511													
LGALSL	gene	LGALSL	Expert Review Amber;ClinGen	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown	amyotrophic lateral sclerosis MONDO:0004976				30940688		False	2	0;100;0	21.664	True		ENSG00000119862	ENSG00000119862	HGNC:25012													
LMNA	gene	LMNA	Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease, type 2B1 , MIM#605588				11799477;28902413		False	2	0;100;0	21.664	False		ENSG00000160789	ENSG00000160789	HGNC:6636													
LMNB1	gene	LMNB1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Global developmental delay;Intellectual disability;Microcephaly;Short stature;Seizures;Abnormality of the corpus callosum;Cortical gyral simplification;Feeding difficulties;Scoliosis				32910914		False	2	0;100;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000113368	ENSG00000113368	HGNC:6637													
LMNB2	gene	LMNB2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Epilepsy, progressive myoclonic, 9  MIM#616540				PMID: 33783721;25954030;34466237		False	2	0;100;0	21.664	True		ENSG00000176619	ENSG00000176619	HGNC:6638													
LPIN1	gene	LPIN1	Expert Review Green;Expert Review Amber;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myoglobinuria, acute recurrent, autosomal recessive (MIM#268200)				28649549;18817903;32410653		False	2	67;33;0	21.664	True		ENSG00000134324	ENSG00000134324	HGNC:13345													
LRIF1	gene	LRIF1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Facioscapulohumeral muscular dystrophy MONDO:0001347				32467133		False	2	0;100;0	21.664	True		ENSG00000121931	ENSG00000121931	HGNC:30299													
LSM7	gene	LSM7	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy and cerebellar atrophy, MIM# 621191				https://doi.org/10.1016/j.xhgg.2021.100034;39420558		False	2	0;50;50	21.664	True		ENSG00000130332	ENSG00000130332	HGNC:20470													
LYRM4	gene	LYRM4	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 19, MIM# 615595				23814038;31497476		False	2	0;100;0	21.664	True		ENSG00000214113	ENSG00000214113	HGNC:21365													
LYST	gene	LYST	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chediak-Higashi syndrome, MIM#214500				10450360		False	2	50;50;0	21.664	True		ENSG00000143669	ENSG00000143669	HGNC:1968													
LYST	gene	LYST	Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	spastic paraplegia;Spastic paraplegia;Chediak-Higashi syndrome, 214500				26307451;24521565		False	2	0;100;0	21.664	False		ENSG00000143669	ENSG00000143669	HGNC:1968													
MAGED1	gene	MAGED1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder, MONDO:0700092, MAGED1-related				42162770		False	2	0;100;0	21.664	False		ENSG00000179222	ENSG00000179222	HGNC:6813													
MAL	gene	MAL	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 28, MIM#  620978				35217805		False	2	0;100;0	21.664	True		ENSG00000172005	ENSG00000172005	HGNC:6817													
MAMDC2	gene	MAMDC2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Muscular Dystrophy MONDO:0020121, MAMDC2-related				37503746		False	2	0;100;0	21.664	True		ENSG00000165072	ENSG00000165072	HGNC:23673													
MAN2A2	gene	MAN2A2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, MONDO:0015286, MAN2A2-reated				36357165;40628855		False	2	0;100;0	21.664	True		ENSG00000196547	ENSG00000196547	HGNC:6825													
MANBA	gene	MANBA	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mannosidosis, beta, MIM#248510				12468273;22369051		False	2	0;100;0	21.664	True		ENSG00000109323	ENSG00000109323	HGNC:6831													
MAPK8IP3	gene	MAPK8IP3	Expert Review Amber;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with or without variable brain abnormalities MIM#618443				PMID: 30612693		False	2	50;50;0	21.664	True		ENSG00000138834	ENSG00000138834	HGNC:6884													
MAPK8IP3	gene	MAPK8IP3	Expert Review Amber;Literature;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431				30612693;30945334		False	2	0;100;0	21.664	True		ENSG00000138834	ENSG00000138834	HGNC:6884													
MAPT	gene	MAPT	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dementia, frontotemporal, with or without parkinsonism MIM#600274				17319286;15883319		False	2	0;100;0	21.664	True		ENSG00000186868	ENSG00000186868	HGNC:6893													
MARS1	gene	MARS1	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 70, autosomal recessive, MIM# 620323				24482476;34585293		False	2	0;50;50	21.664	True		ENSG00000166986	ENSG00000166986	HGNC:6898													
MARS2	gene	MARS2	Expert Review Green;Expert list;Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 25, OMIM #616430;Spastic ataxia 3, autosomal recessive, OMIM #611390				25754315		False	2	0;100;0	21.664	True		ENSG00000247626	ENSG00000247626	HGNC:25133													
MATR3	gene	MATR3	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis 21 MIM#606070;frontotemporal dementia;multisystem proteinopathy				24686783;30015619;28029397;33408686		False	2	0;100;0	21.664	True		ENSG00000015479	ENSG00000015479	HGNC:6912													
MDH1	gene	MDH1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	epilepsy;microcephaly;intellectual disability;Epileptic encephalopathy, early infantile, 88, MIM#618959				31538237		False	2	0;100;0	21.664	True		ENSG00000014641	ENSG00000014641	HGNC:6970													
MFF	gene	MFF	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy due to defective mitochondrial and peroxisomal fission 2 MIM# 617086				26783368		False	2	0;0;100	21.664	True		ENSG00000168958	ENSG00000168958	HGNC:24858													
MICAL1	gene	MICAL1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant epilepsy with auditory features (ADEAF)				29394500;21638339;38705457		False	2	0;100;0	21.664	True		ENSG00000135596	ENSG00000135596	HGNC:20619													
MKKS	gene	MKKS	Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 6, 605231				15637713		False	2	67;33;0	21.664	True		ENSG00000125863	ENSG00000125863	HGNC:7108													
MOCS1	gene	MOCS1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Molybdenum cofactor deficiency A, MIM# 252150				27289259		False	2	0;50;50	21.664	True		ENSG00000124615	ENSG00000124615	HGNC:7190													
MPC2	gene	MPC2	Expert Review Amber;Literature;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	mitochondrial pyruvate carrier deficiency, MONDO:0013877, MPC2-related				36417180		False	2	0;100;0	21.664	True		ENSG00000143158	ENSG00000143158	HGNC:24515													
MRPL50	gene	MRPL50	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO: 004470, MRPL50-related				PMID: 37148394		False	2	0;100;0	21.664	True		ENSG00000136897	ENSG00000136897	HGNC:16654													
MRPS14	gene	MRPS14	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Combined oxidative phosphorylation deficiency 38, MIM#	618378"				30358850		False	2	0;100;0	21.664	True		ENSG00000120333	ENSG00000120333	HGNC:14049													
MRPS16	gene	MRPS16	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Australian Genomcis Health Alliance Leukodystrophy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 2;OMIM #610498				28749478;15505824		False	2	0;0;100	21.664	True		ENSG00000182180	ENSG00000182180	HGNC:14048													
MRPS7	gene	MRPS7	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 34, MIM# 617872				25556185;36421788		False	2	0;50;50	21.664	True		ENSG00000125445	ENSG00000125445	HGNC:14499													
MT-ATP8	gene	MT-ATP8	Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease MONDO:0044970, MT-ATP8 related				24153443;20207608;32858252;33340416;32858252;19759059;22919063		False	2	0;100;0	21.664	True		ENSG00000228253	ENSG00000228253	HGNC:7415													
MT-ATP8	gene	MT-ATP8	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease MONDO:0044970, MT-ATP8 related				24153443;20207608;32858252;33340416;32858252;19759059;22919063		False	2	0;100;0	21.664	True		ENSG00000228253	ENSG00000228253	HGNC:7415													
MT-ATP8	gene	MT-ATP8	Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease MONDO:0044970, MT-ATP8 related				24153443;20207608;32858252;33340416;32858252;19759059;22919063		False	2	0;100;0	21.664	True		ENSG00000228253	ENSG00000228253	HGNC:7415													
MTERF3	gene	MTERF3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease (MONDO:0044970), MTERF3-related				40543543		False	2	0;100;0	21.664	True		ENSG00000156469	ENSG00000156469	HGNC:24258													
MTNAP1	gene	MTNAP1	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970				41720819		False	2	0;100;0	21.664	True		ENSG00000141219	ENSG00000141219	HGNC:29601													
MTNAP1	gene	MTNAP1	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970				41720819		False	2	0;100;0	21.664	True		ENSG00000141219	ENSG00000141219	HGNC:29601													
MTNAP1	gene	MTNAP1	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970				41720819		False	2	0;100;0	21.664	True		ENSG00000141219	ENSG00000141219	HGNC:29601													
MT-ND4L	gene	MT-ND4L	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4L-related				8680405;11935318;17003408;22879922;24568867		False	2	0;100;0	21.664	True		ENSG00000212907	ENSG00000212907	HGNC:7460													
MTPAP	gene	MTPAP	Expert Review Green;Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Ataxia, spastic, 4,;Autosomal recessive spastic ataxia 4, 613672				20970105;26319014;25008111		False	2	50;50;0	21.664	True		ENSG00000107951	ENSG00000107951	HGNC:25532													
MT-TC	gene	MT-TC	Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TC-related				8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363		False	2	0;100;0	21.664	True		ENSG00000210140	ENSG00000210140	HGNC:7477													
MT-TC	gene	MT-TC	Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TC-related				8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363		False	2	0;100;0	21.664	True		ENSG00000210140	ENSG00000210140	HGNC:7477													
MT-TC	gene	MT-TC	Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TC-related				8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363		False	2	0;100;0	21.664	True		ENSG00000210140	ENSG00000210140	HGNC:7477													
MT-TC	gene	MT-TC	Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TC-related				8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363		False	2	0;100;0	21.664	True		ENSG00000210140	ENSG00000210140	HGNC:7477													
MT-TC	gene	MT-TC	Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TC-related				8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363		False	2	0;100;0	21.664	True		ENSG00000210140	ENSG00000210140	HGNC:7477													
MT-TC	gene	MT-TC	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TC-related				8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363		False	2	0;100;0	21.664	True		ENSG00000210140	ENSG00000210140	HGNC:7477													
MT-TQ	gene	MT-TQ	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TQ-related				11171912;10996779;17003408;11335700		False	2	0;100;0	21.664	True		ENSG00000210107	ENSG00000210107	HGNC:7495													
MT-TQ	gene	MT-TQ	Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TQ-related				11171912;10996779;17003408;11335700		False	2	0;100;0	21.664	True		ENSG00000210107	ENSG00000210107	HGNC:7495													
MYH1	gene	MYH1	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	rhabdomyolysis, susceptibility to MONDO:0979250, MYH1-related				33755318;39687948		False	2	33;0;67	21.664	True		ENSG00000109061	ENSG00000109061	HGNC:7567													
MYO9B	gene	MYO9B	Literature;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease type 2 (MONDO:0018993), MYO9B-related				PMID: 36260368;40382695		False	2	0;100;0	21.664	False		ENSG00000099331	ENSG00000099331	HGNC:7609													
NAGA	gene	NAGA	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Schindler disease, type I and type II 609241				8782044;31468281;15619430;31890708;11313741		False	2	33;33;33	21.664	True		ENSG00000198951	ENSG00000198951	HGNC:7631													
NAGLU	gene	NAGLU	Expert Review Amber;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mucopolysaccharidosis type IIIB (Sanfilippo B), AR, 252920;Late-onset painful sensory neuropathy, AD				25818867;12202988		False	2	0;100;0	21.664	True		ENSG00000108784	ENSG00000108784	HGNC:7632													
NAGLU	gene	NAGLU	Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Amber;Expert Review Green;Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	?Charcot-Marie-Tooth disease, axonal, type 2V, 616491;HSAN/SFN						False	2	0;100;0	21.664	False		ENSG00000108784	ENSG00000108784	HGNC:7632													
NDUFA11	gene	NDUFA11	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 14, MIM#618236				18306244;31074871		False	2	0;100;0	21.664	True		ENSG00000174886	ENSG00000174886	HGNC:20371													
NDUFA2	gene	NDUFA2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 13 - MIM#618235;Leigh syndrome due to mitochondrial complex I deficiency, MIM#256000				28857146;32154054;18513682		False	2	0;100;0	21.664	True		ENSG00000131495	ENSG00000131495	HGNC:7685													
NDUFA2	gene	NDUFA2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 13 618235;leukoencephalopathy				28857146;32154054;18513682		False	2	0;100;0	21.664	True		ENSG00000131495	ENSG00000131495	HGNC:7685													
NDUFA8	gene	NDUFA8	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 37, MIM# 619272;Developmental delay;microcehaly;seizures				32385911;33153867		False	2	0;100;0	21.664	True		ENSG00000119421	ENSG00000119421	HGNC:7692													
NDUFA8	gene	NDUFA8	Expert Review Amber;Literature;Expert list;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 37 - 619272;Epilepsy;Microcephaly;Developmental Delay				32385911;33153867		False	2	0;100;0	21.664	True		ENSG00000119421	ENSG00000119421	HGNC:7692													
NDUFAF3	gene	NDUFAF3	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, MIM#252010						False	2	50;50;0	21.664	True		ENSG00000178057	ENSG00000178057	HGNC:29918													
NDUFAF4	gene	NDUFAF4	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, MIM#252010				28853723;19463981		False	2	50;50;0	21.664	True		ENSG00000123545	ENSG00000123545	HGNC:21034													
NDUFAF8	gene	NDUFAF8	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 34, MIM#618776;Leigh Syndrome MONDO:0009723				PMID: 31866046;https://doi.org/10.1212/WNL.000000000021206		False	2	0;100;0	21.664	True		ENSG00000224877	ENSG00000224877	HGNC:33551													
NDUFB9	gene	NDUFB9	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 24, MIM#618245				22200994;38129218		False	2	0;100;0	21.664	True		ENSG00000147684	ENSG00000147684	HGNC:7704													
NDUFC2	gene	NDUFC2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial complex I deficiency, nuclear type 36, MIM#	619170"				32969598		False	2	0;100;0	21.664	True		ENSG00000151366	ENSG00000151366	HGNC:7706													
NDUFS1	gene	NDUFS1	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, MIM#252010						False	2	50;50;0	21.664	True		ENSG00000023228	ENSG00000023228	HGNC:7707													
NDUFS2	gene	NDUFS2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, MIM#252010				23266820;22036843;20819849		False	2	50;50;0	21.664	True		ENSG00000158864	ENSG00000158864	HGNC:7708													
NDUFS6	gene	NDUFS6	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, MIM#252010				15372108;19259137;27290639		False	2	50;50;0	21.664	True		ENSG00000145494	ENSG00000145494	HGNC:7713													
NDUFS7	gene	NDUFS7	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome, MIM#256000				17604671;17275378;15269216		False	2	50;50;0	21.664	True		ENSG00000115286	ENSG00000115286	HGNC:7714													
NDUFV2	gene	NDUFV2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 7 - MIM#618229				33811136;34405929;12754703;26008862;30770271;19167255		False	2	0;100;0	21.664	True		ENSG00000178127	ENSG00000178127	HGNC:7717													
NECAP1	gene	NECAP1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 21, MIM#615833				24399846;30626896;30525121		False	2	0;100;0	21.664	True		ENSG00000089818	ENSG00000089818	HGNC:24539													
NF1	gene	NF1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurofibromatosis, type 1 (MIM#162200)				34944956		False	2	0;0;100	21.664	True		ENSG00000196712	ENSG00000196712	HGNC:7765													
NHLRC1	gene	NHLRC1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2B (Lafora), MIM# 254780;Lafora disease;Progressive Myoclonic Epilepsy;Parkinsonism				22425593;32301727		False	2	50;50;0	21.664	True		ENSG00000187566	ENSG00000187566	HGNC:21576													
NMNAT2	gene	NMNAT2	Expert Review Amber;Research;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	polyneuropathy;erythromelalgia				31132363;25271157;20126265		False	2	0;100;0	21.664	True		ENSG00000157064	ENSG00000157064	HGNC:16789													
NOS3	gene	NOS3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Moyamoya disease 8, MIM# 621469				36941667;37383439		False	2	0;100;0	21.664	True		ENSG00000164867	ENSG00000164867	HGNC:7876													
NPC2	gene	NPC2	Expert list;Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-pick disease, type C2 607625				25396745		False	2	0;100;0	21.664	False		ENSG00000119655	ENSG00000119655	HGNC:14537													
NUBPL	gene	NUBPL	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, MIM#252010				23553477;20818383		False	2	50;50;0	21.664	True		ENSG00000151413	ENSG00000151413	HGNC:20278													
NUP54	gene	NUP54	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 37, early-onset, with striatal lesions, MIM# 620427;Early onset dystonia;progressive neurological deterioration;ataxia;dysarthria;dysphagia;hypotonia				36333996		False	2	0;100;0	21.664	True		ENSG00000138750	ENSG00000138750	HGNC:17359													
OFD1	gene	OFD1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Orofaciodigital syndrome I (MIM#311200)				23033313;31373179		False	2	0;100;0	21.664	True		ENSG00000046651	ENSG00000046651	HGNC:2567													
OPLAH	gene	OPLAH	Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	5-oxoprolinase deficiency MIM#260005;Disorders of the gamma-glutamyl cycle				27604308;27477828		False	2	100;0;0	21.664	True		ENSG00000178814	ENSG00000178814	HGNC:8149													
OTUD5	gene	OTUD5	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Multiple congenital anomalies-neurodevelopmental syndrome, X-linked, MIM# 301056				PMID:33748114		False	2	0;100;0	21.664	True		ENSG00000068308	ENSG00000068308	HGNC:25402													
OTX2	gene	OTX2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Microphthalmia, syndromic 5 610125				19965921;15846561		False	2	0;100;0	21.664	True		ENSG00000165588	ENSG00000165588	HGNC:8522													
P4HTM	gene	P4HTM	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, hypoventilation, impaired intellectual development, dysautonomia, epilepsy, and eye abnormalities;OMIM #618493				25078763;30940925;34285383		False	2	0;100;0	21.664	True		ENSG00000178467	ENSG00000178467	HGNC:28858													
PACSIN3	gene	PACSIN3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital myopathy 27, MIM# 621343				38637313		False	2	0;100;0	21.664	True		ENSG00000165912	ENSG00000165912	HGNC:8572													
PAK2	gene	PAK2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Knobloch 2 syndrome MIM#618458				33693784;38894571;38712026		False	2	33;33;33	21.664	True		ENSG00000180370	ENSG00000180370	HGNC:8591													
PAK3	gene	PAK3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 30 (MIM#300558)				17853471;12884430;29246092;25666757		False	2	0;100;0	21.664	True		ENSG00000077264	ENSG00000077264	HGNC:8592													
PANK2	gene	PANK2	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 1, MIM# 234200				23968566;29642163;28024710		False	2	0;50;50	21.664	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PAX6	gene	PAX6	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Aniridia (MIM#106210)				34200146;17417613;12731001		False	2	0;100;0	21.664	True		ENSG00000007372	ENSG00000007372	HGNC:8620													
PCBD1	gene	PCBD1	Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, D, MIM# 264070				9585615		False	2	0;100;0	21.664	True		ENSG00000166228	ENSG00000166228	HGNC:8646													
PCDHA9	gene	PCDHA9	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	amyotrophic lateral sclerosis MONDO:0004976				38467605		False	2	0;100;0	21.664	True		ENSG00000204961	ENSG00000204961	HGNC:8675													
PCK2	gene	PCK2	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peripheral neuropathy (MONDO#0005244), PCK2-related				36845668		False	2	0;50;50	21.664	True		ENSG00000100889	ENSG00000100889	HGNC:8725													
PCK2	gene	PCK2	Literature;Expert Review Amber;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Peripheral neuropathy (MONDO#0005244), PCK2-related				36845668		False	2	0;33;67	21.664	False		ENSG00000100889	ENSG00000100889	HGNC:8725													
PCNA	gene	PCNA	Expert Review Amber;ClinGen	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary ataxia MONDO:0100309				24911150, 33426167, 36990216		False	2	0;100;0	21.664	True		ENSG00000132646	ENSG00000132646	HGNC:8729													
PDSS2	gene	PDSS2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Unknown	Coenzyme Q10 deficiency, primary, 3, MIM#614652				17186472;29032433		False	2	50;50;0	21.664	True		ENSG00000164494	ENSG00000164494	HGNC:23041													
PFAS	gene	PFAS	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Inborn error of metabolism, MONDO:0019052, PFAS-related				40421664		False	2	0;100;0	21.664	True		ENSG00000178921	ENSG00000178921	HGNC:8863													
PFKM	gene	PFKM	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycogen storage disease VII (MIM#232800)				24427140;27066546;30792690		False	2	0;100;0	21.664	True		ENSG00000152556	ENSG00000152556	HGNC:8877													
PGAP2	gene	PGAP2	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphosphatasia with mental retardation syndrome 3, MIM# 614207, MONDO:0013628				23561846;23561847;31805394;29119105;27871432		False	2	0;100;0	21.664	True		ENSG00000148985	ENSG00000148985	HGNC:17893													
PGM3	gene	PGM3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Idiopathic focal epilepsy;Immunodeficiency 23, MIM#	615816"				33193641;24589341		False	2	0;100;0	21.664	True		ENSG00000013375	ENSG00000013375	HGNC:8907													
PIGU	gene	PIGU	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 21, OMIM #618590				31353022		False	2	0;100;0	21.664	True		ENSG00000101464	ENSG00000101464	HGNC:15791													
PIGU	gene	PIGU	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 21;OMIM #618590				31353022		False	2	0;100;0	21.664	True		ENSG00000101464	ENSG00000101464	HGNC:15791													
PIK3C2B	gene	PIK3C2B	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	familial partial epilepsy - MONDO#0017704				PMID: 35786744		False	2	0;100;0	21.664	True		ENSG00000133056	ENSG00000133056	HGNC:8972													
PKD2	gene	PKD2	Expert Review Green;Genomics England PanelApp;Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Polycystic kidney disease 2  613095						False	2	50;50;0	21.664	False		ENSG00000118762	ENSG00000118762	HGNC:9009													
PLD3	gene	PLD3	Literature;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy				PMID: 34267643		False	2	0;100;0	21.664	False		ENSG00000105223	ENSG00000105223	HGNC:17158													
PLD3	gene	PLD3	GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Spinocerebellar ataxia 46				29053796;30312375;30312384;38059248		False	2	0;100;0	21.664	False		ENSG00000105223	ENSG00000105223	HGNC:17158													
PLEKHG2	gene	PLEKHG2	Expert Review Amber;Expert Review Amber;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy and acquired microcephaly with or without dystonia 616763				26573021		False	2	0;100;0	21.664	False		ENSG00000090924	ENSG00000090924	HGNC:29515													
PLP1	gene	PLP1	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Pelizaeus-Merzbacher disease (MIM#312080)				20301361;11872612		False	2	0;100;0	21.664	True		ENSG00000123560	ENSG00000123560	HGNC:9086													
PNPLA6	gene	PNPLA6	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PNPLA6-related spastic paraplegia with or without ataxia MONDO:0100149				32623594;36825042		False	2	0;100;0	21.664	True		ENSG00000032444	ENSG00000032444	HGNC:16268													
PNPLA6	gene	PNPLA6	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 39, autosomal recessive, MIM#	612020"				18313024		False	2	0;100;0	21.664	True		ENSG00000032444	ENSG00000032444	HGNC:16268													
POFUT1	gene	POFUT1	Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Dowling-Degos disease 2 (MIM# 615327)				23684010;29452367;25157627		False	2	0;100;0	21.664	True		ENSG00000101346	ENSG00000101346	HGNC:14988													
POLG	gene	POLG	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial DNA depletion syndrome 4a	MONDO:0008758"				15477547;14694057;16638794		False	2	0;100;0	21.664	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLG2	gene	POLG2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4 MIM#610131				PMID: 21555342		False	2	0;100;0	21.664	True		ENSG00000256525	ENSG00000256525	HGNC:9180													
POLG2	gene	POLG2	Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4 610131				25655951		False	2	0;100;0	21.664	False		ENSG00000256525	ENSG00000256525	HGNC:9180													
POLR1A	gene	POLR1A	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Acrofacial dysostosis, Cincinnati type MIM#616462				PMID: 37075751		False	2	0;100;0	21.664	True		ENSG00000068654	ENSG00000068654	HGNC:17264													
POLR1A	gene	POLR1A	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 27, MIM# 620675				28051070;36917474		False	2	0;67;33	21.664	True		ENSG00000068654	ENSG00000068654	HGNC:17264													
POMGNT2	gene	POMGNT2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 8 MIM#614830				PMID: 36808730		False	2	0;50;50	21.664	True		ENSG00000144647	ENSG00000144647	HGNC:25902													
POMK	gene	POMK	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12 MIM#615249				PMID: 24925318		False	2	0;50;50	21.664	True		ENSG00000185900	ENSG00000185900	HGNC:26267													
POMK	gene	POMK	Expert Review Green;Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Muscular dystrophy-dystroglycanopathy (limb-girdle) type C, 12, 616094;Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12, 615249				24556084;24925318;29910097		False	2	50;50;0	21.664	True		ENSG00000185900	ENSG00000185900	HGNC:26267													
POMT2	gene	POMT2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, MIM#613150						False	2	0;100;0	21.664	True		ENSG00000009830	ENSG00000009830	HGNC:19743													
POU3F3	gene	POU3F3	Expert Review Amber;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Snijders Blok-Fisher syndrome	MIM#618604"				31303265;33645921		False	2	50;50;0	21.664	True		ENSG00000198914	ENSG00000198914	HGNC:9216													
PPP1CB	gene	PPP1CB	Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Noonan syndrome-like disorder with loose anagen hair 2	MIM#617506"				33333793;30236064		False	2	33;67;0	21.664	True		ENSG00000213639	ENSG00000213639	HGNC:9282													
PPP1R3F	gene	PPP1R3F	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Neurodevelopmental Disorder, MONDO:0700092,PPP1R3F-related				37531237		False	2	50;50;0	21.664	True		ENSG00000049769	ENSG00000049769	HGNC:14944													
PPP2R2B	gene	PPP2R2B	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, PPP2R2B-related				25356899;39565297		False	2	0;100;0	21.664	True		ENSG00000156475	ENSG00000156475	HGNC:9305													
PPT1	gene	PPT1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 1 256730				5706364;8576553		False	2	0;100;0	21.664	False		ENSG00000131238	ENSG00000131238	HGNC:9325													
PRICKLE2	gene	PRICKLE2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, PRICKLE2-related				34092786;21276947;26942291;26942292		False	2	33;67;0	21.664	True		ENSG00000163637	ENSG00000163637	HGNC:20340													
PRKCG	gene	PRKCG	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 14, MIM# 605361				34292398		False	2	0;100;0	21.664	True		ENSG00000126583	ENSG00000126583	HGNC:9402													
PRODH	gene	PRODH	Expert Review Amber;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperprolinemia, type I, MIM# 239500;Proline oxidase deficiency				17412540;12217952;34285201;18197084;12525555		False	2	50;50;0	21.664	True		ENSG00000100033	ENSG00000100033	HGNC:9453													
PRPH	gene	PRPH	Expert Review Amber;Expert Review Amber;Expert list;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	{Amyotrophic lateral sclerosis, susceptibility to}, 105400				20363051;15322088;15446584		False	2	0;100;0	21.664	True		ENSG00000135406	ENSG00000135406	HGNC:9461													
PRPH	gene	PRPH	Victorian Clinical Genetics Services;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary motor and sensory neuropathy MONDO:0015358, PRPH-related				20363051;15322088;15446584;30992453;32638105		False	2	0;100;0	21.664	False		ENSG00000135406	ENSG00000135406	HGNC:9461													
PRPS1	gene	PRPS1	Literature;Expert Review Amber;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy				33898739;28967191		False	2	0;100;0	21.664	False		ENSG00000147224	ENSG00000147224	HGNC:9462													
PSAT1	gene	PSAT1	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phosphoserine aminotransferase deficiency, MIM#610992				17436247;26610677;26960553		False	2	50;50;0	21.664	True		ENSG00000135069	ENSG00000135069	HGNC:19129													
PSMC3	gene	PSMC3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354				32500975		False	2	0;100;0	21.664	True		ENSG00000165916	ENSG00000165916	HGNC:9549													
PSPH	gene	PSPH	NHS GMS;Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phosphoserine phosphatase deficiency, MIM#614023				25080166;26589312;14673469		False	2	50;50;0	21.664	True		ENSG00000146733	ENSG00000146733	HGNC:9577													
PTF1A	gene	PTF1A	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pancreatic and cerebellar agenesis, MIM#609069				21749365;15543146;19650412		False	2	0;100;0	21.664	True		ENSG00000168267	ENSG00000168267	HGNC:23734													
PTPA	gene	PTPA	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual disability, MONDO: 36073231, PTPA-related;Parkinson disease MONDO:0005180, PTPA-related				36073231;37448355;37046398		False	2	0;100;0	21.664	True		ENSG00000119383	ENSG00000119383	HGNC:9308													
PYGM	gene	PYGM	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	McArdle disease (MIM#232600)				29143597;25914343		False	2	0;100;0	21.664	True		ENSG00000068976	ENSG00000068976	HGNC:9726													
RAB3GAP1	gene	RAB3GAP1	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Warburg micro syndrome 1, MIM#600118				20512159		False	2	0;100;0	21.664	True		ENSG00000115839	ENSG00000115839	HGNC:17063													
RAB3GAP2	gene	RAB3GAP2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Martsolf syndrome, MIM#212720;Warburg micro syndrome 2, MIM#614225						False	2	0;100;0	21.664	True		ENSG00000118873	ENSG00000118873	HGNC:17168													
RALGAPB	gene	RALGAPB	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorders, autism				PMID: 32853829		False	2	0;100;0	21.664	True		ENSG00000170471	ENSG00000170471	HGNC:29221													
RBFOX3	gene	RBFOX3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder (MONDO:0700092), RBFOX3-related				35951651;36117209;24039908;40011789		False	2	0;100;0	21.664	True		ENSG00000167281	ENSG00000167281	HGNC:27097													
RBL2	gene	RBL2	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brunet-Wagner neurodevelopmental syndrome, MIM# 619690				PMID: 33980986;32105419;9806916		False	2	0;67;33	21.664	True		ENSG00000103479	ENSG00000103479	HGNC:9894													
RBMX	gene	RBMX	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related				39263607		False	2	0;100;0	21.664	True		ENSG00000147274	ENSG00000147274	HGNC:9910													
RBMX	gene	RBMX	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related				39263607		False	2	0;100;0	21.664	True		ENSG00000147274	ENSG00000147274	HGNC:9910													
RFXANK	gene	RFXANK	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive Ataxia and Neurologic Regression;MHC class II deficiency, complementation group B MIM#209920				PMID: 33855173;23314770;28676232		False	2	50;50;0	21.664	True		ENSG00000064490	ENSG00000064490	HGNC:9987													
RNF13	gene	RNF13	Expert Review Amber;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Amyotrophic lateral sclerosis				PMID: 35879052		False	2	50;50;0	21.664	True		ENSG00000082996	ENSG00000082996	HGNC:10057													
RNF216	gene	RNF216	Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and hypogonadotropic hypogonadism, 212840				28334938;26250479		False	2	0;100;0	21.664	False		ENSG00000011275	ENSG00000011275	HGNC:21698													
RPIA	gene	RPIA	Expert Review Amber;Expert Review;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ribose 5-phosphate isomerase deficiency, MIM 608611				14988808;10589548;20499043;28801340;30088433		False	2	50;50;0	21.664	True		ENSG00000153574	ENSG00000153574	HGNC:10297													
RRM1	gene	RRM1	Expert Review Amber;Expert list;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 6, MIM#	620647"				PMID: 35617047		False	2	0;100;0	21.664	True		ENSG00000167325	ENSG00000167325	HGNC:10451													
RRP12	gene	RRP12	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 11, autosomal recessive, MIM# 621452				PMID: 41059649		False	2	0;100;0	21.664	True		ENSG00000052749	ENSG00000052749	HGNC:29100													
RUSC2	gene	RUSC2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mental retardation, autosomal recessive 61, MIM#	617773"				27612186		False	2	0;100;0	21.664	True		ENSG00000198853	ENSG00000198853	HGNC:23625													
RYR3	gene	RYR3	Expert Review Amber;ClinGen;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy MONDO:0100062, RYR3-related				25262651;39840699;39220738;29667327;29498452;32451403;31230720		False	2	25;50;25	21.664	True		ENSG00000198838	ENSG00000198838	HGNC:10485													
SACS	gene	SACS	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia, Charlevoix-Saguenay type MIM#270550				PMID: 27871429;35386405		False	2	0;100;0	21.664	True		ENSG00000151835	ENSG00000151835	HGNC:10519													
SAMHD1	gene	SAMHD1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 5 MIM#612952				20131292		False	2	0;100;0	21.664	True		ENSG00000101347	ENSG00000101347	HGNC:15925													
SARDH	gene	SARDH	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sarcosinemia MIM#268900;Disorders of serine, glycine or glycerate metabolism				22825317;27604308		False	2	100;0;0	21.664	True		ENSG00000123453	ENSG00000123453	HGNC:10536													
SCN10A	gene	SCN10A	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO#0700092), SCN10A-related				PMID: 28078312		False	2	0;50;50	21.664	True		ENSG00000185313	ENSG00000185313	HGNC:10582													
SCO1	gene	SCO1	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, nuclear type 4, MIM# 619048				11013136;19295170;31352446;23878101		False	2	0;100;0	21.664	True		ENSG00000133028	ENSG00000133028	HGNC:10603													
SCP2	gene	SCP2	Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with dystonia and motor neuropathy, MIM#613724				16685654;26497993		False	2	0;50;50	21.664	True		ENSG00000116171	ENSG00000116171	HGNC:10606													
SCP2	gene	SCP2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with dystonia and motor neuropathy, MIM#613724;Neurodegeneration with brain iron accumulation;ataxia				26497993;16685654		False	2	0;50;50	21.664	True		ENSG00000116171	ENSG00000116171	HGNC:10606													
SDHA	gene	SDHA	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome, MIM#256000						False	2	0;100;0	21.664	True		ENSG00000073578	ENSG00000073578	HGNC:10680													
SDHA	gene	SDHA	Expert list;Expert Review Amber;Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259				10976639;27683074		False	2	0;100;0	21.664	False		ENSG00000073578	ENSG00000073578	HGNC:10680													
SETD5	gene	SETD5	Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Moya Moya;Mental retardation, autosomal dominant 23, MIM#	615761"				31474762		False	2	0;0;100	21.664	True		ENSG00000168137	ENSG00000168137	HGNC:25566													
SGMS1	gene	SGMS1	Expert Review Amber;Other	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex neurodevelopmental disorder MONDO:0100038						False	2	0;100;0	21.664	True		ENSG00000198964	ENSG00000198964	HGNC:29799													
SGPL1	gene	SGPL1	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	RENI syndrome (MIM#617575)				28077491;28165339;30274713;28165343		False	2	0;100;0	21.664	True		ENSG00000166224	ENSG00000166224	HGNC:10817													
SHPK	gene	SHPK	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sedoheptulokinase deficiency MIM#617213				25647543;27604308		False	2	0;100;0	21.664	False		ENSG00000197417	ENSG00000197417	HGNC:1492													
SIDT2	gene	SIDT2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysosomal storage disease, MONDO:0002561, SIDT2-related				40541391		False	2	0;100;0	21.664	True		ENSG00000149577	ENSG00000149577	HGNC:24272													
SIDT2	gene	SIDT2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysosomal storage disease, MONDO:0002561, SIDT2-related				PMID: 40541391		False	2	0;100;0	21.664	True		ENSG00000149577	ENSG00000149577	HGNC:24272													
SIX3	gene	SIX3	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Holoprosencephaly 2, MIM#157170						False	2	0;100;0	21.664	True		ENSG00000138083	ENSG00000138083	HGNC:10889													
SLC13A5	gene	SLC13A5	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 25 615905				27913086		False	2	0;100;0	21.664	False		ENSG00000141485	ENSG00000141485	HGNC:23089													
SLC1A1	gene	SLC1A1	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dicarboxylic aminoaciduria, MIM#222730				21123949		False	2	0;100;0	21.664	True		ENSG00000106688	ENSG00000106688	HGNC:10939													
SLC20A2	gene	SLC20A2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 1, MIM# 213600				41458256;35881308		False	2	0;100;0	21.664	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC25A10	gene	SLC25A10	Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intractable epileptic encephalopathy;Mitochondrial DNA depletion syndrome 19, MIM# 618972				29211846		False	2	0;100;0	21.664	True		ENSG00000183048	ENSG00000183048	HGNC:10980													
SLC25A21	gene	SLC25A21	Expert Review Amber;NHS GMS;Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome-18 MIM#618811				29517768		False	2	0;100;0	21.664	True		ENSG00000183032	ENSG00000183032	HGNC:14411													
SLC26A2	gene	SLC26A2	Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Skeletal dysplasia (various)				11241838		False	2	0;100;0	21.664	True		ENSG00000155850	ENSG00000155850	HGNC:10994													
SLC35A1	gene	SLC35A1	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIf, MIM# 603585				28856833;23873973;11157507		False	2	0;100;0	21.664	True		ENSG00000164414	ENSG00000164414	HGNC:11021													
SLC35A3	gene	SLC35A3	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Arthrogryposis, mental retardation, and seizures;OMIM #615553				28328131;24031089;28777481		False	2	0;100;0	21.664	True		ENSG00000117620	ENSG00000117620	HGNC:11023													
SLC35B2	gene	SLC35B2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, MONDO:0019046, SLC35B2-related				35325049		False	2	0;100;0	21.664	True		ENSG00000157593	ENSG00000157593	HGNC:16872													
SLC36A2	gene	SLC36A2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperglycinuria MIM#138500;Iminoglycinuria, digenic MIM#242600;Disorders of amino acid transport				19033659;26141664;27604308		False	2	100;0;0	21.664	False		ENSG00000186335	ENSG00000186335	HGNC:18762													
SLC39A8	gene	SLC39A8	Expert Review Amber;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Congenital disorder of glycosylation, type IIn	MIM#616721"				29453449;27995398		False	2	50;50;0	21.664	True		ENSG00000138821	ENSG00000138821	HGNC:20862													
SLC45A1	gene	SLC45A1	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder with neuropsychiatric features, MIM# 617532				28434495		False	2	0;100;0	21.664	True		ENSG00000162426	ENSG00000162426	HGNC:17939													
SLC52A1	gene	SLC52A1	Expert Review Amber;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Maternal riboflavin deficiency	MONDO:0014013"				37510312;29122468;21089064		False	2	0;50;50	21.664	True		ENSG00000132517	ENSG00000132517	HGNC:30225													
SLC7A2	gene	SLC7A2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, MONDO:0019046, SLC7A2-related				41015522		False	2	0;100;0	21.664	True		ENSG00000003989	ENSG00000003989	HGNC:11060													
SLC9A7	gene	SLC9A7	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 108, OMIM #301024				30335141		False	2	0;100;0	21.664	True		ENSG00000065923	ENSG00000065923	HGNC:17123													
SMAD9	gene	SMAD9	Expert Review Green;Genomics England PanelApp;Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown							False	2	50;50;0	21.664	False		ENSG00000120693	ENSG00000120693	HGNC:6774													
SMDT1	gene	SMDT1	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, SMDT1-related				37454773		False	2	0;100;0	21.664	True		ENSG00000183172	ENSG00000183172	HGNC:25055													
SMDT1	gene	SMDT1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, SMDT1-related				37454773		False	2	0;100;0	21.664	True		ENSG00000183172	ENSG00000183172	HGNC:25055													
SNIP1	gene	SNIP1	Expert Review Amber;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Psychomotor retardation, epilepsy, and craniofacial dysmorphism, 614501				22279524;34570759		False	2	0;50;50	21.664	True		ENSG00000163877	ENSG00000163877	HGNC:30587													
SORL1	gene	SORL1	Expert Review Amber;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease, MONDO:0004975, SORL1-related				27026413;39226352;40182695		False	2	0;50;50	21.664	True		ENSG00000137642	ENSG00000137642	HGNC:11185													
SOX10	gene	SOX10	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurocristopathy;PCWH syndrome, MIM#609136;Complicated hereditary spastic paraplegia				28534044		False	2	0;100;0	21.664	True		ENSG00000100146	ENSG00000100146	HGNC:11190													
SPAST	gene	SPAST	Expert list;Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spastic paraplegia 4, autosomal dominant 182601				23968121		False	2	0;100;0	21.664	False		ENSG00000021574	ENSG00000021574	HGNC:11233													
SPEN	gene	SPEN	Expert Review Amber;Literature;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Radio-Tartaglia syndrome MIM#619312				PMID: 33596411		False	2	40;60;0	21.664	True		ENSG00000065526	ENSG00000065526	HGNC:17575													
SPG7	gene	SPG7	Expert list;Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 7, autosomal recessive 607259				20108356;17646629		False	2	0;100;0	21.664	False		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPTSSA	gene	SPTSSA	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 90B, autosomal recessive , MIM# 620417;Spastic paraplegia 90A, autosomal dominant, MIM# 620416				36718090;40533086		False	2	50;50;0	21.664	True		ENSG00000165389	ENSG00000165389	HGNC:20361													
SQOR	gene	SQOR	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh-like disorder;Sulfide:quinone oxidoreductase deficiency (SQORD), MIM#619221				32160317		False	2	0;100;0	21.664	True		ENSG00000137767	ENSG00000137767	HGNC:20390													
SQSTM1	gene	SQSTM1	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 (MIM#616437)				22084127;22972638;27554286;31362587;28490746;31859009;23942205		False	2	50;50;0	21.664	True		ENSG00000161011	ENSG00000161011	HGNC:11280													
SQSTM1	gene	SQSTM1	Expert Review Amber;Literature;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	myopathy, distal, with rimmed vacuoles MONDO:0014945;multisystem proteinopathy				29599744;26208961;29457785		False	2	33;33;33	21.664	True	Other	ENSG00000161011	ENSG00000161011	HGNC:11280													
SQSTM1	gene	SQSTM1	Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Frontotemporal dementia and/or amyotrophic lateral sclerosis 3	MONDO:0014640"						False	2	100;0;0	21.664	True		ENSG00000161011	ENSG00000161011	HGNC:11280													
SRD5A3	gene	SRD5A3	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Congenital disorder of glycosylation, type Iq, MIM#	612379"				26219881		False	2	0;100;0	21.664	True		ENSG00000128039	ENSG00000128039	HGNC:25812													
SREBF2	gene	SREBF2	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary spastic paraplegia, MONDO:0019064, SREBF2-related				39814172		False	2	0;100;0	21.664	True		ENSG00000198911	ENSG00000198911	HGNC:11290													
SS18L1	gene	SS18L1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	amyotrophic lateral sclerosis (MONDO:0004976)				25888396;24360741;23708140;30976389		False	2	50;50;0	21.664	True		ENSG00000184402	ENSG00000184402	HGNC:15592													
SSR3	gene	SSR3	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation				30945312		False	2	0;100;0	21.664	True		ENSG00000114850	ENSG00000114850	HGNC:11325													
ST3GAL3	gene	ST3GAL3	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 15 , MIM#615006				23252400;31584066		False	2	0;100;0	21.664	True		ENSG00000126091	ENSG00000126091	HGNC:10866													
STARD9	gene	STARD9	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Syndromic disorder (MONDO:0002254), STARD9-related				41137852;28777490		False	2	0;100;0	21.664	True		ENSG00000159433	ENSG00000159433	HGNC:19162													
STX5	gene	STX5	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	congenital disorder of glycosylation MONDO#0015286, STX5-related				34711829		False	2	0;100;0	21.664	True		ENSG00000162236	ENSG00000162236	HGNC:11440													
SUCLA2	gene	SUCLA2	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria) (MONDO:0012791;MIM#612073); Leigh -like syndrome, deafness, progressive dystonia, mild methylmaolnic acidaemia, peripheral neuropathy				20301762;35235001		False	2	0;50;50	21.664	True		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUCLG1	gene	SUCLG1	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria), MIM#245400				26475597;27484306		False	2	50;50;0	21.664	True		ENSG00000163541	ENSG00000163541	HGNC:11449													
SUGCT	gene	SUGCT	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glutaric aciduria III MIM#231690;Organic acidurias				28766179;18926513;33483254;32779420;27604308		False	2	100;0;0	21.664	True		ENSG00000175600	ENSG00000175600	HGNC:16001													
SUPV3L1	gene	SUPV3L1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970				39596606;35023579		False	2	0;100;0	21.664	True		ENSG00000156502	ENSG00000156502	HGNC:11471													
SV2A	gene	SV2A	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, SV2A-related;Developmental and epileptic encephalopathy 113, MIM# 620772				PMID: 37985816		False	2	0;100;0	21.664	True		ENSG00000159164	ENSG00000159164	HGNC:20566													
SVBP	gene	SVBP	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 94, autosomal recessive, MIM#	621150"				39412222		False	2	0;100;0	21.664	True		ENSG00000177868	ENSG00000177868	HGNC:29204													
SVIL	gene	SVIL	Expert Review Amber;Other;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myofibrillar myopathy 10 (MIM#619040)				32779703		False	2	0;100;0	21.664	True		ENSG00000197321	ENSG00000197321	HGNC:11480													
SYNCRIP	gene	SYNCRIP	Expert Review Green;Literature;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, SYNCRIP-related;Global developmental delay;Intellectual disability;Autism;Myoclonic atonic seizures;Abnormality of nervous system morphology				34157790;30504930;27479843;23020937		False	2	33;67;0	21.664	True		ENSG00000135316	ENSG00000135316	HGNC:16918													
SYNGAP1	gene	SYNGAP1	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant mental retardation 5, 612621				26989088		False	2	0;100;0	21.664	True		ENSG00000197283	ENSG00000197283	HGNC:11497													
TAF15	gene	TAF15	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Amyotrophic lateral sclerosis;Frontotemporal dementia				28889094		False	2	0;100;0	21.664	False		-	ENSG00000270647	HGNC:11547													
TAF15	gene	TAF15	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis				21438137;22065782;27810362;28889094		False	2	0;100;0	21.664	True		-	ENSG00000270647	HGNC:11547													
TAF1C	gene	TAF1C	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder (MONDO#0700092), TAF1C-related				32779182		False	2	0;50;50	21.664	True		ENSG00000103168	ENSG00000103168	HGNC:11534													
TBC1D20	gene	TBC1D20	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Warburg micro syndrome 4, MIM#615663				24239381		False	2	0;100;0	21.664	True		ENSG00000125875	ENSG00000125875	HGNC:16133													
TBCB	gene	TBCB	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382				PMID: 40856104		False	2	0;100;0	21.664	True		ENSG00000105254	ENSG00000105254	HGNC:1989													
TBCB	gene	TBCB	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382				PMID: 40856104		False	2	0;100;0	21.664	True		ENSG00000105254	ENSG00000105254	HGNC:1989													
TCEAL1	gene	TCEAL1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder with gait disturbance, dysmorphic facies and behavioral abnormalities, X-linked, MIM# 301094				PMID: 36368327		False	2	0;100;0	21.664	True		ENSG00000172465	ENSG00000172465	HGNC:11616													
TDP1	gene	TDP1	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250				31182267;12244316;39576382		False	2	0;100;0	21.664	True		ENSG00000042088	ENSG00000042088	HGNC:18884													
TDP1	gene	TDP1	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250				31182267;12244316;39576382		False	2	0;100;0	21.664	True		ENSG00000042088	ENSG00000042088	HGNC:18884													
TENM4	gene	TENM4	Literature;Expert Review Amber;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	tremor, hereditary essential, 5 MONDO:0014756				41449293;36689009;26188006;29249217;34589676;22915103		False	2	0;100;0	21.664	False		ENSG00000149256	ENSG00000149256	HGNC:29945													
TFRC	gene	TFRC	Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Disorders of iron metabolism;TFRC-related combined immunodeficiency MONDO:0014760				26642240		False	2	0;0;0	21.664	False		ENSG00000072274	ENSG00000072274	HGNC:11763													
THAP1	gene	THAP1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	cervical dystonia;dystonia;dystonic tremor				38094642;33665847		False	2	100;0;0	21.664	True		ENSG00000131931	ENSG00000131931	HGNC:20856													
THG1L	gene	THG1L	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 28, MIM# 618800				27307223;30214071;31168944		False	2	0;100;0	21.664	True		ENSG00000113272	ENSG00000113272	HGNC:26053													
THG1L	gene	THG1L	Expert Review Amber;Literature;Expert list;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 28 - 618800;Epilepsy;Intellectual disability				33682303		False	2	0;100;0	21.664	True		ENSG00000113272	ENSG00000113272	HGNC:26053													
THOC2	gene	THOC2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Intellectual developmental disorder, X-linked 12 MIM#300957				PMID: 26166480;29851191		False	2	0;100;0	21.664	True		ENSG00000125676	ENSG00000125676	HGNC:19073													
THSD1	gene	THSD1	Expert Review Green;Genomics England PanelApp;Expert Review Amber;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	subarachnoid hemorrhage				27895300		False	2	33;67;0	21.664	False		ENSG00000136114	ENSG00000136114	HGNC:17754													
TIA1	gene	TIA1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Amyotrophic lateral sclerosis 26 with or without frontotemporal dementia	619133"				29235362;29886022;29773329;29699721;29216908;24659297;29457785;28817800		False	2	0;100;0	21.664	True		ENSG00000116001	ENSG00000116001	HGNC:11802													
TIA1	gene	TIA1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	Other	Multisystem proteinopathy				36861178;29599744;29457785		False	2	0;100;0	21.664	True		ENSG00000116001	ENSG00000116001	HGNC:11802													
TIA1	gene	TIA1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	distal myopathy, Welander type MONDO:0011466				23401021		False	2	0;100;0	21.664	True	Other	ENSG00000116001	ENSG00000116001	HGNC:11802													
TIMM22	gene	TIMM22	Expert Review Amber;Expert Review Amber;NHS GMS;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, TIMM22-related				30452684		False	2	0;100;0	21.664	True		ENSG00000177370	ENSG00000177370	HGNC:17317													
TLK2	gene	TLK2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Intellectual developmental disorder, autosomal dominant 57	MIM#618050"				37662408;31558842		False	2	0;100;0	21.664	True		ENSG00000146872	ENSG00000146872	HGNC:11842													
TMEM106B	gene	TMEM106B	Expert Review Green;Expert Review Amber;Literature;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukodystrophy, hypomyelinating, 16 (MIM #617964)				29186371;29444210;32595021		False	2	50;50;0	21.664	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000106460	ENSG00000106460	HGNC:22407													
TMEM138	gene	TMEM138	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 16, MIM#	614465"						False	2	0;100;0	21.664	True		ENSG00000149483	ENSG00000149483	HGNC:26944													
TMEM231	gene	TMEM231	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 20, MIM# 614970;Meckel syndrome 11 615397						False	2	0;100;0	21.664	True		ENSG00000205084	ENSG00000205084	HGNC:37234													
TMEM43	gene	TMEM43	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Emery-Dreifuss muscular dystrophy 7, autosomal dominant MONDO:0013677				21391237;30311943		False	2	0;100;0	21.664	True		ENSG00000170876	ENSG00000170876	HGNC:28472													
TMEM65	gene	TMEM65	Expert Review Amber;Expert Review Amber;NHS GMS;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, TMEM65-related				28295037;41980949		False	2	0;100;0	21.664	True		ENSG00000164983	ENSG00000164983	HGNC:25203													
TMEM70	gene	TMEM70	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2, MIM#614052				18953340;21147908		False	2	0;100;0	21.664	True		ENSG00000175606	ENSG00000175606	HGNC:26050													
TNK2	gene	TNK2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	severe infantile onset epilepsy				27977884;23686771		False	2	0;100;0	21.664	True		ENSG00000061938	ENSG00000061938	HGNC:19297													
TNNT1	gene	TNNT1	Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Nemaline myopathy 5, Amish type	MIM#605355"				31970803		False	2	50;50;0	21.664	True		ENSG00000105048	ENSG00000105048	HGNC:11948													
TOMM70	gene	TOMM70	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970, TOMM70-related				31907385		False	2	0;100;0	21.664	True		ENSG00000154174	ENSG00000154174	HGNC:11985													
TOMM70	gene	TOMM70	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, MONDO:0019046, TOMM70-related				32356556		False	2	0;100;0	21.664	True		ENSG00000154174	ENSG00000154174	HGNC:11985													
TRAPPC11	gene	TRAPPC11	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, autosomal recessive 18 MIM# 615356				23830518;26322222;29855340;30105108;26912795;27707803;27862579;28484880		False	2	50;50;0	21.664	True		ENSG00000168538	ENSG00000168538	HGNC:25751													
TRIP12	gene	TRIP12	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Intellectual developmental disorder, autosomal dominant 49	MIM#617752"				PMID: 36275919;32424948		False	2	0;100;0	21.664	True		ENSG00000153827	ENSG00000153827	HGNC:12306													
TRIP13	gene	TRIP13	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mosaic variegated aneuploidy syndrome 3, MIM# 617598				28553959		False	2	50;50;0	21.664	True		ENSG00000071539	ENSG00000071539	HGNC:12307													
TRPA1	gene	TRPA1	Expert Review Amber;Genomics England PanelApp	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Familial episodic pain syndrome type I;Episodic pain syndrome, familial,  615040				28314413;21468319;24778270;20718100;16564016;28436534;24564660;20547126		False	2	0;100;0	21.664	True		ENSG00000104321	ENSG00000104321	HGNC:497													
TRPC3	gene	TRPC3	GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown					25477146;26112884		False	2	0;100;0	21.664	False		ENSG00000138741	ENSG00000138741	HGNC:12335													
TRPV1	gene	TRPV1	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Exertional heat stroke;rhabdomyolysis				32471784		False	2	0;33;67	21.664	True		ENSG00000196689	ENSG00000196689	HGNC:12716													
TSEN15	gene	TSEN15	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 2F MIM#617026				PMID: 27392077		False	2	0;100;0	21.664	True		ENSG00000198860	ENSG00000198860	HGNC:16791													
TWNK	gene	TWNK	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), MIM# 271245				31455269;19353676		False	2	0;100;0	21.664	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
TXN2	gene	TXN2	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 29, MIM# 616811				26626369;12529397		False	2	0;100;0	21.664	True		ENSG00000100348	ENSG00000100348	HGNC:17772													
TXNIP	gene	TXNIP	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metabolic disease MONDO:0005066, TXNIP-related				41116060;30755400		False	2	0;100;0	21.664	True		-	ENSG00000265972	HGNC:16952													
UBA5	gene	UBA5	Expert Review Amber;Royal Melbourne Hospital;GeneReviews	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Autosomal recessive spinocerebellar ataxia 24, 617133;Early infantile epileptic encephalopathy 44, 617132				26872069;29902590		False	2	0;100;0	21.664	True		ENSG00000081307	ENSG00000081307	HGNC:23230													
UBA5	gene	UBA5	Literature;Expert Review Amber;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelinating neuropathy				32179706;26872069		False	2	0;100;0	21.664	False		ENSG00000081307	ENSG00000081307	HGNC:23230													
UBQLN4	gene	UBQLN4	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Amyotrophic lateral sclerosis				28463112;30804504		False	2	0;100;0	21.664	False		ENSG00000160803	ENSG00000160803	HGNC:1237													
UBR4	gene	UBR4	Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Episodic ataxia;Episodic ataxia type 8, 616055				29062094;23982692;28600779		False	2	0;100;0	21.664	True		ENSG00000127481	ENSG00000127481	HGNC:30313													
UBTF	gene	UBTF	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodegeneration, childhood-onset, with brain atrophy MIM#617672				PMID: 30517966		False	2	0;100;0	21.664	True		ENSG00000108312	ENSG00000108312	HGNC:12511													
UNC80	gene	UNC80	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, infantile, with psychomotor retardation and characteristic facies 2				27513830		False	2	0;100;0	21.664	True		ENSG00000144406	ENSG00000144406	HGNC:26582													
UQCC3	gene	UQCC3	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 9, MIM# 616111				25008109;28804536		False	2	0;100;0	21.664	True		ENSG00000204922	ENSG00000204922	HGNC:34399													
UQCRC1	gene	UQCRC1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinsonism with polyneuropathy, MIM# 619279				33141179;33248804		False	2	50;50;0	21.664	True		ENSG00000010256	ENSG00000010256	HGNC:12585													
UQCRH	gene	UQCRH	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 11, MIM#620137				34750991		False	2	0;100;0	21.664	True		ENSG00000173660	ENSG00000173660	HGNC:12590													
UQCRQ	gene	UQCRQ	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency, nuclear type 4, MIM# 615159				18439546		False	2	0;100;0	21.664	True		ENSG00000164405	ENSG00000164405	HGNC:29594													
UROC1	gene	UROC1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Urocanase deficiency, MIM#276880				19304569;30619714		False	2	0;100;0	21.664	True		ENSG00000159650	ENSG00000159650	HGNC:26444													
USP8	gene	USP8	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complicated hereditary spastic paraplegia				24482476		False	2	0;100;0	21.664	True		ENSG00000138592	ENSG00000138592	HGNC:12631													
VAMP1	gene	VAMP1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spastic ataxia 1, autosomal dominant, MIM#	108600"				22958904		False	2	0;100;0	21.664	True		ENSG00000139190	ENSG00000139190	HGNC:12642													
VAMP1	gene	VAMP1	Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Autosomal dominant spastic ataxia 1, 108600;Spastic ataxia 1, autosomal dominant, 108600				22958904		False	2	0;100;0	21.664	False		ENSG00000139190	ENSG00000139190	HGNC:12642													
VAMP1	gene	VAMP1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spastic ataxia 1, autosomal dominant, MIM#	108600"				22958904		False	2	0;100;0	21.664	True		ENSG00000139190	ENSG00000139190	HGNC:12642													
VLDLR	gene	VLDLR	Expert Review Amber;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, MIM#224050				16174313;18326629		False	2	0;100;0	21.664	True		ENSG00000147852	ENSG00000147852	HGNC:12698													
VPS37A	gene	VPS37A	Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 53, autosomal recessive, MIM# 614898, AR				22717650		False	2	0;100;0	21.664	True		ENSG00000155975	ENSG00000155975	HGNC:24928													
VRK1	gene	VRK1	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 1A, 607596				19646678;21937992;25609612;24126608;27281532		False	2	0;100;0	21.664	True		ENSG00000100749	ENSG00000100749	HGNC:12718													
VRK1	gene	VRK1	Expert Review Amber;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Adult-onset spinal muscular atrophy without pontocerebellar hypoplasia;Distal hereditary motor neuropathy;dHMN/dSMA				31560180;32242460;31178479;31837156;30847374;34169149;26583493		False	2	0;50;50	21.664	True		ENSG00000100749	ENSG00000100749	HGNC:12718													
WARS1	gene	WARS1	Royal Melbourne Hospital;Literature;Expert Review Amber;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronopathy, distal hereditary motor, type IX, MIM#617721				28369220;31321409;31069783		False	2	50;50;0	21.664	False		ENSG00000140105	ENSG00000140105	HGNC:12729													
WDR45	gene	WDR45	Expert Review Amber;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegeneration with brain iron accumulation 5, MIM# 300894				26859818;25301227		False	2	0;100;0	21.664	True		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDTC1	gene	WDTC1	Expert Review Amber;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder MONDO:0700092, WDTC1-related				41793087		False	2	0;100;0	21.664	True		ENSG00000142784	ENSG00000142784	HGNC:29175													
XPR1	gene	XPR1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Basal ganglia calcification, idiopathic, 6 MIM#616413				PMID: 33433330		False	2	0;100;0	21.664	True		ENSG00000143324	ENSG00000143324	HGNC:12827													
YME1L1	gene	YME1L1	Expert Review Amber;NHS GMS;Expert Review Amber;NHS GMS	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Optic atrophy 11 MIM#617302;Mitochondrial disease, MONDO:0044970, YME1L1-related				30544562;27495975;40255048		False	2	0;100;0	21.664	True		ENSG00000136758	ENSG00000136758	HGNC:12843													
ZFYVE26	gene	ZFYVE26	Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spastic paraplegia 15, 270700				24367272;18394578		False	2	0;100;0	21.664	False		ENSG00000072121	ENSG00000072121	HGNC:20761													
ZMIZ1	gene	ZMIZ1	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with dysmorphic facies and distal skeletal anomalies MIM#618659				PMID: 30639322		False	2	0;50;50	21.664	True		ENSG00000108175	ENSG00000108175	HGNC:16493													
ABCD3_OPDM_GCC	str	ABCD3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy 5, MIM# 621446				39068203		False	3	100;0;0	21.664	True		ENSG00000117528	ENSG00000117528	HGNC:67	1	94883977	94883998	94418421	94418442	GCC	50	118					
AR_SBMA_CAG	str	AR	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Spinal and bulbar muscular atrophy of Kennedy MIM#313200				20301508;29325606		False	3	100;0;0	21.664	True		ENSG00000169083	ENSG00000169083	HGNC:644	X	66765160	66765225	67545318	67545383	CAG	34	38					
ARX_EIEE1_GCN1	str	ARX	Expert Review Green;Expert Review	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510				11889467;33811808		False	3	100;0;0	21.664	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031767	25031814	25013650	25013697	GCN	16	23					
ARX_EIEE1_GCN1	str	ARX	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510				11889467;33811808		False	3	100;0;0	21.664	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031767	25031814	25013650	25013697	GCN	16	23					
ARX_EIEE1_GCN2	str	ARX	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510				11889467;33811808		False	3	100;0;0	21.664	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031647	25031682	25013530	25013565	GCN	12	20					
ARX_EIEE1_GCN2	str	ARX	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510				11889467;33811808		False	3	100;0;0	21.664	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031647	25031682	25013530	25013565	GCN	12	20					
ATN1_DRPLA_CAG	str	ATN1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370				8136840;8136826;29325606;20301664		False	3	100;0;0	21.664	True		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	32	48					
ATN1_DRPLA_CAG	str	ATN1	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370				8136840;8136826;29325606;20301664		False	3	100;0;0	21.664	False		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
ATN1_DRPLA_CAG	str	ATN1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370				29325606;20301664		False	3	100;0;0	21.664	True		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
ATN1_DRPLA_CAG	str	ATN1	Expert Review Green;Expert List	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370				29325606;20301664		False	3	100;0;0	21.664	True		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
ATXN10_SCA10_ATTCT	str	ATXN10	Expert Review Green;Expert List	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 10 MIM#603516				20301354		False	3	100;0;0	21.664	True		ENSG00000130638	ENSG00000130638	HGNC:10549	22	46191235	46191304	45795355	45795424	ATTCT	32	800					
ATXN1_SCA1_CAG	str	ATXN1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar Ataxia type 1;Parkinsonism;OMIM 164400				" 	PMID: 24602359"		False	3	100;0;0	21.664	True		ENSG00000124788	ENSG00000124788	HGNC:10548	6	16327867	16327953	16327636	16327722	CAG	36	45					
ATXN1_SCA1_CAG	str	ATXN1	Expert Review Green;Expert List	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 1 MIM#164400				29325606;20301363		False	3	100;0;0	21.664	True		ENSG00000124788	ENSG00000124788	HGNC:10548	6	16327918	16327953	16327687	16327722	CAG	35	39					
ATXN2_SCA2_CAG	str	ATXN2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 2 MIM#183090				20301452		False	3	100;0;0	21.664	True		ENSG00000204842	ENSG00000204842	HGNC:10555	12	112036755	112036823	111598951	111599016	CAG	31	35					
ATXN2_SCA2_CAG	str	ATXN2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 2 MIM#183090				11761482;17923635;8896555;29325606;20301452		False	3	100;0;0	21.664	True		ENSG00000204842	ENSG00000204842	HGNC:10555	12	112036755	112036823	111598951	111599019	CAG	31	35					
ATXN2_SCA2_CAG	str	ATXN2	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia type 2 MONDO:0008458				40741828		False	3	100;0;0	21.664	True		ENSG00000204842	ENSG00000204842	HGNC:10555	12	112036755	112036823	111598951	111599019	CAG	31	35					
ATXN3_SCA3_CAG	str	ATXN3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3				11176969;7574470;7874163;20301375;29325606		False	3	100;0;0	21.664	True		ENSG00000066427	ENSG00000066427	HGNC:7106	14	92537355	92537396	92071011	92071052	CAG	44	60					
ATXN3_SCA3_CAG	str	ATXN3	Expert Review Green;Expert List	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3				20301375;29325606		False	3	100;0;0	21.664	True		ENSG00000066427	ENSG00000066427	HGNC:7106	14	92537355	92537396	92071011	92071052	CAG	44	60					
ATXN7_SCA7_CAG	str	ATXN7	Expert Review Green;Expert List	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 7 MIM#164500				29325606;20301433		False	3	100;0;0	21.664	True		ENSG00000163635	ENSG00000163635	HGNC:10560	3	63898362	63898391	63912686	63912715	CAG	27	37					
ATXN8OS_SCA8_CTG	str	ATXN8OS	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 8 MIM#608768				24285970;20301445;10192387		False	3	100;0;0	21.664	True		ENSG00000230223	ENSG00000230223	HGNC:10561	13	70713486	70713560	70139354	70139428	CTG	50	80					
ATXN8OS_SCA8_CTG	str	ATXN8OS	Expert Review Green;Expert List	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 8 MIM#608768				20301445		False	3	100;0;0	21.664	True		ENSG00000230223	ENSG00000230223	HGNC:10561	13	70713486	70713560	70139354	70139422	CTG	50	80					
BEAN1_SCA31_TGGAA	str	BEAN1	Expert Review Green;Expert List	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 31 MIM#117210				19878914;31755042		False	3	100;0;0	21.664	True		ENSG00000166546	ENSG00000166546	HGNC:24160	16	66524300	66524369	66490397	66490466	TGGAA	22	80					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MONDO:0007105				36970046;36632182		False	3	100;0;0	21.664	False		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550				25577942;21944779;21944778		False	3	100;0;0	21.664	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550				26166205;24363131;26187722;25577942;21944779;21944778		False	3	100;0;0	21.664	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550				25577942;21944779;21944778;31779815		False	3	100;0;0	21.664	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550				25577942;21944779;21944778		False	3	100;0;0	21.664	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
CACNA1A_SCA6_CAG	str	CACNA1A	Expert Review Green;Expert List	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500				20301319;29325606		False	3	100;0;0	21.664	True		ENSG00000141837	ENSG00000141837	HGNC:1388	19	13318673	13318691	13207859	13207897	CAG	18	20					
CNBP_DM2_CCTG	str	CNBP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myotonic dystrophy 2 MIM#602668				20301639;11486088		False	3	100;0;0	21.664	True		ENSG00000169714	ENSG00000169714	HGNC:13164	3	128891420	128891499	129172577	129172656	CCTG	26	75					
CSTB_EPM1_CCCCGCCCCGCG	str	CSTB	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800				29325606;20301321		False	3	100;0;0	21.664	False		ENSG00000160213	ENSG00000160213	HGNC:2482	21	45196325	45196360	43776444	43776479	CCCCGCCCCGCG	3	30					
CSTB_EPM1_CCCCGCCCCGCG	str	CSTB	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800				29325606;20301321;9126745		False	3	100;0;0	21.664	True		ENSG00000160213	ENSG00000160213	HGNC:2482	21	45196325	45196360	43776444	43776479	CCCCGCCCCGCG	3	30					
DAB1_SCA37_ATTTC	str	DAB1	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 37 MIM#615945				28686858;31145571		False	3	100;0;0	21.664	False		ENSG00000173406	ENSG00000173406	HGNC:2661	1	57832716	57832797	57367044	57367121	ATTTC	0	31					
DMPK_DM1_CTG	str	DMPK	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myotonic dystrophy 1 MIM#160900				20301344;29325606		False	3	100;0;0	21.664	True		ENSG00000104936	ENSG00000104936	HGNC:2933	19	46273463	46273522	45770205	45770264	CTG	34	50					
FGF14_SCA27B_GAA	str	FGF14	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs)				37165652;36516086;36493768		False	3	100;0;0	21.664	False		ENSG00000102466	ENSG00000102466	HGNC:3671	13	102813926	102814076	102161576	102161726	GAA	249	300					
FMR1_FXTAS_CGG	str	FMR1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Fragile X tremor/ataxia syndrome MIM#300623				27340021;28176767;20301558;23765048;25227148;11445641		False	3	100;0;0	21.664	True		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	55					
FMR1_FXTAS_CGG	str	FMR1	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Fragile X tremor/ataxia syndrome MIM#300623				23765048;25227148		False	3	100;0;0	21.664	False		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	55					
FXN_FRDA_GAA	str	FXN	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300				20301458;8596916		False	3	100;0;0	21.664	True		ENSG00000165060	ENSG00000165060	HGNC:3951	9	71652203	71652220	69037287	69037304	GAA	33	66					
FXN_FRDA_GAA	str	FXN	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300				20301458;8596916		False	3	100;0;0	21.664	True		ENSG00000165060	ENSG00000165060	HGNC:3951	9	71652203	71652220	69037287	69037304	GAA	33	66					
FXN_FRDA_GAA	str	FXN	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300				20301458		False	3	100;0;0	21.664	False		ENSG00000165060	ENSG00000165060	HGNC:3951	9	71652203	71652220	69037287	69037304	GAA	33	66					
FXN_FRDA_GAA	str	FXN	Expert Review Green;Expert List	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300				20301458;8596916		False	3	100;0;0	21.664	True		ENSG00000165060	ENSG00000165060	HGNC:3951	9	71652203	71652220	69037287	69037301	GAA	33	66					
GIPC1_OPDM2_CGG	str	GIPC1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy 2 MIM#618940				32413282;33374016		False	3	100;0;0	21.664	True		ENSG00000123159	ENSG00000123159	HGNC:1226	19	14606854	14606886	14496042	14496074	CGG	32	70					
GLS_GDPAG_GCA	str	GLS	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412				30970188		False	3	100;0;0	21.664	True		ENSG00000115419	ENSG00000115419	HGNC:4331	2	191745599	191745646	190880873	190880920	GCA	16	400					
GLS_GDPAG_GCA	str	GLS	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412				30970188		False	3	100;0;0	21.664	True		ENSG00000115419	ENSG00000115419	HGNC:4331	2	191745599	191745646	190880873	190880920	GCA	16	400					
HTT_HD_CAG	str	HTT	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease MIM#143100				20301482;29325606		False	3	100;0;0	21.664	False		ENSG00000197386	ENSG00000197386	HGNC:4851	4	3076604	3076666	3074877	3074939	CAG	26	40					
HTT_HD_CAG	str	HTT	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease MIM#143100				8458085;20301482;29325606		False	3	100;0;0	21.664	False		ENSG00000197386	ENSG00000197386	HGNC:4851	4	3076604	3076666	3074877	3074939	CAG	26	40					
JPH3_HDL2_CTG	str	JPH3	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438				11558794;20301701		False	3	100;0;0	21.664	False		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
JPH3_HDL2_CTG	str	JPH3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438				11558794;20301701		False	3	100;0;0	21.664	True		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
JPH3_HDL2_CTG	str	JPH3	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438				20301701		False	3	100;0;0	21.664	False		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
LRP12_ALS_CGG	str	LRP12	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Amyotrophic lateral sclerosis MONDO:0004976;Amyotrophic lateral sclerosis 28, MIM#	620452"				37339631		False	3	100;0;0	21.664	True		ENSG00000147650	ENSG00000147650	HGNC:31708	8	105601201	105601227	104588973	104588999	CGG	50	61					
LRP12_OPDM1_CGG	str	LRP12	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy 1 MIM#164310				31332380;34047774		False	3	100;0;0	21.664	True		ENSG00000147650	ENSG00000147650	HGNC:31708	8	105601201	105601227	104588973	104588999	CGG	45	85					
MARCHF6_FAME3_TTTCA	str	MARCHF6	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial adult myoclonic, 3 MIM#613608				31664039		False	3	100;0;0	21.664	True		ENSG00000145495	ENSG00000145495	HGNC:30550	5	10356451	10356519	10356347	10356411	TTTCA	0	660					
NOP56_SCA36_GGCCTG	str	NOP56	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 36 MIM#614153				21683323		False	3	100;0;0	21.664	False		ENSG00000101361	ENSG00000101361	HGNC:15911	20	2633380	2633403	2652734	2652757	GGCCTG	14	650					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866				31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	21.664	True		-	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866				31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	21.664	True		-	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866				31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	21.664	True		-	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866				31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	21.664	True		-	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866				31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	21.664	False		-	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
NUTM2B-AS1_OPDM_CCG	str	NUTM2B-AS1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy MONDO:0025193				31332380;37923380;39308795;38159879		False	3	100;0;0	21.664	True		ENSG00000225484	ENSG00000225484	HGNC:51204	10	81586142	81586159	79826386	79826403	CCG	16	35					
PABPN1_OPMD_GCN	str	PABPN1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Oculopharyngeal muscular dystrophy MIM#164300				9462747;20301305		False	3	100;0;0	21.664	True		ENSG00000100836	ENSG00000100836	HGNC:8565	14	23790682	23790711	23321473	23321502	GCN	10	11					
PLIN4_MRUPAV_33-mer	str	PLIN4	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	myopathy, distal, with rimmed vacuoles MONDO:0014945				32451610;37145156;36151849;35499779		False	3	100;0;0	21.664	True		ENSG00000167676	ENSG00000167676	HGNC:29393	19	4510975	4511073	4510963	4511061	ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC	31	39					
PPP2R2B_SCA12_CAG	str	PPP2R2B	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 12 MIM#604326				31286011;27864267;33811808;10581021		False	3	100;0;0	21.664	True		ENSG00000156475	ENSG00000156475	HGNC:9305	5	146258292	146258321	146878729	146878758	CAG	32	51					
PPP2R2B_SCA12_CAG	str	PPP2R2B	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 12 MIM#604326				27864267;33811808		False	3	100;0;0	21.664	False		ENSG00000156475	ENSG00000156475	HGNC:9305	5	146258292	146258321	146878729	146878758	CAG	32	51					
PRDM12_HSAN8_GCC	str	PRDM12	Literature;Expert Review Green;Expert Review Green;Literature;Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488				26005867		False	3	100;0;0	21.664	False		ENSG00000130711	ENSG00000130711	HGNC:13997	9	133556993	133557026	130681606	130681639	GCC	14	18					
PRDM12_HSAN8_GCC	str	PRDM12	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488				26005867		False	3	100;0;0	21.664	False		ENSG00000130711	ENSG00000130711	HGNC:13997	9	133556993	133557026	130681606	130681639	GCC	14	18					
PRNP_CJD_octapeptide	str	PRNP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	21.664	True		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
PRNP_CJD_octapeptide	str	PRNP	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	21.664	False		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
PRNP_CJD_octapeptide	str	PRNP	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	21.664	False		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699424	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
PRNP_CJD_octapeptide	str	PRNP	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	21.664	True		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
PRNP_CJD_octapeptide	str	PRNP	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	21.664	False		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
RFC1_CANVAS_ANNGN	str	RFC1	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575				30926972		False	3	100;0;0	21.664	False		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	ANNGN	0	400					
RFC1_CANVAS_ANNGN	str	RFC1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575				30926972		False	3	100;0;0	21.664	True		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	ANNGN	0	400					
RFC1_CANVAS_ANNGN	str	RFC1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease MONDO:0005180				39833204;39152783;38789445;36705320;35013364		False	3	100;0;0	21.664	True		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	ANNGN	0	400					
RILPL1_OPDM4_CGG	str	RILPL1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Oculopharyngodistal myopathy MONDO:0025193				35148830		False	3	100;0;0	21.664	True		ENSG00000188026	ENSG00000188026	HGNC:26814	12	124018270	124018296	123533723	123533749	CGG	16	139					
SAMD12_FAME1_TTTCA	str	SAMD12	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Epilepsy, familial adult myoclonic, 1 MIM#601068				30194086;29507423		False	3	100;0;0	21.664	True		ENSG00000177570	ENSG00000177570	HGNC:31750	8	119379055	119379157	118366816	118366918	TTTCA	0	100					
STARD7_FAME2_ATTTC	str	STARD7	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial adult myoclonic, 2 MIM#607876				11701600;24114805;31664034		False	3	100;0;0	21.664	True		ENSG00000084090	ENSG00000084090	HGNC:18063	2	96862805	96862859	96197067	96197121	ATTTC	0	661					
TAF1_XDP_CCCTCT	str	TAF1	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia-Parkinsonism, X-linked MIM#314250				17273961;29229810		False	3	100;0;0	21.664	True		ENSG00000147133	ENSG00000147133	HGNC:11535	X	70672905	70672979	71453055	71453129	CCCTCT	13	30					
TAF1_XDP_CCCTCT	str	TAF1	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Dystonia-Parkinsonism, X-linked MIM#314250				17273961;29229810		False	3	100;0;0	21.664	False		ENSG00000147133	ENSG00000147133	HGNC:11535	X	70672905	70672979	71453055	71453129	CCCTCT	13	30					
TBP_SCA17_CAG	str	TBP	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136				20301611;29325606		False	3	100;0;0	21.664	False		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
TBP_SCA17_CAG	str	TBP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136				10484774;20301611		False	3	100;0;0	21.664	True		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
TBP_SCA17_CAG	str	TBP	Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136				10484774;20301611;29325606;27172828;14638975;11313753;11914409		False	3	100;0;0	21.664	True		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
TBP_SCA17_CAG	str	TBP	Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136				10484774;20301611;29325606		False	3	100;0;0	21.664	False		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
VWA1_HMNMYO_GCGCGGAGCG	str	VWA1	Literature;Expert Review Green;Expert Review Green;Literature;Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Neuropathy, hereditary motor, with myopathic features	MIM#619216"				33559681;33459760		False	3	100;0;0	21.664	False		ENSG00000179403	ENSG00000179403	HGNC:30910	1	1371179	1371198	1435799	1435818	GCGCGGAGCG	2	3					
XYLT1_DBQD2_GGC	str	XYLT1	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Desbuquois dysplasia 2 MIM#615777				30554721		False	3	100;0;0	21.664	True		ENSG00000103489	ENSG00000103489	HGNC:15516	16	17564765	17564779	17470908	17470922	GGC	20	120					
ZFHX3_SCA4_GGC	str	ZFHX3	Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	spinocerebellar ataxia type 4 MONDO:0010847				38035881;38197134		False	3	100;0;0	21.664	True		ENSG00000140836	ENSG00000140836	HGNC:777	16	72821594	72821657	72787695	72787758	GGC	30	48					
ZFHX3_SCA4_GGC	str	ZFHX3	Literature;Expert Review Green;Expert Review Green;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	spinocerebellar ataxia type 4 MONDO:0010847				38035881;38197134		False	3	100;0;0	21.664	False		ENSG00000140836	ENSG00000140836	HGNC:777	16	72821594	72821657	72787695	72787758	GGC	30	48					
RAPGEF2_FAME7_TTTCA	str	RAPGEF2	Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epilepsy, familial adult myoclonic, 7 MIM#618075				29507423;30351492;33791773		False	2	0;100;0	21.664	True		ENSG00000109756	ENSG00000109756	HGNC:16854	4	160263679	160263768	159342527	159342616	TTTCA	0	1					
THAP11_SCA51_CAG	str	THAP11	Literature;Expert Review Amber;Expert Review Amber;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 51 MONDO:0975800				15368101;24677642;34165550;38113319;40459937;39651830;37148549		False	2	0;100;0	21.664	False		ENSG00000168286	ENSG00000168286	HGNC:23194	16	67876766	67876853	67842863	67842950	CAG	39	47					
ISCA-37400-Loss	region		Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Chromosome 16p11.2 deletion syndrome, proximal, MIM#	611913;autism;intellectual disability;seizures"						False	3	100;0;0	21.664	True					16			29638675	30188534				3		80	cnv_loss	Chromosome 16p11.2 deletion syndrome, proximal
ISCA-37404-Loss	region		Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Angelman syndrome, MIM#	105830;Prader-Willi syndrome, MIM#	176270"				20301323;20301505		False	3	100;0;0	21.664	True					15			22782170	28134729				3		80	cnv_loss	Angelman and Prader-Willi syndromes
ISCA-37404-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Angelman syndrome, MIM#	105830;Prader-Willi syndrome, MIM#	176270"				20301323;20301505		False	3	100;0;0	21.664	False					15			22782170	28134729				3		80	cnv_loss	Angelman and Prader-Willi syndromes
ISCA-37405-Loss	region	NPHP1	Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Nephronophthisis 1, juvenile, MIM#	256100;Joubert syndrome 4, MIM#	609583;Senior-Loken syndrome 1, MIM#	266900"				29146700		False	3	100;0;0	21.664	True		ENSG00000144061	ENSG00000144061	HGNC:7905	2			110122329	110205017				3		80	cnv_loss	NPHP1 deletion
ISCA-37411-Loss	region		Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Chromosome 15q13.3 microdeletion syndrome, MIM#	612001;intellectual disability;epilepsy"				19372089;20979196		False	3	100;0;0	21.664	True					15			30844901	32153207				3		80	cnv_loss	Chromosome 15q13.3 microdeletion syndrome
ISCA-37429-Loss	region		Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Wolf-Hirschhorn syndrome, MIM#	194190;intellectual disability;growth retardation;seizures;dysmorphic features"						False	3	100;0;0	21.664	True					4			337779	2009235				3		80	cnv_loss	Wolf-Hirschhorn syndrome, chromosome 4p16.3 terminal deletion
ISCA-37431-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 17q11.2 deletion syndrome, MIM#613675;NF1 deletion syndrome				12660952;14729829		False	3	100;0;0	21.664	False					17			30835804	31891648				3		80	cnv_loss	Chromosome 17q11.2 deletion syndrome, NF1 deletion syndrome
ISCA-37432-Gain	region		Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Chromosome 17q12 duplication syndrome	614526;intellectual disability;seizures;congenital anomalies"				PMID: 19844256		False	3	100;0;0	21.664	False					17			36458167	37854617					3	80	cnv_gain	Chromosome 17q12 duplication syndrome
ISCA-37433-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	DiGeorge syndrome MIM#188400						False	3	100;0;0	21.664	False					22			18924718	20299686				3		80	cnv_loss	DiGeorge syndrome
ISCA-37434-Loss	region		Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Chromosome 1p36 deletion syndrome MIM#607872;intellectual disability;hypotonia;congenital anomalies				PMID: 12974736;18245432		False	3	100;0;0	21.664	False					1			898703	6229913				3		80	cnv_loss	Chromosome 1p36 deletion syndrome
ISCA-37436-Gain	region		Expert list;Expert Review Green;Expert list;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Charcot-Marie-Tooth disease type 1A, MIM#118220				PMID: 32648354		False	3	100;0;0	21.664	False					17			14194598	15567587					3	80	cnv_gain	Charcot-Marie-Tooth disease type 1A
ISCA-37436-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neuropathy, recurrent, with pressure palsies, MIM# 162500				PMID: 32356557;31118906;24726093		False	3	100;0;0	21.664	False					17			14194598	15567587				3		80	cnv_loss	Hereditary neuropathy with liability to pressure palsies
ISCA-37440-Loss	region		Expert list;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"2p21 deletion syndrome;Hypotonia-cystinuria syndrome, MIM#	606407"				PMID: 18234729;23794250		False	3	100;0;0	21.664	False					2			44183133	44362502				30		80	cnv_loss	2p21 deletion syndrome
ISCA-37446-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 22q11.2 deletion syndrome, distal MIM#611867;intellectual disability;autism;multiple congenital anomalies				18179902;23765049;21671380		False	3	100;0;0	21.664	False					22			18924718	21111384				3		80	cnv_loss	Chromosome 22q11.2 deletion syndrome, distal
ISCA-37478-Gain	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chromosome 15q11q13 duplication syndrome, MIM#608636;autism;intellectual disability;ataxia						False	3	100;0;0	21.664	False					15			23513243	28312040					3	80	cnv_gain	Chromosome 15q11q13 duplication syndrome
ISCA-37493-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	1q43q44 microdeletion syndrome;intellectual disability;seizures;microcephaly;corpus callosum abnormalities				28283832;31929334;31830750;30853971		False	3	100;0;0	21.664	False					1			243124428	245154985				3		80	cnv_loss	1q43q44 microdeletion syndrome
ISCA-46290-Gain	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Chromosome Xp11.23-p11.22 duplication syndrome MIM#300801;intellectual disability;seizures				19716111;27605428;29707408;16900295		False	3	100;0;0	21.664	False					X			48447780	52444265					3	80	cnv_gain	Chromosome Xp11.23-p11.22 duplication syndrome
ISCA-46295-Loss	region		Expert list;Expert Review Green;Expert Review Green;Expert list	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Chromosome 15q13.3 microdeletion syndrome MIM#612001;intellectual disability;seizures				PMID: 19289393		False	3	100;0;0	21.664	False					15			31727418	32153205				3		80	cnv_loss	Chromosome 15q13.3 microdeletion syndrome
ISCA-46304-Gain	region	MECP2	Expert Review Green;ClinGen;ClinGen	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Syndromic X-linked intellectual disability Lubs type, MONDO:0010283				PMID: 29141583, 22679399		False	3	100;0;0	21.664	True		ENSG00000169057	ENSG00000169057	HGNC:6990	X			154008529	154110279				0	3	80	cnv_gain	Xq28 (includes MECP2) gain
LMNB1 upstream region	region		Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Adult-onset autosomal dominant demyelinating leukodystrophy, MONDO:0008215				PMID: 30842973;30697589;25701871		False	3	100;0;0	21.664	False					5			126522203	126689287						80	cnv_loss	LMNB1 upstream region
LMNB1 upstream region	region		Expert Review Green;Literature;Literature	Progressive Neurological Conditions		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Adult-onset autosomal dominant demyelinating leukodystrophy, MONDO:0008215				PMID: 30842973;30697589;25701871		False	3	100;0;0	21.664	False					5			126522203	126689287						80	cnv_loss	LMNB1 upstream region
