Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name A4GALT gene A4GALT Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal A4GALT-congenital disorder of glycosylation MONDO:0100587 12823750;15142124;10747952;10993874;11896312;27612185 False 3 50;0;50 21.569 True ENSG00000128274 ENSG00000128274 HGNC:18149 AAAS gene AAAS Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Glucocorticoid deficiency with achalasia;Achalasia-addisonianism-alacrimia syndrome, MIM# 231550 False 3 100;0;0 21.569 True ENSG00000094914 ENSG00000094914 HGNC:13666 AAAS gene AAAS Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Achalasia-addisonianism-alacrimia syndrome MIM#231550 False 3 100;0;0 21.569 True ENSG00000094914 ENSG00000094914 HGNC:13666 AARS gene AARS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 29, MIM# 616339 28493438;25817015 False 3 100;0;0 21.569 True ENSG00000090861 ENSG00000090861 HGNC:20 AARS gene AARS Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 29, MIM#616339 28493438;25817015 False 3 100;0;0 21.569 True ENSG00000090861 ENSG00000090861 HGNC:20 AARS gene AARS Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot Marie Tooth disease, axonal, type 2N, 613287;HMSN, dHMN/dSMA 20045102;22009580;22206013;30373780;26032230 False 3 100;0;0 21.569 False ENSG00000090861 ENSG00000090861 HGNC:20 AARS2 gene AARS2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, progressive, with ovarian failure, 615889 False 3 100;0;0 21.569 False ENSG00000124608 ENSG00000124608 HGNC:21022 AARS2 gene AARS2 Expert Review Green;Other;Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 8 MIM#614096 21549344;25058219 False 3 100;0;0 21.569 True ENSG00000124608 ENSG00000124608 HGNC:21022 AARS2 gene AARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 8 MIM#614096;Leukoencephalopathy, progressive, with ovarian failure MIM#615889;MONDO:0013570 30706699;27839525;21549344;25058219;24808023 False 3 100;0;0 21.569 True ENSG00000124608 ENSG00000124608 HGNC:21022 ABAT gene ABAT Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mtDNA depletion syndrome (MDS) 25738457;27903293 False 3 100;0;0 21.569 True ENSG00000183044 ENSG00000183044 HGNC:23 ABAT gene ABAT Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GABA-transaminase deficiency, MIM#613163 10407778;20052547;27596361;28411234 False 3 100;0;0 21.569 True ENSG00000183044 ENSG00000183044 HGNC:23 ABAT gene ABAT Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GABA-transaminase deficiency, MIM# 613163 28411234;27596361;20052547;10407778;6148708 False 3 100;0;0 21.569 True ENSG00000183044 ENSG00000183044 HGNC:23 ABCA1 gene ABCA1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Tangier Disease (MONDO:0008783;MIM#205400) 29582519;4165386;31751110 False 3 50;50;0 21.569 True ENSG00000165029 ENSG00000165029 HGNC:29 ABCA2 gene ABCA2 Expert Review Green;Expert Review;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with poor growth and with or without seizures or ataxia, 618808 30237576;29302074;31047799 False 3 100;0;0 21.569 True ENSG00000107331 ENSG00000107331 HGNC:32 ABCB11 gene ABCB11 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cholestasis, progressive familial intrahepatic 2 MIM#601847;disorder of bile acid metabolism 9806540 False 3 100;0;0 21.569 True ENSG00000073734 ENSG00000073734 HGNC:42 ABCB4 gene ABCB4 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive familial intrahepatic cholestasis type 3, MONDO:0011214 8666348, 9419367, 26474921, 32793533, 11313315 False 3 100;0;0 21.569 True ENSG00000005471 ENSG00000005471 HGNC:45 ABCB7 gene ABCB7 NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females 301310 Anemia, sideroblastic, with ataxia 10196363;30401706;29787825 False 3 0;0;0 21.569 False ENSG00000131269 ENSG00000131269 HGNC:48 ABCB7 gene ABCB7 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Anaemia, sideroblastic, with ataxia, MIM# 301310 10196363;10196363;33157103;31772327;31511561;26242992 False 3 100;0;0 21.569 True ENSG00000131269 ENSG00000131269 HGNC:48 ABCB7 gene ABCB7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Anaemia, sideroblastic, with ataxia, MIM# 301310 10196363;10196363;33157103;31772327;31511561;26242992 False 3 100;0;0 21.569 True ENSG00000131269 ENSG00000131269 HGNC:48 ABCD1 gene ABCD1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females adrenoleukodystrophy (MONDO:0018544) 15811009;8651290;7825602;21700483 False 3 100;0;0 21.569 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenomyeloneuropathy, adult (MIM#300100);Adrenomyeloneuropathy, spastic paraparesis, adrenal insufficiency, axonal sensory-motor neuropathy, sphincter disturbance 20301491 False 3 100;0;0 21.569 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Adrenoleukodystrophy, MIM# 300100" False 3 100;0;0 21.569 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Adrenoleukodystrophy, MIM# 300100" False 3 100;0;0 21.569 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Royal Melbourne Hospital;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenoleukodystrophy MIM# 300100, XLR False 3 100;0;0 21.569 True ENSG00000101986 ENSG00000101986 HGNC:61 ABHD12 gene ABHD12 Expert Review Green;NHS GMS;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Onset 2nd decade, neuropathy with SNCV, sensory neuronal hearing loss, retinitis pigmentosa, spastic paraplegia, ataxia;Neurodegeneration, childhood-onset, with cerebellar atrophy,612674;HMSN False 3 100;0;0 21.569 False ENSG00000100997 ENSG00000100997 HGNC:15868 ABHD12 gene ABHD12 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674;disorder of of endocannabinoid metabolism 20797687 False 3 100;0;0 21.569 True ENSG00000100997 ENSG00000100997 HGNC:15868 ABHD12 gene ABHD12 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674 False 3 100;0;0 21.569 True ENSG00000100997 ENSG00000100997 HGNC:15868 ABHD16A gene ABHD16A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities PMID: 34587489 False 3 100;0;0 21.569 True ENSG00000204427 ENSG00000204427 HGNC:13921 ABHD16A gene ABHD16A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities PMID: 34587489 False 3 100;0;0 21.569 True ENSG00000204427 ENSG00000204427 HGNC:13921 ABHD5 gene ABHD5 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dorfman-Chanarin disease MONDO:0010155 31883530 False 3 100;0;0 21.569 True ENSG00000011198 ENSG00000011198 HGNC:21396 ABHD5 gene ABHD5 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chanarin-Dorfman syndrome MIM#275630;neutral lipid storage disease with ichthyosis;lipid metabolism 30795549 False 3 100;0;0 21.569 True ENSG00000011198 ENSG00000011198 HGNC:21396 ACAD9 gene ACAD9 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency due to ACAD9 deficiency 611126 30025539 False 3 100;0;0 21.569 True ENSG00000177646 ENSG00000177646 HGNC:21497 ACAD9 gene ACAD9 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 20, MIM# 611126 False 3 100;0;0 21.569 True ENSG00000177646 ENSG00000177646 HGNC:21497 ACAD9 gene ACAD9 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 20 MIM#611126 30025539 False 3 100;0;0 21.569 True ENSG00000177646 ENSG00000177646 HGNC:21497 ACADM gene ACADM Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Acyl-CoA dehydrogenase, medium chain, deficiency of 201450;Rhabdomyolysis False 3 100;0;0 21.569 True ENSG00000117054 ENSG00000117054 HGNC:89 ACADM gene ACADM Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Acyl-CoA dehydrogenase, medium chain, deficiency of MIM#201450 25778941;1972503;26223887 False 3 100;0;0 21.569 True ENSG00000117054 ENSG00000117054 HGNC:89 ACADM gene ACADM Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Acyl-CoA dehydrogenase, medium chain, deficiency of, MIM# 201450 False 3 100;0;0 21.569 True ENSG00000117054 ENSG00000117054 HGNC:89 ACADSB gene ACADSB Expert Review Green;Expert Review Green;Literature;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 2-methylbutyrylglycinuria MIM#610006 25778941;17945527 False 3 100;0;0 21.569 True ENSG00000196177 ENSG00000196177 HGNC:91 ACADSB gene ACADSB Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 2-methylbutyrylglycinuria MIM#610006 11013134;17945527;30730842 False 3 100;0;0 21.569 True ENSG00000196177 ENSG00000196177 HGNC:91 ACADVL gene ACADVL Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal VLCAD deficiency MIM#201475 25778941;8845838;29459657 False 3 100;0;0 21.569 True ENSG00000072778 ENSG00000072778 HGNC:92 ACADVL gene ACADVL Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal VLCAD deficiency 201475 9546340;24263034 False 3 100;0;0 21.569 True ENSG00000072778 ENSG00000072778 HGNC:92 ACADVL gene ACADVL Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal VLCAD deficiency, MIM# 201475 False 3 100;0;0 21.569 True ENSG00000072778 ENSG00000072778 HGNC:92 ACAT1 gene ACAT1 Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Alpha-methylacetoacetic aciduria MIM#203750" 31268215;25778941;1715688 False 3 100;0;0 21.569 True ENSG00000075239 ENSG00000075239 HGNC:93 ACAT1 gene ACAT1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alpha-methylacetoacetic aciduria, MIM#203750;Deficiency of acetyl-CoA acetyltransferase;Beta-ketothiolase deficiency MONDO:0008760 17236799;1715688 False 3 100;0;0 21.569 True ENSG00000075239 ENSG00000075239 HGNC:93 ACBD5 gene ACBD5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive leukodystrophy;syndromic cleft palate;ataxia;retinal dystrophy 23105016;27799409 False 3 100;0;0 21.569 False ENSG00000107897 ENSG00000107897 HGNC:23338 ACBD5 gene ACBD5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Retinal dystrophy with leukodystrophy (MIM#618863) 27799409;23105016 False 3 100;0;0 21.569 True ENSG00000107897 ENSG00000107897 HGNC:23338 ACBD6 gene ACBD6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 37951597 False 3 100;0;0 21.569 True ENSG00000230124 ENSG00000230124 HGNC:23339 ACBD6 gene ACBD6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 37951597 False 3 100;0;0 21.569 True ENSG00000230124 ENSG00000230124 HGNC:23339 ACER3 gene ACER3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, progressive, early childhood-onset, OMIM:617762 32816236;26792856;34281620 False 3 50;50;0 21.569 True ENSG00000078124 ENSG00000078124 HGNC:16066 ACO2 gene ACO2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Infantile cerebellar-retinal degeneration, MIM#614559;Optic atrophy 9, MIM# 616289 22405087;25351951;30689204;32519519;25351951;34056600 False 3 100;0;0 21.569 True ENSG00000100412 ENSG00000100412 HGNC:118 ACO2 gene ACO2 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile cerebellar-retinal degeneration, MIM#614559 False 3 100;0;0 21.569 True ENSG00000100412 ENSG00000100412 HGNC:118 ACOX1 gene ACOX1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470;Mitchell syndrome, MIM# 618960 32169171;17458872 False 3 100;0;0 21.569 True ENSG00000161533 ENSG00000161533 HGNC:119 ACOX1 gene ACOX1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470;Mitchell syndrome, MIM# 618960 False 3 0;0;0 21.569 True ENSG00000161533 ENSG00000161533 HGNC:119 ACOX1 gene ACOX1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mitchell syndrome, MIM# 618960 32169171 False 3 100;0;0 21.569 True ENSG00000161533 ENSG00000161533 HGNC:119 ACOX1 gene ACOX1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisomal acyl-CoA oxidase deficiency, MIM# 264470 False 3 0;0;0 21.569 True ENSG00000161533 ENSG00000161533 HGNC:119 ACOX2 gene ACOX2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 6, 617308 27647924;27884763;29287774;35395098 False 3 67;33;0 21.569 True ENSG00000168306 ENSG00000168306 HGNC:120 ACP5 gene ACP5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spondyloenchondrodysplasia with immune dysregulation, MIM# 607944 21217755;21217752 False 3 100;0;0 21.569 True ENSG00000102575 ENSG00000102575 HGNC:124 ACTA1 gene ACTA1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Myopathy, scapulohumeroperoneal 616852" 28606400;25938801 False 3 100;0;0 21.569 True ENSG00000143632 ENSG00000143632 HGNC:129 ACTA2 gene ACTA2 Genomics England PanelApp;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Multisystemic smooth muscle dysfunction syndrome,613834;Aortic aneurysm familial thoracic 6,611788;Moyamoya Disease;Moyamoya disease 5;Moyamoya disease 5,614042 False 3 0;100;0 21.569 False ENSG00000107796 ENSG00000107796 HGNC:130 ACTA2 gene ACTA2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted multisystemic smooth muscle dysfunction syndrome MONDO:0013452 29300374 False 3 100;0;0 21.569 True Other ENSG00000107796 ENSG00000107796 HGNC:130 ACTB gene ACTB Expert Review Green;Expert Review;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Baraitser-Winter syndrome 1 243310 Thrombocytopenia 8, with dysmorphic features and developmental delay, MIM# 620475 (PMID:22366783,25052316,31970217) False 3 100;0;0 21.569 True ENSG00000075624 ENSG00000075624 HGNC:132 ACTB gene ACTB Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Baraitser-Winter syndrome 1, 243310;Dystonia, juvenile-onset, 607371 29788902;28487785 False 3 100;0;0 21.569 True Other ENSG00000075624 ENSG00000075624 HGNC:132 ACTG1 gene ACTG1 Expert Review Green;Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Baraitser-Winter syndrome 2, MIM# 614583" 22366783;25052316 False 3 100;0;0 21.569 True ENSG00000184009 ENSG00000184009 HGNC:144 ACTL6B gene ACTL6B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 76, MIM# 618468;Intellectual developmental disorder with severe speech and ambulation defects, MIM# 618470" 31134736;31031012;30656450;30237576 False 3 100;0;0 21.569 True ENSG00000077080 ENSG00000077080 HGNC:160 ACTN2 gene ACTN2 Expert Review Green;Literature;Expert Review Amber Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, distal, 6, adult onset MIM#618655;ACTN2-related cardiac and skeletal myopathy, MONDO:0700349 30900782;34170073;36116040;34471957;34386585 False 3 67;33;0 21.569 True Other ENSG00000077522 ENSG00000077522 HGNC:164 ACVR1 gene ACVR1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fibrodysplasia ossificans progressiva, MIM# 135100 27565519 False 3 100;0;0 21.569 True ENSG00000115170 ENSG00000115170 HGNC:171 ACVRL1 gene ACVRL1 Expert Review Green;Genomics England PanelApp;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Telangiectasia, hereditary hemorrhagic, type 2 600376 False 3 100;0;0 21.569 False ENSG00000139567 ENSG00000139567 HGNC:175 ACY1 gene ACY1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aminoacylase 1 deficiency MIM#609924;disorder of amino acid metabolism 16465618;17562838;24117009 False 3 100;0;0 21.569 True ENSG00000243989 ENSG00000243989 HGNC:177 ACY1 gene ACY1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aminoacylase 1 deficiency, MIM# 609924 (PMID: 16465618,16274666, 24117009) False 3 100;0;0 21.569 True ENSG00000243989 ENSG00000243989 HGNC:177 ADA gene ADA Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Adenosine deaminase deficiency, partial MIM#102700;Severe combined immunodeficiency due to ADA deficiency MIM#102700;disorder of purine metabolism 3475710;3684597;2783588;1680289 False 3 100;0;0 21.569 True ENSG00000196839 ENSG00000196839 HGNC:186 ADAM22 gene ADAM22 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 61 (MIM#617933) 27066583;30237576;35373813 False 3 50;50;0 21.569 True ENSG00000008277 ENSG00000008277 HGNC:201 ADAR gene ADAR Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6, MIM# 615010;Dyschromatosis symmetrica hereditaria, MIM# 127400 False 3 100;0;0 21.569 True ENSG00000160710 ENSG00000160710 HGNC:225 ADAR gene ADAR Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Aicardi-Goutieres syndrome 6, MIM# 615010" False 3 100;0;0 21.569 True ENSG00000160710 ENSG00000160710 HGNC:225 ADAR gene ADAR Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6;neuroinflammatory disorder with cerebral calcification;progressive loss of cognition;spasticity;dystonia;parkinsonism;OMIM 615010 PMID: 32911246 False 3 100;0;0 21.569 True ENSG00000160710 ENSG00000160710 HGNC:225 ADAR gene ADAR Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6, MIM#615010 23001123;24262145;23001123;30692772 False 3 100;0;0 21.569 True ENSG00000160710 ENSG00000160710 HGNC:225 ADAR gene ADAR Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6, 615010 autosomal recessive False 3 100;0;0 21.569 True ENSG00000160710 ENSG00000160710 HGNC:225 ADAR gene ADAR Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dystonia;Aicardi-Goutieres syndrome 6, 615010 False 3 100;0;0 21.569 False ENSG00000160710 ENSG00000160710 HGNC:225 ADARB1 gene ADARB1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, microcephaly, and seizures, 618862;Intellectual disability;microcephaly;seizures 32220291;32719099 False 3 100;0;0 21.569 True ENSG00000197381 ENSG00000197381 HGNC:226 ADCY5 gene ADCY5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651 22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617 False 3 100;0;0 21.569 True ENSG00000173175 ENSG00000173175 HGNC:236 ADCY5 gene ADCY5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651 22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617 False 3 100;0;0 21.569 False ENSG00000173175 ENSG00000173175 HGNC:236 ADGRG1 gene ADGRG1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polymicrogyria, Frontoparietal, 606854;Polymicrogyria, perisylvian type, 615752 False 3 100;0;0 21.569 True ENSG00000205336 ENSG00000205336 HGNC:4512 ADGRG1 gene ADGRG1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polymicrogyria, bilateral frontoparietal, MIM#606854 16240336;33299078 False 3 100;0;0 21.569 True ENSG00000205336 ENSG00000205336 HGNC:4512 ADGRV1 gene ADGRV1 Expert Review Green;Expert Review Amber;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epilepsy, MONDO:0005027, ADGRV1-related 29266188;29261713;32962041;34160719 False 3 50;50;0 21.569 True ENSG00000164199 ENSG00000164199 HGNC:17416 ADNP gene ADNP Expert Review Green;Expert Review;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Helsmoortel-van der Aa syndrome MIM#615873 (PMID: 27054228;24531329) False 3 100;0;0 21.569 True ENSG00000101126 ENSG00000101126 HGNC:15766 ADPRHL2 gene ADPRHL2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced, with variable ataxia and seizures (MIM#618170) 30100084;30401461 False 3 100;0;0 21.569 True ENSG00000116863 ENSG00000116863 HGNC:21304 ADPRHL2 gene ADPRHL2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced, with variable ataxia and seizures (MIM#618170) 30100084;30401461 False 3 100;0;0 21.569 True ENSG00000116863 ENSG00000116863 HGNC:21304 ADPRHL2 gene ADPRHL2 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced with variable ataxia and seizures, 618170 30100084;30401461 False 3 100;0;0 21.569 True ENSG00000116863 ENSG00000116863 HGNC:21304 ADSL gene ADSL Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Adenylosuccinase deficiency MIM#103050;disorder of purine metabolism 1302001;22180458;18524658;27626380 False 3 100;0;0 21.569 True ENSG00000239900 ENSG00000239900 HGNC:291 ADSL gene ADSL Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Adenylosuccinase deficiency MIM#103050 1302001;22180458;18524658;27626380 False 3 100;0;0 21.569 True ENSG00000239900 ENSG00000239900 HGNC:291 ADSSL1 gene ADSSL1 Expert Review Green;Literature;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal adenylosuccinate synthetase-like 1-related distal myopathy MONDO:0018834 26506222;28268051;34635388;32646962 False 3 100;0;0 21.569 True ENSG00000185100 ENSG00000185100 HGNC:20093 AFF3 gene AFF3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted KINSSHIP syndrome, MIM# 619297;Intellectual disability;seizures;hypertrichosis 31388108;33961779 False 3 100;0;0 21.569 True ENSG00000144218 ENSG00000144218 HGNC:6473 AFG3L2 gene AFG3L2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive, MIM# 614487, MONDO:0013776;Early-onset spastic paraplegia, later myoclonic epilepsy, sensory-motor axonal neuropathy, ataxia, dystonia 22022284;25401298 False 3 100;0;0 21.569 True ENSG00000141385 ENSG00000141385 HGNC:315 AFG3L2 gene AFG3L2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive MIM#614487;Spinocerebellar ataxia 28 MIM#610246 20725928 False 3 100;0;0 21.569 True ENSG00000141385 ENSG00000141385 HGNC:315 AFG3L2 gene AFG3L2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive, MIM# 614487;Spinocerebellar ataxia 28, MIM# 610246 22022284;20208537;20725928;33075064;32248051;30910913 False 3 100;0;0 21.569 True Other ENSG00000141385 ENSG00000141385 HGNC:315 AFG3L2 gene AFG3L2 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive (MIM#614487);Spinocerebellar ataxia 28 (MIM#610246);Optic atrophy 12, MIM# 618977 29181157;26539208;30252181;30389403;32219868;32600459;32548275;20725928 False 3 100;0;0 21.569 True ENSG00000141385 ENSG00000141385 HGNC:315 AGA gene AGA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aspartylglucosaminuria, MIM# 208400;MONDO:0008830 1703489;1904874;8064811;8946839 False 3 100;0;0 21.569 True ENSG00000038002 ENSG00000038002 HGNC:318 AGA gene AGA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aspartylglucosaminuria, MIM# 208400 (PMID: 33439067;8333236;19175389;15036433;8064811;8946839;1756604) False 3 100;0;0 21.569 True ENSG00000038002 ENSG00000038002 HGNC:318 AGK gene AGK Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sengers syndrome, MIM#212350;Cataract 38 MIM#614691 22415731;25208612;22415731;25208612;37354892 False 3 100;0;0 21.569 True ENSG00000006530 ENSG00000006530 HGNC:21869 AGK gene AGK Expert Review Green;Other;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sengers Syndrome (MIM#212350;MONDO:0008922) 22284826 False 3 100;0;0 21.569 True ENSG00000006530 ENSG00000006530 HGNC:21869 AGL gene AGL Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IIIa and IIIb, MIM# 232400 False 3 100;0;0 21.569 True ENSG00000162688 ENSG00000162688 HGNC:321 AGL gene AGL Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IIIa 232400;Glycogen storage disease IIIb 232400 20301788 False 3 100;0;0 21.569 True ENSG00000162688 ENSG00000162688 HGNC:321 AGMO gene AGMO Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, AGMO-related 31555905;27000257 False 3 100;0;0 21.569 True ENSG00000187546 ENSG00000187546 HGNC:33784 AGO1 gene AGO1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with language delay and behavioral abnormalities, with or without seizures, MIM# 620292 35060114;30213762;25356899 False 3 100;0;0 21.569 True ENSG00000092847 ENSG00000092847 HGNC:3262 AGPS gene AGPS Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000018510 ENSG00000018510 HGNC:327 AGTPBP1 gene AGTPBP1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650 30420557, 28600779, 30976113, 38153683, 28325758 False 3 100;0;0 21.569 True ENSG00000135049 ENSG00000135049 HGNC:17258 AGTPBP1 gene AGTPBP1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650 30420557, 28600779, 30976113, 38153683, 28325758 False 3 100;0;0 21.569 True ENSG00000135049 ENSG00000135049 HGNC:17258 AGXT gene AGXT Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperoxaluria, primary, type 1, MIM#259900 False 3 100;0;0 21.569 True ENSG00000172482 ENSG00000172482 HGNC:341 AGXT gene AGXT Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000172482 ENSG00000172482 HGNC:341 AHCY gene AHCY Expert Review Green;Expert Review Green;Expert list;Expert list;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase MIM#613752 28779239;15024124;30121674 False 3 100;0;0 21.569 True ENSG00000101444 ENSG00000101444 HGNC:343 AHCY gene AHCY Expert Review Green;NHS GMS;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase MIM#613752;disorder of methionine metabolism 28779239;26095522;20852937;15024124;27626380 False 3 100;0;0 21.569 True ENSG00000101444 ENSG00000101444 HGNC:343 AHI1 gene AHI1 Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 3 25616960 False 3 100;0;0 21.569 True ENSG00000135541 ENSG00000135541 HGNC:21575 AIFM1 gene AIFM1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Combined oxidative phosphorylation deficiency 6;Cowchock syndrome;HMSN 3856385;22019070;26173962;25583628 False 3 100;0;0 21.569 True ENSG00000156709 ENSG00000156709 HGNC:8768 AIFM1 gene AIFM1 Expert Review Green;Other;Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Combined oxidative phosphorylation deficiency 6 (COXPD6) (MIM#300816);Encephalamyopathy, Mitochondrial, X-Linked 20362274;22019070;26173962 False 3 100;0;0 21.569 True ENSG00000156709 ENSG00000156709 HGNC:8768 AIFM1 gene AIFM1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, MIM# 300232 28842795;27102849 False 3 100;0;0 21.569 True ENSG00000156709 ENSG00000156709 HGNC:8768 AIFM1 gene AIFM1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Combined oxidative phosphorylation deficiency 6, 300816;Cowchock syndrome, 310490;Deafness, X-linked 5, 300614;Spondyloepimetaphyseal dysplasia, X-linked, with hypomyelinating leukodystrophy, 300232 False 3 100;0;0 21.569 True ENSG00000156709 ENSG00000156709 HGNC:8768 AIMP1 gene AIMP1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 3, MIM#260600 21092922;24958424;33402283;32531460;30486714;30477741 False 3 100;0;0 21.569 True ENSG00000164022 ENSG00000164022 HGNC:10648 AIMP1 gene AIMP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 3, MIM# 260600 21092922;24958424;33402283;32531460;30486714;30477741 False 3 100;0;0 21.569 True ENSG00000164022 ENSG00000164022 HGNC:10648 AIMP1 gene AIMP1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 3 260600 False 3 0;0;0 21.569 False ENSG00000164022 ENSG00000164022 HGNC:10648 AJAP1 gene AJAP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder, MONDO:0700092, AJAP1-related 38985877 False 3 100;0;0 21.569 True ENSG00000196581 ENSG00000196581 HGNC:30801 AKR1D1 gene AKR1D1 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 2 MIM#235555;disorder of bile acid metabolism 12970144;20522910;15030995 False 3 100;0;0 21.569 True ENSG00000122787 ENSG00000122787 HGNC:388 AKT1 gene AKT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders Other Proteus syndrome, somatic, MIM# 176920 21793738 False 3 50;50;0 21.569 True ENSG00000142208 ENSG00000142208 HGNC:391 AKT3 gene AKT3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 2 MIM#615937 22729224 False 3 100;0;0 21.569 True Other ENSG00000117020 ENSG00000117020 HGNC:393 ALAS2 gene ALAS2 NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females 300752 Protoporphyria, erythropoietic, X-linked;Sideroblastic anaemia - increased serum ferritin;300751 Anemia, sideroblastic, 1 24003969;30401706;10029606;30098397 False 3 0;0;0 21.569 False ENSG00000158578 ENSG00000158578 HGNC:397 ALDH18A1 gene ALDH18A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spastic paraplegia 9B, autosomal recessive, MIM# 616586;Spastic paraplegia 9A, autosomal dominant, MIM# 601162" 26026163;29915212 False 3 100;0;0 21.569 True ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH18A1 gene ALDH18A1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IIIA MIM#219150;Spastic paraplegia 9A, autosomal dominant MIM#601162;Spastic paraplegia 9B, autosomal recessive MIM#616586;Cutis laxa, autosomal dominant 3 MIM#616603;disorders of ornithine or proline metabolism 32221810;11092761;29754261;26026163 False 3 100;0;0 21.569 True ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH18A1 gene ALDH18A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Adolescent-onset and adult-onset spastic paraplegia, dysarthria and motor neuronopathy, cataracts, skeletal abnormalities False 3 100;0;0 21.569 False ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH3A2 gene ALDH3A2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Sjogren-Larsson syndrome, MIM# 270200" False 3 100;0;0 21.569 True ENSG00000072210 ENSG00000072210 HGNC:403 ALDH3A2 gene ALDH3A2 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sjogren-Larsson syndrome MIM#270200;disorder of lipid metabolism 8528251;31273323 False 3 100;0;0 21.569 True ENSG00000072210 ENSG00000072210 HGNC:403 ALDH3A2 gene ALDH3A2 Expert Review Green;Literature;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sjogren-Larsson syndrome, MIM# 270200 (PMID:32021380,30372562 False 3 100;0;0 21.569 True ENSG00000072210 ENSG00000072210 HGNC:403 ALDH3A2 gene ALDH3A2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sj gren-Larsson syndrome False 3 100;0;0 21.569 True ENSG00000072210 ENSG00000072210 HGNC:403 ALDH4A1 gene ALDH4A1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperprolinemia, type II MIM#239510;disorders of ornithine or proline metabolism 9700195;31884946 False 3 100;0;0 21.569 True ENSG00000159423 ENSG00000159423 HGNC:406 ALDH4A1 gene ALDH4A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperprolinaemia, type II, MIM#239510 9700195, 31884946 False 3 100;0;0 21.569 True ENSG00000159423 ENSG00000159423 HGNC:406 ALDH5A1 gene ALDH5A1 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency MIM#271980;disorder of neurotransmitter metabolism 9683595;14635103;32887777 False 3 100;0;0 21.569 True ENSG00000112294 ENSG00000112294 HGNC:408 ALDH5A1 gene ALDH5A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 14635103 False 3 100;0;0 21.569 True ENSG00000112294 ENSG00000112294 HGNC:408 ALDH5A1 gene ALDH5A1 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 9683595;14635103;32402538 False 3 100;0;0 21.569 True ENSG00000112294 ENSG00000112294 HGNC:408 ALDH5A1 gene ALDH5A1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 9683595;14635103;32402538 False 3 100;0;0 21.569 True ENSG00000112294 ENSG00000112294 HGNC:408 ALDH6A1 gene ALDH6A1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Methylmalonate semialdehyde dehydrogenase deficiency MIM#614105;disorder of valine and pyrimidine metabolism 32151545;10947204;21863277;23835272 False 3 100;0;0 21.569 True ENSG00000119711 ENSG00000119711 HGNC:7179 ALDH7A1 gene ALDH7A1 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, pyridoxine-dependent MM#266100;disorder of lysine metabolism 16491085;17068770 False 3 100;0;0 21.569 True ENSG00000164904 ENSG00000164904 HGNC:877 ALDH7A1 gene ALDH7A1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, pyridoxine-dependent, MIM# 266100 False 3 100;0;0 21.569 True ENSG00000164904 ENSG00000164904 HGNC:877 ALDH7A1 gene ALDH7A1 Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, pyridoxine-dependent, MIM# 266100 33200442 False 3 100;0;0 21.569 True ENSG00000164904 ENSG00000164904 HGNC:877 ALDOA gene ALDOA Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XII 611881 8598869;25392908;14615364 False 3 100;0;0 21.569 True ENSG00000149925 ENSG00000149925 HGNC:414 ALDOA gene ALDOA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XII , MIM#611881 7331996;8598869;25392908 False 3 100;0;0 21.569 True ENSG00000149925 ENSG00000149925 HGNC:414 ALDOB gene ALDOB Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fructose intolerance, hereditary, MIM# 229600 False 3 100;0;0 21.569 True ENSG00000136872 ENSG00000136872 HGNC:417 ALG1 gene ALG1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ik, MIM# 608540 26931382 False 3 100;0;0 21.569 True ENSG00000033011 ENSG00000033011 HGNC:18294 ALG1 gene ALG1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Congenital disorder of glycosylation, type Ik 608540" 26931382 False 3 100;0;0 21.569 True ENSG00000033011 ENSG00000033011 HGNC:18294 ALG11 gene ALG11 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Congenital disorder of glycosylation, type Ip, MIM# 613661" 30676690 False 3 100;0;0 21.569 True ENSG00000253710 ENSG00000253710 HGNC:32456 ALG11 gene ALG11 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ip, MIM# 613661 30676690 False 3 100;0;0 21.569 True ENSG00000253710 ENSG00000253710 HGNC:32456 ALG12 gene ALG12 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Congenital disorder of glycosylation, type Ig 607143" 31481313 False 3 100;0;0 21.569 True ENSG00000182858 ENSG00000182858 HGNC:19358 ALG13 gene ALG13 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Congenital disorder of glycosylation, type Is (MIM# 300884) 22492991;28887793;26138355;31444733;23033978;23934111;24781210;24896178;25732998;26138355;26482601;28940310;32238909 False 3 67;33;0 21.569 True ENSG00000101901 ENSG00000101901 HGNC:30881 ALG13 gene ALG13 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Congenital disorder of glycosylation, type Is (MIM# 300884) 23033978;23934111;24781210;24896178;25732998;26138355;26482601;28940310;32238909 False 3 100;0;0 21.569 True ENSG00000101901 ENSG00000101901 HGNC:30881 ALG14 gene ALG14 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal intellectual developmental disorder with epilepsy, behavioral abnormalities, and coarse facies (IDDEBF), MIM#619031;Myopathy, epilepsy, and progressive cerebral atrophy, MIM# 619036 30221345, 23404334, 28733338, 33751823, 34971077 False 3 100;0;0 21.569 True ENSG00000172339 ENSG00000172339 HGNC:28287 ALG14 gene ALG14 Expert list;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 15, without tubular aggregates 616227;Intellectual developmental disorder with epilepsy, behavioral abnormalities, and coarse facies (IDDEBF), MIM#619031;Myopathy, epilepsy, and progressive cerebral atrophy, MIM# 619036;Disorder of N-glycosylation 30221345, 23404334, 28733338, 33751823, 34971077 False 3 100;0;0 21.569 True ENSG00000172339 ENSG00000172339 HGNC:28287 ALG2 gene ALG2 Expert Review Green;NHS GMS;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 14, with tubular aggregates, MIM# 616228;Congenital disorder of glycosylation, type Ii, MIM# 607906 (PMID:12684507;28733338;28007376) False 3 33;0;67 21.569 True ENSG00000119523 ENSG00000119523 HGNC:23159 ALG2 gene ALG2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ii (MIM# 607906) 12684507;23404334;24461433 False 3 50;0;50 21.569 True ENSG00000119523 ENSG00000119523 HGNC:23159 ALG3 gene ALG3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Id, MIM# 601110 31067009 False 3 100;0;0 21.569 True ENSG00000214160 ENSG00000214160 HGNC:23056 ALG3 gene ALG3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Id, MIM# 601110 31067009 False 3 100;0;0 21.569 True ENSG00000214160 ENSG00000214160 HGNC:23056 ALG6 gene ALG6 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ic (MIM#603147) 10914684;27498540 False 3 100;0;0 21.569 True ENSG00000088035 ENSG00000088035 HGNC:23157 ALG6 gene ALG6 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ic (MIM#603147) 10914684;27498540 False 3 100;0;0 21.569 True ENSG00000088035 ENSG00000088035 HGNC:23157 ALG8 gene ALG8 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ih, MIM# 608104 26066342;35716054 False 3 100;0;0 21.569 True ENSG00000159063 ENSG00000159063 HGNC:23161 ALG8 gene ALG8 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ih, MIM# 608104 26066342 False 3 100;0;0 21.569 True ENSG00000159063 ENSG00000159063 HGNC:23161 ALG9 gene ALG9 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Il, MIM#608776;Gillessen-Kaesbach-Nishimura syndrome, MIM# 263210 28932688;25966638;26453364 False 3 100;0;0 21.569 True ENSG00000086848 ENSG00000086848 HGNC:15672 ALG9 gene ALG9 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Il, MIM#608776 28932688 False 3 100;0;0 21.569 True ENSG00000086848 ENSG00000086848 HGNC:15672 ALKBH8 gene ALKBH8 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder, autosomal recessive 71, MIM# 618504" 31079898 False 3 0;100;0 21.569 True ENSG00000137760 ENSG00000137760 HGNC:25189 ALPK1 gene ALPK1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "ROSAH syndrome, MIM# 614979" False 3 100;0;0 21.569 True ENSG00000073331 ENSG00000073331 HGNC:20917 ALPL gene ALPL Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypophosphatasia, adult 146300 (AD, AR);Hypophosphatasia, childhood 241510 AR;Hypophosphatasia, infantile 241500 AR;Odontohypophosphatasia 146300 AD, AR 19500388;23688511;3174660;1409720 False 3 100;0;0 21.569 True Other ENSG00000162551 ENSG00000162551 HGNC:438 ALPL gene ALPL Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypophosphatasia;disorder of bone metabolism 3174660;1409720 False 3 100;0;0 21.569 True ENSG00000162551 ENSG00000162551 HGNC:438 ALS2 gene ALS2 ClinGen;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ALS2-related motor neuron disease, MONDO:0100227 30128655, 33409823, 11586298, 16240357, 23282280, 24562058, 33155358 False 3 100;0;0 21.569 True ENSG00000003393 ENSG00000003393 HGNC:443 ALS2 gene ALS2 ClinGen;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ALS2-related motor neuron disease, MONDO:0100227 30128655, 33409823, 11586298, 16240357, 23282280, 24562058, 33155358 False 3 100;0;0 21.569 True ENSG00000003393 ENSG00000003393 HGNC:443 AMACR gene AMACR Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 4, MIM# 214950;Alpha-methylacyl-CoA racemase deficiency, MIM# 614307 35641312;35428665 False 3 100;0;0 21.569 True ENSG00000242110 ENSG00000242110 HGNC:451 AMACR gene AMACR Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000242110 ENSG00000242110 HGNC:451 AMACR gene AMACR Expert Review Green;Expert Review;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alpha-methylacyl-CoA racemase deficiency, MIM# 614307 35428665;21576695;11060344;21686617 False 3 100;0;0 21.569 True ENSG00000242110 ENSG00000242110 HGNC:451 AMACR gene AMACR Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alpha-methylacyl-CoA racemase deficiency (MIM#614307);Retinopathy, myelopathy, axonal or SNCV neuropathy, elevated phytanic and pristanic acids 36108118;10655068;20821052;18032455 False 3 100;0;0 21.569 True ENSG00000242110 ENSG00000242110 HGNC:451 AMFR gene AMFR Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 89, autosomal recessive, MIM# 620379 37119330 False 3 100;0;0 21.569 True ENSG00000159461 ENSG00000159461 HGNC:463 AMPD2 gene AMPD2 Expert Review Green;Other;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 9, MIM#615809 23911318;27066553 False 3 100;0;0 21.569 True ENSG00000116337 ENSG00000116337 HGNC:469 AMT gene AMT Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycine encephalopathy MIM#605899;disorder of glycine metabolism 8188235;10873393;11592811 False 3 100;0;0 21.569 True ENSG00000145020 ENSG00000145020 HGNC:473 AMT gene AMT Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycine encephalopathy MIM#605899;disorder of glycine metabolism 8188235;10873393;11592811 False 3 100;0;0 21.569 True ENSG00000145020 ENSG00000145020 HGNC:473 ANGPTL6 gene ANGPTL6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral aneurysm 29304371;33106390 False 3 100;0;0 21.569 True ENSG00000130812 ENSG00000130812 HGNC:23140 ANK2 gene ANK2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Complex neurodevelopmental disorder, MONDO:0100038, ANK2-related PMID:37195288 False 3 100;0;0 21.569 True ENSG00000145362 ENSG00000145362 HGNC:493 ANKRD11 gene ANKRD11 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted KBG syndrome, MIM#148050 29565525;30182498 False 3 100;0;0 21.569 True ENSG00000167522 ENSG00000167522 HGNC:21316 ANKRD17 gene ANKRD17 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chopra-Amiel-Gordan syndrome, MIM# 619504;Intellectual disability;dysmorphic features 33909992 False 3 50;50;0 21.569 True ENSG00000132466 ENSG00000132466 HGNC:23575 ANO10 gene ANO10 Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 10 MIM#613728 False 3 100;0;0 21.569 True ENSG00000160746 ENSG00000160746 HGNC:25519 ANO3 gene ANO3 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 24, 615034;familial form of cranio-cervical dystonia 33388357 False 3 100;0;0 21.569 False ENSG00000134343 ENSG00000134343 HGNC:14004 ANO4 gene ANO4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, ANO4-related 38744284 False 3 100;0;0 21.569 True ENSG00000151572 ENSG00000151572 HGNC:23837 ANO5 gene ANO5 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Miyoshi muscular dystrophy 3 613319;Muscular dystrophy, limb-girdle, type 2L 611307 23193613 False 3 100;0;0 21.569 True ENSG00000171714 ENSG00000171714 HGNC:27337 ANO5 gene ANO5 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2L, 611307;Miyoshi muscular dystrophy 3, 613319 20096397;32399949 False 3 100;0;0 21.569 True ENSG00000171714 ENSG00000171714 HGNC:27337 ANXA11 gene ANXA11 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amytrophic lateral sclerosis 23 MIM#617839 28469040;29845112;30109997 False 3 100;0;0 21.569 False ENSG00000122359 ENSG00000122359 HGNC:535 ANXA11 gene ANXA11 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis type 23 MONDO:0027694 36458208;39755715;38896345;38896262 False 3 100;0;0 21.569 True Other ENSG00000122359 ENSG00000122359 HGNC:535 AP1G1 gene AP1G1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Usmani-Riazuddin syndrome, autosomal dominant, MIM# 619467;Usmani-Riazuddin syndrome, autosomal recessive, MIM# 619548;Neurodevelopmental disorder (NDD);Intellectual Disability;Epilepsy 34102099 False 3 100;0;0 21.569 True ENSG00000166747 ENSG00000166747 HGNC:555 AP1S1 gene AP1S1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal MEDNIK Syndrome (MONDO:0012251, MIM#609313);Congenital-onset, Mental retardation, Enteropathy (severe congenital diarrhoea), Deafness, sensory-motor Neuropathy with intermediate conduction velocities, Ichthyosis, Keratoderma 30244301;23423674 False 3 50;50;0 21.569 True ENSG00000106367 ENSG00000106367 HGNC:559 AP1S1 gene AP1S1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal MEDNIK syndrome MONDO:0012251;Disorders of copper metabolism 31399000 False 3 0;0;0 21.569 False ENSG00000106367 ENSG00000106367 HGNC:559 AP1S2 gene AP1S2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Pettigrew syndrome, MIM# 304340 19161147;17617514 False 3 100;0;0 21.569 True ENSG00000182287 ENSG00000182287 HGNC:560 AP1S2 gene AP1S2 Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Pettigrew syndrome, MIM# 304340 False 3 100;0;0 21.569 True ENSG00000182287 ENSG00000182287 HGNC:560 AP2M1 gene AP2M1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder 60 with seizures, MIM# 618587" 31104773 False 3 100;0;0 21.569 True ENSG00000161203 ENSG00000161203 HGNC:564 AP2S1 gene AP2S1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, AP2S1-related 31981491;33057194;35982160;35982159 False 3 100;0;0 21.569 True ENSG00000042753 ENSG00000042753 HGNC:565 AP3B2 gene AP3B2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Early-onset epileptic encephalopathy with optic atrophy, MIM#617276 27889060 False 3 100;0;0 21.569 True ENSG00000103723 ENSG00000103723 HGNC:567 AP4B1 gene AP4B1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 47, autosomal recessive MIM#614066" 29193663 False 3 100;0;0 21.569 True ENSG00000134262 ENSG00000134262 HGNC:572 AP4B1 gene AP4B1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 47, autosomal recessive, 614066 21620353;22290197;24700674;24781758;32979048;32171285;32166732;31525725;31525725 False 3 100;0;0 21.569 True ENSG00000134262 ENSG00000134262 HGNC:572 AP4B1 gene AP4B1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 47, autosomal recessive, MIM# 614066 21620353;22290197;24700674;24781758;32166732 False 3 100;0;0 21.569 True ENSG00000134262 ENSG00000134262 HGNC:572 AP4E1 gene AP4E1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 51, autosomal recessive, 613744 20972249;21620353;21937992;32979048;23472171 False 3 100;0;0 21.569 True ENSG00000081014 ENSG00000081014 HGNC:573 AP4M1 gene AP4M1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 50, autosomal recessive, 612936 19559397;21937992;21937992;32979048;31915823;29096665;28464862;25496299 False 3 100;0;0 21.569 True ENSG00000221838 ENSG00000221838 HGNC:574 AP4S1 gene AP4S1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal developmental delay;Spastic paraplegia 52, autosomal recessive, 614067;seizures 21620353;25552650;32979048;32216065;31915823;30283821;27444738 False 3 100;0;0 21.569 True ENSG00000100478 ENSG00000100478 HGNC:575 AP5B1 gene AP5B1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related 40081374 False 3 50;50;0 21.569 True ENSG00000254470 ENSG00000254470 HGNC:25104 AP5M1 gene AP5M1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary macular dystrophy MONDO:0020242, AP-5 complex-related 40081374 False 3 100;0;0 21.569 False ENSG00000053770 ENSG00000053770 HGNC:20192 AP5Z1 gene AP5Z1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of autophagy;hereditary spastic paraplegia MONDO:0019064 26085577;29884839 False 3 100;0;0 21.569 True ENSG00000242802 ENSG00000242802 HGNC:22197 AP5Z1 gene AP5Z1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 48, autosomal recessive, MIM# 613647" 26085577 False 3 50;50;0 21.569 True ENSG00000242802 ENSG00000242802 HGNC:22197 APC2 gene APC2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cortical dysplasia, complex, with other brain malformations 10, MIM#618677 31585108 False 3 100;0;0 21.569 True ENSG00000115266 ENSG00000115266 HGNC:24036 APOA1 gene APOA1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyloidosis, 3 or more types 105200;Renal failure, Axonal sensory-motor neuropathy, amyloid nephropathy" False 3 100;0;0 21.569 True ENSG00000118137 ENSG00000118137 HGNC:600 APOPT1 gene APOPT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 17, MIM#619061 25175347 False 3 100;0;0 21.569 True ENSG00000256053 ENSG00000256053 HGNC:20492 APOPT1 gene APOPT1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, MIM# 220110 25175347 False 3 100;0;0 21.569 True ENSG00000256053 ENSG00000256053 HGNC:20492 APP gene APP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease MONDO:0007088 20301340;1671712;1678058;1908231;1302033 False 3 100;0;0 21.569 True Other ENSG00000142192 ENSG00000142192 HGNC:620 APP gene APP Other;Expert Review Green;Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted early-onset autosomal dominant Alzheimer disease MONDO:0015140 36845656 False 3 100;0;0 21.569 False ENSG00000142192 ENSG00000142192 HGNC:620 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-oculomotor apraxia type 1;Dystonia 15876520 False 3 100;0;0 21.569 True ENSG00000137074 ENSG00000137074 HGNC:15984 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia (MIM#208920) 11586299 False 3 100;0;0 21.569 True ENSG00000137074 ENSG00000137074 HGNC:15984 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminaemia MIM#208920 30986824;26256098;11586299 False 3 100;0;0 21.569 True ENSG00000137074 ENSG00000137074 HGNC:15984 APTX gene APTX Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia MIM#208920 30986824;26256098 False 3 100;0;0 21.569 True ENSG00000137074 ENSG00000137074 HGNC:15984 ARF1 gene ARF1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Periventricular nodular heterotopia 8, MIM# 618185 28868155;34353862 False 3 100;0;0 21.569 True ENSG00000143761 ENSG00000143761 HGNC:652 ARF3 gene ARF3 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder (MONDO:0700092), ARF3-related;Global developmental delay;Intellectual disability;Seizures;Morphological abnormality of the central nervous system 34346499;36369169 False 3 33;67;0 21.569 True ENSG00000134287 ENSG00000134287 HGNC:654 ARFGEF1 gene ARFGEF1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay, impaired speech, and behavioral abnormalities, MIM# 619964 34113008 False 3 100;0;0 21.569 True ENSG00000066777 ENSG00000066777 HGNC:15772 ARFGEF2 gene ARFGEF2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Periventricular heterotopia with microcephaly (MIM#608097) 25160555;26126837;23812912 False 3 100;0;0 21.569 True ENSG00000124198 ENSG00000124198 HGNC:15853 ARG1 gene ARG1 NHS GMS;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Argininemia, 207800 2365823;29726057 False 3 100;0;0 21.569 True ENSG00000118520 ENSG00000118520 HGNC:663 ARG1 gene ARG1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Argininemia MIM#207800;Urea cycle disorders and inherited hyperammonaemias;disorder of arginine metabolism 2365823;1598908;29726057 False 3 100;0;0 21.569 True ENSG00000118520 ENSG00000118520 HGNC:663 ARG1 gene ARG1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive spastic tetraplegia;Argininaemia, 207800 29726057 False 3 100;0;0 21.569 True ENSG00000118520 ENSG00000118520 HGNC:663 ARHGAP19 gene ARHGAP19 Literature;Literature;Expert Review Green;Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2KK, MIM# 621466 41086021 False 3 100;0;0 21.569 False ENSG00000213390 ENSG00000213390 HGNC:23724 ARHGEF9 gene ARHGEF9 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Epileptic encephalopathy, early infantile, 8, MIM# 300607 31942680;30048823;29130122;28620718 False 3 100;0;0 21.569 True ENSG00000131089 ENSG00000131089 HGNC:14561 ARID1A gene ARID1A Expert Review Green;Expert Review;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 2 #614607 (PMID:34942405;25168959;33303725;35571021;23906836;23929686) False 3 100;0;0 21.569 True ENSG00000117713 ENSG00000117713 HGNC:11110 ARID1B gene ARID1B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 1 MIM#135900 False 3 100;0;0 21.569 True ENSG00000049618 ENSG00000049618 HGNC:18040 ARL13B gene ARL13B Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 8, MIM# 612291" False 3 100;0;0 21.569 True ENSG00000169379 ENSG00000169379 HGNC:25419 ARL6IP1 gene ARL6IP1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 61, autosomal recessive, MIM#615685 24482476;31272422;30980493;28471035 False 3 100;0;0 21.569 True ENSG00000170540 ENSG00000170540 HGNC:697 ARL6IP1 gene ARL6IP1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Childhood-onset spastic paraplegia with mutilating, sensory>motor axonal neuropathy False 3 100;0;0 21.569 True ENSG00000170540 ENSG00000170540 HGNC:697 ARSA gene ARSA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM#250100 False 3 100;0;0 21.569 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSA gene ARSA Expert Review Green;Literature;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy - # 250100;Arylsulfatase A deficiency (PMID: 33195324;10987380;37359369;20301309;36324388;19021637) False 3 100;0;0 21.569 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSA gene ARSA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM# 250100;MONDO:0009591 False 3 100;0;0 21.569 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSA gene ARSA Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic Leukodystrophy, 250100;Metachromatic leukodystrophy (#250100) False 3 100;0;0 21.569 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSA gene ARSA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM# 250100, adult-onset 29486463;26890752;15710861 False 3 100;0;0 21.569 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSA gene ARSA Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM# 250100;Severe late infantile form with mental retardation and severe course. Regression before 30 months;adult-onset, psychiatric symptoms, leukodystrophy on MRI, progressive neuropathy with SNCV, optic atrophy False 3 100;0;0 21.569 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSA gene ARSA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Metachromatic leukodystrophy, MIM# 250100" False 3 100;0;0 21.569 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSB gene ARSB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type VI (Maroteaux-Lamy), MIM# 253200;MONDO:0009661 11668612 False 3 100;0;0 21.569 True ENSG00000113273 ENSG00000113273 HGNC:714 ARSE gene ARSE Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Chondrodysplasia punctata, X-linked recessive (MIM#302950) 23470839 False 3 0;100;0 21.569 True ENSG00000157399 ENSG00000157399 HGNC:719 ARSK gene ARSK Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis MONDO:0019249, ARSK-related 34916232;32856704 False 3 100;0;0 21.569 True ENSG00000164291 ENSG00000164291 HGNC:25239 ARV1 gene ARV1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Developmental and epileptic encephalopathy 38, MIM# 617020" 35227294;27270415;25558065 False 3 100;0;0 21.569 True ENSG00000173409 ENSG00000173409 HGNC:29561 ARX gene ARX Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Epileptic encephalopathy, early infantile, 1 MIM#308350;Hydranencephaly with abnormal genitalia MIM#300215;Lissencephaly, X-linked 2 MIM#300215;Mental retardation, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510;Proud syndrome MIM#300004 14722918;19738637;32519823;28150386;21496008 False 3 100;0;0 21.569 True ENSG00000004848 ENSG00000004848 HGNC:18060 ARX gene ARX Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Partington syndrome, MIM# 309510;Dystonia 11889467;15200506 False 3 100;0;0 21.569 True Other ENSG00000004848 ENSG00000004848 HGNC:18060 ASAH1 gene ASAH1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with progressive myoclonic epilepsy;dHMN/dSMA False 3 100;0;0 21.569 False ENSG00000104763 ENSG00000104763 HGNC:735 ASAH1 gene ASAH1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Farber lipogranulomatosis, MIM# 228000 False 3 100;0;0 21.569 True ENSG00000104763 ENSG00000104763 HGNC:735 ASAH1 gene ASAH1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with progressive myoclonic epilepsy, 159950 8955159;22703880;27026573 False 3 100;0;0 21.569 True ENSG00000104763 ENSG00000104763 HGNC:735 ASCC1 gene ASCC1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 2 26924529 False 3 100;0;0 21.569 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASCC1 gene ASCC1 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spinal muscular atrophy with congenital bone fractures 2 (MONDO:0014807;MIM#616867) 26924529;28218388 False 3 100;0;0 21.569 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASH1L gene ASH1L Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 52, MIM#617796 34373061;25961944;34782621;32469098 False 3 100;0;0 21.569 True ENSG00000116539 ENSG00000116539 HGNC:19088 ASL gene ASL Expert Review Green;NHS GMS;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Argininosuccinic aciduria MIM#207900;Urea cycle disorders and inherited hyperammonaemias;disorder of amino acid metabolism 2263616;12384776 False 3 100;0;0 21.569 True ENSG00000126522 ENSG00000126522 HGNC:746 ASNS gene ASNS Expert Review Green;Expert Review Green;Literature;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Asparagine synthetase deficiency, MIM#615574;microcephaly;cerebral atrophy;drug-resistant epilepsy;axial hypotonia;progressive appendicular spasticity;abnormal myelination 24139043;25227173;29279279;27469131;28776279;29375865;26318253 False 3 100;0;0 21.569 True Other ENSG00000070669 ENSG00000070669 HGNC:753 ASPA gene ASPA Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Canavan disease MIM#271900;disorder of amino acid metabolism 8252036;8023850 False 3 100;0;0 21.569 True ENSG00000108381 ENSG00000108381 HGNC:756 ASPA gene ASPA Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Canavan disease MIM#271900;disorder of amino acid metabolism 8252036;8023850 False 3 100;0;0 21.569 True ENSG00000108381 ENSG00000108381 HGNC:756 ASPA gene ASPA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Canavan disease, MIM# 271900" False 3 100;0;0 21.569 True ENSG00000108381 ENSG00000108381 HGNC:756 ASPM gene ASPM Expert Review Green;ClinGen;Literature;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Primary autosomal recessive Microcephaly 5 - OMIM #608716 (PMID:32239881;19770472;18452193;16141009) False 3 100;0;0 21.569 True ENSG00000066279 ENSG00000066279 HGNC:19048 ASS1 gene ASS1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Citrullinemia MIM#215700;Urea cycle disorders and inherited hyperammonaemias;disorder of amino acid metabolism 19006241 False 3 100;0;0 21.569 True ENSG00000130707 ENSG00000130707 HGNC:758 ASTN1 gene ASTN1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual disability;epilepsy;structural brain malformations 29706646;27431290;26539891 False 3 100;0;0 21.569 True ENSG00000152092 ENSG00000152092 HGNC:773 ASXL3 gene ASXL3 Expert Review Green;Literature;ClinGen;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bainbridge-Ropers syndrome, OMIM:615115 PMID:33151654;34436830;29367179 False 3 100;0;0 21.569 True ENSG00000141431 ENSG00000141431 HGNC:29357 ATAD1 gene ATAD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperekplexia 4, MIM#618011 28180185;29390050;29659736 False 3 100;0;0 21.569 True ENSG00000138138 ENSG00000138138 HGNC:25903 ATAD3A gene ATAD3A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Harel-Yoon syndrome, MIM# 617183 28158749;27640307 False 3 100;0;0 21.569 True ENSG00000197785 ENSG00000197785 HGNC:25567 ATAD3A gene ATAD3A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Global developmental delay, optic atrophy, axonal neuropathy, hypertrophic cardiomyopathy False 3 100;0;0 21.569 False ENSG00000197785 ENSG00000197785 HGNC:25567 ATAD3A gene ATAD3A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Harel-Yoon syndrome, MIM# 617183;Pontocerebellar hypoplasia, hypotonia, and respiratory insufficiency syndrome, neonatal lethal (PHRINL SYNDROME), MIM# 618810 27640307;32004445;28549128 False 3 100;0;0 21.569 True Other ENSG00000197785 ENSG00000197785 HGNC:25567 ATCAY gene ATCAY Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, cerebellar, Cayman type, MIM# 601238;MONDO:0011025 14556008;29449188;23226316;26343454 False 3 50;50;0 21.569 True ENSG00000167654 ENSG00000167654 HGNC:779 ATG7 gene ATG7 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, SCAR31, MIM#619422 34161705 False 3 100;0;0 21.569 True ENSG00000197548 ENSG00000197548 HGNC:16935 ATIC gene ATIC Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal AICA-ribosiduria due to ATIC deficiency MIM#608688;disorders of purine metabolism 15114530;32557644 False 3 100;0;0 21.569 True ENSG00000138363 ENSG00000138363 HGNC:794 ATL1 gene ATL1 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown HSN1D;Neuropathy, hereditary sensory, type ID, 613708;Hereditary spastic paraplegia, 182600;Hereditary sensory neuropathy 21194679;22340599 False 3 0;0;0 21.569 False ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 3A, autosomal dominant MIM#182600 16765570 False 3 100;0;0 21.569 False ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hereditary sensory neuropathy type ID, MIM 613708;Spastic paraplegia 3A, MIM 182600;Hereditary spastic paraplegia, AR 16401858;16537571;17657515;28396731;24473461;26888483 False 3 100;0;0 21.569 True ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HSAN/SFN;Neuropathy, hereditary sensory, type ID , MIM#613708;MONDO:0013381 21194679;24604904;22340599 False 3 100;0;0 21.569 False ENSG00000198513 ENSG00000198513 HGNC:11231 ATL3 gene ATL3 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy type IF;HSAN/SFN 24459106;30666337;30339187;24736309 False 3 100;0;0 21.569 False ENSG00000184743 ENSG00000184743 HGNC:24526 ATL3 gene ATL3 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuropathy, hereditary sensory, type IF, 615632;HSN1F 24459106;24736309 False 3 0;0;0 21.569 False ENSG00000184743 ENSG00000184743 HGNC:24526 ATM gene ATM Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia telangiectasia;Dystonia False 3 100;0;0 21.569 False ENSG00000149311 ENSG00000149311 HGNC:795 ATM gene ATM Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia MIM#208900 False 3 100;0;0 21.569 True ENSG00000149311 ENSG00000149311 HGNC:795 ATN1 gene ATN1 Expert Review Green;Expert list;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital hypotonia, epilepsy, developmental delay, and digital anomalies, MIM#618494 30827498 False 3 100;0;0 21.569 True ENSG00000111676 ENSG00000111676 HGNC:3033 ATP11A gene ATP11A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, hypomyelinating, 24 , MIM# 619851 34403372;39432785 False 3 33;67;0 21.569 True Other ENSG00000068650 ENSG00000068650 HGNC:13552 ATP11A gene ATP11A Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Focal epilepsy MONDO:0005384, ATP11A;Leukodystrophy, hypomyelinating, 24 MIM#619851 34403372;39432785;40185629 False 3 50;50;0 21.569 True ENSG00000068650 ENSG00000068650 HGNC:13552 ATP13A2 gene ATP13A2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 21362476;21696388;31588715;32559632;33033738;33091395;34405108 False 3 100;0;0 21.569 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 78, autosomal recessive, 617225;Kufor-Rakeb syndrome, 606693 AR;complicated hereditary spastic paraplegia;Adult-onset lower-limb predominant spastic paraparesis 27217339;28137957 False 3 100;0;0 21.569 False ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 78, autosomal recessive 617225 28137957;31996848 False 3 100;0;0 21.569 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome, MIM# 606693 False 3 100;0;0 21.569 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal parkinsonism due to ATP13A2 deficiency MONDO:0017809 25900096;20301402 False 3 100;0;0 21.569 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome (OMIM 606693) 22743658;23447832;29325618;20310007 False 3 100;0;0 21.569 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 21094623;20853184;20310007 False 3 100;0;0 21.569 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 30868101;21362476;31588715;22388936 False 3 100;0;0 21.569 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP1A1 gene ATP1A1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;seizures;hypomagnesaemia 30388404 False 3 100;0;0 21.569 True ENSG00000163399 ENSG00000163399 HGNC:799 ATP1A1 gene ATP1A1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 2DD,MIM# 618036;MONDO:0054833 29499166 False 3 100;0;0 21.569 False ENSG00000163399 ENSG00000163399 HGNC:799 ATP1A2 gene ATP1A2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fetal akinesia, respiratory insufficiency, microcephaly, polymicrogyria, and dysmorphic facies, MIM# 619602 30690204 False 3 100;0;0 21.569 True ENSG00000018625 ENSG00000018625 HGNC:800 ATP1A2 gene ATP1A2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alternating hemiplegia of childhood 1, MIM# 104290 15174025;15286158;33126486;31766058;24097848 False 3 100;0;0 21.569 True ENSG00000018625 ENSG00000018625 HGNC:800 ATP1A2 gene ATP1A2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 98, MIM# 619605 33880529 False 3 100;0;0 21.569 True ENSG00000018625 ENSG00000018625 HGNC:800 ATP1A3 gene ATP1A3 Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 21.569 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 33880529, 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 21.569 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder MONDO:0700002 20301294;17282997;15260953;17595045;17516473;22534615 False 3 100;0;0 21.569 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert list;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 21.569 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert Review Green;Expert list;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 15260953;17282997;19351654, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 21.569 False ENSG00000105409 ENSG00000105409 HGNC:801 ATP2A1 gene ATP2A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brody myopathy, MIM# 601003 32040565 False 3 50;50;0 21.569 True ENSG00000196296 ENSG00000196296 HGNC:811 ATP2B1 gene ATP2B1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 66, MIM# 619910 PMID: 35358416 False 3 100;0;0 21.569 True ENSG00000070961 ENSG00000070961 HGNC:814 ATP2B2 gene ATP2B2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related PMID: 37675773 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157087 ENSG00000157087 HGNC:815 ATP2B2 gene ATP2B2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related PMID: 37675773 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157087 ENSG00000157087 HGNC:815 ATP2B2 gene ATP2B2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related PMID: 37675773 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157087 ENSG00000157087 HGNC:815 ATP2B3 gene ATP2B3 Expert Review Green;Expert list;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Spinocerebellar ataxia, X-linked 1 37821930;36207321;31680123;28807751;28720891;27653636;25953895 False 3 50;50;0 21.569 True ENSG00000067842 ENSG00000067842 HGNC:816 ATP5A1 gene ATP5A1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358);Combined oxidative phosphorylation deficiency 22 616045;Mitochondrial complex V (ATP synthase) deficiency nuclear type 4, 615228;Mitochondrial disorder, autosomal dominant 23599390;23596069;34483339;34954817;40672495 False 3 33;33;33 21.569 True ENSG00000152234 ENSG00000152234 HGNC:823 ATP5A1 gene ATP5A1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD 34483339;34954817;40859057 False 3 100;0;0 21.569 True ENSG00000152234 ENSG00000152234 HGNC:823 ATP5D gene ATP5D Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, MIM# 618120 29478781 False 3 100;0;0 21.569 True ENSG00000099624 ENSG00000099624 HGNC:837 ATP5E gene ATP5E Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, nuclear type 3 MIM#614053 20566710;27626380;20026007;34954817 False 3 50;50;0 21.569 True ENSG00000124172 ENSG00000124172 HGNC:838 ATP5G3 gene ATP5G3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Dystonia, early-onset, and/or spastic paraplegia, MIM# 619681" 34636445;34954817 False 3 100;0;0 21.569 True ENSG00000154518 ENSG00000154518 HGNC:843 ATP5G3 gene ATP5G3 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, early-onset, and/or spastic paraplegia, MIM#619681 34636445;34954817 False 3 100;0;0 21.569 True ENSG00000154518 ENSG00000154518 HGNC:843 ATP5G3 gene ATP5G3 Expert Review Green;Literature;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, early-onset, and/or spastic paraplegia, MIM#619681 34636445;34954817 False 3 100;0;0 21.569 True ENSG00000154518 ENSG00000154518 HGNC:843 ATP5O gene ATP5O Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, nuclear type 7, MIM# 620359 35621276;34954817 False 3 100;0;0 21.569 True ENSG00000241837 ENSG00000241837 HGNC:850 ATP5O gene ATP5O Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, nuclear type 7, MIM# 620359 34954817;35621276 False 3 100;0;0 21.569 True ENSG00000241837 ENSG00000241837 HGNC:850 ATP6AP1 gene ATP6AP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "immunodeficiency-47 (MIM# 300972)" PMID: 27231034 False 3 100;0;0 21.569 True ENSG00000071553 ENSG00000071553 HGNC:868 ATP6AP2 gene ATP6AP2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked, syndromic, Hedera type MIM#300423 23595882 False 3 100;0;0 21.569 True Other ENSG00000182220 ENSG00000182220 HGNC:18305 ATP6AP2 gene ATP6AP2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Congenital disorder of glycosylation, type IIr, MIM# 301045 29127204;29388887 False 3 100;0;0 21.569 True ENSG00000182220 ENSG00000182220 HGNC:18305 ATP6AP2 gene ATP6AP2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Parkinsonism with spasticity, X-linked, MIM# 300911" 30985297;23595882 False 3 100;0;0 21.569 True ENSG00000182220 ENSG00000182220 HGNC:18305 ATP6V0A1 gene ATP6V0A1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971 PMID:34909687 False 3 50;50;0 21.569 True ENSG00000033627 ENSG00000033627 HGNC:865 ATP6V0A1 gene ATP6V0A1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971 PMID:34909687 False 3 50;50;0 21.569 True ENSG00000033627 ENSG00000033627 HGNC:865 ATP6V0A2 gene ATP6V0A2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IIA, MIM# 219200;Wrinkly skin syndrome, MIM#278250 29952037;22773132 False 3 100;0;0 21.569 True ENSG00000185344 ENSG00000185344 HGNC:18481 ATP6V0A2 gene ATP6V0A2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cutis laxa, type IIA,219200 18157129;22773132 False 3 100;0;0 21.569 True ENSG00000185344 ENSG00000185344 HGNC:18481 ATP6V0C gene ATP6V0C Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, early-onset, with or without developmental delay, MIM#620465;Epilepsy;Intellectual Disability;microcephaly 33190975;33090716 False 3 50;50;0 21.569 True ENSG00000185883 ENSG00000185883 HGNC:855 ATP6V1A gene ATP6V1A Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epileptic encephalopathy, infantile or early childhood, 618012;Cutis laxa, type IID, 617403 29668857;28065471 False 3 100;0;0 21.569 True ENSG00000114573 ENSG00000114573 HGNC:851 ATP6V1B2 gene ATP6V1B2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy;Intellectual Disability;microcephaly, DOORS syndrome 31655144;32934366;32597767 False 3 100;0;0 21.569 True ENSG00000147416 ENSG00000147416 HGNC:854 ATP7A gene ATP7A Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Menkes disease MIM#309400;Occipital horn syndrome MIM#304150;disorder of copper matabolism 7842019;8981948 False 3 100;0;0 21.569 True ENSG00000165240 ENSG00000165240 HGNC:869 ATP7A gene ATP7A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Menkes disease, 309400 26937406;21924848;29789304 False 3 100;0;0 21.569 True ENSG00000165240 ENSG00000165240 HGNC:869 ATP7A gene ATP7A Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Menkes disease MIM#309400 False 3 100;0;0 21.569 True ENSG00000165240 ENSG00000165240 HGNC:869 ATP7A gene ATP7A Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Disorders of copper metabolism;Menkes disease MONDO:0010651, occipital Horn Syndrome (OHS, OMIM #304150), X-linked distal spinal muscular atrophy-3 (SMAX3, OMIM #300489) 20170900, 33137485, 31969342, 31558336 False 3 0;0;0 21.569 False ENSG00000165240 ENSG00000165240 HGNC:869 ATP7A gene ATP7A Royal Melbourne Hospital;NHS GMS;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;NHS GMS;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal muscular atrophy, distal, X-linked 3, MIM# 300489;dHMN/dSMA 20170900;33137485;31969342;31558336 False 3 100;0;0 21.569 False ENSG00000165240 ENSG00000165240 HGNC:869 ATP7B gene ATP7B Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease MIM#277900 17435591 False 3 50;50;0 21.569 True ENSG00000123191 ENSG00000123191 HGNC:870 ATP7B gene ATP7B Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease, MIM# 277900;Dystonia 32662046 False 3 100;0;0 21.569 True ENSG00000123191 ENSG00000123191 HGNC:870 ATP7B gene ATP7B NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 277900 WILSON DISEASE 24002824;18210110;27982432;28433102;24266916 False 3 0;0;0 21.569 False ENSG00000123191 ENSG00000123191 HGNC:870 ATP7B gene ATP7B Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease, MIM# 277900 False 3 100;0;0 21.569 True ENSG00000123191 ENSG00000123191 HGNC:870 ATP8A2 gene ATP8A2 Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268 22892528;31612321 False 3 100;0;0 21.569 True ENSG00000132932 ENSG00000132932 HGNC:13533 ATP8B1 gene ATP8B1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cholestasis, progressive familial intrahepatic 1 MIM#211600;disorder of bile acid metabolism 9500542 False 3 100;0;0 21.569 True ENSG00000081923 ENSG00000081923 HGNC:3706 ATP9A gene ATP9A Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with poor growth and behavioural abnormalities, MIM# 620242 34379057;34764295;36604604;40226306 False 3 100;0;0 21.569 True ENSG00000054793 ENSG00000054793 HGNC:13540 ATRX gene ATRX Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) ATR-X-related syndrome MONDO:0016980 False 3 100;0;0 21.569 True ENSG00000085224 ENSG00000085224 HGNC:886 AUH gene AUH Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-Methylglutaconic aciduria type 1;Dystonia False 3 100;0;0 21.569 True ENSG00000148090 ENSG00000148090 HGNC:890 AUH gene AUH Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type I, MIM# 250950 False 3 100;0;0 21.569 True ENSG00000148090 ENSG00000148090 HGNC:890 B3GALNT2 gene B3GALNT2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 11 MIM#615181 PMID: 29791932, PMID: 29273094, PMID: 35127920 False 3 100;0;0 21.569 True ENSG00000162885 ENSG00000162885 HGNC:28596 B3GALNT2 gene B3GALNT2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181;MONDO:0014071 23453667;33290285;29791932;29273094;28688748;28303321 False 3 100;0;0 21.569 True ENSG00000162885 ENSG00000162885 HGNC:28596 B3GALT6 gene B3GALT6 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Al-Gazali syndrome, MIM# 609465;Ehlers-Danlos syndrome, spondylodysplastic type, 2, MIM# 615349, MONDO:0014139;Spondyloepimetaphyseal dysplasia with joint laxity, type 1, with or without fractures, MIM# 271640, MONDO:0010075 25149931;29443383;23664117;29931299;23664117;23664118;31614862 False 3 100;0;0 21.569 True ENSG00000176022 ENSG00000176022 HGNC:17978 B3GAT3 gene B3GAT3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects, MIM# 245600 26754439;31988067;26086840;25893793;21763480;24668659 False 3 100;0;0 21.569 True ENSG00000149541 ENSG00000149541 HGNC:923 B3GLCT gene B3GLCT Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peters-plus syndrome (MIM# 261540) 18199743;16909395 False 3 100;0;0 21.569 True ENSG00000187676 ENSG00000187676 HGNC:20207 B4GALNT1 gene B4GALNT1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 26, autosomal recessive MIM#609195 False 3 100;0;0 21.569 True ENSG00000135454 ENSG00000135454 HGNC:4117 B4GALNT1 gene B4GALNT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 26, autosomal recessive (MIM #609195) 23746551;24103911 False 3 100;0;0 21.569 True ENSG00000135454 ENSG00000135454 HGNC:4117 B4GALT1 gene B4GALT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 21.569 True ENSG00000086062 ENSG00000086062 HGNC:924 B4GALT7 gene B4GALT7 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, spondylodysplastic type, 1, 130070 23956117;24755949;31278392;31614862;31862401 False 3 100;0;0 21.569 True ENSG00000027847 ENSG00000027847 HGNC:930 BAAT gene BAAT Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bile acid conjugation defect 1, MIM# 619232;Hypercholanemia, familial MIM#607748;disorder of bile acid metabolism 12704386;23415802 False 3 100;0;0 21.569 True ENSG00000136881 ENSG00000136881 HGNC:932 BAG3 gene BAG3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, myofibrillar, 6 612954 PMID: 25208129;22734908;30061062 False 3 100;0;0 21.569 True ENSG00000151929 ENSG00000151929 HGNC:939 BAIAP2 gene BAIAP2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 120, MIM# 621468 41133935;38149472 False 3 100;0;0 21.569 True ENSG00000175866 ENSG00000175866 HGNC:947 BAP1 gene BAP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Kury-Isidor syndrome , MIM#619762" PMID: 35051358 False 3 100;0;0 21.569 True ENSG00000163930 ENSG00000163930 HGNC:950 BBS1 gene BBS1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 1, 209900 15637713 False 3 100;0;0 21.569 True ENSG00000174483 ENSG00000174483 HGNC:966 BCAP31 gene BCAP31 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Deafness, dystonia and cerebellar hypomyelination, MIM#300475 24011989;28332767;30713915;31330203;32652807 False 3 100;0;0 21.569 True ENSG00000185825 ENSG00000185825 HGNC:16695 BCAP31 gene BCAP31 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Deafness, dystonia, and cerebral hypomyelination, 300475 False 3 100;0;0 21.569 False ENSG00000185825 ENSG00000185825 HGNC:16695 BCAS3 gene BCAS3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hengel-Maroofian-Schols syndrome, MIM# 619641 34022130 False 3 100;0;0 21.569 True ENSG00000141376 ENSG00000141376 HGNC:14347 BCAS3 gene BCAS3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hengel-Maroofian-Schols syndrome, MIM# 619641 34022130 False 3 100;0;0 21.569 True ENSG00000141376 ENSG00000141376 HGNC:14347 BCAS3 gene BCAS3 Expert Review Green;Literature;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hengel-Maroofian-Schols syndrome, MIM# 619641 34981858 False 3 100;0;0 21.569 True ENSG00000141376 ENSG00000141376 HGNC:14347 BCKDHA gene BCKDHA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Maple syrup urine disease, type Ia, MIM# 248600 34883003;34556729;34288399 False 3 100;0;0 21.569 True ENSG00000248098 ENSG00000248098 HGNC:986 BCKDHB gene BCKDHB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Maple syrup urine disease, type Ib, MIM# 248600 34883003;34556729;34288399 False 3 100;0;0 21.569 True ENSG00000083123 ENSG00000083123 HGNC:987 BCKDHB gene BCKDHB Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Maple Syrup Urine Disease, Metabolic encephalopathy, elevated branched chain amino acids in urine, acute axonal neuropathy False 3 100;0;0 21.569 True ENSG00000083123 ENSG00000083123 HGNC:987 BCKDHB gene BCKDHB Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Episodic ataxia during metabolic crises;paroxysmal nonkinesigenic dyskinesia PMID 32151765 False 3 0;0;0 21.569 True ENSG00000083123 ENSG00000083123 HGNC:987 BCKDK gene BCKDK Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Branched-chain keto acid dehydrogenase kinase deficiency MIM#614923" PMID: 22956686, PMID: 35216372, PMID: 36729635 False 3 100;0;0 21.569 True ENSG00000103507 ENSG00000103507 HGNC:16902 BCS1L gene BCS1L Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III disorders;Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000074582 ENSG00000074582 HGNC:1020 BCS1L gene BCS1L Expert Review Green;Literature;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bjornstad syndrome, MIM# 262000;Leigh syndrome, MIM# 256000;BCS1L-related mitochondrial disease 26563427;24172246;17314340;9545407 False 3 100;0;0 21.569 True ENSG00000074582 ENSG00000074582 HGNC:1020 BCS1L gene BCS1L Expert Review Green;Literature;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bjornstad syndrome, MIM# 262000;Leigh syndrome, MIM# 256000;BCS1L-related mitochondrial disease 24172246;17314340;9545407 False 3 100;0;0 21.569 True ENSG00000074582 ENSG00000074582 HGNC:1020 BICD2 gene BICD2 Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted distal myopathy MONDO:0018949 27784775;28635954;31561939;29306765 False 3 100;0;0 21.569 True ENSG00000185963 ENSG00000185963 HGNC:17208 BICD2 gene BICD2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM# 615290;MONDO:0014121;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, MIM# 618291;dHMN/dSMA 23664116;23664119;23664120;27751653;28635954;30054298;29528393 False 3 100;0;0 21.569 False ENSG00000185963 ENSG00000185963 HGNC:17208 BLOC1S1 gene BLOC1S1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO:0700092), BLOC1S1-related https://www.medrxiv.org/content/10.1101/2025.07.17.25331211v1 False 3 100;0;0 21.569 True ENSG00000135441 ENSG00000135441 HGNC:4200 BLOC1S1 gene BLOC1S1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO:0700092), BLOC1S1-related 33875846;https://www.medrxiv.org/content/10.1101/2025.07.17.25331211v1 False 3 100;0;0 21.569 True ENSG00000135441 ENSG00000135441 HGNC:4200 BOLA3 gene BOLA3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia, MIM# 614299 30302924;29654549;30302924 False 3 100;0;0 21.569 True ENSG00000163170 ENSG00000163170 HGNC:24415 BOLA3 gene BOLA3 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia, MIM#614299 30302924;29654549;30302924 False 3 100;0;0 21.569 True ENSG00000163170 ENSG00000163170 HGNC:24415 BOLA3 gene BOLA3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 2 with hyperglycinemia, MIM# 614299 30302924;29654549;30302924 False 3 100;0;0 21.569 True ENSG00000163170 ENSG00000163170 HGNC:24415 BORCS5 gene BORCS5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lysosomal storage disease, MONDO:0002561, BORCS5-related 40385417 False 3 100;0;0 21.569 True ENSG00000165714 ENSG00000165714 HGNC:17950 BORCS5 gene BORCS5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lysosomal storage disease, MONDO:0002561, BORCS5-related 40385417 False 3 100;0;0 21.569 True ENSG00000165714 ENSG00000165714 HGNC:17950 BORCS8 gene BORCS8 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, infantile-onset, with optic atrophy and brain abnormalities, MIM# 620987 38128568 False 3 100;0;0 21.569 True ENSG00000254901 ENSG00000254901 HGNC:37247 BPTF gene BPTF Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dysmorphic facies and distal limb anomalies AD, MIM#617755 33522091;28942966 False 3 100;0;0 21.569 True ENSG00000171634 ENSG00000171634 HGNC:3581 BRAF gene BRAF Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiofaciocutaneous syndrome, MIM# 115150 34309696 False 3 100;0;0 21.569 True ENSG00000157764 ENSG00000157764 HGNC:1097 BRAT1 gene BRAT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056 26483087;26494257;27282546 False 3 100;0;0 21.569 True ENSG00000106009 ENSG00000106009 HGNC:21701 BRAT1 gene BRAT1 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056 26483087;26494257;27282546 False 3 100;0;0 21.569 True ENSG00000106009 ENSG00000106009 HGNC:21701 BRSK1 gene BRSK1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, BRSK1-related 41035394 False 3 100;0;0 21.569 True ENSG00000160469 ENSG00000160469 HGNC:18994 BSCL2 gene BSCL2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuropathy, distal hereditary motor, type VC, MIM# 619112 14981520;15732094 False 3 100;0;0 21.569 False ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Silver spastic paraplegia syndrome MIM#270685;Neuropathy, distal hereditary motor, type VA MIM#600794 16765570 False 3 100;0;0 21.569 False ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Silver spastic paraplegia syndrome MIM#270685;Encephalopathy, progressive, with or without lipodystrophy MIM#615924" False 3 100;0;0 21.569 True ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Encephalopathy, progressive, with or without lipodystrophy, MIM#615924;Developmental and epileptic encephalopathy, BSCL2-related, dominant, MONDO:0100062 11479539;15181077;15126564;23564749;31369919;35290466 False 3 100;0;0 21.569 True ENSG00000168000 ENSG00000168000 HGNC:15832 BSN gene BSN Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO:0700092), BSN-related False 3 100;0;0 21.569 True ENSG00000164061 ENSG00000164061 HGNC:1117 BTD gene BTD Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Biotinidase deficiency, MIM 253260 10801053;12359137;7550325 False 3 100;0;0 21.569 True ENSG00000169814 ENSG00000169814 HGNC:1122 BTD gene BTD Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Biotinidase deficiency MIM#253260;disorder of biotin metabolism 7550325 False 3 100;0;0 21.569 True ENSG00000169814 ENSG00000169814 HGNC:1122 BVES gene BVES Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 25 616812 26642364 32528171 31119192 False 3 100;0;0 21.569 True ENSG00000112276 ENSG00000112276 HGNC:1152 C12orf57 gene C12orf57 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Temtamy syndrome MIM#218340 29383837;31853307 False 3 100;0;0 21.569 True ENSG00000111678 ENSG00000111678 HGNC:29521 C12orf65 gene C12orf65 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 55, autosomal recessive, 615035;optic atrophy and spasticity, tibial muscle weakness and atrophy, peripheral neuropathy;Combined oxidative phosphorylation deficiency 7, 613559 23188110;24080142;24198383 False 3 100;0;0 21.569 True ENSG00000130921 ENSG00000130921 HGNC:26784 C12orf65 gene C12orf65 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 55, autosomal recessive, MIM#615035;Combined oxidative phosphorylation deficiency 7, MIM# 613559 23188110;24080142;24198383;20598281;32808965;32478789;28804760 False 3 100;0;0 21.569 True ENSG00000130921 ENSG00000130921 HGNC:26784 C12orf65 gene C12orf65 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 55, autosomal recessive, MIM#615035;HMSN 20301682;23188110;3479531;24198383 False 3 100;0;0 21.569 True ENSG00000130921 ENSG00000130921 HGNC:26784 C12orf66 gene C12orf66 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 83, MIM# 621100 PMID: 39824192 False 3 100;0;0 21.569 True ENSG00000174206 ENSG00000174206 HGNC:26517 C19orf12 gene C19orf12 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodegeneration with brain iron accumulation 4 MONDO:0013674 21981780;23278385;23447832 False 3 100;0;0 21.569 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 4, MIM# 614298 23278385;21981780;23269600 False 3 100;0;0 21.569 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 4, 614298;Spastic paraplegia 43, autosomal recessive, 615043 33688131;21981780;22508347;23269600;31804703;30088953;20039086 False 3 100;0;0 21.569 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset spastic paraplegia and sensory-motor axonal neuropathy, NBIA with optic atrophy, extrapyramidal signs False 3 100;0;0 21.569 False ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial membrane protein-associated neurodegeneration (MPAN);Neurodegeneration with brain iron accumulation 4, MIM# 614298;Spastic paraplegia 43, autosomal recessive, MIM# 615043 33688131;21981780;22508347;23269600;31804703;30088953;20039086 False 3 100;0;0 21.569 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal neurodegeneration with brain iron accumulation 4 MONDO:0013674 21981780;22508347 False 3 100;0;0 21.569 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf70 gene C19orf70 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Combined oxidative phosphorylation deficiency 37, MIM# 618329" 29618761;27623147;27485409 False 3 100;0;0 21.569 True ENSG00000174917 ENSG00000174917 HGNC:33702 C1orf109 gene C1orf109 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, C1orf109-related 40760247 False 3 100;0;0 21.569 True ENSG00000116922 ENSG00000116922 HGNC:26039 C1QA gene C1QA Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Immunology Flagship;Melbourne Genomics Health Alliance Immunology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal C1q deficiency, MIM# 613652 9225968;21654842;9590289 False 3 100;0;0 21.569 True ENSG00000173372 ENSG00000173372 HGNC:1241 C1QBP gene C1QBP Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 33, MIM# 617713 28942965 False 3 100;0;0 21.569 True ENSG00000108561 ENSG00000108561 HGNC:1243 C1QBP gene C1QBP Expert Review Green;Literature;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive external opthalmoplegia;mitochondrial myopathy 32652806;28942965 False 3 100;0;0 21.569 True ENSG00000108561 ENSG00000108561 HGNC:1243 C1R gene C1R Literature;Other;Expert Review Green;Other;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ehlers-Danlos syndrome, periodontal type, 1 (MIM# 130080);Leukodystrophy - adult onset 8958339;30535813 False 3 50;50;0 21.569 False Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000159403 ENSG00000159403 HGNC:1246 C2orf69 gene C2orf69 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423 34038740;33945503 False 3 100;0;0 21.569 True ENSG00000178074 ENSG00000178074 HGNC:26799 C2orf69 gene C2orf69 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423 34038740;33945503 False 3 100;0;0 21.569 True ENSG00000178074 ENSG00000178074 HGNC:26799 C2orf69 gene C2orf69 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-53 (COXPD53), MIM#619423 34038740;33945503 False 3 100;0;0 21.569 True ENSG00000178074 ENSG00000178074 HGNC:26799 C5orf42 gene C5orf42 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 17, MIM# 614615" False 3 100;0;0 21.569 True ENSG00000197603 ENSG00000197603 HGNC:25801 C9orf3 gene C9orf3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 31, MIM# 619565;Childhood/Adolescence onset generalised dystonia;Dystonia parkinsonism;Zech-Boesch Syndrome PMID: 35306330 False 3 100;0;0 21.569 True ENSG00000148120 ENSG00000148120 HGNC:1361 C9orf3 gene C9orf3 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Dystonia 31, MIM# 619565" 34596301 False 3 100;0;0 21.569 False ENSG00000148120 ENSG00000148120 HGNC:1361 CA2 gene CA2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Osteopetrosis, autosomal recessive 3, with renal tubular acidosis, MIM# 259730 25674028 False 3 100;0;0 21.569 True ENSG00000104267 ENSG00000104267 HGNC:1373 CA5A gene CA5A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hyperammonemia due to carbonic anhydrase VA deficiency, MIM# 615751" False 3 100;0;0 21.569 True ENSG00000174990 ENSG00000174990 HGNC:1377 CA8 gene CA8 Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3;Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3, 613227 21937992;19461874 False 3 100;0;0 21.569 True ENSG00000178538 ENSG00000178538 HGNC:1382 CACNA1A gene CACNA1A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500;Spinocerebellar ataxia 6 MIM#183086 25468264;23441182;19232643;18758887;11344116 False 3 100;0;0 21.569 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1A gene CACNA1A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500 False 3 50;50;0 21.569 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1A gene CACNA1A Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 42, MIM# 617106;Episodic ataxia, type 2 MIM#108500 34267336;27476654 False 3 67;33;0 21.569 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1A gene CACNA1A Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500 False 3 100;0;0 21.569 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1B gene CACNA1B Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with seizures and nonepileptic hyperkinetic movements, MIM# 618497" 30982612 False 3 100;0;0 21.569 True ENSG00000148408 ENSG00000148408 HGNC:1389 CACNA1C gene CACNA1C Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neurodevelopmental disorder with hypotonia, language delay, and skeletal defects with or without seizures, MIM# 620029" 34163037 False 3 100;0;0 21.569 True ENSG00000151067 ENSG00000151067 HGNC:1390 CACNA1D gene CACNA1D Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Primary aldosteronism, seizures, and neurologic abnormalities MIM#615474 25620733;28472301;31139143 False 3 100;0;0 21.569 True ENSG00000157388 ENSG00000157388 HGNC:1391 CACNA1E gene CACNA1E Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 69, MIM#618285 30343943 False 3 100;0;0 21.569 True ENSG00000198216 ENSG00000198216 HGNC:1392 CACNA1G gene CACNA1G Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM# 618087" 29878067 False 3 100;0;0 21.569 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA1G gene CACNA1G Expert Review Green;Expert list;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits MIM#618087 False 3 100;0;0 21.569 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA1G gene CACNA1G Expert Review Green;Expert list;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM#618087 29878067 False 3 100;0;0 21.569 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA1I gene CACNA1I Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with variable intellectual disability and speech impairment, with or without seizures (NEDISS), MIM#620114 33704440 False 3 100;0;0 21.569 True Other ENSG00000100346 ENSG00000100346 HGNC:1396 CACNA1S gene CACNA1S Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown {Malignant hyperthermia susceptibility 5}, 601887 20301325;28011884 False 3 100;0;0 21.569 True Other ENSG00000081248 ENSG00000081248 HGNC:1397 CACNA2D1 gene CACNA2D1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 110, MIM# 620149 35293990 False 3 50;0;50 21.569 True ENSG00000153956 ENSG00000153956 HGNC:1399 CACNA2D2 gene CACNA2D2 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar atrophy with seizures and variable developmental delay MIM#618501 23339110;24358150;30410802;29997391;31402629;11487633;11756448;4177347;14660671;15331424 False 3 100;0;0 21.569 True ENSG00000007402 ENSG00000007402 HGNC:1400 CACNA2D2 gene CACNA2D2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar atrophy with seizures and variable developmental delay MIM#618501 23339110;24358150;30410802;29997391;31402629 False 3 100;0;0 21.569 True ENSG00000007402 ENSG00000007402 HGNC:1400 CAD gene CAD Expert Review Green;Literature;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 50;OMIM # 616457 PMID: 32820246 False 3 100;0;0 21.569 True ENSG00000084774 ENSG00000084774 HGNC:1424 CAD gene CAD Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 50, MIM# 616457" 28007989;25678555 False 3 100;0;0 21.569 True ENSG00000084774 ENSG00000084774 HGNC:1424 CADM3 gene CADM3 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519 33889941;38074074 False 3 33;67;0 21.569 False ENSG00000162706 ENSG00000162706 HGNC:17601 CAMK2A gene CAMK2A Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal ?Mental retardation, autosomal recessive 63 MIM#618095;Mental retardation, autosomal dominant 53 MIM#617798 PMID: 32600977;29784083;29560374 False 3 100;0;0 21.569 True Other ENSG00000070808 ENSG00000070808 HGNC:1460 CAMK2B gene CAMK2B Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 54, MIM# 617799 29100089;29560374;32875707 False 3 100;0;0 21.569 True ENSG00000058404 ENSG00000058404 HGNC:1461 CAMK4 gene CAMK4 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;Autism;Behavioral abnormality;Abnormality of movement;Dystonia;Ataxia;Chorea;Myoclonus 30262571;33098801;33211350 False 3 100;0;0 21.569 True ENSG00000152495 ENSG00000152495 HGNC:1464 CAMSAP1 gene CAMSAP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cortical dysplasia, complex, with other brain malformations 12, MIM# 620316 36283405 False 3 100;0;0 21.569 True ENSG00000130559 ENSG00000130559 HGNC:19946 CAMTA1 gene CAMTA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellarataxia, nonprogressive, with mental retardation, 614756;Cerebellar ataxia with mental retardation, 614756 32157189;22693284 False 3 100;0;0 21.569 True ENSG00000171735 ENSG00000171735 HGNC:18806 CAPN1 gene CAPN1 Expert list;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76 autosomal recessive, 616907;MONDO:0014827 27153400 False 3 100;0;0 21.569 False ENSG00000014216 ENSG00000014216 HGNC:1476 CAPN3 gene CAPN3 Expert Review Green;Literature;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal dominant 4, MIM# 618129;Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM# 253600 31937337;28881388;32342993;32557990 False 3 100;0;0 21.569 True ENSG00000092529 ENSG00000092529 HGNC:1480 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Neurodevelopmental disorder with language impairment, autism, and attention deficit-hyperactivity disorder, MIM# 620782;Neurodegeneration, childhood-onset, with cerebellar ataxia and cognitive decline, MIM# 620636" 35979925;35977029;28135719;31398340 False 3 67;33;0 21.569 True ENSG00000135387 ENSG00000135387 HGNC:6743 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy 39878554 False 3 100;0;0 21.569 True ENSG00000135387 ENSG00000135387 HGNC:6743 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy 39878554 False 3 100;0;0 21.569 True ENSG00000135387 ENSG00000135387 HGNC:6743 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy 39878554 False 3 100;0;0 21.569 True ENSG00000135387 ENSG00000135387 HGNC:6743 CARS2 gene CARS2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 27, MIM# 616672 25361775;25787132;30139652 False 3 100;0;0 21.569 True ENSG00000134905 ENSG00000134905 HGNC:25695 CARS2 gene CARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 27, MIM# 616672;MONDO:0014728 25361775;25787132;30139652 False 3 100;0;0 21.569 True ENSG00000134905 ENSG00000134905 HGNC:25695 CASK gene CASK Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) FG syndrome 4 MIM#300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749;Mental retardation, with or without nystagmus MIM#300422 24278995 False 3 100;0;0 21.569 True ENSG00000147044 ENSG00000147044 HGNC:1497 CASK gene CASK Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) FG syndrome 4, 300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749 False 3 100;0;0 21.569 True ENSG00000147044 ENSG00000147044 HGNC:1497 CASP8 gene CASP8 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autoimmune lymphoproliferative syndrome, type IIB MIM#607271 41026346 False 3 100;0;0 21.569 True ENSG00000064012 ENSG00000064012 HGNC:1509 CASQ1 gene CASQ1 Expert Review Green;Expert list;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, vacuolar, with CASQ1 aggregates MIM#616231 30258016 False 3 67;33;0 21.569 True ENSG00000143318 ENSG00000143318 HGNC:1512 CASQ1 gene CASQ1 Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, vacuolar, with CASQ1 aggregates 616231 PMID: 26136523;30258016 False 3 100;0;0 21.569 True ENSG00000143318 ENSG00000143318 HGNC:1512 CASR gene CASR Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypocalcemia, autosomal dominant, MIM# 601198 32775520;35402765;8733126;8813042 False 3 50;0;50 21.569 True ENSG00000036828 ENSG00000036828 HGNC:1514 CAT gene CAT Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000121691 ENSG00000121691 HGNC:1516 CAV3 gene CAV3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, distal, Tateyama type 614321;Rippling muscle disease 2 606072 PMID: 27312022;26185955;32090499 False 3 50;50;0 21.569 True ENSG00000182533 ENSG00000182533 HGNC:1529 CAV3 gene CAV3 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type IC 607801;Rippling muscle disease 606072;Myopathy, distal, Tateyama type 614321 False 3 100;0;0 21.569 True ENSG00000182533 ENSG00000182533 HGNC:1529 CBL gene CBL Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown early-onset moyamoya angiopathy;Noonan syndrome-like disorder with or without juvenile myelomonocytic leukemia, 613563 25283271;28343148;28589114 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000110395 ENSG00000110395 HGNC:1541 CBS gene CBS Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Homocystinuria, B6-responsive and nonresponsive types MIM#236200;disorder of intracellular cobalamin metabolism;metabolic disorder of sulfur metabolism 7967489 False 3 100;0;0 21.569 True ENSG00000160200 ENSG00000160200 HGNC:1550 CBY1 gene CBY1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal intellectual disability;cerebellar ataxia;molar tooth sign;polydactyly;Joubert syndrome 33131181;25103236;25220153 False 3 100;0;0 21.569 True ENSG00000100211 ENSG00000100211 HGNC:1307 CC2D2A gene CC2D2A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 9, MIM#612285 18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408 False 3 100;0;0 21.569 True ENSG00000048342 ENSG00000048342 HGNC:29253 CC2D2A gene CC2D2A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 9, MIM#612285 18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408 False 3 100;0;0 21.569 True ENSG00000048342 ENSG00000048342 HGNC:29253 CCDC115 gene CCDC115 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Congenital disorder of glycosylation, type IIo (MIM# 616828)" 26833332 False 3 100;0;0 21.569 True ENSG00000136710 ENSG00000136710 HGNC:28178 CCDC186 gene CCDC186 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, CCDC186-related 33259146;37569695;40633195 False 3 100;0;0 21.569 True ENSG00000165813 ENSG00000165813 HGNC:24349 CCDC82 gene CCDC82 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, CCDC82-related 35373332;35118659;27457812 False 3 100;0;0 21.569 True ENSG00000149231 ENSG00000149231 HGNC:26282 CCDC88A gene CCDC88A Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal PEHO syndrome-like, 617507 26917597;30392057 False 3 100;0;0 21.569 True ENSG00000115355 ENSG00000115355 HGNC:25523 CCDC88C gene CCDC88C Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hydrocephalus, congenital, 1 MIM#236600" PMID: 29341397, PMID: 23042809, PMID: 21031079 False 3 50;50;0 21.569 True ENSG00000015133 ENSG00000015133 HGNC:19967 CCM2 gene CCM2 Expert Review Green;Genomics England PanelApp;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebral cavernous malformations 2;Cerebral Cavernous Malformation;Capillary malformation-arteriovenous malformation 608354;Cerebral Cavernous Malformations 14624391;20301470 False 3 100;0;0 21.569 False ENSG00000136280 ENSG00000136280 HGNC:21708 CCT3 gene CCT3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with speech or visual impairment and brain hypomyelination, MIM# 621034 39480921 False 3 100;0;0 21.569 True ENSG00000163468 ENSG00000163468 HGNC:1616 CD59 gene CD59 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hemolytic anemia, CD59-mediated, with or without immune-mediated polyneuropathy 612300" 24382084;23149847 False 3 100;0;0 21.569 True ENSG00000085063 ENSG00000085063 HGNC:1689 CD99L2 gene CD99L2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodevelopmental disorder, MONDO:0700092;CD99L2-related 41690933 False 3 100;0;0 21.569 True ENSG00000102181 ENSG00000102181 HGNC:18237 CD99L2 gene CD99L2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodevelopmental disorder, MONDO:0700092;CD99L2-related 41690933 False 3 100;0;0 21.569 True ENSG00000102181 ENSG00000102181 HGNC:18237 CDK13 gene CDK13 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder MIM#617360 PMID: 29021403, PMID: 35063350 False 3 100;0;0 21.569 True ENSG00000065883 ENSG00000065883 HGNC:1733 CDK19 gene CDK19 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual disability;epileptic encephalopathy;Epileptic encephalopathy, early infantile, 87, MIM# 618916" 32330417 False 3 100;0;0 21.569 True ENSG00000155111 ENSG00000155111 HGNC:19338 CDK5 gene CDK5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lissencephaly 7 with cerebellar hypoplasia MIM#616342" 25560765;40186457 False 3 50;50;0 21.569 True ENSG00000164885 ENSG00000164885 HGNC:1774 CDKL5 gene CDKL5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Developmental and epileptic encephalopathy 2, MIM# 300672 19793311 False 3 100;0;0 21.569 True ENSG00000008086 ENSG00000008086 HGNC:11411 CELF2 gene CELF2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 97, MIM#619561 33131106 False 3 100;0;0 21.569 True ENSG00000048740 ENSG00000048740 HGNC:2550 CELF4 gene CELF4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, CELF4-related 40108438 False 3 100;0;0 21.569 True ENSG00000101489 ENSG00000101489 HGNC:14015 CELSR1 gene CELSR1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO:0700092), CELSR1-related 41530147;36453712 False 3 100;0;0 21.569 False ENSG00000075275 ENSG00000075275 HGNC:1850 CEP290 gene CEP290 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 5, MIM# 610188 18327255;20690115;16682973;16682970;17564967;16909394;17564974 False 3 100;0;0 21.569 True ENSG00000198707 ENSG00000198707 HGNC:29021 CEP41 gene CEP41 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 15, MIM# 614464 22246503 False 3 100;0;0 21.569 True ENSG00000106477 ENSG00000106477 HGNC:12370 CEP85L gene CEP85L Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lissencephaly, posterior predominant 32097630 False 3 100;0;0 21.569 True ENSG00000111860 ENSG00000111860 HGNC:21638 CERS1 gene CERS1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic, 8 MIM#616230 24782409;21625621;30800706 False 3 100;0;0 21.569 True ENSG00000223802 ENSG00000223802 HGNC:14253 CHCHD10 gene CHCHD10 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 2, MIM# 615911 24934289;31690696;30877432;32369233;28069311 False 3 100;0;0 21.569 True ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Expert Review Green;Literature;Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532 30874923;29112723;25193783;24934289 False 3 100;0;0 21.569 True Other ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 21.569 False ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 2 615911;Spinal muscular atrophy, Jokela type 615048;Myopathy, isolated mitochondrial, autosomal dominant 616209 24934289;25428574;25193783;32042922;31690696;30877432;30874923;31261376 False 3 100;0;0 21.569 True Other ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, Jokela type: 615048;CMT2;dHMN/dSMA 22535186;27066538 False 3 100;0;0 21.569 False ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD2 gene CHCHD2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 22, autosomal dominant MIM#616710 32068847;25662902;31600778;26705026 False 3 100;0;0 21.569 False ENSG00000106153 ENSG00000106153 HGNC:21645 CHCHD2 gene CHCHD2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 22, autosomal dominant MIM#616710 32068847;25662902;31600778 False 3 100;0;0 21.569 True ENSG00000106153 ENSG00000106153 HGNC:21645 CHD1 gene CHD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pilarowski-Bjornsson syndrome, MIM#617682 28866611 False 3 100;0;0 21.569 True ENSG00000153922 ENSG00000153922 HGNC:1915 CHD2 gene CHD2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, childhood-onset (MIM # 615369) False 3 100;0;0 21.569 True ENSG00000173575 ENSG00000173575 HGNC:1917 CHD3 gene CHD3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Snijders Blok-Campeau syndrome MIM#618205 PMID: 32483341 False 3 100;0;0 21.569 True ENSG00000170004 ENSG00000170004 HGNC:1918 CHD4 gene CHD4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Sifrim-Hitz-Weiss syndrome, MIM# 617159;Childhood idiopathic epilepsy and sinus arrhythmia 27479907;27616479;34109749 False 3 100;0;0 21.569 True ENSG00000111642 ENSG00000111642 HGNC:1919 CHD5 gene CHD5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;Epilepsy 33944996 False 3 100;0;0 21.569 True ENSG00000116254 ENSG00000116254 HGNC:16816 CHKA gene CHKA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, movement abnormalities, and seizures, MIM#620023 35202461 False 3 100;0;0 21.569 True ENSG00000110721 ENSG00000110721 HGNC:1937 CHKB gene CHKB Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy, congenital, megaconial type, MIM# 602541;Intellectual disability;Abnormal mitochondria" 21665002;23692895;24997086 False 3 100;0;0 21.569 True ENSG00000100288 ENSG00000100288 HGNC:1938 CHMP2B gene CHMP2B Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795, MONDO:0010936) 20301378;16041373 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000083937 ENSG00000083937 HGNC:24537 CHMP2B gene CHMP2B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795;MONDO:0010936) 20301378;16041373 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000083937 ENSG00000083937 HGNC:24537 CHRNA1 gene CHRNA1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal myasthenic syndrome, congenital, 1B, fast-channel MONDO:0012156 36634413 False 3 100;0;0 21.569 True ENSG00000138435 ENSG00000138435 HGNC:1955 CHRNA2 gene CHRNA2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, nocturnal frontal lobe, type 4 MIM#610353 16826524;25770198;30809122;25847220 False 3 100;0;0 21.569 True ENSG00000120903 ENSG00000120903 HGNC:1956 CHRNA4 gene CHRNA4 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, nocturnal frontal lobe, 1, MIM# 600513 14623738;23114665 False 3 100;0;0 21.569 True Other ENSG00000101204 ENSG00000101204 HGNC:1958 CHRNB2 gene CHRNB2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, nocturnal frontal lobe, 3, MIM# 605375 11062464;11104662;19153075;32536355;25770198;23032131 False 3 100;0;0 21.569 True ENSG00000160716 ENSG00000160716 HGNC:1962 CHST14 gene CHST14 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, musculocontractural type 1, MIM# 601776 26373698 False 3 100;0;0 21.569 True ENSG00000169105 ENSG00000169105 HGNC:24464 CHST3 gene CHST3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spondyloepiphyseal dysplasia with congenital joint dislocations, MIM# 143095 18513679 False 3 100;0;0 21.569 True ENSG00000122863 ENSG00000122863 HGNC:1971 CHST6 gene CHST6 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Macular corneal dystrophy, MIM# 217800, MONDO:0009020 11818380;16207214;26604660 False 3 100;0;0 21.569 True ENSG00000183196 ENSG00000183196 HGNC:6938 CHSY1 gene CHSY1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Temtamy preaxial brachydactyly syndrome, MIM# 605282, MONDO:0011533;CHSY1-CDG (Disorders of protein O-glycosylation, O-mannosylglycan synthesis deficiencies) 21129728;21129727;24269551 False 3 100;0;0 21.569 True ENSG00000131873 ENSG00000131873 HGNC:17198 CIAO1 gene CIAO1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 10, MIM#620960 38411040;38196629 False 3 100;0;0 21.569 True ENSG00000144021 ENSG00000144021 HGNC:14280 CIC gene CIC Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Mental retardation, autosomal dominant 45 617600 False 3 100;0;0 21.569 False ENSG00000079432 ENSG00000079432 HGNC:14214 CIC gene CIC Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 45, MIM# 617600 28288114 False 3 100;0;0 21.569 True ENSG00000079432 ENSG00000079432 HGNC:14214 CISD2 gene CISD2 Expert Review Green;Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wolfram syndrome 2 MIM#604928 29237418;28335035;27459537;26230298;17846994 False 3 100;0;0 21.569 True ENSG00000145354 ENSG00000145354 HGNC:24212 CLCN2 gene CLCN2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy with ataxia, MIM# 615651" 23707145 False 3 100;0;0 21.569 True ENSG00000114859 ENSG00000114859 HGNC:2020 CLCN2 gene CLCN2 Expert Review Green;Victorian Clinical Genetics Services;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with ataxia, MIM# 615651 29403011;29403012;23707145 False 3 100;0;0 21.569 True ENSG00000114859 ENSG00000114859 HGNC:2020 CLCN3 gene CLCN3 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Neurodevelopmental disorder with hypotonia and brain abnormalities, MIM# 619512;Neurodevelopmental disorder with seizures and brain abnormalities, MIM# 619517" 34186028 False 3 100;0;0 21.569 True Other ENSG00000109572 ENSG00000109572 HGNC:2021 CLCN4 gene CLCN4 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Raynaud-Claes syndrome, MIM#300114;intellectual disability;epilepsy;autistic features;mood disorders;cerebral white matter changes;progressive appendicular spasticity 27550844 False 3 100;0;0 21.569 True ENSG00000073464 ENSG00000073464 HGNC:2022 CLCN6 gene CLCN6 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Benign partial epilepsy;febrile seizures;NCL 25794116;21107136;33217309 False 3 100;0;0 21.569 True Other ENSG00000011021 ENSG00000011021 HGNC:2024 CLDN10 gene CLDN10 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of magnesium metabolism;HELIX syndrome MONDO:0060564 28686597 False 3 0;0;0 21.569 False ENSG00000134873 ENSG00000134873 HGNC:2033 CLDN11 gene CLDN11 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypomyelinating leukodystrophy-22, MIM#619328 33313762 False 3 100;0;0 21.569 True ENSG00000013297 ENSG00000013297 HGNC:8514 CLDN16 gene CLDN16 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of magnesium metabolism;renal hypomagnesemia 3 MONDO:0009550 26426912, 16501001, 10878661 False 3 0;0;0 21.569 False ENSG00000113946 ENSG00000113946 HGNC:2037 CLDN19 gene CLDN19 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of magnesium metabolism;renal hypomagnesemia 5 with ocular involvement MONDO:0009548 17033971, 22422540, 27530400 False 3 0;0;0 21.569 False ENSG00000164007 ENSG00000164007 HGNC:2040 CLDN5 gene CLDN5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Syndromic disorder, MONDO:0002254, CLDN5-related PMID: 36477332 False 3 100;0;0 21.569 True ENSG00000184113 ENSG00000184113 HGNC:2047 CLDN5 gene CLDN5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Syndromic disorder, MONDO:0002254, CLDN5-related 35714222;36477332 False 3 50;50;0 21.569 True ENSG00000184113 ENSG00000184113 HGNC:2047 CLN3 gene CLN3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 3 MIM#204200 19489875;11342698 False 3 100;0;0 21.569 True ENSG00000188603 ENSG00000188603 HGNC:2074 CLN3 gene CLN3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 3, MIM# 204200;MONDO:0008767 7553855 False 3 100;0;0 21.569 True ENSG00000188603 ENSG00000188603 HGNC:2074 CLN3 gene CLN3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ceroid lipofuscinosis, neuronal, 3 204200" 19353721 False 3 100;0;0 21.569 True ENSG00000188603 ENSG00000188603 HGNC:2074 CLN3 gene CLN3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 3, MIM# 204200;MONDO:0008767 7553855 False 3 100;0;0 21.569 True ENSG00000188603 ENSG00000188603 HGNC:2074 CLN5 gene CLN5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 5, MIM# 256731;MONDO:0009745 20157158 False 3 100;0;0 21.569 True ENSG00000102805 ENSG00000102805 HGNC:2076 CLN5 gene CLN5 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis neuronal 5, MIM# 256731 False 3 100;0;0 21.569 True ENSG00000102805 ENSG00000102805 HGNC:2076 CLN5 gene CLN5 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ceroid lipofuscinosis, neuronal, 5, MIM# 256731" 32983231;15728307;20157158 False 3 100;0;0 21.569 True ENSG00000102805 ENSG00000102805 HGNC:2076 CLN6 gene CLN6 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300 11791207;11727201;21549341;30561534 False 3 100;0;0 21.569 True ENSG00000128973 ENSG00000128973 HGNC:2077 CLN6 gene CLN6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, Kufs type, adult onset MIM#204300 30561534 False 3 100;0;0 21.569 True ENSG00000128973 ENSG00000128973 HGNC:2077 CLN6 gene CLN6 Expert Review Green;Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300 11791207;11727201;21549341;33798445;33024953 False 3 100;0;0 21.569 True ENSG00000128973 ENSG00000128973 HGNC:2077 CLN6 gene CLN6 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300 11791207;11727201;21549341 False 3 100;0;0 21.569 True ENSG00000128973 ENSG00000128973 HGNC:2077 CLN8 gene CLN8 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 8, MIM# 600143;Ceroid lipofuscinosis, neuronal, 8, Northern epilepsy variant, MIM# 610003 10508524;15024724;16570191 False 3 100;0;0 21.569 True ENSG00000182372 ENSG00000182372 HGNC:2079 CLN8 gene CLN8 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 8, MIM# 600143;Ceroid lipofuscinosis, neuronal, 8, Northern epilepsy variant, MIM# 610003 10508524;15024724;16570191 False 3 100;0;0 21.569 True ENSG00000182372 ENSG00000182372 HGNC:2079 CLP1 gene CLP1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 10;dHMN/dSMA False 3 100;0;0 21.569 False ENSG00000172409 ENSG00000172409 HGNC:16999 CLPB gene CLPB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271;3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835;Neutropenia, severe congenital, 9, autosomal dominant, MIM# 619813 25597510;34140661 False 3 100;0;0 21.569 True ENSG00000162129 ENSG00000162129 HGNC:30664 CLPB gene CLPB Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type VII, with cataracts, neurologic involvement and neutropaenia, MIM# 616271;3-methylglutaconic aciduria, type VIIA, autosomal dominant, MIM# 619835 25597510;34140661 False 3 100;0;0 21.569 True ENSG00000162129 ENSG00000162129 HGNC:30664 CLPP gene CLPP Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 3, MIM# 614129 23541340;27087618;27899912;25254289 False 3 100;0;0 21.569 True ENSG00000125656 ENSG00000125656 HGNC:2084 CLPP gene CLPP Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 3, MIM#614129 27899912 False 3 100;0;0 21.569 True ENSG00000125656 ENSG00000125656 HGNC:2084 CLPP gene CLPP Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 3, MIM# 614129 25254289 False 3 100;0;0 21.569 True ENSG00000125656 ENSG00000125656 HGNC:2084 CLTC gene CLTC Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 56, MIM# 617854 29100083;26822784 False 3 100;0;0 21.569 True ENSG00000141367 ENSG00000141367 HGNC:2092 CNKSR2 gene CNKSR2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndromic, Houge type, MIM# 301008 34266427 False 3 100;0;0 21.569 True ENSG00000149970 ENSG00000149970 HGNC:19701 CNNM2 gene CNNM2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hypomagnesemia 6, renal MIM#613882;Hypomagnesemia, seizures, and mental retardation MIM#616418 34604137;35170241 False 3 100;0;0 21.569 True ENSG00000148842 ENSG00000148842 HGNC:103 CNNM2 gene CNNM2 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal renal hypomagnesemia 6 MONDO:0013480;Disorders of magnesium metabolism 34604137, 35170241 False 3 0;0;0 21.569 False ENSG00000148842 ENSG00000148842 HGNC:103 CNOT9 gene CNOT9 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092 PMID: 37092538 False 3 100;0;0 21.569 True ENSG00000144580 ENSG00000144580 HGNC:10445 CNP gene CNP Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 20, MIM# 619071 32128616;12590258;40396300 False 3 50;50;0 21.569 True ENSG00000173786 ENSG00000173786 HGNC:2158 CNPY3 gene CNPY3 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 60 (MIM 617929) 29394991;30237576 False 3 100;0;0 21.569 True ENSG00000137161 ENSG00000137161 HGNC:11968 CNTN2 gene CNTN2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, MONDO:0015653, CNTN2-related;Epilepsy, myoclonic, familial adult, 5 MIM#615400 23518707;34120799;34691156 False 3 33;33;33 21.569 True ENSG00000184144 ENSG00000184144 HGNC:2172 CNTNAP1 gene CNTNAP1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating neuropathy, congenital, 3, MIM# 618186;Lethal congenital contracture syndrome 7, MIM# 616286 28374019;29882456 False 3 100;0;0 21.569 True ENSG00000108797 ENSG00000108797 HGNC:8011 CNTNAP1 gene CNTNAP1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating neuropathy, congenital, 3 (MONDO:0017049;MIM#618186) 29511323;27881385 False 3 100;0;0 21.569 True ENSG00000108797 ENSG00000108797 HGNC:8011 CNTNAP2 gene CNTNAP2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cortical dysplasia-focal epilepsy syndrome, MIM# 610042 16571880;19896112;27439707 False 3 100;0;0 21.569 True ENSG00000174469 ENSG00000174469 HGNC:13830 COA6 gene COA6 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 13, MIM# 616501;Cardioencephalomyopathy, fatal infantile, MONDO:0014668 24549041;25339201;31851937;26160915 False 3 100;0;0 21.569 True ENSG00000168275 ENSG00000168275 HGNC:18025 COA7 gene COA7 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387 27683825;29718187 False 3 100;0;0 21.569 True ENSG00000162377 ENSG00000162377 HGNC:25716 COA7 gene COA7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3, 618387;Cerebellar atrophy, leukoencephalopathy and spinal cord atrophy in some patients. Axonal sensory and motor neuropathy False 3 100;0;0 21.569 False ENSG00000162377 ENSG00000162377 HGNC:25716 COA7 gene COA7 Expert Review Green;Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387 30885959;29718187 False 3 100;0;0 21.569 True ENSG00000162377 ENSG00000162377 HGNC:25716 COA7 gene COA7 Expert Review Green;Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387 False 3 100;0;0 21.569 True ENSG00000162377 ENSG00000162377 HGNC:25716 COASY gene COASY GeneReviews;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal OMIM 618266);COASY protein-associated neurodegeneration (CoPAN False 3 100;0;0 21.569 False ENSG00000068120 ENSG00000068120 HGNC:29932 COASY gene COASY Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodegeneration with brain iron accumulation 6, MONDO:0014290;Neurodegeneration with brain iron accumulation 6 615643 23447832;24360804;27021474 False 3 100;0;0 21.569 True ENSG00000068120 ENSG00000068120 HGNC:29932 COASY gene COASY Expert Review Green;Expert Review Green;Literature;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 6 MIM#615643;Pontocerebellar hypoplasia, type 12 MIM#618266 25778941;24360804;30089828;28489334 False 3 100;0;0 21.569 True ENSG00000068120 ENSG00000068120 HGNC:29932 COG1 gene COG1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIg, MIM# 611209 16537452;19008299;17904886;11980916 False 3 100;0;0 21.569 True ENSG00000166685 ENSG00000166685 HGNC:6545 COG4 gene COG4 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIj 613489 21185756;19494034 False 3 100;0;0 21.569 True ENSG00000103051 ENSG00000103051 HGNC:18620 COG5 gene COG5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIi, MIM# 613612 23228021;31572517;32174980 False 3 100;0;0 21.569 True ENSG00000164597 ENSG00000164597 HGNC:14857 COG6 gene COG6 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIl, MIM# 614576 20605848;23430903;26260076;32905044;32683677;31420886 False 3 100;0;0 21.569 True ENSG00000133103 ENSG00000133103 HGNC:18621 COG7 gene COG7 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIe , MIM#608779 15107842;17356545;28883096 False 3 100;0;0 21.569 True ENSG00000168434 ENSG00000168434 HGNC:18622 COG7 gene COG7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIe , MIM#608779 15107842;17356545;28883096 False 3 100;0;0 21.569 True ENSG00000168434 ENSG00000168434 HGNC:18622 COG8 gene COG8 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIh, MIM# 611182 17220172;28619360;30690882;17331980 False 3 100;0;0 21.569 True ENSG00000213380 ENSG00000213380 HGNC:18623 COL18A1 gene COL18A1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Knobloch syndrome, type 1, MIM# 267750 27259167;25456301 False 3 100;0;0 21.569 True ENSG00000182871 ENSG00000182871 HGNC:2195 COL3A1 gene COL3A1 Genomics England PanelApp;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ehlers-Danlos syndrome, type IV 130050 False 3 100;0;0 21.569 False ENSG00000168542 ENSG00000168542 HGNC:2201 COL3A1 gene COL3A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polymicrogyria with or without vascular-type ehlers-danlos syndrome, MIM # 618343 PMID: 28258187, PMID: 37393059, PMID: 28742248, PMID: 22235340 False 3 100;0;0 21.569 True ENSG00000168542 ENSG00000168542 HGNC:2201 COL4A1 gene COL4A1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Brain small vessel disease 1 with or without ocular anomalies MONDO:0008289;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MONDO:0032814" 35699195;37272523;36300346;30413629 False 3 100;0;0 21.569 True ENSG00000187498 ENSG00000187498 HGNC:2202 COL4A1 gene COL4A1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, 611773;Brain small vessel disease with or without ocular anomalies, 175780 False 3 100;0;0 21.569 False ENSG00000187498 ENSG00000187498 HGNC:2202 COL4A1 gene COL4A1 Expert Review Green;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps, MIM# 611773;Brain small vessel disease with or without ocular anomalies, MIM# 175780 27794444;25719457 False 3 100;0;0 21.569 True ENSG00000187498 ENSG00000187498 HGNC:2202 COL4A1 gene COL4A1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Brain small vessel disease with or without ocular anomalies, MIM# 175780 24372060;22134833;25719457;23225343;22932948 False 3 100;0;0 21.569 True ENSG00000187498 ENSG00000187498 HGNC:2202 COL4A1 gene COL4A1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps MIM#611773;Brain small vessel disease with or without ocular anomalies MIM#175780;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MIM#618564 24628545;25719457;21625620;23225343;23065703;20818663;20301768 False 3 100;0;0 21.569 True ENSG00000187498 ENSG00000187498 HGNC:2202 COL4A2 gene COL4A2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cerebral Palsy MONDO#0006497, COL4A2-related;Brain small vessel disease 2 MIM# 614483 33528536;33912663;22209246;30315939;22333902 False 3 100;0;0 21.569 True ENSG00000134871 ENSG00000134871 HGNC:2203 COL4A3BP gene COL4A3BP Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, speech delay, and dysmorphic facies (MIM#616351) PMID: 36976648 False 3 100;0;0 21.569 True Other ENSG00000113163 ENSG00000113163 HGNC:2205 COL6A1 gene COL6A1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy MIM#158810;Ullrich congenital muscular dystrophy MIM#254090 20301676;25535305;15955946;23738969;29277723;24443028 False 3 100;0;0 21.569 True ENSG00000142156 ENSG00000142156 HGNC:2211 COL6A2 gene COL6A2 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090 20301676 False 3 100;0;0 21.569 True ENSG00000142173 ENSG00000142173 HGNC:2212 COL6A3 gene COL6A3 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090 20301676;26004199;32037012;26872670;32037012 False 3 100;0;0 21.569 True ENSG00000163359 ENSG00000163359 HGNC:2213 COLGALT1 gene COLGALT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brain small vessel disease 3 MIM#618360 30412317;33709034;31759980 False 3 100;0;0 21.569 True ENSG00000130309 ENSG00000130309 HGNC:26182 COLGALT1 gene COLGALT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brain small vessel disease 3 MIM#618360 30412317;33709034;31759980 False 3 100;0;0 21.569 True ENSG00000130309 ENSG00000130309 HGNC:26182 COQ2 gene COQ2 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Leukoencephalopathy;General Leukodystrophy & Mitochondrial Leukoencephalopathy;Coenzyme Q10 deficiency, primary, 1 False 3 0;0;0 21.569 False ENSG00000173085 ENSG00000173085 HGNC:25223 COQ2 gene COQ2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 1, MIM# 607426;MONDO:0011829 16400613;17332895;17855635 False 3 100;0;0 21.569 True ENSG00000173085 ENSG00000173085 HGNC:25223 COQ2 gene COQ2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 1, MIM# 607426;MONDO:0011829 16400613;17332895;17855635 False 3 100;0;0 21.569 True ENSG00000173085 ENSG00000173085 HGNC:25223 COQ4 gene COQ4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Spastic ataxia 10, autosomal recessive, MIM# 620666 25658047;26185144;33704555;36047608;38014483;38013626 False 3 100;0;0 21.569 True ENSG00000167113 ENSG00000167113 HGNC:19693 COQ4 gene COQ4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 7, MIM# 616276 25658047;26185144;33704555 False 3 100;0;0 21.569 True ENSG00000167113 ENSG00000167113 HGNC:19693 COQ4 gene COQ4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Childhood-onset ataxia 30225196;33704555;30847826 False 3 100;0;0 21.569 True ENSG00000167113 ENSG00000167113 HGNC:19693 COQ5 gene COQ5 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 9 MIM#619028 29044765;37599337;21937992;41199775;36266294 False 3 33;0;67 21.569 True ENSG00000110871 ENSG00000110871 HGNC:28722 COQ5 gene COQ5 Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 9 MIM#619028 29044765;37599337;21937992;41199775;36266294 False 3 33;0;67 21.569 True ENSG00000110871 ENSG00000110871 HGNC:28722 COQ5 gene COQ5 Expert Review Green;Victorian Clinical Genetics Services;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary 9, MIM#619028 29044765;37599337;21937992;41199775;36266294 False 3 100;0;0 21.569 True ENSG00000110871 ENSG00000110871 HGNC:28722 COQ6 gene COQ6 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 6 MIM#614650 28125198 False 3 100;0;0 21.569 True ENSG00000119723 ENSG00000119723 HGNC:20233 COQ7 gene COQ7 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 9, MIM# 620402 PMID: 36454683;36758993;36759155 False 3 67;33;0 21.569 True ENSG00000167186 ENSG00000167186 HGNC:2244 COQ7 gene COQ7 Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 8 MIM#616733 31240163 False 3 100;0;0 21.569 True ENSG00000167186 ENSG00000167186 HGNC:2244 COQ7 gene COQ7 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, COQ7-related (MONDO#0019064) PMID: 33215859 False 3 50;0;50 21.569 False ENSG00000167186 ENSG00000167186 HGNC:2244 COQ8A gene COQ8A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 PMID 32337771 False 3 100;0;0 21.569 True ENSG00000163050 ENSG00000163050 HGNC:16812 COQ8A gene COQ8A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Coenzyme Q10 deficiency, primary, 4, MIM# 612016" 32337771 False 3 100;0;0 21.569 True ENSG00000163050 ENSG00000163050 HGNC:16812 COQ8A gene COQ8A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 32337771 False 3 100;0;0 21.569 True ENSG00000163050 ENSG00000163050 HGNC:16812 COQ8A gene COQ8A Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 32337771 False 3 100;0;0 21.569 True ENSG00000163050 ENSG00000163050 HGNC:16812 COQ8A gene COQ8A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 32337771 False 3 100;0;0 21.569 True ENSG00000163050 ENSG00000163050 HGNC:16812 COQ8B gene COQ8B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nephrotic syndrome, type 9 MIM#615573 24270420 False 3 100;0;0 21.569 True ENSG00000123815 ENSG00000123815 HGNC:19041 COQ9 gene COQ9 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 5, MIM#614654 19375058;26081641;23255162;31821167 False 3 100;0;0 21.569 True ENSG00000088682 ENSG00000088682 HGNC:25302 COQ9 gene COQ9 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 5, MIM#614654 19375058;26081641;23255162;31821167 False 3 100;0;0 21.569 True ENSG00000088682 ENSG00000088682 HGNC:25302 COX10 gene COX10 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Leukoencephalopathy;General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial complex IV disorder False 3 0;0;0 21.569 False ENSG00000006695 ENSG00000006695 HGNC:2260 COX10 gene COX10 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 3, MIM# 619046 10767350;12928484;15455402;27290639 False 3 100;0;0 21.569 True ENSG00000006695 ENSG00000006695 HGNC:2260 COX11 gene COX11 Expert Review Green;Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease (MONDO:0044970), COX11-related 36030551 False 3 100;0;0 21.569 True ENSG00000166260 ENSG00000166260 HGNC:2261 COX11 gene COX11 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease (MONDO:0044970), COX11-related 36030551 False 3 100;0;0 21.569 True ENSG00000166260 ENSG00000166260 HGNC:2261 COX15 gene COX15 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 6, MIM# 615119 33746038;32232962;26959537;21412973;12474143;15235026 False 3 100;0;0 21.569 True ENSG00000014919 ENSG00000014919 HGNC:2263 COX15 gene COX15 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Leukoencephalopathy;Mitochondrial complex IV disorders False 3 0;0;0 21.569 False ENSG00000014919 ENSG00000014919 HGNC:2263 COX18 gene COX18 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 25, MIM# 621487;Charcot-Marie-Tooth disease, axonal, type 2MM, MIM# 621488 PMID:37468577;40830826 False 3 67;0;33 21.569 True ENSG00000163626 ENSG00000163626 HGNC:26801 COX18 gene COX18 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 25, MIM# 621487;Charcot-Marie-Tooth disease, axonal, type 2MM, MIM# 621488 37468577;40830826 False 3 100;0;0 21.569 True ENSG00000163626 ENSG00000163626 HGNC:26801 COX20 gene COX20 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal sensory neuronopathy;sensory neuron disease;ganglionopathy PMID: 33751098 False 3 100;0;0 21.569 False ENSG00000203667 ENSG00000203667 HGNC:26970 COX20 gene COX20 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, 220110;Mitochondrial complex IV deficiency False 3 100;0;0 21.569 False ENSG00000203667 ENSG00000203667 HGNC:26970 COX20 gene COX20 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 11, MIM#619054 24202787;31079202;30656193;23125284;32606554 False 3 100;0;0 21.569 True ENSG00000203667 ENSG00000203667 HGNC:26970 COX4I1 gene COX4I1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 16, MIM#619060;regression;seizures;short stature;mild dysmorphic features;Fanconi anemia 28766551;22592081;31290619 False 3 33;33;33 21.569 True ENSG00000131143 ENSG00000131143 HGNC:2265 COX6A1 gene COX6A1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, recessive intermediate D, MIM# 616039;MONDO:0014467 25152455;26302975;25152455 False 3 100;0;0 21.569 True ENSG00000111775 ENSG00000111775 HGNC:2277 COX6A1 gene COX6A1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, recessive intermediate D, 616039;MONDO:0014467;HMSN 25152455;26302975;25152455 False 3 100;0;0 21.569 False ENSG00000111775 ENSG00000111775 HGNC:2277 COX6A2 gene COX6A2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 18, MIM#619062 31155743;23460811 False 3 100;0;0 21.569 True ENSG00000156885 ENSG00000156885 HGNC:2279 COX6B1 gene COX6B1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 7, MIM# 619051 18499082;24781756 False 3 100;0;0 21.569 True ENSG00000126267 ENSG00000126267 HGNC:2280 COX7B gene COX7B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Linear skin defects with multiple congenital anomalies 2, MIM#300887 23122588 False 3 100;0;0 21.569 True ENSG00000131174 ENSG00000131174 HGNC:2291 CP gene CP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hemosiderosis, systemic, due to aceruloplasminemia MIM#604290 7539672;https://doi.org/10.1093/qjmed/89.5.355;28874056;28012953 False 3 100;0;0 21.569 False ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminaemia, MIM#604290 False 3 100;0;0 21.569 True ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP GeneReviews;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminemia False 3 100;0;0 21.569 False ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminaemia, MIM#604290 False 3 100;0;0 21.569 True ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 604290 ACERULOPLASMINEMIA;604290 Hemosiderosis, systemic, due to aceruloplasminemia 15338274 False 3 0;0;0 21.569 False ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP Victorian Clinical Genetics Services;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290 20301666 False 3 100;0;0 21.569 False ENSG00000047457 ENSG00000047457 HGNC:2295 CPLX1 gene CPLX1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 63, MIM# 617976" 26539891;28422131 False 3 100;0;0 21.569 True ENSG00000168993 ENSG00000168993 HGNC:2309 CPOX gene CPOX Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coproporphyria, MIM#121300;Harderoporphyria, MIM#121300 False 3 100;0;0 21.569 True ENSG00000080819 ENSG00000080819 HGNC:2321 CPSF3 gene CPSF3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, hypotonia, and seizures (NEDMHS), MIM#619876 35121750 False 3 100;0;0 21.569 True ENSG00000119203 ENSG00000119203 HGNC:2326 CPT1A gene CPT1A Expert Review Green;Expert Review Green;Literature;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal CPT deficiency, hepatic, type IA MIM#255120 25778941;12189492;23430932 False 3 100;0;0 21.569 True ENSG00000110090 ENSG00000110090 HGNC:2328 CPT1A gene CPT1A Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal CPT deficiency, hepatic, type IA, MIM# 255120 12189492;33565078;34869124;20696606 False 3 67;33;0 21.569 True ENSG00000110090 ENSG00000110090 HGNC:2328 CPT1A gene CPT1A Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal CPT deficiency, hepatic, type IA, MIM# 255120 12189492 False 3 100;0;0 21.569 True ENSG00000110090 ENSG00000110090 HGNC:2328 CPT2 gene CPT2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal CPT II deficiency, infantile 600649;CPT II deficiency, lethal neonatal 608836;CPT II deficiency, myopathic, stress-induced 255110 PMID: 20301431;35028265;36478999 False 3 100;0;0 21.569 True ENSG00000157184 ENSG00000157184 HGNC:2330 CPT2 gene CPT2 Expert Review Green;Expert list;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal CPT II deficiency, myopathic, stress-induced (exercise intolerance and rhabdomyolysis, late onset) 255110 False 3 100;0;0 21.569 True ENSG00000157184 ENSG00000157184 HGNC:2330 CPT2 gene CPT2 Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "CPT II deficiency, infantile MIM#600649;CPT II deficiency, lethal neonatal MIM#608836;CPT II deficiency, myopathic, stress-induced MIM#255110" 25778941;12673791;30957255 False 3 100;0;0 21.569 True ENSG00000157184 ENSG00000157184 HGNC:2330 CPT2 gene CPT2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal CPT II deficiency, infantile 600649;CPT II deficiency, lethal neonatal 608836;CPT II deficiency, myopathic, stress-induced 255110 False 3 100;0;0 21.569 True ENSG00000157184 ENSG00000157184 HGNC:2330 CRADD gene CRADD Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 34, with variant lissencephaly, MIM# 614499 PMID: 27773430;30914828 False 3 50;50;0 21.569 True ENSG00000169372 ENSG00000169372 HGNC:2340 CREBBP gene CREBBP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Menke-Hennekam syndrome 1, MIM# 618332" 29460469 False 3 100;0;0 21.569 True ENSG00000005339 ENSG00000005339 HGNC:2348 CRELD1 gene CRELD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Jeffries-Lakhani neurodevelopmental syndrome, MIM# 620771 37947183 False 3 100;0;0 21.569 True ENSG00000163703 ENSG00000163703 HGNC:14630 CRLS1 gene CRLS1 Expert Review Green;Literature;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 57, MIM# 620167 35147173 False 3 100;0;0 21.569 True ENSG00000088766 ENSG00000088766 HGNC:16148 CSF1R gene CSF1R Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 21.569 False ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted leukoencephalopathy, diffuse hereditary, with spheroids 1 MONDO:0800027 25935893;22934315;22934315 False 3 100;0;0 21.569 True ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Brain abnormalities, neurodegeneration, and dysosteosclerosis, (MIM#618476) PMID: 22197934;24336230;30982608;30982609 False 3 100;0;0 21.569 True ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukoencephalopathy, diffuse hereditary, with spheroids, 221820 False 3 100;0;0 21.569 False ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia 24198292;25563800;25935893 False 3 100;0;0 21.569 False ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brain abnormalities, neurodegeneration, and dysosteosclerosis, MIM# 618476;BANDDOS 30982609;33749994;34135456 False 3 100;0;0 21.569 True ENSG00000182578 ENSG00000182578 HGNC:2433 CSGALNACT1 gene CSGALNACT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation;Skeletal dysplasia, mild, with joint laxity and advanced bone age, MIM# 618870 31705726;31325655 False 3 100;0;0 21.569 True ENSG00000147408 ENSG00000147408 HGNC:24290 CSMD1 gene CSMD1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038 PMID: 38816421 False 3 100;0;0 21.569 True ENSG00000183117 ENSG00000183117 HGNC:14026 CSMD1 gene CSMD1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038 PMID 38816421 False 3 100;0;0 21.569 True ENSG00000183117 ENSG00000183117 HGNC:14026 CSMD3 gene CSMD3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, MONDO:0005027, CSMD3-related PMID: 40632521 False 3 100;0;0 21.569 True ENSG00000164796 ENSG00000164796 HGNC:19291 CSNK2A1 gene CSNK2A1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Okur-Chung neurodevelopmental syndrome, MIM# 617062 PMID: 35679446;36588763 False 3 100;0;0 21.569 True ENSG00000101266 ENSG00000101266 HGNC:2457 CSNK2B gene CSNK2B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732 34041744;28585349;28762608 False 3 100;0;0 21.569 True ENSG00000204435 ENSG00000204435 HGNC:2460 CSNK2B gene CSNK2B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732 PMID: 34041744 False 3 100;0;0 21.569 True ENSG00000204435 ENSG00000204435 HGNC:2460 CST3 gene CST3 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214 38489591 False 3 100;0;0 21.569 False ENSG00000101439 ENSG00000101439 HGNC:2475 CST3 gene CST3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral amyloid angiopathy MIM#105150;Leukodystrophy, adult-onset, autosomal dominant, without amyloid angiopathy, MIM#621214 22435454;8866434;2602413;8108423;38489591 False 3 50;50;0 21.569 True Other ENSG00000101439 ENSG00000101439 HGNC:2475 CSTB gene CSTB Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM#254800 9012407;9054946 False 3 50;50;0 21.569 True ENSG00000160213 ENSG00000160213 HGNC:2482 CSTB gene CSTB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM# 254800 32920378;18028412 False 3 50;50;0 21.569 True ENSG00000160213 ENSG00000160213 HGNC:2482 CTBP1 gene CTBP1 Expert Review Green;Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, MIM#617915 27094857;28955726;31041561 False 3 100;0;0 21.569 True ENSG00000159692 ENSG00000159692 HGNC:2494 CTC1 gene CTC1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199 22267198;22387016;22532422;22899577;24372060 False 3 100;0;0 21.569 True ENSG00000178971 ENSG00000178971 HGNC:26169 CTC1 gene CTC1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebroretinal microangiopathy with calcifications and cysts, MIM# 612199" 22267198;22387016 False 3 100;0;0 21.569 True ENSG00000178971 ENSG00000178971 HGNC:26169 CTDP1 gene CTDP1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital cataracts, facial dysmorphism, and neuropathy (MIM#604168) 20301787 False 3 50;50;0 21.569 True ENSG00000060069 ENSG00000060069 HGNC:2498 CTNNA2 gene CTNNA2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cortical dysplasia, complex, with other brain malformations 9, MIM#618174 30013181 False 3 100;0;0 21.569 True ENSG00000066032 ENSG00000066032 HGNC:2510 CTNS gene CTNS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cystinosis, late-onset juvenile or adolescent nephropathic 219900;Cystinosis, nephropathic 219800;Cystinosis, ocular nonnephropathic 219750" PMID: 32564281 False 3 100;0;0 21.569 True ENSG00000040531 ENSG00000040531 HGNC:2518 CTSA gene CTSA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galactosialidosis, MIM# 256540 8514852;8968752 False 3 100;0;0 21.569 True ENSG00000064601 ENSG00000064601 HGNC:9251 CTSA gene CTSA Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Brain small vessel disease 6 with leukoencephalopathy, MIM# 621394 31177426 False 3 100;0;0 21.569 False ENSG00000064601 ENSG00000064601 HGNC:9251 CTSC gene CTSC Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ectodermal dysplasia syndrome MONDO:0019287;Other disorders of complex molecule degradation 31282082;29884839 False 3 0;0;0 21.569 False ENSG00000109861 ENSG00000109861 HGNC:2528 CTSC gene CTSC Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Haim-Munk syndrome MIM#245010;Papillon-Lefevre syndrome MIM#245000;other lysosomal disorder 10581027 False 3 100;0;0 21.569 True ENSG00000109861 ENSG00000109861 HGNC:2528 CTSD gene CTSD Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 10, MIM# 610127;MONDO:0012414 16685649;16670177;25298308;33681191;29284168;27072142 False 3 100;0;0 21.569 True ENSG00000117984 ENSG00000117984 HGNC:2529 CTSD gene CTSD Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 10, MIM# 610127;MONDO:0012414 16685649;16670177;25298308;33681191;29284168;27072142 False 3 100;0;0 21.569 True ENSG00000117984 ENSG00000117984 HGNC:2529 CTSF gene CTSF Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ceroid lipofuscinosis, neuronal, 13, Kufs type 615362" PMID: 28749476;27668283;27524508 False 3 100;0;0 21.569 True ENSG00000174080 ENSG00000174080 HGNC:2531 CTSF gene CTSF Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 13 (Kufs type) MIM#615362 PMID: 23297359;25274848;27668283;27524508;35139754 False 3 100;0;0 21.569 True ENSG00000174080 ENSG00000174080 HGNC:2531 CTSF gene CTSF Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 13, Kufs type, MIM# 615362 28749476;27668283;27524508 False 3 100;0;0 21.569 True ENSG00000174080 ENSG00000174080 HGNC:2531 CTSK gene CTSK Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Pycnodysostosis 265800" PMID: 32667742;25725806;25304337 False 3 50;50;0 21.569 True ENSG00000143387 ENSG00000143387 HGNC:2536 CTU2 gene CTU2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia syndrome, MIM#618142 PMID: 27480277;33559988 False 3 100;0;0 21.569 True ENSG00000174177 ENSG00000174177 HGNC:28005 CUL1 gene CUL1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, CUL1-related PMID: 41189326 False 3 100;0;0 21.569 True ENSG00000055130 ENSG00000055130 HGNC:2551 CUL4B gene CUL4B Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked, syndromic 15 (Cabezas type), 300354 22182342;17236139 False 3 100;0;0 21.569 True ENSG00000158290 ENSG00000158290 HGNC:2555 CUX2 gene CUX2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 67, MIM#618141 2963073;29795476 False 3 100;0;0 21.569 True ENSG00000111249 ENSG00000111249 HGNC:19347 CWF19L1 gene CWF19L1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 17, 616127;Autosomal recessive spinocerebellar ataxia type 17, 616127 False 3 100;0;0 21.569 False ENSG00000095485 ENSG00000095485 HGNC:25613 CWF19L1 gene CWF19L1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 17, MIM# 616127" 33012273;36453471;37752213 False 3 50;0;50 21.569 True ENSG00000095485 ENSG00000095485 HGNC:25613 CXorf56 gene CXorf56 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 107, MIM# 301013 29374277;31822863 False 3 100;0;0 21.569 True ENSG00000018610 ENSG00000018610 HGNC:26239 CYC1 gene CYC1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 6 MIM#615453 23910460;34252606 False 3 100;0;0 21.569 True ENSG00000179091 ENSG00000179091 HGNC:2579 CYCS gene CYCS Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Thrombocytopenia 4, MIM#612004 18345000;24326104;30051457 False 3 100;0;0 21.569 True ENSG00000172115 ENSG00000172115 HGNC:19986 CYFIP2 gene CYFIP2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 65, MIM#618008 29534297 False 3 100;0;0 21.569 True ENSG00000055163 ENSG00000055163 HGNC:13760 CYP27A1 gene CYP27A1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, MIM# 213700;Cholestanol storage disease;Dystonia 19373932;21531161;25424010 False 3 100;0;0 21.569 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis MIM#213700;Disorders of bile acid biosynthesis PMID: 16816916;20301583;22658436 False 3 100;0;0 21.569 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebrotendinous xanthomatosis, MIM# 213700;Cerebrotendinous xanthomatosis, infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas;Epilepsy;Parkinsonism;Ataxia;Peripheral neuropathy" PMID: 30054180 False 3 100;0;0 21.569 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, MIM# 213700 False 3 100;0;0 21.569 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Cholestanol storage disease False 3 100;0;0 21.569 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 NHS GMS;Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700 False 3 100;0;0 21.569 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebrotendinous xanthomatosis MIM#213700;Disorders of bile acid biosynthesis" 2019602 False 3 100;0;0 21.569 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700 False 3 100;0;0 21.569 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700;MONDO:0008948;progressive lower extremity spasticity,often disproportionate to any degree of weakness False 3 100;0;0 21.569 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP2U1 gene CYP2U1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 56, autosomal recessive, 615030 23176821;32006740;29034544 False 3 100;0;0 21.569 True ENSG00000155016 ENSG00000155016 HGNC:20582 CYP2U1 gene CYP2U1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 56, autosomal recessive, MIM# 615030" 30111349;33107650;23176821 False 3 100;0;0 21.569 True ENSG00000155016 ENSG00000155016 HGNC:20582 CYP2U1 gene CYP2U1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 56, autosomal recessive, MIM#615030 23176821 False 3 100;0;0 21.569 True ENSG00000155016 ENSG00000155016 HGNC:20582 CYP7B1 gene CYP7B1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 5A, autosomal recessive, MIM# 270800" 24117163;19439420;19187859 False 3 100;0;0 21.569 True ENSG00000172817 ENSG00000172817 HGNC:2652 CYP7B1 gene CYP7B1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 3 MIM#613812;Spastic paraplegia 5A, autosomal recessive MIM#270800;Disorders of bile acid biosynthesis 9802883;18252231;31337596 False 3 100;0;0 21.569 True ENSG00000172817 ENSG00000172817 HGNC:2652 CYP7B1 gene CYP7B1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 5A, autosomal recessive, MIM# 270800" 19439420;18252231 False 3 100;0;0 21.569 True ENSG00000172817 ENSG00000172817 HGNC:2652 CYP7B1 gene CYP7B1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood to adult-onset spastic paraplegia and bladder dysfunction, periventricular white matter abnormalities on MRI, one patient described with SNCV False 3 100;0;0 21.569 False ENSG00000172817 ENSG00000172817 HGNC:2652 D2HGDH gene D2HGDH Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal L2-Hydroxyglutaric aciduria False 3 0;0;0 21.569 False ENSG00000180902 ENSG00000180902 HGNC:28358 D2HGDH gene D2HGDH Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal D-2-hydroxyglutaric aciduria MIM#600721 25778941;31349060;15609246;20020533 False 3 100;0;0 21.569 True ENSG00000180902 ENSG00000180902 HGNC:28358 D2HGDH gene D2HGDH Expert Review Green;Expert Review Green;NHS GMS;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal D-2-hydroxyglutaric aciduria MIM#600721 25778941;31349060;15609246;20020533 False 3 100;0;0 21.569 True ENSG00000180902 ENSG00000180902 HGNC:28358 DAG1 gene DAG1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9, 613818 21388311;25934851;24052401;25503980 False 3 100;0;0 21.569 True ENSG00000173402 ENSG00000173402 HGNC:2666 DAGLA gene DAGLA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuroocular syndrome 2, paroxysmal type, MIM# 168885 35737950 False 3 100;0;0 21.569 True ENSG00000134780 ENSG00000134780 HGNC:1165 DAGLB gene DAGLB Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease, MONDO:0005180, DALGB-related 35715418;40244389 False 3 100;0;0 21.569 True ENSG00000164535 ENSG00000164535 HGNC:28923 DAP3 gene DAP3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 7, MIM# 621101 39701103 False 3 100;0;0 21.569 True ENSG00000132676 ENSG00000132676 HGNC:2673 DARS gene DARS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281 25527264;23643384 False 3 100;0;0 21.569 True ENSG00000115866 ENSG00000115866 HGNC:2678 DARS gene DARS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281" 23643384 False 3 100;0;0 21.569 True ENSG00000115866 ENSG00000115866 HGNC:2678 DARS2 gene DARS2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2LL, MIM# 621485 20506600;19592391;33574740;40814755 False 3 50;50;0 21.569 True ENSG00000117593 ENSG00000117593 HGNC:25538 DARS2 gene DARS2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation;Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105 False 3 100;0;0 21.569 False ENSG00000117593 ENSG00000117593 HGNC:25538 DARS2 gene DARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105 17384640;15002045;16788019 False 3 100;0;0 21.569 True ENSG00000117593 ENSG00000117593 HGNC:25538 DARS2 gene DARS2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, MIM# 611105" 17384640;15002045;16788019 False 3 100;0;0 21.569 True ENSG00000117593 ENSG00000117593 HGNC:25538 DBH gene DBH Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dopamine beta-hydroxylase deficiency, MIM#223360 11857564 False 3 100;0;0 21.569 True ENSG00000123454 ENSG00000123454 HGNC:2689 DBT gene DBT Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Maple syrup urine disease, type II (MIM#248600) False 3 100;0;0 21.569 True ENSG00000137992 ENSG00000137992 HGNC:2698 DCAF17 gene DCAF17 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Woodhouse-Sakati syndrome MONDO:0009419;Dystonia 18175354;36185913;17167799 False 3 100;0;0 21.569 True ENSG00000115827 ENSG00000115827 HGNC:25784 DCAF17 gene DCAF17 GeneReviews;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Woodhouse-Sakati syndrome False 3 100;0;0 21.569 False ENSG00000115827 ENSG00000115827 HGNC:25784 DCAF17 gene DCAF17 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Woodhouse-Sakati syndrome, MIM# 241080" 19026396;20507343 False 3 100;0;0 21.569 True ENSG00000115827 ENSG00000115827 HGNC:25784 DCTN1 gene DCTN1 Literature;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MONDO:0008201 20945553, 19136952, 24343258 False 3 100;0;0 21.569 True ENSG00000204843 ENSG00000204843 HGNC:2711 DCTN1 gene DCTN1 Literature;Expert Review Green;Expert Review Amber;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MONDO:0008201 20945553, 19136952, 24343258 False 3 100;0;0 21.569 False ENSG00000204843 ENSG00000204843 HGNC:2711 DCTN1 gene DCTN1 Expert list;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MONDO:0008201 20945553, 19136952, 24343258 False 3 100;0;0 21.569 True ENSG00000204843 ENSG00000204843 HGNC:2711 DCTN1 gene DCTN1 Expert Review Green;Literature;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuronopathy, distal hereditary motor, type 7B, MONDO:0011879 12627231;15326253;33443672;32023010;27573046 False 3 100;0;0 21.569 False ENSG00000204843 ENSG00000204843 HGNC:2711 DCX gene DCX Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Lissencephaly, X-linked, MIM# 300067;Subcortical laminal heterotopia, X-linked 300067 10915612;9489699;12552055 False 3 100;0;0 21.569 True ENSG00000077279 ENSG00000077279 HGNC:2714 DDC gene DDC Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aromatic L-amino acid decarboxylase deficiency, MIM# 608643 False 3 100;0;0 21.569 True ENSG00000132437 ENSG00000132437 HGNC:2719 DDC gene DDC Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aromatic L-amino acid decarboxylase deficiency, 608643;Dystonia 20505134 False 3 100;0;0 21.569 True ENSG00000132437 ENSG00000132437 HGNC:2719 DDC gene DDC Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aromatic L-amino acid decarboxylase deficiency, MIM# 608643 20505134 False 3 100;0;0 21.569 True ENSG00000132437 ENSG00000132437 HGNC:2719 DDHD1 gene DDHD1 ClinGen;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia 28, MONDO:0012256 15786464, 23176821, 24989667, 27216551, 26944165, 28818478, 29980238, 27999540, 33600578 False 3 50;50;0 21.569 True ENSG00000100523 ENSG00000100523 HGNC:19714 DDHD1 gene DDHD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia 28, MONDO:0012256 15786464, 23176821, 24989667, 27216551, 26944165, 28818478, 29980238, 27999540, 33600578 False 3 100;0;0 21.569 True ENSG00000100523 ENSG00000100523 HGNC:19714 DDHD2 gene DDHD2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive paraplegia 54 (#615033). Complex form of disease ataxia reported amongst the phenotypic features in Citterio et al. (2014), Journal of Neurology, 261, pp.373-381 and Doi et al. (2014), Scientific Reports, 4, 7132.;Spastic paraplegia 54 False 3 100;0;0 21.569 False ENSG00000085788 ENSG00000085788 HGNC:29106 DDHD2 gene DDHD2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 54, autosomal recessive, MIM# 615033;MONDO:0014018" 23486545;24482476;23176823 False 3 100;0;0 21.569 True ENSG00000085788 ENSG00000085788 HGNC:29106 DDOST gene DDOST Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal DDOST-congenital disorder of glycosylation MONDO:0013789 22305527 False 3 67;33;0 21.569 True ENSG00000244038 ENSG00000244038 HGNC:2728 DDX39B gene DDX39B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, DDX39B-related 39918047 False 3 100;0;0 21.569 True ENSG00000198563 ENSG00000198563 HGNC:13917 DDX3X gene DDX3X Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndrome, Snijders Blok type MIM# 300958 30266093;26235985;25533962;33528536;30936465;31274575;30817323 False 3 100;0;0 21.569 True ENSG00000215301 ENSG00000215301 HGNC:2745 DEAF1 gene DEAF1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, impaired expressive language, and with or without seizures 617171;Vulto-van Silfout-de Vries syndrome 615828 30923367;26048982;28940898;26834045 False 3 100;0;0 21.569 True ENSG00000177030 ENSG00000177030 HGNC:14677 DEGS1 gene DEGS1 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 21.569 True ENSG00000143753 ENSG00000143753 HGNC:13709 DEGS1 gene DEGS1 Expert Review Green;Expert list;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 18 618404 False 3 100;0;0 21.569 True ENSG00000143753 ENSG00000143753 HGNC:13709 DEGS1 gene DEGS1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy hypomyelinating 18, MIM#618404 31186544;30620337;30620338 False 3 100;0;0 21.569 True ENSG00000143753 ENSG00000143753 HGNC:13709 DENND5A gene DENND5A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 49, MIM# 617281 27431290;27866705;32705489 False 3 100;0;0 21.569 True ENSG00000184014 ENSG00000184014 HGNC:19344 DENND5B gene DENND5B Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with white matter anomalies, MONDO:0700092, DENND5B-related PMID: 38387458 False 3 100;0;0 21.569 True ENSG00000170456 ENSG00000170456 HGNC:28338 DEPDC5 gene DEPDC5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Epilepsy, familial focal, with variable foci 1 MIM#604364;Developmental and epileptic encephalopathy 111, MIM# 620504" 31444548;23542697;23542701 False 3 100;0;0 21.569 True ENSG00000100150 ENSG00000100150 HGNC:18423 DES gene DES Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Myofibrillar myopathy 1, MONDO:0011076 22395865, 20718792 False 3 50;50;0 21.569 True ENSG00000175084 ENSG00000175084 HGNC:2770 DGUOK gene DGUOK Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial Leukoencephalopathy;Mitochondrial DNA depletion syndrome 3 False 3 0;0;0 21.569 False ENSG00000114956 ENSG00000114956 HGNC:2858 DGUOK gene DGUOK Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070 11687800;12874104;15887277;23043144;26874653 False 3 50;0;50 21.569 True ENSG00000114956 ENSG00000114956 HGNC:2858 DGUOK gene DGUOK Expert Review Green;ClinGen Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070 11687800, 12874104, 15887277, 23043144, 26874653, 18205204, 29137425, 30956829, 35750291, 28215579, 20301766, 28215579, 17073823, 31127938 False 3 100;0;0 21.569 True ENSG00000114956 ENSG00000114956 HGNC:2858 DGUOK gene DGUOK Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070 11687800, 12874104, 15887277, 23043144, 26874653, 18205204, 29137425, 30956829, 35750291, 28215579, 20301766, 28215579, 17073823, 31127938 False 3 100;0;0 21.569 True ENSG00000114956 ENSG00000114956 HGNC:2858 DHCR24 gene DHCR24 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Desmosterolosis, MONDO:0011217 11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936 False 3 100;0;0 21.569 True ENSG00000116133 ENSG00000116133 HGNC:2859 DHCR24 gene DHCR24 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Desmosterolosis, MONDO:0011217 11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936 False 3 100;0;0 21.569 True ENSG00000116133 ENSG00000116133 HGNC:2859 DHCR7 gene DHCR7 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Smith-Lemli-Opitz syndrome MIM#270400;Disorders of sterol biosynthesis 7560069;9634533 False 3 100;0;0 21.569 True ENSG00000172893 ENSG00000172893 HGNC:2860 DHDDS gene DHDDS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental delay and seizures with or without movement abnormalities, MIM#617836;Congenital disorder of glycosylation, MIM#613861 29100083;27343064 False 3 100;0;0 21.569 True ENSG00000117682 ENSG00000117682 HGNC:20603 DHDDS gene DHDDS Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type 1bb, MIM# 621567 27343064;21295283;28130426;29276052;32483926;36046393;24078709;28005406;36046393 False 3 100;0;0 21.569 True ENSG00000117682 ENSG00000117682 HGNC:20603 DHDDS gene DHDDS Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay and seizures with or without movement abnormalities, OMIM:617836 29100083;33798445;34182312;34382076 False 3 100;0;0 21.569 True ENSG00000117682 ENSG00000117682 HGNC:20603 DHFR gene DHFR Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Megaloblastic anemia due to dihydrofolate reductase deficiency, MIM# 613839" 21310276;21310277 False 3 100;0;0 21.569 True ENSG00000228716 ENSG00000228716 HGNC:2861 DHH gene DHH Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 46,XY gonadal dysgenesis-motor and sensory neuropathy syndrome, MONDO:0011766 31018998;29471294;11017805 False 3 100;0;0 21.569 True ENSG00000139549 ENSG00000139549 HGNC:2865 DHODH gene DHODH Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Miller syndrome MIM#263750;Disorders of pyrimidine metabolism 19915526 False 3 100;0;0 21.569 True ENSG00000102967 ENSG00000102967 HGNC:2867 DHPS gene DHPS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures and speech and walking impairment, MIM#618480 30661771 False 3 100;0;0 21.569 True ENSG00000095059 ENSG00000095059 HGNC:2869 DHRSX gene DHRSX Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Congenital disorder of glycosylation, type 1DD, MIM# 301133" 38821050 False 3 100;0;0 21.569 True ENSG00000169084 ENSG00000169084 HGNC:18399 DHRSX gene DHRSX Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type 1DD, MIM# 301133 38821050 False 3 100;0;0 21.569 True ENSG00000169084 ENSG00000169084 HGNC:18399 DHTKD1 gene DHTKD1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 2-aminoadipic 2-oxoadipic aciduria MONDO:0008774 26141459, 25860818, 23141293 False 3 100;0;0 21.569 True ENSG00000181192 ENSG00000181192 HGNC:23537 DHX16 gene DHX16 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuromuscular disease and ocular or auditory anomalies with or without seizures, MIM# 618733 PMID: 31256877;36211162 False 3 100;0;0 21.569 True ENSG00000204560 ENSG00000204560 HGNC:2739 DHX30 gene DHX30 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with severe motor impairment and absent language, MIM#617804 29100085 False 3 100;0;0 21.569 True ENSG00000132153 ENSG00000132153 HGNC:16716 DHX9 gene DHX9 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, MONDO:0015626, DHX9-related 37467750 False 3 100;0;0 21.569 False ENSG00000135829 ENSG00000135829 HGNC:2750 DIAPH1 gene DIAPH1 Literature;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive microcephaly-seizures-cortical blindness-developmental delay syndrome, MONDO:0014714 24781755, 26463574, 33662367, 36212620, 39076976, 39120629 False 3 100;0;0 21.569 True ENSG00000131504 ENSG00000131504 HGNC:2876 DIP2C gene DIP2C Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092), DIP2C-related PMID: 38421105 False 3 50;50;0 21.569 True ENSG00000151240 ENSG00000151240 HGNC:29150 DLAT gene DLAT Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase E2 deficiency MIM#245348 34138529 False 3 100;0;0 21.569 True ENSG00000150768 ENSG00000150768 HGNC:2896 DLAT gene DLAT Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase E2 deficiency 245348;Dystonia 39007626;20022530;16049940 False 3 100;0;0 21.569 True ENSG00000150768 ENSG00000150768 HGNC:2896 DLD gene DLD Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dihydrolipoamide dehydrogenase deficiency MIM#246900 3769994;8506365;9934985;17404228;21558426;21930696 False 3 100;0;0 21.569 True ENSG00000091140 ENSG00000091140 HGNC:2898 DLG4 gene DLG4 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 62 MIM#618793 33597769 False 3 100;0;0 21.569 True ENSG00000132535 ENSG00000132535 HGNC:2903 DLL1 gene DLL1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;autism;seizures;variable brain abnormalities;scoliosis 31353024 False 3 100;0;0 21.569 True ENSG00000198719 ENSG00000198719 HGNC:2908 DMD gene DMD Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Becker muscular dystrophy 300376 20301298 False 3 100;0;0 21.569 True ENSG00000198947 ENSG00000198947 HGNC:2928 DMD gene DMD Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Duchenne muscular dystrophy 310200;Becker muscular dystrophy 300376 20301298 False 3 100;0;0 21.569 True ENSG00000198947 ENSG00000198947 HGNC:2928 DMXL2 gene DMXL2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 81, MIM# 618663" 31688942;30237576 False 3 100;0;0 21.569 True ENSG00000104093 ENSG00000104093 HGNC:2938 DNA2 gene DNA2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Seckel syndrome 8, MIM#615807;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 6 MIM#615156 24389050;31045292;23352259;25635128;28554558 False 3 100;0;0 21.569 True ENSG00000138346 ENSG00000138346 HGNC:2939 DNA2 gene DNA2 Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 6 MIM#615156 31636600;23352259;25635128;28554558 False 3 50;50;0 21.569 True ENSG00000138346 ENSG00000138346 HGNC:2939 DNAJB2 gene DNAJB2 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881) False 3 100;0;0 21.569 True ENSG00000135924 ENSG00000135924 HGNC:5228 DNAJB2 gene DNAJB2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881) 22522442;25274842;33369814;22522442 False 3 100;0;0 21.569 False ENSG00000135924 ENSG00000135924 HGNC:5228 DNAJB4 gene DNAJB4 Expert Review Green;Literature;Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal distal myopathy MONDO:0018949;Myopathy, MONDO:0005336, DNAJB4-related 36512060;36264506 False 3 100;0;0 21.569 True ENSG00000162616 ENSG00000162616 HGNC:14886 DNAJB6 gene DNAJB6 Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Muscular dystrophy, limb-girdle, type 1E, 603511 26847086;26338452;24170373 False 3 100;0;0 21.569 True ENSG00000105993 ENSG00000105993 HGNC:14888 DNAJC12 gene DNAJC12 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hyperphenylalaninemia, mild, non-BH4-deficient, MIM# 617384" 28132689;30139987;28892570 False 3 100;0;0 21.569 True ENSG00000108176 ENSG00000108176 HGNC:28908 DNAJC12 gene DNAJC12 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384 False 3 100;0;0 21.569 True ENSG00000108176 ENSG00000108176 HGNC:28908 DNAJC12 gene DNAJC12 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, mild, non-BH4-deficient, 617384 False 3 100;0;0 21.569 True ENSG00000108176 ENSG00000108176 HGNC:28908 DNAJC19 gene DNAJC19 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type V 610198;dilated cardiomyopathy with ataxia (DCMA) syndrome;3-methylglutaconic aciduria type V, 610198 False 3 100;0;0 21.569 False ENSG00000205981 ENSG00000205981 HGNC:30528 DNAJC19 gene DNAJC19 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type V MIM#610198 16055927;17244376;22797137 False 3 100;0;0 21.569 True ENSG00000205981 ENSG00000205981 HGNC:30528 DNAJC3 gene DNAJC3 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, combined cerebellar and peripheral, with hearing loss and diabetes mellitus, MIM# 616192 25466870;32738013;34654017 False 3 100;0;0 21.569 True ENSG00000102580 ENSG00000102580 HGNC:9439 DNAJC3 gene DNAJC3 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile-onset diabetes mellitus-central and peripheral neurodegeneration syndrome, MONDO:0014523 34654017;34630333;33486469;32738013;28940199 False 3 100;0;0 21.569 True ENSG00000102580 ENSG00000102580 HGNC:9439 DNAJC30 gene DNAJC30 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leber Hereditary Optic Neuropathy, MIM#619382 PMID: 33465056 False 3 100;0;0 21.569 True ENSG00000176410 ENSG00000176410 HGNC:16410 DNAJC5 gene DNAJC5 Expert list;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 21820099;22073189;22235333;22978711 False 3 100;0;0 21.569 True ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC5 gene DNAJC5 Expert list;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 22978711;21820099;22235333 False 3 100;0;0 21.569 True ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC5 gene DNAJC5 Expert list;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 22978711;21820099;22235333;31919451;26659577 False 3 100;0;0 21.569 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC5 gene DNAJC5 Expert Review Green;ClinGen Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 22978711;21820099;22235333;31919451;26659577 False 3 100;0;0 21.569 True ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC5 gene DNAJC5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 False 3 100;0;0 21.569 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC6 gene DNAJC6 Expert list;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 19a, juvenile-onset - MIM#615528;Parkinson disease 19b, early-onset - MIM#615528 22563501, 23211418, 26528954, 33983693 False 3 100;0;0 21.569 True ENSG00000116675 ENSG00000116675 HGNC:15469 DNM1 gene DNM1 Literature;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 31A, autosomal dominant, MIM# 616346;Developmental and epileptic encephalopathy 31B, autosomal recessive, MIM# 620352 25262651;27066543;33372033;34172529;36553519;37900685 False 3 100;0;0 21.569 True ENSG00000106976 ENSG00000106976 HGNC:2972 DNM1L gene DNM1L ClinGen;Literature;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726 31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748 False 3 0;0;0 21.569 False Other ENSG00000087470 ENSG00000087470 HGNC:2973 DNM1L gene DNM1L Literature;ClinGen;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726 31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748 False 3 100;0;0 21.569 True Other ENSG00000087470 ENSG00000087470 HGNC:2973 DNM1L gene DNM1L Expert Review Green;Literature;ClinGen Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Encephalopathy, lethal, due to defective mitochondrial peroxisomal fission 1, MONDO:0013726 31587467, 27145208, 26604000, 27301544, 26931468, 33718295, 30109270, 26825290, 27328748 False 3 100;0;0 21.569 True Other ENSG00000087470 ENSG00000087470 HGNC:2973 DNM2 gene DNM2 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant centronuclear myopathy MONDO:0008048 16227997;33458580;30232666;24465259;23938035 False 3 100;0;0 21.569 True ENSG00000079805 ENSG00000079805 HGNC:2974 DNM2 gene DNM2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Centronuclear myopathy 1 160150 AD 3 Charcot-Marie-Tooth disease, axonal type 2M, MIM# 606482;Charcot-Marie-Tooth disease, dominant intermediate B, MIM# 606482;Lethal congenital contracture syndrome 5, MIM# 615368" False 3 100;0;0 21.569 True ENSG00000079805 ENSG00000079805 HGNC:2974 DNM2 gene DNM2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal type 2M, MIM# 606482;Charcot-Marie-Tooth disease, dominant intermediate B, MIM# 606482;MONDO:0011674 15731758;17636067;33459893;31628461 False 3 100;0;0 21.569 False ENSG00000079805 ENSG00000079805 HGNC:2974 DNMT1 gene DNMT1 Expert Review Green;ClinGen;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 False 3 100;0;0 21.569 False ENSG00000130816 ENSG00000130816 HGNC:2976 DNMT1 gene DNMT1 Expert Review Green;ClinGen;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 False 3 100;0;0 21.569 False ENSG00000130816 ENSG00000130816 HGNC:2976 DNMT1 gene DNMT1 ClinGen;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 False 3 0;100;0 21.569 False ENSG00000130816 ENSG00000130816 HGNC:2976 DOCK3 gene DOCK3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292 False 3 100;0;0 21.569 True ENSG00000088538 ENSG00000088538 HGNC:2989 DOCK6 gene DOCK6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Adams-Oliver syndrome 2 MIM#614219 28884918;40481473;30111349 False 3 100;0;0 21.569 True ENSG00000130158 ENSG00000130158 HGNC:19189 DOCK7 gene DOCK7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 23 MIM#615859;MONDO:0014371 24814191;30771731;30807358 False 3 100;0;0 21.569 True ENSG00000116641 ENSG00000116641 HGNC:19190 DOHH gene DOHH Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, DOHH-related (MONDO#0700092) PMID: 30661771;35858628 False 3 100;0;0 21.569 True ENSG00000129932 ENSG00000129932 HGNC:28662 DOK7 gene DOK7 Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Myasthenic syndrome, congenital, 10 254300" 31453852;32360404;31561939;31449669 False 3 100;0;0 21.569 True ENSG00000175920 ENSG00000175920 HGNC:26594 DOLK gene DOLK Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation type Im, 610768 23890587;28816422;24144945 False 3 100;0;0 21.569 True ENSG00000175283 ENSG00000175283 HGNC:23406 DOLK gene DOLK Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal DK1-CDG, MONDO:0012556;Congenital disorder of glycosylation, type Im, MIM# 610768 17273964;22242004;23890587;30653653;28816422;24144945 False 3 100;0;0 21.569 True ENSG00000175283 ENSG00000175283 HGNC:23406 DPAGT1 gene DPAGT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ij, MIM# 608093;DPAGT1-CDG MONDO:0011964 12872255;22492991;22304930;31153949;30653653;30117111 False 3 100;0;0 21.569 True ENSG00000172269 ENSG00000172269 HGNC:2995 DPAGT1 gene DPAGT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ij, MIM# 608093;DPAGT1-CDG MONDO:0011964 12872255;22492991;22304930;31153949;30653653;30117111 False 3 100;0;0 21.569 True ENSG00000172269 ENSG00000172269 HGNC:2995 DPM1 gene DPM1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ie, 608799 23856421 False 3 100;0;0 21.569 True ENSG00000000419 ENSG00000000419 HGNC:3005 DPM1 gene DPM1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ie, MIM# 608799 23856421;16641202;10642602;10642597 False 3 100;0;0 21.569 True ENSG00000000419 ENSG00000000419 HGNC:3005 DPM2 gene DPM2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Iu, MIM#615042 23109149;33129689 False 3 100;0;0 21.569 True ENSG00000136908 ENSG00000136908 HGNC:3006 DPM3 gene DPM3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 , MIM#612937;Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992 31266720;28803818;19576565;31266720;31469168 False 3 100;0;0 21.569 True ENSG00000179085 ENSG00000179085 HGNC:3007 DPM3 gene DPM3 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 MIM#612937" 19576565;28803818;31266720 False 3 100;0;0 21.569 True ENSG00000179085 ENSG00000179085 HGNC:3007 DPYD gene DPYD Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dihydropyrimidine dehydrogenase deficiency, MIM# 274270 19296131;10071185;29152729 False 3 100;0;0 21.569 True ENSG00000188641 ENSG00000188641 HGNC:3012 DPYD gene DPYD Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dihydropyrimidine dehydrogenase deficiency MIM#274270;5-fluorouracil toxicity MIM#274270;Disorders of pyrimidine metabolism 8051923 False 3 100;0;0 21.569 True ENSG00000188641 ENSG00000188641 HGNC:3012 DPYD gene DPYD Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dihydropyrimidine dehydrogenase deficiency 274270;5-fluorouracil toxicity 274270 False 3 0;0;0 21.569 False ENSG00000188641 ENSG00000188641 HGNC:3012 DPYS gene DPYS Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dihydropyrimidinuria MIM#222748;Disorders of pyrimidine metabolism False 3 100;0;0 21.569 True ENSG00000147647 ENSG00000147647 HGNC:3013 DRD2 gene DRD2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Combined dystonia, MONDO:0020065, DRD2-related;dystonia;chorea;anxiety;ataxia;orofacial dyskinesia;tremor;memory problems 33200438 False 3 100;0;0 21.569 True Other ENSG00000149295 ENSG00000149295 HGNC:3023 DRP2 gene DRP2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot Marie Tooth, intermediate X-linked;HMSN 22764250;26227883;31217940 False 3 100;0;0 21.569 False ENSG00000102385 ENSG00000102385 HGNC:3032 DST gene DST Literature;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neuropathy, hereditary sensory and autonomic, type VI, MIM# 614653;MONDO:0013839;HSAN/SFN" 22522446;30371979;28468842 False 3 100;0;0 21.569 False ENSG00000151914 ENSG00000151914 HGNC:1090 DST gene DST Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VI MIM#614653 28468842;32528525;22522446;30371979 False 3 100;0;0 21.569 True ENSG00000151914 ENSG00000151914 HGNC:1090 DTNA gene DTNA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, MONDO:0020121, DTNA-related PMID: 36799992 False 3 50;50;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000134769 ENSG00000134769 HGNC:3057 DYNC1H1 gene DYNC1H1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 20, MIM# 614228 21820100;32788638;27549087 False 3 100;0;0 21.569 False ENSG00000197102 ENSG00000197102 HGNC:2961 DYNC1H1 gene DYNC1H1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 13, MIM# 614563 21820100;32788638;27549087;25512093;28196890 False 3 100;0;0 21.569 True ENSG00000197102 ENSG00000197102 HGNC:2961 DYRK1A gene DYRK1A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 7, MIM# 614104;MONDO:0013578 25707398;21294719;23160955;23099646;33159716 False 3 100;0;0 21.569 True ENSG00000157540 ENSG00000157540 HGNC:3091 DYSF gene DYSF Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2B 253601;Myopathy, distal, with anterior tibial onset 606768;Miyoshi muscular dystrophy 1 254130 32978841;27602406 False 3 100;0;0 21.569 True ENSG00000135636 ENSG00000135636 HGNC:3097 DYSF gene DYSF Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, distal, with anterior tibial onset, 606768;Miyoshi muscular dystrophy 1, 254130;Muscular dystrophy, limb-girdle, type 2B, 253601 23243261 False 3 100;0;0 21.569 True ENSG00000135636 ENSG00000135636 HGNC:3097 EARS2 gene EARS2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Combined oxidative phosphorylation deficiency 12, MIM# 614924;Leukoencephalopathy with thalamus and brainstem involvement and high lactate" 22492562;23008233;25854774;26619324;26893310 False 3 100;0;0 21.569 True ENSG00000103356 ENSG00000103356 HGNC:29419 EARS2 gene EARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome MONDO:0009723;Combined oxidative phosphorylation deficiency 12 MIM#614924;leukoencephalopathy-thalamus and brainstem anomalies-high lactate syndrome MONDO:0013971 22492562;23008233;25854774;26619324;26893310;27206875;27571996;27117034 False 3 100;0;0 21.569 True ENSG00000103356 ENSG00000103356 HGNC:29419 EARS2 gene EARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome MONDO:0009723;Combined oxidative phosphorylation deficiency 12 MIM#614924;leukoencephalopathy-thalamus and brainstem anomalies-high lactate syndrome MONDO:0013971 22492562;23008233;25854774;26619324;26893310;27206875;27571996;27117034 False 3 100;0;0 21.569 True ENSG00000103356 ENSG00000103356 HGNC:29419 EBF3 gene EBF3 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia and delayed development syndrome, 617330 False 3 100;0;0 21.569 False ENSG00000108001 ENSG00000108001 HGNC:19087 ECHS1 gene ECHS1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome MONDO:0009723 26000322;25393721;25125611;28409271;29575569;28755360;26099313 False 3 100;0;0 21.569 True ENSG00000127884 ENSG00000127884 HGNC:3151 ECHS1 gene ECHS1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277" 31399326;25125611;25393721 False 3 100;0;0 21.569 True ENSG00000127884 ENSG00000127884 HGNC:3151 ECHS1 gene ECHS1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277" 32677093;32858208 False 3 100;0;0 21.569 True ENSG00000127884 ENSG00000127884 HGNC:3151 ECHS1 gene ECHS1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277 PMID: 29575569;35098523 False 3 100;0;0 21.569 True ENSG00000127884 ENSG00000127884 HGNC:3151 ECM1 gene ECM1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Urbach-Wiethe disease, MIM# 247100 PMID: 11929856;28434238 False 3 100;0;0 21.569 True ENSG00000143369 ENSG00000143369 HGNC:3153 ECM1 gene ECM1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Urbach-Wiethe disease, MIM# 247100 27398129;26336196;12603844 False 3 100;0;0 21.569 True ENSG00000143369 ENSG00000143369 HGNC:3153 EDEM3 gene EDEM3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type 2V, MIM# 619493 34143952 False 3 100;0;0 21.569 True ENSG00000116406 ENSG00000116406 HGNC:16787 EEF1A2 gene EEF1A2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 38, MIM# 616393;MONDO:0014617;Developmental and epileptic encephalopathy 33, MIM# 616409;MONDO:0014625 24697219;32196822;32160274;32062104;31893083 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000101210 ENSG00000101210 HGNC:3192 EEF1B2 gene EEF1B2 Expert Review Green;Literature;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder MONDO:0700092;non-syndromic ID and seizures 31845318;21937992;35015920 False 3 100;0;0 21.569 True ENSG00000114942 ENSG00000114942 HGNC:3208 EEFSEC gene EEFSEC Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102 39753114 False 3 100;0;0 21.569 True ENSG00000132394 ENSG00000132394 HGNC:24614 EEFSEC gene EEFSEC Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102 39753114 False 3 100;0;0 21.569 True ENSG00000132394 ENSG00000132394 HGNC:24614 EFTUD2 gene EFTUD2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mandibulofacial dysostosis, Guion-Almeida type, MIM#610536 22305528;19334086 False 3 100;0;0 21.569 True ENSG00000108883 ENSG00000108883 HGNC:30858 EGR2 gene EGR2 Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 1D 607678 AD;Dejerine-Sottas disease 145900 AD, AR;Hypomyelinating neuropathy, congenital, 1 605253 AD, AR 11523566;31852952 False 3 100;0;0 21.569 False Other ENSG00000122877 ENSG00000122877 HGNC:3239 EHMT1 gene EHMT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Kleefstra syndrome 1, MIM# 610253;MONDO:0027407 16826528;19264732;19293338;22670143;30448833 False 3 100;0;0 21.569 True ENSG00000181090 ENSG00000181090 HGNC:24650 EIF2AK2 gene EIF2AK2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness;early onset dystonia 33236446;33866603 False 3 100;0;0 21.569 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2AK2 gene EIF2AK2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877;Neurodevelopmental Syndrome;Developmental delays;Ataxia;Parkinsonism;White matter alterations PMID: 32197074 False 3 100;0;0 21.569 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2AK2 gene EIF2AK2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness 32197074 False 3 100;0;0 21.569 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2AK2 gene EIF2AK2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877 PMID: 32197074 False 3 100;0;0 21.569 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2B1 gene EIF2B1 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896;Neonatal diabetes mellitus, MONDO:0016391, EIF2B1-related 11835386;26285592;15776425;18263758;25843247;25761052;30014503;31882561 False 3 100;0;0 21.569 True ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B1 gene EIF2B1 Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 21.569 True ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B1 gene EIF2B1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy with vanishing white matter, MIM# 603896" False 3 100;0;0 21.569 True ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B2 gene EIF2B2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy with vanishing white matter, MIM# 603896" False 3 100;0;0 21.569 True ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B2 gene EIF2B2 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter, MIM#603896;Ovarioleukodystrophy, MIM# 603896 21484434;14566705;28041799;30266093;28597716 False 3 100;0;0 21.569 True ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B2 gene EIF2B2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 21.569 True ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B3 gene EIF2B3 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal leukoencephalopathy with vanishing white matter MONDO:0011380 11835386;19158808;21484434;18263758;25843247;25761052;28904586;28597716 False 3 100;0;0 21.569 True ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B3 gene EIF2B3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy with vanishing white matter, MIM# 603896" False 3 100;0;0 21.569 True ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B3 gene EIF2B3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 21.569 True ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B4 gene EIF2B4 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy with vanishing white matter, MIM# 603896" False 3 100;0;0 21.569 True ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B4 gene EIF2B4 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal leukoencephalopathy with vanishing white matter MONDO:0011380 11835386;12707859;18263758;25843247;25761052;30014503 False 3 100;0;0 21.569 True ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B4 gene EIF2B4 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 21.569 True ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B5 gene EIF2B5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 21.569 True ENSG00000145191 ENSG00000145191 HGNC:3261 EIF2B5 gene EIF2B5 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal leukoencephalopathy with vanishing white matter MONDO:0011380 11704758;12325082;12707859;14694060;15136689;18263758;25843247;25761052 False 3 100;0;0 21.569 True ENSG00000145191 ENSG00000145191 HGNC:3261 EIF2B5 gene EIF2B5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy with vanishing white matter, MIM# 603896" False 3 100;0;0 21.569 True ENSG00000145191 ENSG00000145191 HGNC:3261 EIF2S3 gene EIF2S3 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females MEHMO syndrome MIM# 300148 33714664;32799315;28055140 False 3 100;0;0 21.569 True ENSG00000130741 ENSG00000130741 HGNC:3267 EIF3F gene EIF3F Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mental retardation, autosomal recessive 67, MIM# 618295" 30409806 False 3 100;0;0 21.569 True ENSG00000175390 ENSG00000175390 HGNC:3275 EIF4A2 gene EIF4A2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455 PMID: 36528028 False 3 100;0;0 21.569 True Other ENSG00000156976 ENSG00000156976 HGNC:3284 EIF4A2 gene EIF4A2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455 37485550 False 3 100;0;0 21.569 True ENSG00000156976 ENSG00000156976 HGNC:3284 ELAC2 gene ELAC2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 17, MIM#615440 23849775;31045291 False 3 100;0;0 21.569 True ENSG00000006744 ENSG00000006744 HGNC:14198 ELFN1 gene ELFN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dursun-Ozgul neurodevelopmental syndrome, MIM# 621344 PMID:40576023 False 3 100;0;0 21.569 True ENSG00000225968 ENSG00000225968 HGNC:33154 ELFN1 gene ELFN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dursun-Ozgul neurodevelopmental syndrome, MIM# 621344 PMID:40576023 False 3 100;0;0 21.569 True ENSG00000225968 ENSG00000225968 HGNC:33154 ELOVL1 gene ELOVL1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, MIM# 618527" 29496980;32123819;30487246 False 3 100;0;0 21.569 True ENSG00000066322 ENSG00000066322 HGNC:14418 ELOVL1 gene ELOVL1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, MIM# 618527 29496980;32123819;30487246 False 3 100;0;0 21.569 False ENSG00000066322 ENSG00000066322 HGNC:14418 ELOVL4 gene ELOVL4 Expert Review Green;Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ichthyosis, spastic quadriplegia, and mental retardation (MIM#614457) 22100072;24571530;33652762 False 3 100;0;0 21.569 True ENSG00000118402 ENSG00000118402 HGNC:14415 ELOVL4 gene ELOVL4 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190 False 3 100;0;0 21.569 False ENSG00000118402 ENSG00000118402 HGNC:14415 ELOVL5 gene ELOVL5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 38, MIM#615957 25065913 False 3 100;0;0 21.569 False ENSG00000012660 ENSG00000012660 HGNC:21308 ELP1 gene ELP1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dysautonomia, familial, 223900;Riley-Day syndrome MONDO:0009131;Hereditary sensory and autonomic neuropathy 3;HSAN/SFN 11179008;11179021;17644305 False 3 100;0;0 21.569 False ENSG00000070061 ENSG00000070061 HGNC:5959 ELP1 gene ELP1 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Familial dysautonomia;NEUROPATHY, HEREDITARY SENSORY AND AUTONOMIC, TYPE III;Dysautonomia, familial, 223900 17985250;11179021;11179008;8102296 False 3 0;0;0 21.569 False ENSG00000070061 ENSG00000070061 HGNC:5959 EMC1 gene EMC1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, EMC1-related 35234901;26942288 False 3 100;0;0 21.569 True ENSG00000127463 ENSG00000127463 HGNC:28957 EMC10 gene EMC10 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with dysmorphic facies and variable seizures, MIM# 619264 32869858;33531666;35684946;37318954;40150819 False 3 100;0;0 21.569 True ENSG00000161671 ENSG00000161671 HGNC:27609 EMD gene EMD Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Emery-Dreifuss muscular dystrophy 1, X-linked 310300 21697856;31802929 False 3 100;0;0 21.569 True ENSG00000102119 ENSG00000102119 HGNC:3331 EML1 gene EML1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Band heterotopia (MIM# 600348) 31710781 False 3 100;0;0 21.569 True ENSG00000066629 ENSG00000066629 HGNC:3330 ENG gene ENG Expert Review Green;Genomics England PanelApp;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Telangiectasia, hereditary hemorrhagic, type 1 187300 15024723;20301525 False 3 100;0;0 21.569 False ENSG00000106991 ENSG00000106991 HGNC:3349 ENO3 gene ENO3 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XIII 612932 11506403;31741825;25267339 False 3 100;0;0 21.569 True ENSG00000108515 ENSG00000108515 HGNC:3354 ENO3 gene ENO3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XIII, MIM#612932 31741825;11506403;18070103;25267339 False 3 100;0;0 21.569 True ENSG00000108515 ENSG00000108515 HGNC:3354 ENTPD1 gene ENTPD1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 64, autosomal recessive MIM#615683 24482476;30652007;35471564 False 3 100;0;0 21.569 True ENSG00000138185 ENSG00000138185 HGNC:3363 ENTPD1 gene ENTPD1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 64, autosomal recessive, MIM# 615683 35471564 False 3 100;0;0 21.569 True ENSG00000138185 ENSG00000138185 HGNC:3363 EOGT gene EOGT Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Adams-Oliver syndrome 4 (MIM #615297);scalp aplasia cutis congenita;transverse terminal limb defects False 3 100;0;0 21.569 True ENSG00000163378 ENSG00000163378 HGNC:28526 EP400 gene EP400 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder with or without early-onset generalized epilepsy - MONDO:0030930 39708813 False 3 100;0;0 21.569 True ENSG00000183495 ENSG00000183495 HGNC:11958 EPB41L3 gene EPB41L3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities MONDO:0030063 39292993 False 3 100;0;0 21.569 True ENSG00000082397 ENSG00000082397 HGNC:3380 EPG5 gene EPG5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506 41053928;36410285;40192014 False 3 100;0;0 21.569 True ENSG00000152223 ENSG00000152223 HGNC:29331 EPG5 gene EPG5 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of autophagy;Vici syndrome MONDO:0009452;Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506 33674710;34130600;29884839;41053928;36410285;40192014 False 3 100;0;0 21.569 True ENSG00000152223 ENSG00000152223 HGNC:29331 EPG5 gene EPG5 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Vici syndrome MIM#242840;Congenital disorders of autophagy 23222957;26715604 False 3 100;0;0 21.569 True ENSG00000152223 ENSG00000152223 HGNC:29331 EPG5 gene EPG5 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Vici syndrome, MIM# 242840 23222957;26917586 False 3 100;0;0 21.569 True ENSG00000152223 ENSG00000152223 HGNC:29331 EPHB4 gene EPHB4 Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Capillary malformation-arteriovenous malformation 2, 618196 False 3 100;0;0 21.569 False ENSG00000196411 ENSG00000196411 HGNC:3395 EPM2A gene EPM2A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lafora disease MONDO:0009697 9771710;9931343;11175283;12019207;12560877;14722920 False 3 100;0;0 21.569 True ENSG00000112425 ENSG00000112425 HGNC:3413 EPM2A gene EPM2A Expert Review Green;Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2A, Lafora, 254780;Epilepsy, progressive myoclonic 2A (Lafora) 254780 False 3 100;0;0 21.569 False ENSG00000112425 ENSG00000112425 HGNC:3413 EPM2A gene EPM2A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2A (Lafora) MIM#254780 12019207 False 3 100;0;0 21.569 True ENSG00000112425 ENSG00000112425 HGNC:3413 EPM2A gene EPM2A Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780 9771710 False 3 100;0;0 21.569 True ENSG00000112425 ENSG00000112425 HGNC:3413 EPRS gene EPRS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 15, MIM# 617951" 29576217 False 3 100;0;0 21.569 True ENSG00000136628 ENSG00000136628 HGNC:3418 ERBB4 gene ERBB4 Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 19 MIM#615515 24119685;28889094 False 3 100;0;0 21.569 True ENSG00000178568 ENSG00000178568 HGNC:3432 ERCC4 gene ERCC4 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM# 278760" 29403087;28431612;29892709 False 3 100;0;0 21.569 False ENSG00000175595 ENSG00000175595 HGNC:3436 ERCC6 gene ERCC6 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome;UV-sensitive syndrome;General Leukodystrophy & Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000225830 ENSG00000225830 HGNC:3438 ERCC6 gene ERCC6 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type B MIM#133540 25453614;20301516 False 3 100;0;0 21.569 True ENSG00000225830 ENSG00000225830 HGNC:3438 ERCC6 gene ERCC6 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type B, MIM#133540 17092472;20522568 False 3 100;0;0 21.569 True ENSG00000225830 ENSG00000225830 HGNC:3438 ERCC8 gene ERCC8 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type A, MIM# 216400 26204423;17092472;20522568 False 3 100;0;0 21.569 True ENSG00000049167 ENSG00000049167 HGNC:3439 ERCC8 gene ERCC8 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne Syndrome;UV-sensitive syndrome;General Leukodystrophy & Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000049167 ENSG00000049167 HGNC:3439 ERCC8 gene ERCC8 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type A MIM#216400 False 3 100;0;0 21.569 True ENSG00000049167 ENSG00000049167 HGNC:3439 ERLIN1 gene ERLIN1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 62, 615681;Hereditary spastic paraplegia False 3 100;0;0 21.569 True ENSG00000107566 ENSG00000107566 HGNC:16947 ERLIN2 gene ERLIN2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 18, autosomal recessive, MIM# 611225;Spastic paraplegia 18A, autosomal dominant, MIM# 620512 23109145;21330303;32094424;29528531 False 3 100;0;0 21.569 True ENSG00000147475 ENSG00000147475 HGNC:1356 ERLIN2 gene ERLIN2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal hereditary spastic paraplegia 18 MONDO:0012639 38607533;38427163;34734492;32042907 False 3 100;0;0 21.569 True ENSG00000147475 ENSG00000147475 HGNC:1356 ESAM gene ESAM Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with intracranial haemorrhage, seizures, and spasticity, MIM# 620371 36996813 False 3 100;0;0 21.569 True ENSG00000149564 ENSG00000149564 HGNC:17474 ESAM gene ESAM Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with intracranial haemorrhage, seizures, and spasticity, MIM# 620371 36996813 False 3 100;0;0 21.569 True ENSG00000149564 ENSG00000149564 HGNC:17474 ESRRG gene ESRRG Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Movement disorder, MONDO:0005395, ESRRG-related 41265451 False 3 100;0;0 21.569 True ENSG00000196482 ENSG00000196482 HGNC:3474 ETFA gene ETFA Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIA 231680 21347544;1430199 False 3 100;0;0 21.569 True ENSG00000140374 ENSG00000140374 HGNC:3481 ETFA gene ETFA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIA, MIM# 231680 False 3 100;0;0 21.569 True ENSG00000140374 ENSG00000140374 HGNC:3481 ETFA gene ETFA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIA MIM#231680;Multiple acyl-CoA dehydrogenase deficiency (MADD) 1882842;12815589 False 3 100;0;0 21.569 True ENSG00000140374 ENSG00000140374 HGNC:3481 ETFB gene ETFB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIB, MIM# 231680 False 3 100;0;0 21.569 True ENSG00000105379 ENSG00000105379 HGNC:3482 ETFB gene ETFB Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIB MIM#231680;Multiple acyl-CoA dehydrogenase deficiency (MADD) 12815589;7912128 False 3 100;0;0 21.569 True ENSG00000105379 ENSG00000105379 HGNC:3482 ETFDH gene ETFDH Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIC, MIM# 231680 False 3 100;0;0 21.569 True ENSG00000171503 ENSG00000171503 HGNC:3483 ETFDH gene ETFDH Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIC 231680 17412732;27038534 False 3 100;0;0 21.569 True ENSG00000171503 ENSG00000171503 HGNC:3483 ETFDH gene ETFDH Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple acyl-CoA dehydrogenase deficiency MONDO:0009282;sensory neuropathy 32608139;35309592;26821934 False 3 100;0;0 21.569 True ENSG00000171503 ENSG00000171503 HGNC:3483 ETFDH gene ETFDH Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Leukoencephalopathy;Glutaric Acidemia IIC False 3 0;0;0 21.569 False ENSG00000171503 ENSG00000171503 HGNC:3483 ETFDH gene ETFDH Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIC MIM#231680;Multiple acyl-CoA dehydrogenase deficiency (MADD) 19249206;17412732 False 3 100;0;0 21.569 True ENSG00000171503 ENSG00000171503 HGNC:3483 ETHE1 gene ETHE1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ethylmalonic encephalopathy , MIM#602473 14732903;28933811 False 3 100;0;0 21.569 True ENSG00000105755 ENSG00000105755 HGNC:23287 ETHE1 gene ETHE1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ethylmalonic encephalopathy, MIM# 602473" 18593870 False 3 100;0;0 21.569 True ENSG00000105755 ENSG00000105755 HGNC:23287 ETHE1 gene ETHE1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ethylmalonic encephalopathy , MIM#602473 14732903;28933811 False 3 100;0;0 21.569 True ENSG00000105755 ENSG00000105755 HGNC:23287 EXOC7 gene EXOC7 Expert Review Green;Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal brain atrophy;seizures;developmental delay;microcephaly PMID: 32103185 False 3 100;0;0 21.569 True ENSG00000182473 ENSG00000182473 HGNC:23214 EXOSC3 gene EXOSC3 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1B, MIM# 614678 22544365;23284067;24524299 False 3 100;0;0 21.569 True ENSG00000107371 ENSG00000107371 HGNC:17944 EXOSC5 gene EXOSC5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, brain abnormalities, and cardiac conduction defects, MIM# 619576;Short stature;Motor developmental delays;Cerebellar hypoplasia;Ataxia 32504085;29302074 False 3 100;0;0 21.569 True ENSG00000077348 ENSG00000077348 HGNC:24662 EXOSC8 gene EXOSC8 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dHMN/dSMA;Pontocerebellar hypoplasia, type 1c, MIM# 616081 24989451 False 3 100;0;0 21.569 True ENSG00000120699 ENSG00000120699 HGNC:17035 EXOSC9 gene EXOSC9 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1D, MIM# 618065 30690203;29727687 False 3 100;0;0 21.569 True ENSG00000123737 ENSG00000123737 HGNC:9137 EXT1 gene EXT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Exostoses, multiple, type 1 133700;Multiple exostoses type I (Disorders of protein O-glycosylation, O-xylosylglycan synthesis deficiencies) 7550340;9521425 False 3 100;0;0 21.569 True ENSG00000182197 ENSG00000182197 HGNC:3512 EXT2 gene EXT2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Seizures, scoliosis, and macrocephaly syndrome, MIM#616682 False 3 100;0;0 21.569 True ENSG00000151348 ENSG00000151348 HGNC:3513 EXT2 gene EXT2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Seizures, scoliosis, and macrocephaly syndrome 616682;Exostoses, multiple, type 2 133701;Multiple exostoses type II (Disorders of protein O-glycosylation, O-xylosylglycan synthesis deficiencies) 30288735;30075207;26246518 False 3 100;0;0 21.569 True ENSG00000151348 ENSG00000151348 HGNC:3513 EXTL3 gene EXTL3 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Immunoskeletal dysplasia with neurodevelopmental abnormalities, MIM# 617425 28132690;28148688;28331220 False 3 100;0;0 21.569 True ENSG00000012232 ENSG00000012232 HGNC:3518 FA2H gene FA2H Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 35, autosomal recessive MIM#612319" 31135052 False 3 100;0;0 21.569 True ENSG00000103089 ENSG00000103089 HGNC:21197 FA2H gene FA2H Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 35, autosomal recessive, MIM#611026 29423566 False 3 100;0;0 21.569 True ENSG00000103089 ENSG00000103089 HGNC:21197 FA2H gene FA2H Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 35, autosomal recessive, MIM#612319 31837835;30446360;22965561;21592092 False 3 100;0;0 21.569 True ENSG00000103089 ENSG00000103089 HGNC:21197 FA2H gene FA2H GeneReviews;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fatty acid hydroxylase-associated neurodegeneration (FAHN) False 3 100;0;0 21.569 False ENSG00000103089 ENSG00000103089 HGNC:21197 FA2H gene FA2H Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia;Spastic paraplegia 35, autosomal recessive 612319;fatty acid hydroxylase-associated neurodegeneration 19068277;20104589;20853438;31135052 False 3 100;0;0 21.569 True ENSG00000103089 ENSG00000103089 HGNC:21197 FA2H gene FA2H Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 35, autosomal recessive, MIM# 612319" 20104589;23745665;19068277;20853438;22146942 False 3 100;0;0 21.569 True ENSG00000103089 ENSG00000103089 HGNC:21197 FAH gene FAH Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Tyrosinemia, type I, MIM# 276700" False 3 100;0;0 21.569 True ENSG00000103876 ENSG00000103876 HGNC:3579 FAM111A gene FAM111A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Kenny-Caffey syndrome, type 2, MIM# 127000 32734340;23996431;35205306 False 3 100;0;0 21.569 True ENSG00000166801 ENSG00000166801 HGNC:24725 FAM126A gene FAM126A Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelination and Congenital Cataract;Leukodystrophy, hypomyelinating, 5, 610532 False 3 0;0;0 21.569 False ENSG00000122591 ENSG00000122591 HGNC:24587 FAM20C gene FAM20C Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Raine syndrome, MIM# 259775 27862258;20825432;36914045;34259997;32299476;29341424 False 3 50;0;50 21.569 True ENSG00000177706 ENSG00000177706 HGNC:22140 FAR1 gene FAR1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Cataracts, spastic paraparesis, and speech delay, MIM#619338;Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM# 616154" PMID: 33239752 False 3 100;0;0 21.569 True ENSG00000197601 ENSG00000197601 HGNC:26222 FAR1 gene FAR1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Peroxisomal fatty acyl-CoA reductase 1 disorder (MIM#616154);Cataracts, spastic paraparesis, and speech delay, MIM#619338 25439727;33239752 False 3 50;50;0 21.569 True ENSG00000197601 ENSG00000197601 HGNC:26222 FARS2 gene FARS2 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal combined oxidative phosphorylation defect type 14 MONDO:0013986;hereditary spastic paraplegia 77 MONDO:0014882 30250868;30177229;29126765;28043061 False 3 100;0;0 21.569 True ENSG00000145982 ENSG00000145982 HGNC:21062 FARS2 gene FARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal combined oxidative phosphorylation defect type 14 MONDO:0013986 30250868;30177229;29126765;28043061 False 3 100;0;0 21.569 True ENSG00000145982 ENSG00000145982 HGNC:21062 FARS2 gene FARS2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 77, autosomal recessive, 617046 26553276;25851414;29126765 False 3 100;0;0 21.569 True ENSG00000145982 ENSG00000145982 HGNC:21062 FARSA gene FARSA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Rajab interstitial lung disease with brain calcifications 2, MIM# 619013" 31355908;33598926 False 3 67;0;33 21.569 True ENSG00000179115 ENSG00000179115 HGNC:3592 FARSB gene FARSB Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Rajab syndrome, MIM#613658;interstitial lung disease;brain calcifications;microcephaly;intellectual disability 29573043;19161147;29979980;30014610 False 3 100;0;0 21.569 True ENSG00000116120 ENSG00000116120 HGNC:17800 FASTKD2 gene FASTKD2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, MIM#220110 18771761;28499982;31944455;34234304 False 3 50;50;0 21.569 True ENSG00000118246 ENSG00000118246 HGNC:29160 FASTKD2 gene FASTKD2 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 44, MIM# 618855;FASTKD2-related infantile mitochondrial encephalomyopathy MONDO:0015632 18771761;28499982;31944455;34234304 False 3 100;0;0 21.569 True ENSG00000118246 ENSG00000118246 HGNC:29160 FASTKD2 gene FASTKD2 Expert Review Green;Other;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 44 (MIM#618855) 31944455;18771761 False 3 50;50;0 21.569 True ENSG00000118246 ENSG00000118246 HGNC:29160 FASTKD5 gene FASTKD5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 24, MIM# 621431 PMID: 40499538 False 3 100;0;0 21.569 True ENSG00000215251 ENSG00000215251 HGNC:25790 FAT2 gene FAT2 GeneReviews;Royal Melbourne Hospital;Expert list;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 45, MIM#617769 29053796;33884300 False 3 50;50;0 21.569 False ENSG00000086570 ENSG00000086570 HGNC:3596 FBLN5 gene FBLN5 Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN;Neuropathy, hereditary, with or without age-related macular degeneration, MIM#608895 32757322;31945625;23328402;28332470 False 3 100;0;0 21.569 False ENSG00000140092 ENSG00000140092 HGNC:3602 FBP1 gene FBP1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fructose-1,6-bisphosphatase deficiency, MIM# 229700 9382095 False 3 100;0;0 21.569 True ENSG00000165140 ENSG00000165140 HGNC:3606 FBXL4 gene FBXL4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) MIM#615471 28940506 False 3 100;0;0 21.569 True ENSG00000112234 ENSG00000112234 HGNC:13601 FBXL4 gene FBXL4 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type), MIM# 615471 28383868 False 3 100;0;0 21.569 True ENSG00000112234 ENSG00000112234 HGNC:13601 FBXL4 gene FBXL4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) MIM#615471 28940506 False 3 100;0;0 21.569 True ENSG00000112234 ENSG00000112234 HGNC:13601 FBXO11 gene FBXO11 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with dysmorphic facies and behavioral abnormalities, 618089 30057029;29796876 False 3 100;0;0 21.569 True ENSG00000138081 ENSG00000138081 HGNC:13590 FBXO28 gene FBXO28 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 100, MIM# 619777 33280099 False 3 100;0;0 21.569 True ENSG00000143756 ENSG00000143756 HGNC:29046 FBXO28 gene FBXO28 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 100, MIM# 619777 33280099 False 3 100;0;0 21.569 True ENSG00000143756 ENSG00000143756 HGNC:29046 FBXO7 gene FBXO7 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal parkinsonian-pyramidal syndrome MONDO:0009830 20301402 False 3 100;0;0 21.569 True ENSG00000100225 ENSG00000100225 HGNC:13586 FBXO7 gene FBXO7 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile parkinsonism;Dystonia False 3 0;0;0 21.569 False ENSG00000100225 ENSG00000100225 HGNC:13586 FBXO7 gene FBXO7 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 15, autosomal recessive MIM#260300 18513678;19038853 False 3 100;0;0 21.569 False ENSG00000100225 ENSG00000100225 HGNC:13586 FDFT1 gene FDFT1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal squalene synthase deficiency MONDO:0032566 29909962 False 3 100;0;0 21.569 True ENSG00000079459 ENSG00000079459 HGNC:3629 FDFT1 gene FDFT1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Squalene synthase deficiency, MIM# 618156 29909962 False 3 50;50;0 21.569 True ENSG00000079459 ENSG00000079459 HGNC:3629 FDX2 gene FDX2 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy MIM#251900 24281368;30010796;28803783 False 3 100;0;0 21.569 True ENSG00000267673 ENSG00000267673 HGNC:30546 FDX2 gene FDX2 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy, MIM# 251900;inborn mitochondrial myopathy MONDO:0009637 24281368;28803783;30010796;35079622;34905296 False 3 100;0;0 21.569 True ENSG00000267673 ENSG00000267673 HGNC:30546 FDXR gene FDXR Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Auditory neuropathy and optic atrophy, MIM#617717;Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 30250212;28965846;29040572;33348459;37046037;37481223 False 3 100;0;0 21.569 True ENSG00000161513 ENSG00000161513 HGNC:3642 FDXR gene FDXR Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 30250212;28965846;29040572;33348459;37046037;37481223 False 3 100;0;0 21.569 True ENSG00000161513 ENSG00000161513 HGNC:3642 FGD4 gene FGD4 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, type 4H, 609311;MONDO:0012250;HMSN 17564959;31152969;28847448;28543957 False 3 100;0;0 21.569 False ENSG00000139132 ENSG00000139132 HGNC:19125 FGF12 gene FGF12 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 47, MIM# 617166 32645220;27164707;27830185;27872899 False 3 100;0;0 21.569 True ENSG00000114279 ENSG00000114279 HGNC:3668 FGF13 gene FGF13 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 90, MIM# 301058;Intellectual disability;epilepsy 33245860 False 3 100;0;0 21.569 True ENSG00000129682 ENSG00000129682 HGNC:3670 FGF14 gene FGF14 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 27 MIM#609307 False 3 100;0;0 21.569 True ENSG00000102466 ENSG00000102466 HGNC:3671 FGFR1 gene FGFR1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Hartsfield syndrome (MIM#615465)" 26937548;31512363;23812909;26931467 False 3 100;0;0 21.569 True ENSG00000077782 ENSG00000077782 HGNC:3688 FGFR3 gene FGFR3 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypochondroplasia, MIM#146000 24630288;27485793;23649205;12794698 False 3 100;0;0 21.569 True ENSG00000068078 ENSG00000068078 HGNC:3690 FH gene FH Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal hereditary leiomyomatosis and renal cell cancer MONDO:0007888;fumaric aciduria MONDO:0011730 11865300;28300276;20301430;8200987;20549362;31746132;20301679 False 3 100;0;0 21.569 True ENSG00000091483 ENSG00000091483 HGNC:3700 FH gene FH Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fumarase deficiency, MIM#606812 20301679;10805328;20549362;15221078;16151915 False 3 100;0;0 21.569 True ENSG00000091483 ENSG00000091483 HGNC:3700 FHL1 gene FHL1 Expert Review Green;Expert list;Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Reducing body myopathy MONDO:0019948;X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680 19716112;20186852;20301609;18179901;25274776;34366191;18274675;19181672 False 3 67;33;0 21.569 True ENSG00000022267 ENSG00000022267 HGNC:3702 FICD gene FICD Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 92, autosomal recessive, MIM# 620911 36136088 False 3 100;0;0 21.569 True ENSG00000198855 ENSG00000198855 HGNC:18416 FICD gene FICD Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 92, autosomal recessive, MIM# 620911 36136088 False 3 100;0;0 21.569 False ENSG00000198855 ENSG00000198855 HGNC:18416 FIG4 gene FIG4 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4J, MIM# 611228;MONDO:0012640;HMSN 17572665;21705420;24878229 False 3 100;0;0 21.569 False ENSG00000112367 ENSG00000112367 HGNC:16873 FIG4 gene FIG4 Expert Review Green;Expert list;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4J 611228;Yunis-Varon syndrome 216340;leukoencephalopathy 30740813;29688489 False 3 100;0;0 21.569 False ENSG00000112367 ENSG00000112367 HGNC:16873 FITM2 gene FITM2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Siddiqi syndrome MIM#618635;dystonia;deafness 28067622;30214770;30288795 False 3 100;0;0 21.569 True ENSG00000197296 ENSG00000197296 HGNC:16135 FKRP gene FKRP Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5 613153;Muscular dystrophy-dystroglycanopathy (congenital with or without mental retardation), type B, 5 606612;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 607155 False 3 100;0;0 21.569 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKRP gene FKRP Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Limb-girdle muscular dystrophy;Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type 11592034;11741828;14647208;19299310;19155270 False 3 100;0;0 21.569 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKRP gene FKRP Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 607155 27602406;11592034;11741828;14647208;19299310;19155270 False 3 100;0;0 21.569 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKTN gene FKTN Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 4 253800;Muscular dystrophy-dystroglycanopathy (congenital without mental retardation), type B, 4 613152;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 4 611588 False 3 100;0;0 21.569 True ENSG00000106692 ENSG00000106692 HGNC:3622 FKTN gene FKTN Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (with brain and eye anomalies), 253800;Muscular dystrophy-dystroglycanopathy (without mental retardation), 613152;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 4, 611588;Cardiomyopathy, dilated, 1X, 611615 9690476;19017726;20301385;28680109 False 3 100;0;0 21.569 True ENSG00000106692 ENSG00000106692 HGNC:3622 FKTN gene FKTN Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy MONDO:0018276 9690476;19017726;20301385;28680109 False 3 100;0;0 21.569 True ENSG00000106692 ENSG00000106692 HGNC:3622 FLAD1 gene FLAD1 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100 34454814;34718578;31392824;30982706;30311138;30427553;28433476;27259049;25058219 False 3 100;0;0 21.569 True ENSG00000160688 ENSG00000160688 HGNC:24671 FLAD1 gene FLAD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency, MIM# 255100" 25058219;27259049;16643857;20060505;30061063;30982706;30311138;31392824;30427553 False 3 0;100;0 21.569 True ENSG00000160688 ENSG00000160688 HGNC:24671 FLAD1 gene FLAD1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100 34454814;34718578;31392824;30982706;30311138;30427553;28433476;27259049;25058219 False 3 100;0;0 21.569 True ENSG00000160688 ENSG00000160688 HGNC:24671 FLNA gene FLNA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Heterotopia, periventricular, 1, MIM# 300049" 30089473 False 3 100;0;0 21.569 True ENSG00000196924 ENSG00000196924 HGNC:3754 FLNC gene FLNC Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Cardiomyopathy, familial restrictive 5 617047;Myopathy, distal, 4 614065;Myopathy, myofibrillar, 5 609524" PMID: 29858533 False 3 100;0;0 21.569 True Other ENSG00000128591 ENSG00000128591 HGNC:3756 FLVCR1 gene FLVCR1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, posterior column, with retinitis pigmentosa MIM#609033 False 3 100;0;0 21.569 True ENSG00000162769 ENSG00000162769 HGNC:24682 FLVCR1 gene FLVCR1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia, posterior column, with retinitis pigmentosa, MIM# 609033" 21267618;21070897 False 3 100;0;0 21.569 True ENSG00000162769 ENSG00000162769 HGNC:24682 FLVCR1 gene FLVCR1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder MONDO:0700092, FLVCR1-related 39306721 False 3 100;0;0 21.569 True ENSG00000162769 ENSG00000162769 HGNC:24682 FLVCR2 gene FLVCR2 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, MIM# 225790 30712878;20206334;20518025;20690116;25677735 False 3 100;0;0 21.569 True ENSG00000119686 ENSG00000119686 HGNC:20105 FLVCR2 gene FLVCR2 Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Proliferative Vasculopathy And Hydranencephaly-Hydrocephaly Syndrome 20206334 False 3 67;0;33 21.569 False ENSG00000119686 ENSG00000119686 HGNC:20105 FMO3 gene FMO3 Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Trimethylaminuria MIM#602079;Disorders and variants of other enzymes that oxidise xenobiotics 27604308;9536088 False 3 100;0;0 21.569 True ENSG00000007933 ENSG00000007933 HGNC:3771 FOLR1 gene FOLR1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration due to cerebral folate transport deficiency 613068 False 3 0;0;0 21.569 False ENSG00000110195 ENSG00000110195 HGNC:3791 FOLR1 gene FOLR1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration due to cerebral folate transport deficiency, 613068;Neurodegeneration due to cerebral folate transport deficiency False 3 100;0;0 21.569 False ENSG00000110195 ENSG00000110195 HGNC:3791 FOLR1 gene FOLR1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration due to cerebral folate transport deficiency, MIM# 613068 19732866;30420205;27743887 False 3 100;0;0 21.569 True ENSG00000110195 ENSG00000110195 HGNC:3791 FOLR1 gene FOLR1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodegeneration due to cerebral folate transport deficiency, MIM# 613068" 19732866;30420205;27743887 False 3 100;0;0 21.569 True ENSG00000110195 ENSG00000110195 HGNC:3791 FOXG1 gene FOXG1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Rett syndrome, congenital variant;Dystonia 27029630 False 3 100;0;0 21.569 True ENSG00000176165 ENSG00000176165 HGNC:3811 FOXG1 gene FOXG1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Rett syndrome, congenital variant, MIM# 613454;Developmental and Epileptic Encephalopathy;Dystonia,;Athetosis;Parkinsonism;Stereotypies" PMID: 21953941 False 3 100;0;0 21.569 True ENSG00000176165 ENSG00000176165 HGNC:3811 FOXG1 gene FOXG1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Rett syndrome, congenital variant, MIM# 613454 18571142;30842224 False 3 100;0;0 21.569 True ENSG00000176165 ENSG00000176165 HGNC:3811 FOXP1 gene FOXP1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder with language impairment with or without autistic features, MIM# 613670" 26633542;28741757;34109629 False 3 100;0;0 21.569 True ENSG00000114861 ENSG00000114861 HGNC:3823 FOXRED1 gene FOXRED1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 19 MIM#618241 33613441 False 3 100;0;0 21.569 True ENSG00000110074 ENSG00000110074 HGNC:26927 FOXRED1 gene FOXRED1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome due to mitochondrial complex I deficiency, MIM#256000 20858599;20818383;31434271 False 3 100;0;0 21.569 True ENSG00000110074 ENSG00000110074 HGNC:26927 FRMD5 gene FRMD5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094 36206744 False 3 100;0;0 21.569 True ENSG00000171877 ENSG00000171877 HGNC:28214 FRMD5 gene FRMD5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094 36206744 False 3 100;0;0 21.569 True ENSG00000171877 ENSG00000171877 HGNC:28214 FRRS1L gene FRRS1L Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy, 37 MONDO:0014859 27236917;27239025;30692144 False 3 100;0;0 21.569 True ENSG00000260230 ENSG00000260230 HGNC:1362 FRRS1L gene FRRS1L Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 37, MIM# 616981;Seizures;Chorea;Parkinsonism;Developmental delay PMID: 29086067 False 3 100;0;0 21.569 True ENSG00000260230 ENSG00000260230 HGNC:1362 FTCD gene FTCD Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutamate formiminotransferase deficiency MIM#229100;Disorders of histidine, tryptophan or lysine metabolism http://iembase.com/disorder/47 False 3 100;0;0 21.569 True ENSG00000160282 ENSG00000160282 HGNC:3974 FTH1 gene FTH1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodegeneration with brain iron accumulation 9, MIM# 620669 37660254 False 3 50;50;0 21.569 True Other ENSG00000167996 ENSG00000167996 HGNC:3976 FTL gene FTL Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration with brain iron accumulation 3, MIM# 606159 11438811;18854324;15099026;15173247 False 3 100;0;0 21.569 True ENSG00000087086 ENSG00000087086 HGNC:3999 FTL gene FTL Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 23447832;20301320 False 3 100;0;0 21.569 False ENSG00000087086 ENSG00000087086 HGNC:3999 FTL gene FTL Expert Review Green;NHS Genomic Medicine Service;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown 606159 NEURODEGENERATION WITH BRAIN IRON ACCUMULATION 3;LFTD;NBIA3;615604 L-FERRITIN DEFICIENCY;HRFTC;606159 Neurodegeneration with brain iron accumulation 3;600886 HYPERFERRITINEMIA WITH OR WITHOUT CATARACT;600886 Hyperferritinemia-cataract syndrome;615604 L-ferritin deficiency, dominant and recessive 23940258;18413574;23421845;19176363 False 3 100;0;0 21.569 True ENSG00000087086 ENSG00000087086 HGNC:3999 FTL gene FTL Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodegeneration with brain iron accumulation 3, MIM# 606159 11438811;15099026;12746423;18413574 False 3 100;0;0 21.569 True ENSG00000087086 ENSG00000087086 HGNC:3999 FTL gene FTL GeneReviews;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuroferritinopathy False 3 100;0;0 21.569 False ENSG00000087086 ENSG00000087086 HGNC:3999 FUCA1 gene FUCA1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fucosidosis, MIM# 230000;MONDO:0009254 10094192 False 3 100;0;0 21.569 True ENSG00000179163 ENSG00000179163 HGNC:4006 FUCA1 gene FUCA1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fucosidosis, MIM#230000 31064022 False 3 100;0;0 21.569 True ENSG00000179163 ENSG00000179163 HGNC:4006 FUCA1 gene FUCA1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fucosidosis, MIM# 230000;MONDO:0009254 10094192 False 3 100;0;0 21.569 True ENSG00000179163 ENSG00000179163 HGNC:4006 FUCA1 gene FUCA1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fucosidosis;General Leukodystrophy & Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000179163 ENSG00000179163 HGNC:4006 FUK gene FUK Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation with defective fucosylation 2, MIM# 618324 30503518 False 3 100;0;0 21.569 True ENSG00000157353 ENSG00000157353 HGNC:29500 FUK gene FUK Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Congenital disorder of glycosylation with defective fucosylation 2, MIM# 618324" 30503518;35718084;36426412 False 3 100;0;0 21.569 True ENSG00000157353 ENSG00000157353 HGNC:29500 FUS gene FUS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia, MIM# 608030 32941707;32770214 False 3 100;0;0 21.569 True ENSG00000089280 ENSG00000089280 HGNC:4010 FUS gene FUS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia (MIM#608030) 19251628;19251627 False 3 100;0;0 21.569 True ENSG00000089280 ENSG00000089280 HGNC:4010 FUT8 gene FUT8 Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation with defective fucosylation, 618005 29304374 False 3 100;0;0 21.569 True ENSG00000033170 ENSG00000033170 HGNC:4019 FUT8 gene FUT8 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation with defective fucosylation, 618005 29304374 False 3 100;0;0 21.569 True ENSG00000033170 ENSG00000033170 HGNC:4019 FXN gene FXN Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Friedreich ataxia, MIM# 229300" False 3 100;0;0 21.569 True Other ENSG00000165060 ENSG00000165060 HGNC:3951 FXN gene FXN Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 False 3 100;0;0 21.569 True ENSG00000165060 ENSG00000165060 HGNC:3951 FXN gene FXN Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia, MIM# 229300 10500103;11351132 False 3 100;0;0 21.569 True ENSG00000165060 ENSG00000165060 HGNC:3951 FXN gene FXN Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia, 229300 False 3 100;0;0 21.569 False ENSG00000165060 ENSG00000165060 HGNC:3951 FZR1 gene FZR1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 109, MIM# 620145 34788397 False 3 100;0;0 21.569 True ENSG00000105325 ENSG00000105325 HGNC:24824 G6PC gene G6PC Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease Ia, MIM# 232200 8733042 False 3 100;0;0 21.569 True ENSG00000131482 ENSG00000131482 HGNC:4056 G6PC3 gene G6PC3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dursun syndrome 612541;Neutropenia, severe congenital 4, autosomal recessive 612541 21385794 False 3 0;100;0 21.569 True ENSG00000141349 ENSG00000141349 HGNC:24861 GAA gene GAA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glycogen storage disease II 232300" PMID: 29880332 False 3 100;0;0 21.569 True ENSG00000171298 ENSG00000171298 HGNC:4065 GAA gene GAA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease II, MIM# 232300;MONDO:0009290 16917947 False 3 100;0;0 21.569 True ENSG00000171298 ENSG00000171298 HGNC:4065 GAA gene GAA Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease II (MIM#232300) 25103075;27365701 False 3 100;0;0 21.569 True ENSG00000171298 ENSG00000171298 HGNC:4065 GAA gene GAA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease II (MIM#232300);MONDO:0009290 25103075;27365701 False 3 100;0;0 21.569 True ENSG00000171298 ENSG00000171298 HGNC:4065 GABBR2 gene GABBR2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 59, MIM# 617904 29100083;25262651;28856709 False 3 100;0;0 21.569 True ENSG00000136928 ENSG00000136928 HGNC:4507 GABBR2 gene GABBR2 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy, 59 MONDO:0033368;Gamma-aminobutyric acid neurotransmitter disorders 35850019 False 3 0;0;0 21.569 False ENSG00000136928 ENSG00000136928 HGNC:4507 GABRA1 gene GABRA1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 19, MIM# 615744 24623842 False 3 100;0;0 21.569 True ENSG00000022355 ENSG00000022355 HGNC:4075 GABRA1 gene GABRA1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 19 615744;Rett syndrome;Rett-like phenotypes;idiopathic generalized Epilepsy;Dravet syndrome 11992121;21714819;24623842;30842224 False 3 100;0;0 21.569 True ENSG00000022355 ENSG00000022355 HGNC:4075 GABRA2 gene GABRA2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 78, MIM# 618557" 29961870;31032849;29422393 False 3 100;0;0 21.569 True ENSG00000151834 ENSG00000151834 HGNC:4076 GABRA3 gene GABRA3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Epilepsy, X-linked 2, with or without impaired intellectual development and dysmorphic features, MIM# 301091" PMID: 29053855 False 3 100;0;0 21.569 True ENSG00000011677 ENSG00000011677 HGNC:4077 GABRA4 gene GABRA4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, GABRA4-related 35152403;35781801 False 3 100;0;0 21.569 True ENSG00000109158 ENSG00000109158 HGNC:4078 GABRA5 gene GABRA5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 79;OMIM #618559 31056671;29961870 False 3 100;0;0 21.569 True ENSG00000186297 ENSG00000186297 HGNC:4079 GABRB1 gene GABRB1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 45, MIM# 617153" 23934111;27273810;31618474 False 3 100;0;0 21.569 True ENSG00000163288 ENSG00000163288 HGNC:4081 GABRB1 gene GABRB1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy, 45 MONDO:0014942;Gamma-aminobutyric acid neurotransmitter disorders 23934111;27273810;35850019;31618474 False 3 0;0;0 21.569 False ENSG00000163288 ENSG00000163288 HGNC:4081 GABRB2 gene GABRB2 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631;Gamma-aminobutyric acid neurotransmitter disorders 27789573;35850019;29100083 False 3 0;0;0 21.569 False ENSG00000145864 ENSG00000145864 HGNC:4082 GABRB2 gene GABRB2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631 38996765 False 3 100;0;0 21.569 True Other ENSG00000145864 ENSG00000145864 HGNC:4082 GABRB2 gene GABRB2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, infantile or early childhood, 2, MIM# 617829 27789573;29100083 False 3 100;0;0 21.569 True ENSG00000145864 ENSG00000145864 HGNC:4082 GABRB3 gene GABRB3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 43, MIM# 617113 23934111;27476654 False 3 100;0;0 21.569 True ENSG00000166206 ENSG00000166206 HGNC:4083 GABRB3 gene GABRB3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 43, MIM# 617113 23934111;27476654 False 3 100;0;0 21.569 True ENSG00000166206 ENSG00000166206 HGNC:4083 GABRB3 gene GABRB3 Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 43 MIM#617113 37647766 False 3 100;0;0 21.569 False Other ENSG00000166206 ENSG00000166206 HGNC:4083 GABRD gene GABRD Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;Epilepsy;Susceptibility to epilepsy, MIM#613060 15115768;34633442 False 3 100;0;0 21.569 True ENSG00000187730 ENSG00000187730 HGNC:4084 GABRD gene GABRD Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;Epilepsy;Susceptibility to epilepsy, MIM#613060 15115768;34633442 False 3 100;0;0 21.569 True ENSG00000187730 ENSG00000187730 HGNC:4084 GABRG2 gene GABRG2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 74 618396;Epilepsy, generalized, with febrile seizures plus, type 3 607681 11326274;11326275;27864268 False 3 100;0;0 21.569 True ENSG00000113327 ENSG00000113327 HGNC:4087 GABRG2 gene GABRG2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 74 618396;Epilepsy, generalized, with febrile seizures plus, type 3 607681 11326274;11326275;27864268 False 3 100;0;0 21.569 True ENSG00000113327 ENSG00000113327 HGNC:4087 GAD1 gene GAD1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 89, MIM# 619124 32282878 False 3 100;0;0 21.569 True ENSG00000128683 ENSG00000128683 HGNC:4092 GALC gene GALC Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Krabbe disease, MIM# 245200" False 3 100;0;0 21.569 True ENSG00000054983 ENSG00000054983 HGNC:4115 GALC gene GALC Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe disease, MIM# 245200;MONDO:0009499 20886637 False 3 100;0;0 21.569 True ENSG00000054983 ENSG00000054983 HGNC:4115 GALC gene GALC Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe disease, MIM# 245200;MONDO:0009499 20886637 False 3 100;0;0 21.569 True ENSG00000054983 ENSG00000054983 HGNC:4115 GALC gene GALC Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Krabbe disease, MIM# 245200" False 3 100;0;0 21.569 True ENSG00000054983 ENSG00000054983 HGNC:4115 GALC gene GALC Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe disease MIM#245200 9272171;11971051;22959700;26396125;26915362;28547031;31185936;32064984 False 3 100;0;0 21.569 False ENSG00000054983 ENSG00000054983 HGNC:4115 GALE gene GALE Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galactose epimerase deficiency MIM#230350;Disorders of galactose metabolism 27604308;9700591 False 3 100;0;0 21.569 True ENSG00000117308 ENSG00000117308 HGNC:4116 GALK1 gene GALK1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galactokinase deficiency with cataracts MIM#230200;Disorders of galactose metabolism 27604308;5129682 False 3 100;0;0 21.569 True ENSG00000108479 ENSG00000108479 HGNC:4118 GALM gene GALM Expert Review Green;NHS GMS;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galactosemia IV MIM#618881;Disorders of galactose metabolism 30451973;30910422 False 3 100;0;0 21.569 True ENSG00000143891 ENSG00000143891 HGNC:24063 GALNS gene GALNS Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis IVA, MIM# 253000;MONDO:0009659 9298823 False 3 100;0;0 21.569 True ENSG00000141012 ENSG00000141012 HGNC:4122 GALNT2 gene GALNT2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIt, MIM# 618885 32293671 False 3 100;0;0 21.569 True ENSG00000143641 ENSG00000143641 HGNC:4124 GALNT2 gene GALNT2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation 32293671 False 3 100;0;0 21.569 True ENSG00000143641 ENSG00000143641 HGNC:4124 GALNT3 gene GALNT3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Tumoral calcinosis, hyperphosphatemic, familial, 1, MIM# 211900 15133511;20358599;32125652 False 3 100;0;0 21.569 True ENSG00000115339 ENSG00000115339 HGNC:4125 GALT gene GALT Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Galactosemia, MIM#230400" 30718057 False 3 100;0;0 21.569 True ENSG00000213930 ENSG00000213930 HGNC:4135 GALT gene GALT Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galactosemia MIM#230400;Disorders of galactose metabolism 27604308;2011574 False 3 100;0;0 21.569 True ENSG00000213930 ENSG00000213930 HGNC:4135 GAMT gene GAMT Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral creatine deficiency syndrome 2 MIM#612736 19027335;33996490;12557293;19288536;16855203 False 3 50;0;50 21.569 True ENSG00000130005 ENSG00000130005 HGNC:4136 GAMT gene GAMT Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral creatine deficiency syndrome 2 MIM#612736;Disorders of creatinine metabolism 27604308;8651275 False 3 100;0;0 21.569 True ENSG00000130005 ENSG00000130005 HGNC:4136 GAMT gene GAMT Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral creatine deficiency syndrome 2 MIM#612736;Disorders of creatinine metabolism 27604308;8651275 False 3 100;0;0 21.569 True ENSG00000130005 ENSG00000130005 HGNC:4136 GAN gene GAN Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Giant axonal neuropathy-1, MIM# 256850" 26381321;11062483 False 3 100;0;0 21.569 True ENSG00000261609 ENSG00000261609 HGNC:4137 GAN gene GAN Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Giant axonal neuropathy-1, MIM# 256850 11062483 False 3 100;0;0 21.569 True ENSG00000261609 ENSG00000261609 HGNC:4137 GARS gene GARS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial disease (MONDO:0044970), GARS1-related;Spinal muscular atrophy, infantile, James type, MIM# 619042;Charcot-Marie-Tooth disease, type 2D, MIM# 601472;Neuronopathy, distal hereditary motor, type VA, MIM# 600794;Multi-system mitochondrial disorder 17101916;22462675;31985473;32181591;12690580;25168514;26503042;29648643;16982418;24669931;28594869 False 3 100;0;0 21.569 True ENSG00000106105 ENSG00000106105 HGNC:4162 GARS gene GARS Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown HMSN, dHMN/dSMA;Spinal muscular atrophy, infantile, James type, MIM# 619042;Neuropathy, distal hereditary motor, type V, 600794;Charcot Marie Tooth disease, type 2D, 601472 17101916;22462675;31985473;32181591;12690580;25168514;26503042;29648643;16982418 False 3 100;0;0 21.569 False ENSG00000106105 ENSG00000106105 HGNC:4162 GATA3 gene GATA3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypoparathyroidism, sensorineural deafness, and renal dysplasia, MIM# 146255 32642802;19248180;26268891;16912130;15337474 False 3 100;0;0 21.569 True ENSG00000107485 ENSG00000107485 HGNC:4172 GATM gene GATM Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral creatine deficiency syndrome 3 MIM#612718 11555793;27604308 False 3 100;0;0 21.569 False ENSG00000171766 ENSG00000171766 HGNC:4175 GBA gene GBA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Gaucher disease, type III, MIM# 231000" 27789132 False 3 100;0;0 21.569 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA gene GBA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gaucher disease, perinatal lethal, MIM# 608013;Gaucher disease, type I, MIM# 230800;Gaucher disease, type II, MIM# 230900;Gaucher disease, type III, MIM# 231000;Gaucher disease, type IIIC, MIM# 231005 False 3 100;0;0 21.569 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA gene GBA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson's disease, MONDO:0005180, GBA-related PMID: 12809640;35639160 False 3 100;0;0 21.569 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA gene GBA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gaucher disease, perinatal lethal, MIM# 608013;Gaucher disease, type I, MIM# 230800;Gaucher disease, type II, MIM# 230900;Gaucher disease, type III, MIM# 231000;Gaucher disease, type IIIC, MIM# 231005 False 3 100;0;0 21.569 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA gene GBA NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 230800 Gaucher disease, type I;230900 Gaucher disease, type II;231005 Gaucher disease, type IIIC;231000 Gaucher disease, type III 27265538;27816428;20575041 False 3 0;0;0 21.569 False ENSG00000177628 ENSG00000177628 HGNC:4177 GBA2 gene GBA2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, MIM# 614409;MONDO:0013737 23332916;23332917;29524657 False 3 100;0;0 21.569 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBA2 gene GBA2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 46, autosomal recessive, MIM# 614409" 23332916;23332917 False 3 100;0;0 21.569 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBA2 gene GBA2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, 614409;SPG46, Spastic paraplegia, cognitive decline, thin corpus callosum, ataxia, cataracts, bulbar dysfunction, axonal sensory-motor neuropathy 20301682;23332917;29524657 False 3 100;0;0 21.569 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBE1 gene GBE1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease due to glycogen branching enzyme deficiency MONDO:0009292 8613547 False 3 100;0;0 21.569 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form MIM#263570;Late-onset, cognitive impairment, spasticity, sensory-motor axonal neuropathy, bladder dysfunction, cerebellar and extrapyramidal signs also seen, periventricular white matter abnormalities on MRI 23034915;1763891;8494336;20301758 False 3 100;0;0 21.569 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Polyglucosan body disease, adult form MIM#263570" 20301758;26194201 False 3 100;0;0 21.569 False ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IV, MIM# 232500;Polyglucosan body disease, adult form MIM#263570 8613547;20301758 False 3 100;0;0 21.569 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form, 263570 False 3 100;0;0 21.569 False ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form MIM#263570 23034915 False 3 100;0;0 21.569 False ENSG00000114480 ENSG00000114480 HGNC:4180 GBF1 gene GBF1 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, dominant intermediate A, MIM# 606483;Axonal Neuropathy 32937143 False 3 100;0;0 21.569 False ENSG00000107862 ENSG00000107862 HGNC:4181 GCDH gene GCDH Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal glutaryl-CoA dehydrogenase deficiency MONDO:0009281 32777384;21912879;31536184 False 3 100;0;0 21.569 True ENSG00000105607 ENSG00000105607 HGNC:4189 GCDH gene GCDH Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaricaciduria, type I MIM#231670;Organic acidurias 27604308;8541831;8900227 False 3 100;0;0 21.569 True ENSG00000105607 ENSG00000105607 HGNC:4189 GCDH gene GCDH Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric aciduria, type I MIM#231670 25875215 False 3 100;0;0 21.569 True ENSG00000105607 ENSG00000105607 HGNC:4189 GCH1 gene GCH1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, B, MIM# 233910;Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230 False 3 100;0;0 21.569 True ENSG00000131979 ENSG00000131979 HGNC:4193 GCH1 gene GCH1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230 32170445;32278297;32746945;30314816 False 3 100;0;0 21.569 True ENSG00000131979 ENSG00000131979 HGNC:4193 GCH1 gene GCH1 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia MONDO:0019064, GCH1-related 21935284;24509643;33713342 False 3 0;100;0 21.569 True ENSG00000131979 ENSG00000131979 HGNC:4193 GCH1 gene GCH1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, B, MIM# 233910 7730309 False 3 100;0;0 21.569 True ENSG00000131979 ENSG00000131979 HGNC:4193 GCH1 gene GCH1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230 7874165;11113234;15753436 False 3 100;0;0 21.569 False ENSG00000131979 ENSG00000131979 HGNC:4193 GCLC gene GCLC Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hemolytic anemia due to gamma-glutamylcysteine synthetase deficiency MIM#230450;Disorders of the gamma-glutamyl cycle 27604308;10515893;18024385;11118286;10733484;12663448 False 3 100;0;0 21.569 True ENSG00000001084 ENSG00000001084 HGNC:4311 GCM2 gene GCM2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypoparathyroidism, familial isolated 2, MIM# 618883 32642802;19940031;36405867;18583467 False 3 100;0;0 21.569 True ENSG00000124827 ENSG00000124827 HGNC:4198 GCSH gene GCSH Expert Review Green;Literature;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Multiple mitochondrial dysfunctions syndrome 7, MIM# 620423" 36190515 False 3 33;0;67 21.569 True ENSG00000140905 ENSG00000140905 HGNC:4208 GCSH gene GCSH Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Multiple mitochondrial dysfunctions syndrome 7, MIM# 620423" 33890291;36190515 False 3 100;0;0 21.569 True ENSG00000140905 ENSG00000140905 HGNC:4208 GDAP1 gene GDAP1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Charcot-Marie-Tooth disease, axonal, type 2K 607831, MIM# Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM# 607706;Charcot-Marie-Tooth disease, recessive intermediate, A, MIM# 608340;Charcot-Marie-Tooth disease, type 4A, MIM# 214400" 16172208;21753178;21365284;20232219;11743580 False 3 100;0;0 21.569 True ENSG00000104381 ENSG00000104381 HGNC:15968 GDAP1 gene GDAP1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2K 607831, MIM# Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM# 607706;Charcot-Marie-Tooth disease, recessive intermediate, A, MIM# 608340;Charcot-Marie-Tooth disease, type 4A, MIM# 214400 16172208;21753178;21365284;20232219;11743580 False 3 100;0;0 21.569 False ENSG00000104381 ENSG00000104381 HGNC:15968 GDAP2 gene GDAP2 Expert Review Green;Royal Melbourne Hospital;Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia False 3 100;0;0 21.569 False ENSG00000196505 ENSG00000196505 HGNC:18010 GEMIN5 gene GEMIN5 Expert Review Green;Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, OMIM # 619333 34569062;33963192 False 3 100;0;0 21.569 True ENSG00000082516 ENSG00000082516 HGNC:20043 GFAP gene GFAP Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Alexander disease, MIM# 203450" 11138011;12034785;31004048;15732097 False 3 100;0;0 21.569 True ENSG00000131095 ENSG00000131095 HGNC:4235 GFAP gene GFAP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Alexander disease, MIM# 203450" False 3 100;0;0 21.569 True ENSG00000131095 ENSG00000131095 HGNC:4235 GFAP gene GFAP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alexander disease MONDO:0008752 34146839 False 3 100;0;0 21.569 True ENSG00000131095 ENSG00000131095 HGNC:4235 GFAP gene GFAP Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease False 3 100;0;0 21.569 False ENSG00000131095 ENSG00000131095 HGNC:4235 GFER gene GFER Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, mitochondrial progressive, with congenital cataract, hearing loss, and developmental delay (MIM #613076) 28155230 False 3 100;0;0 21.569 True ENSG00000127554 ENSG00000127554 HGNC:4236 GFER gene GFER Expert Review Green;Other;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, mitochondrial progressive, with congenital cataract and developmental delay (MIM#613076) 28155230;19409522;26018198 False 3 100;0;0 21.569 True ENSG00000127554 ENSG00000127554 HGNC:4236 GFM1 gene GFM1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 1 MIM#609060 31680380;25852744;26937387 False 3 100;0;0 21.569 True ENSG00000168827 ENSG00000168827 HGNC:13780 GFM1 gene GFM1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 1;Mitochondrial Leukoencephalopathy;General Leukodystrophy & Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000168827 ENSG00000168827 HGNC:13780 GFM1 gene GFM1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 1 MIM#609060 31680380;25852744;26937387 False 3 100;0;0 21.569 True ENSG00000168827 ENSG00000168827 HGNC:13780 GFM2 gene GFM2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 39, OMIM #618397 22700954;26016410;29075935 False 3 100;0;0 21.569 True ENSG00000164347 ENSG00000164347 HGNC:29682 GFPT1 gene GFPT1 Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenia, congenital, 12, with tubular aggregates MIM#610542;Limb-girdle congenital myasthenic syndrome 28712002;29905857;31449669 False 3 100;0;0 21.569 True ENSG00000198380 ENSG00000198380 HGNC:4241 GFPT1 gene GFPT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenia, congenital, 12, with tubular aggregates, 610542;Limb-girdle congenital myasthenic syndrome;Leukoencephalopathy 21310273;30635494 False 3 100;0;0 21.569 True ENSG00000198380 ENSG00000198380 HGNC:4241 GJA1 gene GJA1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Oculodentodigital dysplasia, MIM# 164200 26444782;31023660;31240666 False 3 100;0;0 21.569 True ENSG00000152661 ENSG00000152661 HGNC:4274 GJA1 gene GJA1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 31023660 False 3 100;0;0 21.569 False ENSG00000152661 ENSG00000152661 HGNC:4274 GJA1 gene GJA1 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 31023660 False 3 100;0;0 21.569 False ENSG00000152661 ENSG00000152661 HGNC:4274 GJB1 gene GJB1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM# 302800;MONDO:0010549;HMSN 8266101;17100997;17353473 False 3 100;0;0 21.569 False ENSG00000169562 ENSG00000169562 HGNC:4283 GJB1 gene GJB1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, 302800;Reversible posterior leukoencephalopathy 31842800 False 3 100;0;0 21.569 False ENSG00000169562 ENSG00000169562 HGNC:4283 GJC2 gene GJC2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating leukodystrophy 2, 608804;Leukodystrophy, hypomyelinating, 2;Autosomal Recessive Ataxia;Spastic paraplegia 44, 613206 False 3 100;0;0 21.569 False ENSG00000198835 ENSG00000198835 HGNC:17494 GJC2 gene GJC2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 2, MIM# 608804" 15192806;18094336 False 3 100;0;0 21.569 True ENSG00000198835 ENSG00000198835 HGNC:17494 GJC2 gene GJC2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 2, MIM# 608804" 22669416;24374284;15192806 False 3 100;0;0 21.569 True ENSG00000198835 ENSG00000198835 HGNC:17494 GJC2 gene GJC2 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 2, MIM# 608804" False 3 100;0;0 21.569 True ENSG00000198835 ENSG00000198835 HGNC:17494 GK gene GK Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Glycerol kinase deficiency MIM#307030;Disorders of glycerol metabolism 27604308;8499912;8651297 False 3 100;0;0 21.569 True ENSG00000198814 ENSG00000198814 HGNC:4289 GLA gene GLA Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Cardiomyopathy;HSAN/SFN;Fabry disease 19318041;22497776 False 3 0;100;0 21.569 True ENSG00000102393 ENSG00000102393 HGNC:4296 GLA gene GLA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Fabry disease, MIM# 301500;MONDO:0010526 28613767;33673160 False 3 100;0;0 21.569 True ENSG00000102393 ENSG00000102393 HGNC:4296 GLA gene GLA Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Fabry disease, 301500" False 3 0;0;0 21.569 False ENSG00000102393 ENSG00000102393 HGNC:4296 GLA gene GLA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Fabry disease MONDO:0010526" 36927868;38254927;9213072;23949010;32510623 False 3 100;0;0 21.569 True ENSG00000102393 ENSG00000102393 HGNC:4296 GLA gene GLA Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Fabry disease, Fabry disease, cardiac variant, 301500 False 3 100;0;0 21.569 False ENSG00000102393 ENSG00000102393 HGNC:4296 GLB1 gene GLB1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1-gangliosidosis, type III , MIM#230650;Parkinsonism PMID: 34514040 False 3 100;0;0 21.569 True ENSG00000170266 ENSG00000170266 HGNC:4298 GLB1 gene GLB1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "GM1-gangliosidosis, type I, MIM# 230500;GM1-gangliosidosis, type II, MIM# 230600" 25691190 False 3 100;0;0 21.569 True ENSG00000170266 ENSG00000170266 HGNC:4298 GLB1 gene GLB1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1-gangliosidosis, type I, MIM# 230500;GM1-gangliosidosis, type II, MIM# 230600;GM1-gangliosidosis, type III, MIM# 230650;Mucopolysaccharidosis type IVB (Morquio), MIM# 253010 1907800;1909089;17309651;11511921 False 3 100;0;0 21.569 True ENSG00000170266 ENSG00000170266 HGNC:4298 GLB1 gene GLB1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1 gangliosidosis type 3 MONDO:0009262 24156116;35937492;34514040;1353343 False 3 100;0;0 21.569 True ENSG00000170266 ENSG00000170266 HGNC:4298 GLB1 gene GLB1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1-gangliosidosis, type I MIM#230500;GM1-gangliosidosis, type II MIM# 230600 24156116 False 3 100;0;0 21.569 True ENSG00000170266 ENSG00000170266 HGNC:4298 GLDC gene GLDC Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycine encephalopathy (MIM#605899) 27604308;2246863;1634607;27362913 False 3 100;0;0 21.569 True ENSG00000178445 ENSG00000178445 HGNC:4313 GLDC gene GLDC Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycine encephalopathy MIM#605899;Disorders of serine, glycine or glycerate metabolism 27604308;2246863;1634607 False 3 100;0;0 21.569 True ENSG00000178445 ENSG00000178445 HGNC:4313 GLI3 gene GLI3 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pallister-Hall syndrome, MIM# 146510 False 3 100;0;0 21.569 True ENSG00000106571 ENSG00000106571 HGNC:4319 GLRA1 gene GLRA1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 1, MIM# 149400 8298642;16832093 False 3 100;0;0 21.569 True ENSG00000145888 ENSG00000145888 HGNC:4326 GLRA1 gene GLRA1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 1, MIM# 149400 8298642;16832093 False 3 100;0;0 21.569 True ENSG00000145888 ENSG00000145888 HGNC:4326 GLRA2 gene GLRA2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndromic, Pilorge type, MIM# 301076 35294868 False 3 100;0;0 21.569 True ENSG00000101958 ENSG00000101958 HGNC:4327 GLRB gene GLRB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperekplexia 2, MIM# 614619 21391991;11929858;27843043 False 3 100;0;0 21.569 True ENSG00000109738 ENSG00000109738 HGNC:4329 GLRB gene GLRB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperekplexia 2, MIM# 614619 21391991;11929858;27843043 False 3 100;0;0 21.569 True ENSG00000109738 ENSG00000109738 HGNC:4329 GLRX5 gene GLRX5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spasticity, childhood-onset, with hyperglycinemia 616859" PMID: 24334290;30770271 False 3 50;50;0 21.569 True ENSG00000182512 ENSG00000182512 HGNC:20134 GLRX5 gene GLRX5 NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 616860 Anemia, sideroblastic, 3, pyridoxine-refractory;Sideroblastic anaemia - increased serum ferritin 24003969;30401706;25342667;30098397 False 3 0;0;0 21.569 False ENSG00000182512 ENSG00000182512 HGNC:20134 GLRX5 gene GLRX5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spasticity, childhood-onset, with hyperglycinemia 616859 PMID: 24334290;30770271 False 3 100;0;0 21.569 True ENSG00000182512 ENSG00000182512 HGNC:20134 GLRX5 gene GLRX5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Anaemia, sideroblastic, 3, pyridoxine-refractory, MIM# 616860 False 3 100;0;0 21.569 True ENSG00000182512 ENSG00000182512 HGNC:20134 GLS gene GLS Expert Review Green;NHS GMS;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 71 MIM#618328;Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412;disorder of amino acid metabolism 30575854;30970188;30239721 False 3 100;0;0 21.569 True ENSG00000115419 ENSG00000115419 HGNC:4331 GLS gene GLS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 71, MIM# 618328;Infantile cataract, skin abnormalities, glutamate excess, and impaired intellectual development MONDO:0032685 30575854;38622440;37151363 False 3 50;50;0 21.569 True ENSG00000115419 ENSG00000115419 HGNC:4331 GLUD1 gene GLUD1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperinsulinism-hyperammonemia syndrome, MIM# 606762 11214910;11297618 False 3 100;0;0 21.569 True ENSG00000148672 ENSG00000148672 HGNC:4335 GLUD1 gene GLUD1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperinsulinism-hyperammonemia syndrome, MIM# 606762 11214910;11297618 False 3 100;0;0 21.569 True ENSG00000148672 ENSG00000148672 HGNC:4335 GLUL gene GLUL Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Glutamine deficiency, congenital MIM#610015;Developmental and epileptic encephalopathy 116, MIM# 620806 16267323;21353613;33150193 False 3 100;0;0 21.569 True ENSG00000135821 ENSG00000135821 HGNC:4341 GLUL gene GLUL Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Glutamine deficiency, congenital MIM#610015;Developmental and epileptic encephalopathy 116, MIM# 620806 16267323;21353613;33150193 False 3 100;0;0 21.569 True ENSG00000135821 ENSG00000135821 HGNC:4341 GLYCTK gene GLYCTK Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal D-glyceric aciduria MIM#220120;Disorders of serine, glycine or glycerate metabolism 20949620;31837836 False 3 100;0;0 21.569 True ENSG00000168237 ENSG00000168237 HGNC:24247 GLYCTK gene GLYCTK NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal D-glyceric aciduria, MIM# 220120 3588091;30637540;28462797;20949620;28190537 False 3 100;0;0 21.569 True ENSG00000168237 ENSG00000168237 HGNC:24247 GM2A gene GM2A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, AB variant MIM#272750 28417072;28192816;27402091;33819415 False 3 100;0;0 21.569 True ENSG00000196743 ENSG00000196743 HGNC:4367 GM2A gene GM2A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "GM2-gangliosidosis, AB variant, MIM# 272750" False 3 100;0;0 21.569 True ENSG00000196743 ENSG00000196743 HGNC:4367 GM2A gene GM2A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, AB variant, MIM#272750 False 3 100;0;0 21.569 True ENSG00000196743 ENSG00000196743 HGNC:4367 GMPPA gene GMPPA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alacrima, achalasia, and impaired intellectual development syndrome (MIM# 615510) 24035193;28574218 False 3 100;0;0 21.569 True ENSG00000144591 ENSG00000144591 HGNC:22923 GMPPB gene GMPPB Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 14 615350 30257713 False 3 100;0;0 21.569 True ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 615352 False 3 100;0;0 21.569 False ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 MIM#615352;Limb myalgia;exercise intolerance;myoglobinuria" 28456886;27874200;25681410 False 3 100;0;0 21.569 True ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 14 (MIM# 615350);Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 14 (MIM# 615351);Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 (MIM# 615352) False 3 100;0;0 21.569 True ENSG00000173540 ENSG00000173540 HGNC:22932 GNAI1 gene GNAI1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, impaired speech, and behavioral abnormalities, MIM# 619854 28135719;33473207 False 3 100;0;0 21.569 True ENSG00000127955 ENSG00000127955 HGNC:4384 GNAL gene GNAL Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 25, MIM# 615073;MONDO:0014033 23222958;33175450;32180288 False 3 100;0;0 21.569 False ENSG00000141404 ENSG00000141404 HGNC:4388 GNAO1 gene GNAO1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with involuntary movements, 617493 28747448;30682224 False 3 100;0;0 21.569 True Other ENSG00000087258 ENSG00000087258 HGNC:4389 GNAO1 gene GNAO1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 17;Neurodevelopmental disorder with involuntary movements 28747448;30682224 False 3 100;0;0 21.569 True ENSG00000087258 ENSG00000087258 HGNC:4389 GNAQ gene GNAQ Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Sturge-Weber syndrome, somatic, mosaic 185300 34124757;30920161 False 3 100;0;0 21.569 True Other ENSG00000156052 ENSG00000156052 HGNC:4390 GNAS gene GNAS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Pseudohypoparathyroidism Ib, MIM# 603233 28296742;35600030;20444925 False 3 100;0;0 21.569 True ENSG00000087460 ENSG00000087460 HGNC:4392 GNB1 gene GNB1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 42, MIM# 616973;Myoclonus dystonia 30194818;27108799;27668284;31034681 False 3 100;0;0 21.569 True ENSG00000078369 ENSG00000078369 HGNC:4396 GNB1 gene GNB1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 42, MIM# 616973 32134617 False 3 100;0;0 21.569 True ENSG00000078369 ENSG00000078369 HGNC:4396 GNB4 gene GNB4 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, dominant intermediate F, MIM# 615185;MONDO:0014074;HMSN 23434117;28642160;27908631 False 3 100;0;0 21.569 False ENSG00000114450 ENSG00000114450 HGNC:20731 GNB5 gene GNB5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal gnb5-related intellectual disability-cardiac arrhythmia syndrome MONDO:0014953;Lodder-Merla syndrome, type 1, with impaired intellectual development and cardiac arrhythmia (MIM#617173);Lodder-Merla syndrome, type 2, with developmental delay and with or without cardiac arrhythmia (MIM#617182) 27523599;27677260;28697420;29368331 False 3 100;0;0 21.569 True ENSG00000069966 ENSG00000069966 HGNC:4401 GNE gene GNE Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nonaka myopathy 605820;Sialuria MIM#269921;ADUDP-GlcNAc epimerase/kinase deficiency (Disorders of multiple glycosylation and other glycosylation pathways) 12177386;12473753;32053088;29923088;10356312;11326336;11486897;27142465 False 3 100;0;0 21.569 True ENSG00000159921 ENSG00000159921 HGNC:23657 GNE gene GNE Expert Review Green;Expert Review;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nonaka myopathy (MIM#605820) 22883483;20301439 False 3 50;50;0 21.569 True ENSG00000159921 ENSG00000159921 HGNC:23657 GNE gene GNE Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Nonaka myopathy, MIM# 605820" False 3 100;0;0 21.569 True ENSG00000159921 ENSG00000159921 HGNC:23657 GNMT gene GNMT Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycine N-methyltransferase deficiency MIM#606664;Disorders of the metabolism of sulphur amino acids 11810299;14739680;17937387;27207470 False 3 100;0;0 21.569 True ENSG00000124713 ENSG00000124713 HGNC:4415 GNPAT gene GNPAT Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000116906 ENSG00000116906 HGNC:4416 GNPTAB gene GNPTAB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GNPTAB-mucolipidosis MONDO:0100122;Mucolipidosis II alpha/beta, MIM# 252500;Mucolipidosis III alpha/beta, MIM# 252600 False 3 100;0;0 21.569 True ENSG00000111670 ENSG00000111670 HGNC:29670 GNPTG gene GNPTG Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucolipidosis III gamma, MIM# 252605;MONDO:0009652 10712439;19370764;19659762;33507475;33023972;32651481 False 3 100;0;0 21.569 True ENSG00000090581 ENSG00000090581 HGNC:23026 GNS gene GNS Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type IIID, MIM# 252940;Sanfilippo syndrome type D, MONDO:0009658 12573255;12624138;31536183;25851924 False 3 100;0;0 21.569 True ENSG00000135677 ENSG00000135677 HGNC:4422 GORAB gene GORAB Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Geroderma osteodysplasticum MIM#231070 PMID: 18348262;28807865;30631079. False 3 100;0;0 21.569 True ENSG00000120370 ENSG00000120370 HGNC:25676 GOSR2 gene GOSR2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 6 , MIM#614018 21549339;24458321;30363482 False 3 100;0;0 21.569 True ENSG00000108433 ENSG00000108433 HGNC:4431 GOSR2 gene GOSR2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 6, 614018;Progressive myoclonic epilepsy 6, 614018 False 3 100;0;0 21.569 False ENSG00000108433 ENSG00000108433 HGNC:4431 GOT2 gene GOT2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 82, MIM# 618721" 31422819 False 3 100;0;0 21.569 True ENSG00000125166 ENSG00000125166 HGNC:4433 GPAA1 gene GPAA1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 15, MIM# 617810 29100095 False 3 100;0;0 21.569 True ENSG00000197858 ENSG00000197858 HGNC:4446 GPAA1 gene GPAA1 Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 15, 617810 False 3 100;0;0 21.569 True ENSG00000197858 ENSG00000197858 HGNC:4446 GPAA1 gene GPAA1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glycosylphosphatidylinositol biosynthesis defect 15, MIM# 617810" 29100095 False 3 100;0;0 21.569 True ENSG00000197858 ENSG00000197858 HGNC:4446 GPD1 gene GPD1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypertriglyceridemia, transient infantile MIM#614480;glycerol-3-phosphate dehydrogenase deficiency 32591995;22226083;33447932 False 3 100;0;0 21.569 True ENSG00000167588 ENSG00000167588 HGNC:4455 GPD1 gene GPD1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of mitochondrial shuttles and carriers;transient infantile hypertriglyceridemia and hepatosteatosis MONDO:0013771 29884839;35988808;24549054 False 3 100;0;0 21.569 True ENSG00000167588 ENSG00000167588 HGNC:4455 GPHN gene GPHN Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of molybdenum cofactor metabolism;sulfite oxidase deficiency due to molybdenum cofactor deficiency type C MONDO:0014212 27604308, 11095995, 22040219, 9812897 False 3 0;0;0 21.569 False ENSG00000171723 ENSG00000171723 HGNC:15465 GPHN gene GPHN Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Molybdenum cofactor deficiency C MIM#615501;Disorders of molybdenum cofactor metabolism 27604308;11095995;22040219;9812897 False 3 100;0;0 21.569 True ENSG00000171723 ENSG00000171723 HGNC:15465 GPHN gene GPHN NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Molybdenum cofactor deficiency C, MIM# 615501;Epilepsy;Autism;Intellectual disability 22040219;11095995;26613940;24561070;23393157;34617111 False 3 100;0;0 21.569 True ENSG00000171723 ENSG00000171723 HGNC:15465 GPRC5B gene GPRC5B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Megalencephalic leukoencephalopathy with subcortical cysts 3 MIM#620447 37143309 False 3 100;0;0 21.569 True ENSG00000167191 ENSG00000167191 HGNC:13308 GPRC5B gene GPRC5B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Megalencephalic leukoencephalopathy with subcortical cysts 3 MIM#620447 37143309 False 3 100;0;0 21.569 True ENSG00000167191 ENSG00000167191 HGNC:13308 GPT2 gene GPT2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281 27601654;25758935;31471722 False 3 100;0;0 21.569 True ENSG00000166123 ENSG00000166123 HGNC:18062 GPT2 gene GPT2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281 29882329;31471722;27601654 False 3 100;0;0 21.569 True ENSG00000166123 ENSG00000166123 HGNC:18062 GPT2 gene GPT2 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281 27601654;25758935 False 3 100;0;0 21.569 True ENSG00000166123 ENSG00000166123 HGNC:18062 GRIA1 gene GRIA1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 67, MIM# 619927 35675825;38890806;37921875 False 3 50;0;50 21.569 True ENSG00000155511 ENSG00000155511 HGNC:4571 GRIA2 gene GRIA2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual disability;autism;Rett-like features;epileptic encephalopathy;Neurodevelopmental disorder with language impairment and behavioral abnormalities, MIM# 618917" 31300657 False 3 100;0;0 21.569 True ENSG00000120251 ENSG00000120251 HGNC:4572 GRIA3 gene GRIA3 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndromic, Wu type (MIM#300699) 32977175;17989220;38038360 False 3 100;0;0 21.569 True ENSG00000125675 ENSG00000125675 HGNC:4573 GRIA3 gene GRIA3 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Glutamate neurotransmitter disorders;X-linked complex neurodevelopmental disorder MONDO:0100148 38038360 False 3 0;0;0 21.569 False ENSG00000125675 ENSG00000125675 HGNC:4573 GRIA4 gene GRIA4 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glutamate neurotransmitter disorders;Neurodevelopmental disorder with or without seizures and gait abnormalities MONDO:0060641 35518358;29220673 False 3 0;0;0 21.569 False ENSG00000152578 ENSG00000152578 HGNC:4574 GRIA4 gene GRIA4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without seizures and gait abnormalities MIM#617864 35518358;29220673 False 3 100;0;0 21.569 True ENSG00000152578 ENSG00000152578 HGNC:4574 GRID2 gene GRID2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 18, 616204 False 3 100;0;0 21.569 False ENSG00000152208 ENSG00000152208 HGNC:4576 GRIK2 gene GRIK2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 6 MIM#611092;Neurodevelopmental disorder with impaired language and ataxia and with or without seizures MIM#619580 34375587;17847003;25039795 False 3 100;0;0 21.569 True ENSG00000164418 ENSG00000164418 HGNC:4580 GRIN1 gene GRIN1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 29365063;27164704;27164704;28051072 False 3 100;0;0 21.569 True ENSG00000176884 ENSG00000176884 HGNC:4584 GRIN1 gene GRIN1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 101, MIM# 619814;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 29365063;27164704;27164704;28051072;34611970 False 3 100;0;0 21.569 True ENSG00000176884 ENSG00000176884 HGNC:4584 GRIN1 gene GRIN1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Glutamate neurotransmitter disorders;Complex neurodevelopmental disorder MONDO:0100038 29365063;27164704;28051072 False 3 0;0;0 21.569 False ENSG00000176884 ENSG00000176884 HGNC:4584 GRIN2A gene GRIN2A Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glutamate neurotransmitter disorders;Complex neurodevelopmental disorder MONDO:0100038 30544257 False 3 0;0;0 21.569 False ENSG00000183454 ENSG00000183454 HGNC:4585 GRIN2A gene GRIN2A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epilepsy, focal, with speech disorder and with or without mental retardation, MIM# 245570 30544257;35983985 False 3 100;0;0 21.569 True Other ENSG00000183454 ENSG00000183454 HGNC:4585 GRIN2B gene GRIN2B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted GRIN2B-related complex neurodevelopmental disorder MONDO:0700350;Developmental and epileptic encephalopathy 27 MIM#616139;Intellectual developmental disorder, autosomal dominant 6, with or without seizures MIM#613970 28377535 False 3 100;0;0 21.569 True ENSG00000273079 ENSG00000273079 HGNC:4586 GRIN2B gene GRIN2B Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glutamate neurotransmitter disorders;Complex neurodevelopmental disorder MONDO:0100038 28377535 False 3 0;0;0 21.569 False ENSG00000273079 ENSG00000273079 HGNC:4586 GRIN2D gene GRIN2D Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glutamate neurotransmitter disorders;Complex neurodevelopmental disorder MONDO:0100038 30280376;27616483 False 3 0;0;0 21.569 False ENSG00000105464 ENSG00000105464 HGNC:4588 GRIN2D gene GRIN2D Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 46, MIM# 617162;intellectual disability 27616483;30280376 False 3 100;0;0 21.569 True Other ENSG00000105464 ENSG00000105464 HGNC:4588 GRM1 gene GRM1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 13;Spinocerebellar ataxia 44, 617691, autosomal recessive spinocerebellar ataxia type 13, 614831 False 3 100;0;0 21.569 False ENSG00000152822 ENSG00000152822 HGNC:4593 GRM1 gene GRM1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Cerebellar ataxia MONDO:0000437;Glutamate neurotransmitter disorders 26308914;31319223;22901947 False 3 0;0;0 21.569 False ENSG00000152822 ENSG00000152822 HGNC:4593 GRM7 gene GRM7 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, microcephaly, developmental delay;neurodevelopmental disorder with seizures, hypotonia, and brain imaging abnormalities (NEDSHBA), MIM#618922 32286009;32248644 False 3 100;0;0 21.569 True ENSG00000196277 ENSG00000196277 HGNC:4599 GRN gene GRN Expert Review Green;ClinGen Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 18184915;23596077 False 3 100;0;0 21.569 True ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM#607485" False 3 100;0;0 21.569 True ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ceroid lipofuscinosis, neuronal, 11 614706" PMID: 22608501;31855245 False 3 100;0;0 21.569 True ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 20301545;17436289 False 3 100;0;0 21.569 True ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM# 607485 17923627;20301545 False 3 100;0;0 21.569 False ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal neuronal ceroid lipofuscinosis MONDO:0016295;GRN-related frontotemporal lobar degeneration with Tdp43 inclusions MONDO:0011842 37981505;38347588;29884839 False 3 0;0;0 21.569 False ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Other;Expert Review Green;Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted GRN-related frontotemporal lobar degeneration with Tdp43 inclusions MONDO:0011842 36970046;36632182 False 3 100;0;0 21.569 False ENSG00000030582 ENSG00000030582 HGNC:4601 GSN gene GSN Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amyloidosis, Finnish type MIM#105120 8684801;228009;3513049 False 3 0;100;0 21.569 True ENSG00000148180 ENSG00000148180 HGNC:4620 GSPT2 gene GSPT2 Expert Review Green;Genetic Health Queensland;Genomics England PanelApp;Genomics England PanelApp;Genetic Health Queensland Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Neurodevelopmental disorder, MONDO:0700092, GSPT2-related 28414775;41420488 False 3 100;0;0 21.569 True ENSG00000189369 ENSG00000189369 HGNC:4622 GSS gene GSS Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutathione synthetase deficiency MIM#266130;Hemolytic anemia due to glutathione synthetase deficiency MIM#231900;Disorders of the gamma-glutamyl cycle 8896573 False 3 100;0;0 21.569 True ENSG00000100983 ENSG00000100983 HGNC:4624 GSS gene GSS NHS GMS;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gluthathione synthetase deficiency, MIM# 266130 15717202 False 3 100;0;0 21.569 True ENSG00000100983 ENSG00000100983 HGNC:4624 GSS gene GSS NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutathione synthetase deficiency, MIM# 266130 False 3 100;0;0 21.569 True ENSG00000100983 ENSG00000100983 HGNC:4624 GSX2 gene GSX2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Diencephalic-mesencephalic junction dysplasia syndrome 2 618646;Intellectual disability;Dystonia;Spastic tetra paresis" 31412107;39119454 False 3 100;0;0 21.569 True ENSG00000180613 ENSG00000180613 HGNC:24959 GTF3C3 gene GTF3C3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with dysmorphic facies, brain anomalies, and seizures, MIM# 621201 PMID: 39636576 False 3 100;0;0 21.569 True ENSG00000119041 ENSG00000119041 HGNC:4666 GTPBP2 gene GTPBP2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Jaberi-Elahi syndrome, MIM#617988 26675814;29449720;30790272 False 3 100;0;0 21.569 True ENSG00000172432 ENSG00000172432 HGNC:4670 GTPBP2 gene GTPBP2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Jaberi-Elahi syndrome, MIM#617988 26675814;29449720 False 3 100;0;0 21.569 True ENSG00000172432 ENSG00000172432 HGNC:4670 GTPBP3 gene GTPBP3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 23, MIM#616198 25434004 False 3 100;0;0 21.569 True ENSG00000130299 ENSG00000130299 HGNC:14880 GTPBP3 gene GTPBP3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 23, MIM#616198 34276756;25434004 False 3 100;0;0 21.569 True ENSG00000130299 ENSG00000130299 HGNC:14880 GUCY1A3 gene GUCY1A3 Expert Review Green;Genomics England PanelApp;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Moyamoya 6 with achalasia;Moyamoya 6 with achalasia, 615750 24581742;26777256 False 3 100;0;0 21.569 False ENSG00000164116 ENSG00000164116 HGNC:4685 GUK1 gene GUK1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 21, MIM# 621071 39230499 False 3 100;0;0 21.569 True ENSG00000143774 ENSG00000143774 HGNC:4693 GUK1 gene GUK1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 21, MIM# 621071 39230499 False 3 100;0;0 21.569 True ENSG00000143774 ENSG00000143774 HGNC:4693 GUSB gene GUSB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis VII, MIM# 253220;MONDO:0009662 False 3 100;0;0 21.569 True ENSG00000169919 ENSG00000169919 HGNC:4696 GYG1 gene GYG1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body myopathy 2, MIM# 616199;Glycogen storage disease XV , MIM# 613507 29422440;32477874;32528171 False 3 100;0;0 21.569 True ENSG00000163754 ENSG00000163754 HGNC:4699 GYG1 gene GYG1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XV, MIM# 613507;Polyglucosan body myopathy 2, MIM# 616199 31791869;20357282;27718144 False 3 100;0;0 21.569 True ENSG00000163754 ENSG00000163754 HGNC:4699 GYG1 gene GYG1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Glycogen storage disease XV 613507;Polyglucosan body myopathy 2 616199 25272951;26652229 False 3 100;0;0 21.569 True ENSG00000163754 ENSG00000163754 HGNC:4699 GYS1 gene GYS1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glycogen storage disease 0, muscle, MIM# 611556" 17928598;19699667;21958591 False 3 100;0;0 21.569 True ENSG00000104812 ENSG00000104812 HGNC:4706 GYS1 gene GYS1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease 0, muscle 611556 17928598;19699667;18358695;21958591 False 3 100;0;0 21.569 True ENSG00000104812 ENSG00000104812 HGNC:4706 GYS2 gene GYS2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease 0, liver (MIM#240600) 32395408;28245189 False 3 100;0;0 21.569 True ENSG00000111713 ENSG00000111713 HGNC:4707 H3F3A gene H3F3A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bryant-Li-Bhoj neurodevelopmental syndrome 1 MIM#619720 33268356 False 3 50;50;0 21.569 True ENSG00000163041 ENSG00000163041 HGNC:4764 H3F3B gene H3F3B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bryant-Li-Bhoj neurodevelopmental syndrome 2 MIM#619721 33268356 False 3 100;0;0 21.569 True ENSG00000132475 ENSG00000132475 HGNC:4765 HAAO gene HAAO Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Vertebral, cardiac, renal, and limb defects syndrome 1 MIM#617660;NAD deficiency 28792876;33942433 False 3 100;0;0 21.569 True ENSG00000162882 ENSG00000162882 HGNC:4796 HACE1 gene HACE1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia and psychomotor retardation with or without seizures, 616756;MONDO:0014764 26424145;26437029;31321300 False 3 100;0;0 21.569 True ENSG00000085382 ENSG00000085382 HGNC:21033 HACE1 gene HACE1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia and psychomotor retardation with or without seizures, 616756;MONDO:0014764;Spastic paraplegia;psychomotor retardation 26424145;26437029;31321300 False 3 100;0;0 21.569 True ENSG00000085382 ENSG00000085382 HGNC:21033 HADH gene HADH Expert Review Green;Expert Review Green;NHS GMS;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-hydroxyacyl-CoA dehydrogenase deficiency MIM#231530 25778941;23430856;27771675;11489939 False 3 100;0;0 21.569 True ENSG00000138796 ENSG00000138796 HGNC:4799 HADH gene HADH Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-hydroxyacyl-CoA dehydrogenase deficiency, MIM# 231530;Hyperinsulinemic hypoglycemia, familial, 4, MIM# 609975;SCHAD deficiency, MONDO:0009278 False 3 100;0;0 21.569 True ENSG00000138796 ENSG00000138796 HGNC:4799 HADHA gene HADHA Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal LCHAD deficiency MIM#609016;Trifunctional protein deficiency MIM#609015 25778941;7811722;29459657 False 3 100;0;0 21.569 True ENSG00000084754 ENSG00000084754 HGNC:4801 HADHA gene HADHA Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal LCHAD deficiency MIM#609016;Mitochondrial trifunctional protein deficiency MIM#609015 8871579;23868323;33744096;12838198;36063482 False 3 0;100;0 21.569 True ENSG00000084754 ENSG00000084754 HGNC:4801 HADHA gene HADHA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal LCHAD deficiency, MIM# 609016 False 3 100;0;0 21.569 True ENSG00000084754 ENSG00000084754 HGNC:4801 HADHA gene HADHA Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal LCHAD deficiency MIM#609016;Trifunctional protein deficiency MIM#609015 25778941;7811722;29459657 False 3 100;0;0 21.569 True ENSG00000084754 ENSG00000084754 HGNC:4801 HADHB gene HADHB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Trifunctional protein deficiency, MIM# 609015 30682426;28515471 False 3 100;0;0 21.569 True ENSG00000138029 ENSG00000138029 HGNC:4803 HADHB gene HADHB Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Trifunctional protein deficiency MIM#609015 25778941;30682426;9259266;29956646 False 3 100;0;0 21.569 True ENSG00000138029 ENSG00000138029 HGNC:4803 HADHB gene HADHB Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Trifunctional protein deficiency MIM#609015 25778941;30682426;9259266;29956646 False 3 100;0;0 21.569 True ENSG00000138029 ENSG00000138029 HGNC:4803 HAMP gene HAMP NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 613313 Hemochromatosis, type 2B;613313 HEMOCHROMATOSIS, TYPE 2B;HFE2B 12915468;15198949;12469120 False 3 0;0;0 21.569 False ENSG00000105697 ENSG00000105697 HGNC:15598 HARS gene HARS Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 2W, MIM# 616625;MONDO:0014711;HMSN 26072516 False 3 100;0;0 21.569 False ENSG00000170445 ENSG00000170445 HGNC:4816 HARS2 gene HARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 2, MIM# 614926 31827252 False 3 100;0;0 21.569 True ENSG00000112855 ENSG00000112855 HGNC:4817 HAX1 gene HAX1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neutropaenia, severe congenital 3, autosomal recessive, MIM# 610738;Kostmann syndrome MONDO:0012548 17187068;18611981;19036076 False 3 100;0;0 21.569 True ENSG00000143575 ENSG00000143575 HGNC:16915 HCCS gene HCCS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Linear skin defects with multiple congenital anomalies 1, MIM# 309801 17033964;30068298;24735900 False 3 100;0;0 21.569 True ENSG00000004961 ENSG00000004961 HGNC:4837 HCFC1 gene HCFC1 Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked 3 (methylmalonic acidaemia and homocysteinaemia, cblX type) MIM# 309541 34164576;24011988 False 3 100;0;0 21.569 True ENSG00000172534 ENSG00000172534 HGNC:4839 HCN1 gene HCN1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 24, MIM# 615871;Generalized epilepsy with febrile seizures plus, type 10, MIM# 618482 24747641;30351409;30351409 False 3 100;0;0 21.569 True ENSG00000164588 ENSG00000164588 HGNC:4845 HCN2 gene HCN2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Generalized epilepsy with febrile seizures plus, type 11, MIM# 602477;Febrile seizures, familial, 2, MIM# 602477;Genetic epilepsy with febrile seizures plus;Other seizure disorders" 40468825;22131395;30986657;29064616;20437590;12514127;17931874 False 3 100;0;0 21.569 True ENSG00000099822 ENSG00000099822 HGNC:4846 HDAC3 gene HDAC3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, HDAC3-related 39047730 False 3 100;0;0 21.569 True ENSG00000171720 ENSG00000171720 HGNC:4854 HECTD1 gene HECTD1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092 PMID: 39879987 False 3 100;0;0 21.569 True ENSG00000092148 ENSG00000092148 HGNC:20157 HECTD4 gene HECTD4 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures, spasticity, and complete or partial agenesis of the corpus callosum, MIM# 620250 PMID: 36401616 False 3 100;0;0 21.569 False ENSG00000173064 ENSG00000173064 HGNC:26611 HECW2 gene HECW2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, seizures, and absent language, MIM# 617268;intellectual disability;epilepsy;regression;microcephaly 29807643;29395664;27334371;27389779 False 3 67;33;0 21.569 True Other ENSG00000138411 ENSG00000138411 HGNC:29853 HEPACAM gene HEPACAM Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Megalencephalic leukoencephalopathy with subcortical cysts 2A, MIM# 613925;Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, MIM# 613926 21419380;21419380 False 3 100;0;0 21.569 True ENSG00000165478 ENSG00000165478 HGNC:26361 HEPACAM gene HEPACAM Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Megalencephalic leukoencephalopathy with subcortical cysts 2A, MIM# 613925;Megalencephalic leukoencephalopathy with subcortical cysts 2B, remitting, with or without mental retardation, MIM# 613926" 21419380;21419380 False 3 100;0;0 21.569 True ENSG00000165478 ENSG00000165478 HGNC:26361 HERC2 gene HERC2 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 38 (MIM 615516) 23065719;23243086;30902390;32571899;27848944;26077850;27759030 False 3 100;0;0 21.569 True ENSG00000128731 ENSG00000128731 HGNC:4868 HEXA gene HEXA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms, MIM# 272800;Tay-Sachs disease, MIM# 272800;MONDO:0010100 False 3 100;0;0 21.569 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXA gene HEXA Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Usually infantile-onset, developmental delay and cognitive decline, visual loss ( cherry red spot ), motor>sensory neuronopathy, hypometric saccades, adult-onset (second decade) cases described;Tay-Sachs disease 17015493;18642377;3159334;1838393 False 3 100;0;0 21.569 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXA gene HEXA Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms, 272800;Tay-Sachs disease, 272800 False 3 100;0;0 21.569 False ENSG00000213614 ENSG00000213614 HGNC:4878 HEXA gene HEXA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Tay-Sachs disease, MIM# 272800" False 3 100;0;0 21.569 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXA gene HEXA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms or Tay-Sachs disease MIM#272800 31995250;31076878 False 3 100;0;0 21.569 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXA gene HEXA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms 272800;Tay-Sachs disease 272800 31388111 False 3 100;0;0 21.569 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXB gene HEXB Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms, 268800;Sandhoff disease, 268800 False 3 100;0;0 21.569 False ENSG00000049860 ENSG00000049860 HGNC:4879 HEXB gene HEXB Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Usually infantile-onset, developmental delay and cognitive decline, visual loss ( cherry red spot ), motor>sensory neuronopathy, hypometric saccades, adult-onset (second decade) cases described;Tay-Sachs disease False 3 100;0;0 21.569 False ENSG00000049860 ENSG00000049860 HGNC:4879 HEXB gene HEXB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms, MIM# 268800;MONDO:0010006 False 3 100;0;0 21.569 True ENSG00000049860 ENSG00000049860 HGNC:4879 HEXB gene HEXB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms, MIM# 268800;MONDO:0010006 False 3 100;0;0 21.569 True ENSG00000049860 ENSG00000049860 HGNC:4879 HEXB gene HEXB Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms MIM#268800 31995250;24263030 False 3 100;0;0 21.569 True ENSG00000049860 ENSG00000049860 HGNC:4879 HFE gene HFE NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 235200 Hemochromatosis;235200 HEMOCHROMATOSIS, TYPE 1;235200HEMOCHROMATOSIS, TYPE 1;HFE1 18199861 False 3 0;0;0 21.569 False ENSG00000010704 ENSG00000010704 HGNC:4886 HFE2 gene HFE2 NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HFE2A;602390 HEMOCHROMATOSIS, TYPE 2A;602390 Hemochromatosis, type 2A 14982873 False 3 0;0;0 21.569 False ENSG00000168509 ENSG00000168509 HGNC:4887 HGD gene HGD Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alkaptonuria MIM#203500;Disorders of phenylalanine or tyrosine metabolism 8782815;27604308 False 3 100;0;0 21.569 True ENSG00000113924 ENSG00000113924 HGNC:4892 HGSNAT gene HGSNAT Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type IIIC (Sanfilippo C), MIM# 252930;MONDO:0009657;Retinitis pigmentosa 73, MIM# 616544;MONDO:0014687 17033958;25859010;19479962;31228227;20825431;20583299 False 3 100;0;0 21.569 True ENSG00000165102 ENSG00000165102 HGNC:26527 HIBCH gene HIBCH Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620 26026795;25251209;24299452;32677093 False 3 100;0;0 21.569 True ENSG00000198130 ENSG00000198130 HGNC:4908 HIBCH gene HIBCH Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620" 26026795;25251209;24299452;32677093 False 3 100;0;0 21.569 True ENSG00000198130 ENSG00000198130 HGNC:4908 HID1 gene HID1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 105 with hypopituitarism MIM#619983 33999436 False 3 100;0;0 21.569 True ENSG00000167861 ENSG00000167861 HGNC:15736 HIKESHI gene HIKESHI Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 13, MIM#616881 False 3 100;0;0 21.569 False ENSG00000149196 ENSG00000149196 HGNC:26938 HINT1 gene HINT1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuromyotonia and axonal neuropathy, autosomal recessive, MIM# 137200;Gamstorp-Wohlfart syndrome, MONDO:0007646;HMSN, dHMN/dSMA 22961002;33663550;33404983;31848916 False 3 100;0;0 21.569 False ENSG00000169567 ENSG00000169567 HGNC:4912 HIVEP2 gene HIVEP2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder, autosomal dominant 43, MIM# 616977" 27003583 False 3 100;0;0 21.569 True ENSG00000010818 ENSG00000010818 HGNC:4921 HK1 gene HK1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Neurodevelopmental disorder with visual defects and brain anomalies, MIM# 618547" 40469904;38617198 False 3 100;0;0 21.569 True ENSG00000156515 ENSG00000156515 HGNC:4922 HK1 gene HK1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Neuropathy, hereditary motor and sensory, Russe type, 605285 19536174;26822750 False 3 100;0;0 21.569 False ENSG00000156515 ENSG00000156515 HGNC:4922 HLCS gene HLCS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Holocarboxylase synthetase deficiency, MIM# 253270 False 3 100;0;0 21.569 True ENSG00000159267 ENSG00000159267 HGNC:4976 HLCS gene HLCS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Holocarboxylase synthetase deficiency, MIM# 253270 10190325 False 3 100;0;0 21.569 True ENSG00000159267 ENSG00000159267 HGNC:4976 HMBS gene HMBS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, porphyria-related, MIM# 620711 27558376;34089223 False 3 50;50;0 21.569 True ENSG00000256269 ENSG00000256269 HGNC:4982 HMBS gene HMBS Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Porphyria, acute intermittent MIM#176000 25389600;18647325 False 3 100;0;0 21.569 True ENSG00000256269 ENSG00000256269 HGNC:4982 HMBS gene HMBS Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Porphyria, acute intermittent MIM#176000;MONDO:0008294 31205461;20301372;8563760 False 3 50;50;0 21.569 True ENSG00000256269 ENSG00000256269 HGNC:4982 HMGCL gene HMGCL Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMG-CoA lyase deficiency, 246450 11461194 False 3 100;0;0 21.569 True ENSG00000117305 ENSG00000117305 HGNC:5005 HMGCL gene HMGCL Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMG-CoA lyase deficiency MIM#246450 25778941;11129331;19036343 False 3 100;0;0 21.569 True ENSG00000117305 ENSG00000117305 HGNC:5005 HMGCL gene HMGCL Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMG-CoA lyase deficiency, MIM# 246450 8617516 False 3 100;0;0 21.569 True ENSG00000117305 ENSG00000117305 HGNC:5005 HMGCL gene HMGCL Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMG-CoA lyase deficiency, MIM# 246450 8617516 False 3 100;0;0 21.569 True ENSG00000117305 ENSG00000117305 HGNC:5005 HMGCR gene HMGCR Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive limb-girdle muscular dystrophy (MONDO:0015152), HMGCR-related PMID: 37167966;36745799 False 3 50;0;50 21.569 True ENSG00000113161 ENSG00000113161 HGNC:5006 HMGCS2 gene HMGCS2 Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMG-CoA synthase-2 deficiency MIM#605911 25778941;9337379;23751782 False 3 100;0;0 21.569 True ENSG00000134240 ENSG00000134240 HGNC:5008 HMGCS2 gene HMGCS2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMG-CoA synthase-2 deficiency, MIM# 605911 33045405 False 3 100;0;0 21.569 True ENSG00000134240 ENSG00000134240 HGNC:5008 HNRNPA1 gene HNRNPA1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 20 MIM#615426 23455423;34291734 False 3 100;0;0 21.569 True ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA1 gene HNRNPA1 Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, distal, 3, MIM# 610099;inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 3 MONDO:0014179 23455423;27066560;34291734;34722876 False 3 100;0;0 21.569 True Other ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA2B1 gene HNRNPA2B1 Expert Review Green;Literature;Literature;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted oculopharyngeal muscular dystrophy, MONDO:0008116, OMIM#620460 23455423;30279180;29358076;26744327;23635965;35484142 False 3 33;67;0 21.569 True ENSG00000122566 ENSG00000122566 HGNC:5033 HNRNPDL gene HNRNPDL Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Muscular dystrophy, limb-girdle, type 1G 609115 24647604;31267206;31995753;32407983;32904822;32367994 False 3 100;0;0 21.569 True ENSG00000152795 ENSG00000152795 HGNC:5037 HNRNPH2 gene HNRNPH2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndromic, Bain type MIM#300986 34907471;33728377;31670473;31236915;30887513 False 3 100;0;0 21.569 True ENSG00000126945 ENSG00000126945 HGNC:5042 HNRNPR gene HNRNPR Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dysmorphic facies and skeletal and brain abnormalities, MIM# 620073 26795593;31079900 False 3 100;0;0 21.569 True ENSG00000125944 ENSG00000125944 HGNC:5047 HNRNPU gene HNRNPU Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 54 MIM# 617391 28944577;28393272 False 3 100;0;0 21.569 True ENSG00000153187 ENSG00000153187 HGNC:5048 HPCA gene HPCA Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 2, torsion, autosomal recessive, 224500;MONDO:0009141;childhood-onset generalized dystonia;adolescence-onset segmental dystonia;generalized dystonia with additional neurological features 25799108;30991467;30145809 False 3 100;0;0 21.569 False ENSG00000121905 ENSG00000121905 HGNC:5144 HPD gene HPD Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hawkinsinuria MIM#140350;Tyrosinemia, type III MIM#276710;Disorders of phenylalanine or tyrosine metabolism 10942115;11073718;27604308 False 3 100;0;0 21.569 True ENSG00000158104 ENSG00000158104 HGNC:5147 HPDL gene HPDL Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome 32707086 False 3 100;0;0 21.569 True ENSG00000186603 ENSG00000186603 HGNC:28242 HPDL gene HPDL Expert Review Green;Literature;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome 32707086 False 3 100;0;0 21.569 True ENSG00000186603 ENSG00000186603 HGNC:28242 HPDL gene HPDL Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome 32707086 False 3 100;0;0 21.569 True ENSG00000186603 ENSG00000186603 HGNC:28242 HPDL gene HPDL Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome 32707086 False 3 100;0;0 21.569 True ENSG00000186603 ENSG00000186603 HGNC:28242 HPRT1 gene HPRT1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Lesch-Nyhan syndrome;Dystonia 20301328 False 3 100;0;0 21.569 True ENSG00000165704 ENSG00000165704 HGNC:5157 HPS1 gene HPS1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hermansky-Pudlak syndrome 1, MIM# 203300" False 3 100;0;0 21.569 True ENSG00000107521 ENSG00000107521 HGNC:5163 HRAS gene HRAS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Costello syndrome, MIM# 218040 16329078;16372351;16443854 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000174775 ENSG00000174775 HGNC:5173 HS2ST1 gene HS2ST1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194;Developmental delay and corpus callosum, skeletal, and renal abnormalities;disorder of glycosaminoglycan metabolism 33159882 False 3 100;0;0 21.569 True ENSG00000153936 ENSG00000153936 HGNC:5193 HSD17B10 gene HSD17B10 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) HSD10 mitochondrial disease, MIM# 300438 False 3 100;0;0 21.569 True ENSG00000072506 ENSG00000072506 HGNC:4800 HSD17B10 gene HSD17B10 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) HSD10 mitochondrial disease, MIM# 300438 False 3 100;0;0 21.569 True ENSG00000072506 ENSG00000072506 HGNC:4800 HSD17B4 gene HSD17B4 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal D-bifunctional protein deficiency, AR (MIM#261515);Perrault syndrome 1, AR (MIM#233400) 27790638 False 3 100;0;0 21.569 True ENSG00000133835 ENSG00000133835 HGNC:5213 HSD17B4 gene HSD17B4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal D-bifunctional protein deficiency, AR (MIM#261515);Perrault syndrome 1, AR (MIM#233400) 27790638 False 3 100;0;0 21.569 True ENSG00000133835 ENSG00000133835 HGNC:5213 HSD17B4 gene HSD17B4 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal General Leukodystrophy & Mitochondrial Leukoencephalopathy;Peroxisome-Associated Disorders & Zellweger Syndrome;D-bifunctional protein deficiency False 3 0;0;0 21.569 False ENSG00000133835 ENSG00000133835 HGNC:5213 HSD3B7 gene HSD3B7 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bile acid synthesis defect, congenital, 1 MIM#607765;Disorders of bile acid biosynthesis 11067870;27604308 False 3 100;0;0 21.569 True ENSG00000099377 ENSG00000099377 HGNC:18324 HSPA9 gene HSPA9 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Anaemia, sideroblastic, 4, MIM# 182170;Even-plus syndrome, MIM# 616854 29884839;21123823;26598328;26491070;39196378;36094340;38284453;38281662;35779070 False 3 100;0;0 21.569 True ENSG00000113013 ENSG00000113013 HGNC:5244 HSPB1 gene HSPB1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease axonal type 2F MONDO:0011687 21785432;15122254;18832141;32639100;32334137;33943041;35328016 False 3 100;0;0 21.569 False ENSG00000106211 ENSG00000106211 HGNC:5246 HSPB8 gene HSPB8 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN, dHMN/dSMA;Neuropathy, distal hereditary motor, type IIA, 158590;Charcot Marie Tooth disease, axonal, type 2L, 608673 15122253;15565283;29029362;28780615;28144995;26718575 False 3 100;0;0 21.569 False ENSG00000152137 ENSG00000152137 HGNC:30171 HSPB8 gene HSPB8 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, myofibrillar, 13, with rimmed vacuoles, MIM# 621078;autosomal dominant distal axonal motor neuropathy-myofibrillar myopathy syndrome MONDO:0018773 32165108;26718575;31403083;28780615 False 3 100;0;0 21.569 True Other ENSG00000152137 ENSG00000152137 HGNC:30171 HSPD1 gene HSPD1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 4, MIM# 612233;Spastic paraplegia 13, autosomal dominant, MIM# 605280 18571143;27405012;32532876;28377887;27405012;11898127;17420924 False 3 100;0;0 21.569 True ENSG00000144381 ENSG00000144381 HGNC:5261 HSPD1 gene HSPD1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 4, MIM# 612233 18571143;27405012;32532876;28377887;27405012;11898127;17420924 False 3 100;0;0 21.569 True ENSG00000144381 ENSG00000144381 HGNC:5261 HSPD1 gene HSPD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 4, MIM# 612233;Spastic paraplegia 13, autosomal dominant, MIM# 605280" False 3 100;0;0 21.569 True ENSG00000144381 ENSG00000144381 HGNC:5261 HSPD1 gene HSPD1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 13, autosomal dominant, 605280;Leukodystrophy, hypomyelinating, 4, 612233 18571143;27405012;32532876;28377887;27405012 False 3 100;0;0 21.569 True ENSG00000144381 ENSG00000144381 HGNC:5261 HTRA1 gene HTRA1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal CARASIL syndrome MIM#600142;Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2 MIM#616779 29895533;26063658;19387015 False 3 100;0;0 21.569 False ENSG00000166033 ENSG00000166033 HGNC:9476 HTRA1 gene HTRA1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cerebral arteriopathy, autosomal dominant, with subcortical infarcts and leukoencephalopathy, type 2, 616779;CARASIL syndrome, 600142 False 3 100;0;0 21.569 False ENSG00000166033 ENSG00000166033 HGNC:9476 HTRA2 gene HTRA2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria type 8 MONDO:0044723 27208207;27696117;30114719 False 3 50;50;0 21.569 True ENSG00000115317 ENSG00000115317 HGNC:14348 HTRA2 gene HTRA2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "3-methylglutaconic aciduria, type VIII, MIM# 617248" 27208207;27696117 False 3 100;0;0 21.569 True ENSG00000115317 ENSG00000115317 HGNC:14348 HTRA2 gene HTRA2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type VIII, MIM# 617248 27208207;27696117 False 3 100;0;0 21.569 True ENSG00000115317 ENSG00000115317 HGNC:14348 IARS2 gene IARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cataracts, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia, MIM# 616007 28328135;30419932;25130867;30041933 False 3 100;0;0 21.569 True ENSG00000067704 ENSG00000067704 HGNC:29685 IARS2 gene IARS2 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cataracts, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia, MIM# 616007" 28328135;30419932;25130867;30041933 False 3 100;0;0 21.569 True ENSG00000067704 ENSG00000067704 HGNC:29685 IBA57 gene IBA57 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 74, autosomal recessive MIM#616451 25609768;30258207 False 3 100;0;0 21.569 True ENSG00000181873 ENSG00000181873 HGNC:27302 IBA57 gene IBA57 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 3, MIM# 615330 23462291;25971455;27785568;28671726;28913435 False 3 100;0;0 21.569 True ENSG00000181873 ENSG00000181873 HGNC:27302 IBA57 gene IBA57 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 3, MIM#615330 23462291;25971455;27785568;28671726;28913435 False 3 100;0;0 21.569 True ENSG00000181873 ENSG00000181873 HGNC:27302 IDH2 gene IDH2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted D-2-hydroxyglutaric aciduria 2, MIM# 613657 25778941;27142242;20847235;24049096 False 3 100;0;0 21.569 True ENSG00000182054 ENSG00000182054 HGNC:5383 IDH2 gene IDH2 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted D-2-hydroxyglutaric aciduria 2 MIM#613657 25778941;27142242;20847235;24049096 False 3 100;0;0 21.569 True ENSG00000182054 ENSG00000182054 HGNC:5383 IDH3A gene IDH3A Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa 90, MIM#619007 31012789;30478029;30058936;28412069 False 3 100;0;0 21.569 True ENSG00000166411 ENSG00000166411 HGNC:5384 IDH3G gene IDH3G Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Retinitis pigmentosa 99, MIM# 301148 40119724 False 3 100;0;0 21.569 True ENSG00000067829 ENSG00000067829 HGNC:5386 IDS gene IDS Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mucopolysaccharidosis II, MIM# 309900;MONDO:0010674;Hunter syndrome 9921913;9762601;8940265;1901826 False 3 100;0;0 21.569 True ENSG00000010404 ENSG00000010404 HGNC:5389 IDUA gene IDUA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis Ih, MIM# 607014;Mucopolysaccharidosis Ih/s, MIM# 607015;Mucopolysaccharidosis Is, MIM# 607016;Mucopolysaccharidosis type 1, MONDO:0001586 False 3 100;0;0 21.569 True ENSG00000127415 ENSG00000127415 HGNC:5391 IER3IP1 gene IER3IP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, epilepsy, and diabetes syndrome, MIM# 614231;Primary microcephaly-epilepsy-permanent neonatal diabetes syndrome, MONDO:0013647 21835305;22991235;24138066;28711742 False 3 100;0;0 21.569 True ENSG00000134049 ENSG00000134049 HGNC:18550 IFIH1 gene IFIH1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aicardi-Goutieres syndrome 7 MIM#615846 25243380;31427910;24686847;24995871 False 3 100;0;0 21.569 True ENSG00000115267 ENSG00000115267 HGNC:18873 IFIH1 gene IFIH1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aicardi-Goutieres syndrome 7, MIM#615846 24686847 False 3 100;0;0 21.569 True ENSG00000115267 ENSG00000115267 HGNC:18873 IFIH1 gene IFIH1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aicardi-Goutieres syndrome 7, MIM#615846 24686847;34185153 False 3 100;0;0 21.569 True Other ENSG00000115267 ENSG00000115267 HGNC:18873 IFIH1 gene IFIH1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Aicardi-Goutieres syndrome 7 MIM#615846 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000115267 ENSG00000115267 HGNC:18873 IGHMBP2 gene IGHMBP2 Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN, dHMN/dSMA;Charcot-Marie-Tooth disease, axonal, type 2S 616155;Neuronopathy, distal hereditary motor, type VI, 604320 25439726 False 3 100;0;0 21.569 False ENSG00000132740 ENSG00000132740 HGNC:5542 IKBKG gene IKBKG Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Incontinentia pigmenti, MIM# 308300 31874111;35289316 False 3 100;0;0 21.569 True ENSG00000073009 ENSG00000269335 HGNC:5961 IMPDH2 gene IMPDH2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dystonia PMID: 33098801 False 3 100;0;0 21.569 True ENSG00000178035 ENSG00000178035 HGNC:6053 INF2 gene INF2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot Marie Tooth disease, dominant intermediate E, 614455;HMSN 22187985;30680856;25943269 False 3 100;0;0 21.569 False ENSG00000203485 ENSG00000203485 HGNC:23791 INPP4A gene INPP4A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354 PMID: 39315527 False 3 100;0;0 21.569 True ENSG00000040933 ENSG00000040933 HGNC:6074 INPP4A gene INPP4A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354 PMID: 39315527 False 3 100;0;0 21.569 True ENSG00000040933 ENSG00000040933 HGNC:6074 INPP5E gene INPP5E Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 1 False 3 100;0;0 21.569 False ENSG00000148384 ENSG00000148384 HGNC:21474 IQSEC2 gene IQSEC2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked 1, MIM# 309530;Neurodevelopmental disorder, X-linked, with poor or absent speech and behavioral abnormalities, MIM# 301164 31415821;20473311;30842726;33368194;23674175 False 3 100;0;0 21.569 True ENSG00000124313 ENSG00000124313 HGNC:29059 IRF2BPL gene IRF2BPL Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with regression, abnormal movement, loss of speech and seizures, 618088 30057031 False 3 100;0;0 21.569 True ENSG00000119669 ENSG00000119669 HGNC:14282 IRF2BPL gene IRF2BPL Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures 618088 PMID: 30057031;30166628 False 3 100;0;0 21.569 True ENSG00000119669 ENSG00000119669 HGNC:14282 IRF2BPL gene IRF2BPL Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures, MIM# 618088 30057031;30166628 False 3 100;0;0 21.569 True ENSG00000119669 ENSG00000119669 HGNC:14282 ISCA1 gene ISCA1 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 5 MIM#617613 28356563;32092383;31016283;30113620;30105122 False 3 100;0;0 21.569 True ENSG00000135070 ENSG00000135070 HGNC:28660 ISCA1 gene ISCA1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Multiple mitochondrial dysfunctions syndrome 5, MIM# 617613" 28356563;32092383;31016283;30113620;30105122 False 3 100;0;0 21.569 True ENSG00000135070 ENSG00000135070 HGNC:28660 ISCA1 gene ISCA1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Multiple mitochondrial dysfunctions syndrome 5, MIM# 617613" 28356563;32092383;31016283;30113620;30105122 False 3 100;0;0 21.569 True ENSG00000135070 ENSG00000135070 HGNC:28660 ISCA2 gene ISCA2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 4, MIM# 616370 25539947;29297947;29122497;29359243 False 3 100;0;0 21.569 True ENSG00000165898 ENSG00000165898 HGNC:19857 ISCA2 gene ISCA2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 4, 616370 25539947;29297947;29122497;29359243 False 3 100;0;0 21.569 True ENSG00000165898 ENSG00000165898 HGNC:19857 ISCU gene ISCU Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy with lactic acidosis, hereditary, MIM# 255125 29079705;18304497;18296749;19567699 False 3 100;0;0 21.569 True ENSG00000136003 ENSG00000136003 HGNC:29882 ISCU gene ISCU Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy with lactic acidosis, hereditary, MIM# 255125 29079705;18304497;18296749;19567699 False 3 100;0;0 21.569 True ENSG00000136003 ENSG00000136003 HGNC:29882 ISG15 gene ISG15 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 38 with BG calcification, MIM# 616126 25307056;32944031 False 3 100;0;0 21.569 True ENSG00000187608 ENSG00000187608 HGNC:4053 ISPD gene ISPD Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM#614643 28688748;30060766;22522420;24120487;35863218 False 3 67;33;0 21.569 True ENSG00000214960 ENSG00000214960 HGNC:37276 ISPD gene ISPD Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, 616052 23390185;30060766;28688748;26404900 False 3 100;0;0 21.569 True ENSG00000214960 ENSG00000214960 HGNC:37276 ISPD gene ISPD Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7 614643;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7 616052 False 3 100;0;0 21.569 True ENSG00000214960 ENSG00000214960 HGNC:37276 ITM2B gene ITM2B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral amyloid angiopathy MONDO:0005620 10391242;10781099;20385796;33814452 False 3 100;0;0 21.569 True ENSG00000136156 ENSG00000136156 HGNC:6174 ITM2B gene ITM2B Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia 10391242;10781099;33814452 False 3 100;0;0 21.569 False ENSG00000136156 ENSG00000136156 HGNC:6174 ITPA gene ITPA Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 35, MIM# 616647 26224535;19498443;35234647;35098521;27604308;12384777 False 3 100;0;0 21.569 True ENSG00000125877 ENSG00000125877 HGNC:6176 ITPA gene ITPA Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Inosine triphosphatase deficiency MIM#613850;Developmental and epileptic encephalopathy 35 MIM#616647;Disorders of purine metabolism 27604308;12384777 False 3 100;0;0 21.569 True ENSG00000125877 ENSG00000125877 HGNC:6176 ITPR1 gene ITPR1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 15 MIM#606658;Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360 False 3 100;0;0 21.569 True ENSG00000150995 ENSG00000150995 HGNC:6180 ITPR3 gene ITPR3 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, demyelinating, type 1J, MIM# 620111;Immunodeficiency 133 with ectodermal dysplasia with or without peripheral neuropathy, MIM# 621254 32949214;24627108;36302985;39270020;39560673 False 3 100;0;0 21.569 False Other ENSG00000096433 ENSG00000096433 HGNC:6182 JAG1 gene JAG1 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Peripheral neuropathy 32065591;25707699 False 3 100;0;0 21.569 False ENSG00000101384 ENSG00000101384 HGNC:6188 JAG2 gene JAG2 Expert Review Green;Other;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal muscular dystrophy, limb-girdle, autosomal recessive 27 MONDO:0030456 33861953 False 3 100;0;0 21.569 True ENSG00000184916 ENSG00000184916 HGNC:6189 JAM2 gene JAM2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 8, autosomal recessive MIM#618824 31851307 False 3 100;0;0 21.569 True ENSG00000154721 ENSG00000154721 HGNC:14686 JAM3 gene JAM3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hemorrhagic destruction of the brain, subependymal calcification, and cataracts, MIM# 613730 23255084;21109224 False 3 100;0;0 21.569 True ENSG00000166086 ENSG00000166086 HGNC:15532 JKAMP gene JKAMP Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with seizures and impaired intellectual and language development, MIM# 621533" 41643666 False 3 100;0;0 21.569 True ENSG00000050130 ENSG00000050130 HGNC:20184 KANSL1 gene KANSL1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Koolen-De Vries syndrome MIM#610443 PMID: 28440867 False 3 100;0;0 21.569 True ENSG00000120071 ENSG00000120071 HGNC:24565 KARS gene KARS Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with or without deafness (LEPID), MIM#619147 26741492;31618474;28887846;25330800;29615062;30252186;28496994 False 3 100;0;0 21.569 True ENSG00000065427 ENSG00000065427 HGNC:6215 KARS gene KARS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, progressive, infantile-onset, with or without deafness MIM#619147 26741492;31618474;28887846;25330800;29615062;30252186;28496994;23768514;14975237;33942428 False 3 100;0;0 21.569 True ENSG00000065427 ENSG00000065427 HGNC:6215 KARS gene KARS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with or without deafness (LEPID), MIM#619147;Deafness, autosomal recessive 89, MIM# 613916;Congenital deafness and adult-onset progressive leukoencephalopathy (DEAPLE), MIM#619196 26741492;31618474;28887846;25330800;29615062;30252186;28496994;23768514;14975237 False 3 100;0;0 21.569 True ENSG00000065427 ENSG00000065427 HGNC:6215 KARS gene KARS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with or without deafness (LEPID), MIM#619147 30737337;31116475;30715177 False 3 100;0;0 21.569 True ENSG00000065427 ENSG00000065427 HGNC:6215 KAT5 gene KAT5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with dysmorphic facies, sleep disturbance, and brain abnormalities (NEDFASB), MIM#619103;Severe global developmental delay;Intellectual disability;Seizures;Microcephaly;Behavioral abnormality;Sleep disturbance;Morphological abnormality of the central nervous system;Short stature;Oral cleft;Abnormality of the face 32822602 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000172977 ENSG00000172977 HGNC:5275 KAT6A gene KAT6A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Arboleda-Tham syndrome MIM#616268 PMID: 34748993 False 3 100;0;0 21.569 True ENSG00000083168 ENSG00000083168 HGNC:13013 KAT8 gene KAT8 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;seizures;autism;dysmorphic features;Li-Ghorbani-Weisz syndrome, MIM#618974 31794431 False 3 100;0;0 21.569 True ENSG00000103510 ENSG00000103510 HGNC:17933 KATNB1 gene KATNB1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lissencephaly 6, with microcephaly MIM#616212 PMID: 26640080 False 3 50;0;50 21.569 True ENSG00000140854 ENSG00000140854 HGNC:6217 KCNA1 gene KCNA1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown EPISODIC ATAXIA, TYPE 1;myokymia with periodic ataxia;Episodic ataxia/myokymia syndrome, 160120;Episodic ataxia/myokymia syndrome 11026449 False 3 100;0;0 21.569 True Other ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA1 gene KCNA1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia/myokymia syndrome, MIM# 160120 11026449 False 3 100;0;0 21.569 True Other ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA1 gene KCNA1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy;seizures;epileptic encephalopathies;episodic ataxia type 1 and epilepsy PMID: 32316562 False 3 100;0;0 21.569 True ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA2 gene KCNA2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 32, MIM#616366 29050392 False 3 100;0;0 21.569 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNA2 gene KCNA2 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 32, 616366 29050392 False 3 100;0;0 21.569 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNA2 gene KCNA2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia and ataxia False 3 100;0;0 21.569 False ENSG00000177301 ENSG00000177301 HGNC:6220 KCNA3 gene KCNA3 Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, KCNA3-related 37964487 False 3 100;0;0 21.569 True ENSG00000177272 ENSG00000177272 HGNC:6221 KCNA6 gene KCNA6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy, MONDO:0100620, KCNA6-related 36318112;40472070 False 3 100;0;0 21.569 True ENSG00000151079 ENSG00000151079 HGNC:6225 KCNB1 gene KCNB1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 26, MIM# 616056 31600826;31513310 False 3 100;0;0 21.569 True ENSG00000158445 ENSG00000158445 HGNC:6231 KCNC1 gene KCNC1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, progressive myoclonic 7 (MIM#616187);Intellectual disability;Movement disorders 28145425;31353862;25401298 False 3 100;0;0 21.569 True ENSG00000129159 ENSG00000129159 HGNC:6233 KCNC2 gene KCNC2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 103, MIM# 619913 32392612;31972370;35314505 False 3 50;50;0 21.569 True ENSG00000166006 ENSG00000166006 HGNC:6234 KCNC3 gene KCNC3 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 13 MIM#605259 False 3 100;0;0 21.569 True ENSG00000131398 ENSG00000131398 HGNC:6235 KCND1 gene KCND1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females neurodevelopmental disorder MONDO:0700092, KCND1-related 38772379 False 3 100;0;0 21.569 True ENSG00000102057 ENSG00000102057 HGNC:6237 KCND2 gene KCND2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, KCND2-related 24501278;16934482;29581270;34245260 False 3 100;0;0 21.569 True ENSG00000184408 ENSG00000184408 HGNC:6238 KCND3 gene KCND3 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 19, MIM#607346 32823520 False 3 100;0;0 21.569 True ENSG00000171385 ENSG00000171385 HGNC:6239 KCND3 gene KCND3 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 19, MIM# 607346" 32823520 False 3 100;0;0 21.569 True ENSG00000171385 ENSG00000171385 HGNC:6239 KCNH1 gene KCNH1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Temple-Baraitser syndrome, OMIM:611816 Zimmermann-Laband syndrome 1, OMIM:135500 Intellectual disability Encephalopathy without features of TBS/ZLS PMID: 33594261 False 3 100;0;0 21.569 True ENSG00000143473 ENSG00000143473 HGNC:6250 KCNH5 gene KCNH5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Developmental and epileptic encephalopathy 112, MIM# 620537 36307226 False 3 100;0;0 21.569 True Other ENSG00000140015 ENSG00000140015 HGNC:6254 KCNJ10 gene KCNJ10 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Seizures, Sensorineural Deafness, Ataxia, Mental Retardation, and Electrolyte Imbalance Syndrome;SESAME syndrome, 612780 False 3 100;0;0 21.569 False ENSG00000177807 ENSG00000177807 HGNC:6256 KCNJ10 gene KCNJ10 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal SESAME syndrome, MIM# 612780 19289823;19420365;21849804;11466414 False 3 100;0;0 21.569 True ENSG00000177807 ENSG00000177807 HGNC:6256 KCNJ10 gene KCNJ10 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal EAST syndrome MONDO:0013005, SESAME syndrome, MIM# 612780;Disorders of magnesium metabolism 19289823, 21849804, 11466414 False 3 0;0;0 21.569 False ENSG00000177807 ENSG00000177807 HGNC:6256 KCNJ11 gene KCNJ11 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Diabetes mellitus, transient neonatal, 3 610582;Diabetes, permanent neonatal, with or without neurologic features 606176;Hyperinsulinemic hypoglycemia, familial, 2 601820 18250167;11395395;23275527;23345197 False 3 100;0;0 21.569 True ENSG00000187486 ENSG00000187486 HGNC:6257 KCNJ2 gene KCNJ2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Andersen syndrome, MIM# 170390 16217063;16571646;16419128;17324964 False 3 100;0;0 21.569 True ENSG00000123700 ENSG00000123700 HGNC:6263 KCNJ4 gene KCNJ4 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, KCNJ4-related 41830586 False 3 100;0;0 21.569 True Other ENSG00000168135 ENSG00000168135 HGNC:6265 KCNK4 gene KCNK4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Facial dysmorphism, hypertrichosis, epilepsy, intellectual/developmental delay, and gingival overgrowth syndrome 618381 30290154 False 3 100;0;0 21.569 True Other ENSG00000182450 ENSG00000182450 HGNC:6279 KCNMA1 gene KCNMA1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM# 609446;Cerebellar atrophy, developmental delay, and seizures, MIM# 617643;Liang-Wang syndrome, MIM# 618729 15937479;26195193;27567911;29545233;31427379;31152168 False 3 100;0;0 21.569 True ENSG00000156113 ENSG00000156113 HGNC:6284 KCNMA1 gene KCNMA1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM# 609446 15937479;26195193 False 3 100;0;0 21.569 True ENSG00000156113 ENSG00000156113 HGNC:6284 KCNMA1 gene KCNMA1 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy MIM#609446 26195193;15937479;29356177 False 3 100;0;0 21.569 False Other ENSG00000156113 ENSG00000156113 HGNC:6284 KCNN2 gene KCNN2 Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 34, myoclonic, MIM#619724;Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 32212350;33242881 False 3 100;0;0 21.569 False ENSG00000080709 ENSG00000080709 HGNC:6291 KCNN2 gene KCNN2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 33242881 False 3 100;0;0 21.569 True ENSG00000080709 ENSG00000080709 HGNC:6291 KCNN2 gene KCNN2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 33242881 False 3 100;0;0 21.569 True ENSG00000080709 ENSG00000080709 HGNC:6291 KCNQ2 gene KCNQ2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 7, 613720;Seizures, benign neonatal, 1, 121200 25959266;32917465;24318194 False 3 67;33;0 21.569 True Other ENSG00000075043 ENSG00000075043 HGNC:6296 KCNQ2 gene KCNQ2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myokymia, MIM# 121200;Seizures, benign neonatal, 1, MIM# 121200;Developmental and epileptic encephalopathy 7, MIM# 613720 False 3 100;0;0 21.569 True ENSG00000075043 ENSG00000075043 HGNC:6296 KCNQ3 gene KCNQ3 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Seizures, benign neonatal, 2, MIM# 121201 33337327 False 3 100;0;0 21.569 False ENSG00000184156 ENSG00000184156 HGNC:6297 KCNQ3 gene KCNQ3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Seizures, benign neonatal, 2, MIM# 121201 33337327;25524373;24851285 False 3 100;0;0 21.569 True ENSG00000184156 ENSG00000184156 HGNC:6297 KCNQ5 gene KCNQ5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 46, MIM# 617601 28669405;30359776 False 3 100;0;0 21.569 True ENSG00000185760 ENSG00000185760 HGNC:6299 KCNT1 gene KCNT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, nocturnal frontal lobe, 5, MIM# 615005;Epileptic encephalopathy, early infantile, 14, MIM# 614959 23086397;23086396;31872048;31532509 False 3 100;0;0 21.569 True ENSG00000107147 ENSG00000107147 HGNC:18865 KCNT2 gene KCNT2 Expert Review Green;Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 57, MIM#617771;Developmental and epileptic encephalopathy 29069600;29740868 False 3 100;0;0 21.569 True Other ENSG00000162687 ENSG00000162687 HGNC:18866 KCTD17 gene KCTD17 Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Dystonia 26, myoclonic MIM#616398 25983243;30642807;30579817 False 3 100;0;0 21.569 False ENSG00000100379 ENSG00000100379 HGNC:25705 KCTD3 gene KCTD3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder MONDO:0700092, KCTD3-related 29406573 False 3 100;0;0 21.569 True ENSG00000136636 ENSG00000136636 HGNC:21305 KCTD7 gene KCTD7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 3, with or without intracellular inclusions (MIM#611726), AR 33767931;33970744;22693283;22748208;22693283;22748208 False 3 100;0;0 21.569 True ENSG00000243335 ENSG00000243335 HGNC:21957 KCTD7 gene KCTD7 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonus epilepsy MONDO:0020074;Neuronal ceroid lipofuscinosis 36368077;30295347;29884839 False 3 0;0;0 21.569 False ENSG00000243335 ENSG00000243335 HGNC:21957 KDM4B gene KDM4B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 65, MIM# 619320;Global developmental delay, intellectual disability and neuroanatomical defects PMID: 33232677 False 3 100;0;0 21.569 True ENSG00000127663 ENSG00000127663 HGNC:29136 KDM5C gene KDM5C Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type MIM# 300534;MONDO:0010355 15586325;32279304 False 3 100;0;0 21.569 True ENSG00000126012 ENSG00000126012 HGNC:11114 KDM5C gene KDM5C Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type MIM# 300534;MONDO:0010355 23246292;32279304;26919706;15586325 False 3 100;0;0 21.569 True ENSG00000126012 ENSG00000126012 HGNC:11114 KIAA0391 gene KIAA0391 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Combined oxidative phosphorylation deficiency 54, MIM# 619737" PMID: 34715011 False 3 100;0;0 21.569 True ENSG00000100890 ENSG00000100890 HGNC:19958 KIAA1109 gene KIAA1109 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal lkuraya-Kucinskas syndrome, MIM# 617822 29290337;30906834 False 3 100;0;0 21.569 True ENSG00000138688 ENSG00000138688 HGNC:26953 KIAA1161 gene KIAA1161 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317;Primary familial brain calcification;Atypical parkinsonism;Supranuclear gaze palsy 32211515;30656188;30649222;30460687;29910000;31951047 False 3 100;0;0 21.569 True ENSG00000164976 ENSG00000164976 HGNC:19918 KIAA1161 gene KIAA1161 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 7, MIM#618317 30656188;30649222;30460687;29910000;31951047 False 3 100;0;0 21.569 True ENSG00000164976 ENSG00000164976 HGNC:19918 KIDINS220 gene KIDINS220 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296;MONDO:0015007 27005418;29667355 False 3 100;0;0 21.569 True ENSG00000134313 ENSG00000134313 HGNC:29508 KIF1A gene KIF1A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia;spastic paraplegia;intellectual disability 32096284;32935419 False 3 100;0;0 21.569 False ENSG00000130294 ENSG00000130294 HGNC:888 KIF1A gene KIF1A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted NESCAV syndrome, MIM# 614255 21820098;28708278 False 3 100;0;0 21.569 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1A gene KIF1A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 30, autosomal dominant MIM# 610357;Spastic paraplegia 30, autosomal recessive 620607 26410750;21487076;22258533;32096284;31488895;29159194;25585697 False 3 100;0;0 21.569 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1A gene KIF1A Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary Sensory and Autonomic Neuropathy, Type II;Neuropathy, hereditary sensory, type IIC, 614213 25265257;21820098 False 3 0;0;0 21.569 False ENSG00000130294 ENSG00000130294 HGNC:888 KIF1A gene KIF1A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Neuropathy, hereditary sensory, type IIC, 614213 21820098;28708278 False 3 100;0;0 21.569 False ENSG00000130294 ENSG00000130294 HGNC:888 KIF1C gene KIF1C Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive MIM#611302 24482476;24319291;31413903;29544888 False 3 100;0;0 21.569 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF1C gene KIF1C Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive, 611302;Spastic ataxia 2, autosomal recessive 24482476;24319291;31413903;29544888 False 3 100;0;0 21.569 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF21A gene KIF21A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fibrosis of extraocular muscles, congenital, 1/3B, MIM#135700 37921537;39643435;41282472;32141982;24715754;36494820;22699964 False 3 100;0;0 21.569 True ENSG00000139116 ENSG00000139116 HGNC:19349 KIF2A gene KIF2A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 3, MIM# 615411 23603762;27896282;27747449;29077851;31919497 False 3 100;0;0 21.569 True ENSG00000068796 ENSG00000068796 HGNC:6318 KIF5A gene KIF5A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myoclonus, intractable, neonatal, MIM#617235 27463701;27414745 False 3 100;0;0 21.569 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 10, autosomal dominant, MIM# 604187" 16489470;21623771;15452312;18853458;16476820 False 3 100;0;0 21.569 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Amyotrophic lateral sclerosis, susceptibility to, 25} MIM#617921 29342275;30301576;29566793 False 3 100;0;0 21.569 False ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Myoclonus, intractable, neonatal MIM#617235" 27414745;33681666;27463701 False 3 100;0;0 21.569 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary Neuropathies;HMSN 30057544;29892902;28902413;26403765;25695920;25008398 False 3 100;0;0 21.569 False ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5C gene KIF5C Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 2, MIM# 615282 23603762;23033978;32562872 False 3 100;0;0 21.569 True ENSG00000168280 ENSG00000168280 HGNC:6325 KIF7 gene KIF7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Koubert syndrome 12;Acrocallosal syndrome, Schinzel type False 3 100;0;0 21.569 False ENSG00000166813 ENSG00000166813 HGNC:30497 KLC2 gene KLC2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia, optic atrophy, and neuropathy MIM#609541 26385635 False 3 100;0;0 21.569 True ENSG00000174996 ENSG00000174996 HGNC:20716 KLC2 gene KLC2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia, optic atrophy, and neuropathy, MIM#609541 False 3 50;0;50 21.569 True ENSG00000174996 ENSG00000174996 HGNC:20716 KLHL20 gene KLHL20 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with early-onset seizures, facial dysmorphism, and behavioral abnormalities, MIM# 621390 PMID: 36214804 False 3 100;0;0 21.569 True ENSG00000076321 ENSG00000076321 HGNC:25056 KMT2A gene KMT2A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Wiedemann-Steiner syndrome MIM#605130 PMID: 37075569 False 3 100;0;0 21.569 True ENSG00000118058 ENSG00000118058 HGNC:7132 KMT2B gene KMT2B Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted early-onset dystonia;Dystonia 28, childhood-onset 617284;MONDO:0015004 27839873;27992417 False 3 100;0;0 21.569 False ENSG00000272333 ENSG00000272333 HGNC:15840 KMT2B gene KMT2B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 28, childhood-onset , MIM#617284 PMID: 33816656 False 3 100;0;0 21.569 True ENSG00000272333 ENSG00000272333 HGNC:15840 KMT2C gene KMT2C Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Kleefstra syndrome 2, MIM# 617768;Neurodevelopmental disorder, MONDO:0700092, KMT2C-related 39013459 False 3 100;0;0 21.569 True ENSG00000055609 ENSG00000055609 HGNC:13726 KMT2D gene KMT2D Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Kabuki syndrome 1 MIM#147920" 33552639;28404210;27922244;21882399 False 3 100;0;0 21.569 True ENSG00000167548 ENSG00000167548 HGNC:7133 KMT2E gene KMT2E Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted O'Donnell-Luria-Rodan syndrome, MIM# 618512;Intellectual disability;Autism;Seizures 31079897 False 3 100;0;0 21.569 True ENSG00000005483 ENSG00000005483 HGNC:18541 KPNA3 gene KPNA3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia-88 (SPG88), MIM#620106 34564892 False 3 100;0;0 21.569 True ENSG00000102753 ENSG00000102753 HGNC:6396 KPTN gene KPTN Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 4, MIM#1615637 25847626;24239382;32358097;32808430 False 3 100;0;0 21.569 True ENSG00000118162 ENSG00000118162 HGNC:6404 KRAS gene KRAS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Oculoectodermal syndrome, somatic MIM#600268;Schimmelpenning-Feuerstein-Mims syndrome, somatic mosaic MIM#163200 PMID: 37126322;37722300 False 3 100;0;0 21.569 True Other ENSG00000133703 ENSG00000133703 HGNC:6407 KRIT1 gene KRIT1 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cavernous malformations of CNS and retina, 116860;Cerebral cavernous malformations-1, 116860;Hyperkeratotic cutaneous capillary-venous malformations associated with cerebral capillary malformations, 116860 10508515;20301470 False 3 100;0;0 21.569 True ENSG00000001631 ENSG00000001631 HGNC:1573 KRIT1 gene KRIT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Hyperkeratotic cutaneous capillary-venous malformations associated with cerebral capillary malformations MIM#116860;Cavernous malformations of CNS and retina MIM#116860;Cerebral cavernous malformations-1 MIM#116860" 35836010;35444609 False 3 100;0;0 21.569 True ENSG00000001631 ENSG00000001631 HGNC:1573 KY gene KY Expert Review Green;Other;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 7 (MIM#617114) 27484770;27485408;30591934;11136708 False 3 100;0;0 21.569 True ENSG00000174611 ENSG00000174611 HGNC:26576 KYNU gene KYNU Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hydroxykynureninuria MIM#236800;Vertebral, cardiac, renal, and limb defects syndrome 2 MIM#617661;Disorders of histidine, tryptophan or lysine metabolism 17334708;28792876;31923704 False 3 100;0;0 21.569 True ENSG00000115919 ENSG00000115919 HGNC:6469 L1CAM gene L1CAM Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Hereditary spastic paraplegia, 308840;MASA syndrome, 303350;X-linked hydrocephalus, 307000 False 3 100;0;0 21.569 True ENSG00000198910 ENSG00000198910 HGNC:6470 L2HGDH gene L2HGDH Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal L-2-hydroxyglutaric aciduria MIM#236792 24753671;18780161;15824270;10399870 False 3 100;0;0 21.569 True ENSG00000087299 ENSG00000087299 HGNC:20499 L2HGDH gene L2HGDH Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal L-2-hydroxyglutaric aciduria MIM#236792;organic acidurias 27604308;15385440 False 3 100;0;0 21.569 True ENSG00000087299 ENSG00000087299 HGNC:20499 L2HGDH gene L2HGDH Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "L-2-hydroxyglutaric aciduria, MIM# 236792" False 3 100;0;0 21.569 True ENSG00000087299 ENSG00000087299 HGNC:20499 L2HGDH gene L2HGDH Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal L-2-hydroxyglutaric aciduria MIM#236792 PMID: 37113859 False 3 100;0;0 21.569 True ENSG00000087299 ENSG00000087299 HGNC:20499 L2HGDH gene L2HGDH Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal L-2-hydroxyglutaric aciduria, MIM#236792 29884839;37995940;37113859;34270333;17475916;28137912;15385440 False 3 100;0;0 21.569 True ENSG00000087299 ENSG00000087299 HGNC:20499 LAMA1 gene LAMA1 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Poretti-Boltshauser syndrome;Cerebellar ataxia, intellectual disability, oculomotor apraxia, cerebellar cysts syndrome 26932191;25105227 False 3 100;0;0 21.569 True ENSG00000101680 ENSG00000101680 HGNC:6481 LAMA2 gene LAMA2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 30055037 False 3 100;0;0 21.569 True ENSG00000196569 ENSG00000196569 HGNC:6482 LAMA2 gene LAMA2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23 , MIM#618138" 33333793;34325301 False 3 100;0;0 21.569 True ENSG00000196569 ENSG00000196569 HGNC:6482 LAMB1 gene LAMB1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Cystic leukoencephalopathy 29888467;25925986;34606115 False 3 50;50;0 21.569 True ENSG00000091136 ENSG00000091136 HGNC:6486 LAMC3 gene LAMC3 Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cortical malformations, occipital, MIM#614115 33639934;21572413;34354730 False 3 100;0;0 21.569 True ENSG00000050555 ENSG00000050555 HGNC:6494 LAMP2 gene LAMP2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Danon disease, MIM# 300257;MONDO:0010281 False 3 100;0;0 21.569 True ENSG00000005893 ENSG00000005893 HGNC:6501 LAMP2 gene LAMP2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Danon disease, MIM# 300257;MONDO:0010281 False 3 100;0;0 21.569 True ENSG00000005893 ENSG00000005893 HGNC:6501 LAMP2 gene LAMP2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Danon disease, MIM# 300257 False 3 100;0;0 21.569 True ENSG00000005893 ENSG00000005893 HGNC:6501 LARGE1 gene LARGE1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6 613154;Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 6 MIM#608840 False 3 100;0;0 21.569 True ENSG00000133424 ENSG00000133424 HGNC:6511 LARS gene LARS Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile liver failure syndrome 1 MIM#615438;disorder of leucine metabolism 22607940;30349989;28774368 False 3 100;0;0 21.569 True ENSG00000133706 ENSG00000133706 HGNC:6512 LARS gene LARS Expert Review Green;NHS GMS;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile liver failure syndrome 1, MIM# 615438;Seizures;Intellectual disability;Encephalopathy 32699352 False 3 100;0;0 21.569 True ENSG00000133706 ENSG00000133706 HGNC:6512 LARS2 gene LARS2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021;Leukodystrophy 29205794;32423379;30737337 False 3 100;0;0 21.569 True ENSG00000011376 ENSG00000011376 HGNC:17095 LARS2 gene LARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anaemia, MIM# 617021;Leukodystrophy 29205794;32423379;30737337;26537577;23541342 False 3 100;0;0 21.569 True ENSG00000011376 ENSG00000011376 HGNC:17095 LARS2 gene LARS2 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy 32442335;30737337 False 3 100;0;0 21.569 False ENSG00000011376 ENSG00000011376 HGNC:17095 LBR gene LBR Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Greenberg skeletal dysplasia MIM#215140;Disorders of sterol biosynthesis 12618959;27604308 False 3 100;0;0 21.569 True ENSG00000143815 ENSG00000143815 HGNC:6518 LCT gene LCT Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lactase deficiency, congenital MIM#223000;Other carbohydrate disorders 9758622;27604308 False 3 100;0;0 21.569 True ENSG00000115850 ENSG00000115850 HGNC:6530 LDB3 gene LDB3 Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted myofibrillar myopathy 4 MONDO:0012277 24668811;27546599;25911362 False 3 100;0;0 21.569 True Other ENSG00000122367 ENSG00000122367 HGNC:15710 LDHA gene LDHA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XI, MIM# 612933 2334430;1959923;8327147 False 3 100;0;0 21.569 True ENSG00000134333 ENSG00000134333 HGNC:6535 LDHA gene LDHA Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XI, MIM# 612933 2334430;1959923;8327147 False 3 100;0;0 21.569 True ENSG00000134333 ENSG00000134333 HGNC:6535 LDHD gene LDHD Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal D-lactic aciduria with susceptibility to gout MIM#245450 40678184 False 3 100;0;0 21.569 True ENSG00000166816 ENSG00000166816 HGNC:19708 LETM1 gene LETM1 Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089 36055214 False 3 100;0;0 21.569 True ENSG00000168924 ENSG00000168924 HGNC:6556 LETM1 gene LETM1 Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089 36055214 False 3 100;0;0 21.569 True ENSG00000168924 ENSG00000168924 HGNC:6556 LETM1 gene LETM1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089 36055214 False 3 100;0;0 21.569 True ENSG00000168924 ENSG00000168924 HGNC:6556 LFNG gene LFNG Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spondylocostal dysostosis 3, autosomal recessive, MIM# 609813 9690472;16385447;30531807;9690473 False 3 100;0;0 21.569 True ENSG00000106003 ENSG00000106003 HGNC:6560 LGI1 gene LGI1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Epilepsy, familial temporal lobe, 1, MIM# 6000512;Developmental and epileptic encephalopathy 121, MIM# 621475 18711109;12205652;15079010;22496201;40455867 False 3 100;0;0 21.569 True ENSG00000108231 ENSG00000108231 HGNC:6572 LIAS gene LIAS Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperglycinemia, lactic acidosis, and seizures, MIM# 614462 22152680;24334290;26108146 False 3 100;0;0 21.569 True ENSG00000121897 ENSG00000121897 HGNC:16429 LIAS gene LIAS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperglycinaemia, lactic acidosis, and seizures, MIM# 614462 22152680;24334290;26108146 False 3 100;0;0 21.569 True ENSG00000121897 ENSG00000121897 HGNC:16429 LIG3 gene LIG3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780 33855352 False 3 100;0;0 21.569 True ENSG00000005156 ENSG00000005156 HGNC:6600 LIG3 gene LIG3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780 PMID: 33855352 False 3 100;0;0 21.569 True ENSG00000005156 ENSG00000005156 HGNC:6600 LIG3 gene LIG3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780 33855352 False 3 100;0;0 21.569 True ENSG00000005156 ENSG00000005156 HGNC:6600 LIPA gene LIPA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cholesteryl ester storage disease, MIM# 278000;Wolman disease, MIM# 278000;Lysosomal acid lipase deficiency, MONDO:0010204 11487567 False 3 100;0;0 21.569 True ENSG00000107798 ENSG00000107798 HGNC:6617 LIPT1 gene LIPT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipoyltransferase 1 deficiency, MIM#616299;Leigh-like presentation False 3 100;0;0 21.569 True ENSG00000144182 ENSG00000144182 HGNC:29569 LIPT2 gene LIPT2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM#617668 28757203 False 3 100;0;0 21.569 True ENSG00000175536 ENSG00000175536 HGNC:37216 LIPT2 gene LIPT2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, neonatal severe, with lactic acidosis and brain abnormalities, MIM# 617668 28757203 False 3 100;0;0 21.569 True ENSG00000175536 ENSG00000175536 HGNC:37216 LITAF gene LITAF Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 1C, MIM# 601098;MONDO:0010995 12525712;19541485;23359569;32665875;28211240 False 3 100;0;0 21.569 False ENSG00000189067 ENSG00000189067 HGNC:16841 LMBRD2 gene LMBRD2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Developmental delay with variable neurologic and brain abnormalities, MIM# 619694;Global developmental delay;Intellectual disability;Microcephaly;Seizures;Abnormality of nervous system morphology;Abnormality of the eye 32820033;https://doi.org/10.1101/797787 False 3 50;50;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000164187 ENSG00000164187 HGNC:25287 LMNA gene LMNA Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Emery-Dreifuss muscular dystrophy 2, autosomal dominant (MIM#181350)" 27220833;23746545;17377071 False 3 0;100;0 21.569 True Other ENSG00000160789 ENSG00000160789 HGNC:6636 LMNB1 gene LMNB1 Victorian Clinical Genetics Services;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant MIM#169500 31695592 False 3 100;0;0 21.569 False ENSG00000113368 ENSG00000113368 HGNC:6637 LMNB1 gene LMNB1 Victorian Clinical Genetics Services;Australian Genomcis Health Alliance Leukodystrophy Flagship;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Australian Genomcis Health Alliance Leukodystrophy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant, MIM# 169500;Leukodystrophy, demyelinating, adult-onset, autosomal dominan, atypical, MIM#621061 16951681;30842973 False 3 100;0;0 21.569 False ENSG00000113368 ENSG00000113368 HGNC:6637 LNPK gene LNPK Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with epilepsy and hypoplasia of the corpus callosum, MIM# 618090 30032983 False 3 100;0;0 21.569 True ENSG00000144320 ENSG00000144320 HGNC:21610 LONP1 gene LONP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal CODAS syndrome, MIM#600373;mitochondrial disease (MONDO:0044970), LONP1-related 31636596;36353900;31923470 False 3 100;0;0 21.569 True ENSG00000196365 ENSG00000196365 HGNC:9479 LONP1 gene LONP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal CODAS syndrome, MIM#600373;mitochondrial disease (MONDO:0044970), LONP1-related 31636596;36353900;31923470 False 3 100;0;0 21.569 True ENSG00000196365 ENSG00000196365 HGNC:9479 LPIN1 gene LPIN1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myoglobinuria, acute recurrent, autosomal recessive, MIM# 268200 18817903;32549891;32522502;32410653 False 3 100;0;0 21.569 True ENSG00000134324 ENSG00000134324 HGNC:13345 LPIN1 gene LPIN1 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myoglobinuria, acute recurrent, autosomal recessive 268200 22481384;28649549;18817903;32410653 False 3 100;0;0 21.569 True ENSG00000134324 ENSG00000134324 HGNC:13345 LRPPRC gene LRPPRC Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian) MIM#220111 32972427;26510951;21266382 False 3 100;0;0 21.569 True ENSG00000138095 ENSG00000138095 HGNC:15714 LRPPRC gene LRPPRC Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 5, (French-Canadian) (MIM#220111) 21266382;26510951;38046674;29152527 False 3 0;100;0 21.569 True ENSG00000138095 ENSG00000138095 HGNC:15714 LRRK2 gene LRRK2 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown False 3 100;0;0 21.569 False ENSG00000188906 ENSG00000188906 HGNC:18618 LRRK2 gene LRRK2 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted False 3 100;0;0 21.569 False ENSG00000188906 ENSG00000188906 HGNC:18618 LRSAM1 gene LRSAM1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2P, MIM# 614436;MONDO:0013753;HMSN 20865121;22012984;22781092;27686364;33568173;33414056;30996334 False 3 100;0;0 21.569 False ENSG00000148356 ENSG00000148356 HGNC:25135 LSS gene LSS Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alopecia-intellectual disability syndrome 4, MIM#618840 PMID: 30723320;37157980 False 3 100;0;0 21.569 True ENSG00000160285 ENSG00000160285 HGNC:6708 LYRM7 gene LYRM7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 8 - MIM#615838 False 3 100;0;0 21.569 True ENSG00000186687 ENSG00000186687 HGNC:28072 LYRM7 gene LYRM7 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 615838;Mitochondrial complex III deficiency, nuclear type 8;leukoencephalopathy and complex III deficiency;severe encephalopathy, lactic acidosis and profound, isolated cIII deficiency in skeletal muscle False 3 0;0;0 21.569 False ENSG00000186687 ENSG00000186687 HGNC:28072 LYST gene LYST Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chediak-Higashi syndrome MIM#214500;MONDO:0008963 24521565;15790783;20301751 False 3 0;100;0 21.569 True ENSG00000143669 ENSG00000143669 HGNC:1968 LYST gene LYST Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chediak-Higashi syndrome MONDO:0008963 23436631;23521865;20301751 False 3 100;0;0 21.569 True ENSG00000143669 ENSG00000143669 HGNC:1968 MACF1 gene MACF1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Lissencephaly 9 with complex brainstem malformation, MIM# 618325" 30471716 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000127603 ENSG00000127603 HGNC:13664 MADD gene MADD Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal DEEAH syndrome, MIM#619004 (Developmental Delay With Endocrine, Exocrine, Autonomic, and Hematologic Abnormalities);Neurodevelopmental disorder with dysmorphic facies, impaired speech and hypotonia (NEDDISH), MIM# 619005 28940097;29302074;32761064 False 3 100;0;0 21.569 True ENSG00000110514 ENSG00000110514 HGNC:6766 MAF gene MAF Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ayme-Gripp syndrome (MIM#601088) 30160832;34643041 False 3 100;0;0 21.569 True ENSG00000178573 ENSG00000178573 HGNC:6776 MAG gene MAG Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 75, autosomal recessive, 616680;Cerebellar ataxia 31402626;24482476;26179919;32629324 False 3 100;0;0 21.569 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAG gene MAG Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 75, autosomal recessive, MIM# 616680;Cerebellar ataxia;Oculomotor apraxia" 32629324;32340215;32629324 False 3 100;0;0 21.569 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAGT1 gene MAGT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Congenital disorder of glycosylation, type Icc (MIM# 301031);Immunodeficiency, X-linked, with magnesium defect, Epstein-Barr virus infection and neoplasia (MIM# 300853)" 31036665;31714901 False 3 100;0;0 21.569 True ENSG00000102158 ENSG00000102158 HGNC:28880 MAN1B1 gene MAN1B1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 15, MIM#614202 False 3 100;0;0 21.569 True ENSG00000177239 ENSG00000177239 HGNC:6823 MAN2B1 gene MAN2B1 Expert Review Green;Expert list;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alpha-mannosidosis MONDO:0009561 20301570 False 3 100;0;0 21.569 True ENSG00000104774 ENSG00000104774 HGNC:6826 MAN2B1 gene MAN2B1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mannosidosis, alpha-, types I and II, MIM# 248500;MONDO:0009561 False 3 100;0;0 21.569 True ENSG00000104774 ENSG00000104774 HGNC:6826 MAN2B1 gene MAN2B1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mannosidosis, alpha-, types I and II, MIM#248500 False 3 100;0;0 21.569 False ENSG00000104774 ENSG00000104774 HGNC:6826 MAN2B2 gene MAN2B2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation type 1EE with or without immunodeficiency, MIM# 621140 38622837;35637269;31775018 False 3 50;50;0 21.569 True ENSG00000013288 ENSG00000013288 HGNC:29623 MANBA gene MANBA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mannosidosis, beta, MIM# 248510;MONDO:0009562 False 3 100;0;0 21.569 True ENSG00000109323 ENSG00000109323 HGNC:6831 MAOA gene MAOA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Brunner syndrome, MIM# 300615 25807999;24169519 False 3 100;0;0 21.569 True ENSG00000189221 ENSG00000189221 HGNC:6833 MAP1B gene MAP1B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual disability;seizures;PVNH;dysmorphic features;Periventricular nodular heterotopia 9, MIM# 618918 33772511 False 3 50;0;50 21.569 True ENSG00000131711 ENSG00000131711 HGNC:6836 MAP2K1 gene MAP2K1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiofaciocutaneous syndrome 3, MIM# 615279 16439621;17551924;18042262;20301365 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000169032 ENSG00000169032 HGNC:6840 MAP2K2 gene MAP2K2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiofaciocutaneous syndrome 4, MIM# 615280 20358587;16439621;18042262 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000126934 ENSG00000126934 HGNC:6842 MAP2K4 gene MAP2K4 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder, MONDO:0700092 41480045 False 3 100;0;0 21.569 False Other ENSG00000065559 ENSG00000065559 HGNC:6844 MAPK8IP3 gene MAPK8IP3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Neurodevelopmental disorder with or without variable brain abnormalities 618443" PMID: 30612693;30945334 False 3 100;0;0 21.569 True ENSG00000138834 ENSG00000138834 HGNC:6884 MAPT gene MAPT Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Supranuclear palsy, progressive (MIM# 601104) AD;Supranuclear palsy, progressive atypical (MIM# 260540) AR 20838030;11220749 False 3 100;0;0 21.569 True ENSG00000186868 ENSG00000186868 HGNC:6893 MAPT gene MAPT Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted late-onset Parkinson disease MONDO:0008199 20301678 False 3 100;0;0 21.569 True ENSG00000186868 ENSG00000186868 HGNC:6893 MAPT gene MAPT Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "semantic dementia MONDO:0010857" 33802612;36970046 False 3 100;0;0 21.569 False Other ENSG00000186868 ENSG00000186868 HGNC:6893 MARK2 gene MARK2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 76, MIM# 621285 PMID: 39419027, 39436150 False 3 100;0;0 21.569 True ENSG00000072518 ENSG00000072518 HGNC:3332 MARS2 gene MARS2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 16672289;22448145 False 3 100;0;0 21.569 True ENSG00000247626 ENSG00000247626 HGNC:25133 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 False 3 100;0;0 21.569 True ENSG00000247626 ENSG00000247626 HGNC:25133 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 16672289;22448145 False 3 100;0;0 21.569 True ENSG00000247626 ENSG00000247626 HGNC:25133 MAST1 gene MAST1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mega-corpus-callosum syndrome with cerebellar hypoplasia and cortical malformations;OMIM #618273 31721002;30449657;32198973 False 3 100;0;0 21.569 True ENSG00000105613 ENSG00000105613 HGNC:19034 MAST3 gene MAST3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 108, MIM#620115 34185323 False 3 100;0;0 21.569 True ENSG00000099308 ENSG00000099308 HGNC:19036 MAST4 gene MAST4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, MAST4-related 36910266;33057194 False 3 100;0;0 21.569 True ENSG00000069020 ENSG00000069020 HGNC:19037 MAT1A gene MAT1A Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hypermethioninemia, persistent, autosomal dominant, due to methionine adenosyltransferase I/III deficiency MIM#250850;Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850;Disorders of the metabolism of sulphur amino acids 27604308;7560086 False 3 100;0;0 21.569 True ENSG00000151224 ENSG00000151224 HGNC:6903 MATR3 gene MATR3 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 19344878;24686783;35205163;34659085;34173818;26493020 False 3 100;0;0 21.569 False ENSG00000015479 ENSG00000015479 HGNC:6912 MATR3 gene MATR3 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted distal myopathy with vocal cord weakness MONDO:0018951 19344878;34659085;25154462;31056746 False 3 100;0;0 21.569 True Other ENSG00000015479 ENSG00000015479 HGNC:6912 MB gene MB Expert Review Green;Other;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, sarcoplasmic body MIM#620286 35527200;30918256 False 3 100;0;0 21.569 True ENSG00000198125 ENSG00000198125 HGNC:6915 MBD5 gene MBD5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 1, MIM# 156200;MONDO:0007974 18812405;21981781;23708187;22726846;33912662 False 3 100;0;0 21.569 True ENSG00000204406 ENSG00000204406 HGNC:20444 MBOAT7 gene MBOAT7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal intellectual disability MIM#617188 33335874;32645526;32744787;31852446;31282596;30701556 False 3 100;0;0 21.569 True ENSG00000125505 ENSG00000125505 HGNC:15505 MCCC1 gene MCCC1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-Methylcrotonyl-CoA carboxylase 1 deficiency MIM#210200;Organic acidurias 36822454;31730530 False 3 100;0;0 21.569 True ENSG00000078070 ENSG00000078070 HGNC:6936 MCCC2 gene MCCC2 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-Methylcrotonyl-CoA carboxylase 2 deficiency MIM#210210;Organic acidurias 27604308;11181649 False 3 100;0;0 21.569 True ENSG00000131844 ENSG00000131844 HGNC:6937 MCEE gene MCEE Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Methylmalonyl-CoA epimerase deficiency MIM#251120;Organic acidurias 27604308;16752391;32521958;31146325;32719376;30682498 False 3 100;0;0 21.569 True ENSG00000124370 ENSG00000124370 HGNC:16732 MCM3AP gene MCM3AP Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development, 618124 24123876;28633435;28969388;29982295;32202298 False 3 100;0;0 21.569 True ENSG00000160294 ENSG00000160294 HGNC:6946 MCOLN1 gene MCOLN1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucolipidosis IV, MIM# 252650;MONDO:0009653 False 3 100;0;0 21.569 True ENSG00000090674 ENSG00000090674 HGNC:13356 MCOLN1 gene MCOLN1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mucolipidosis IV, MIM# 252650" 10973263;11030752 False 3 100;0;0 21.569 True ENSG00000090674 ENSG00000090674 HGNC:13356 MDGA2 gene MDGA2 Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal MDGA2-related neurodevelopmental disorder MONDO:0700092 https://doi.org/10.1101/2025.08.28.25330873;40168357;27608760 False 3 100;0;0 21.569 True ENSG00000139915 ENSG00000139915 HGNC:19835 MDH2 gene MDH2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 51 MIM#617339 27989324;34766628 False 3 100;0;0 21.569 True ENSG00000146701 ENSG00000146701 HGNC:6971 MDH2 gene MDH2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 51 MIM#617339 34766628;27989324 False 3 100;0;0 21.569 True ENSG00000146701 ENSG00000146701 HGNC:6971 MECP2 gene MECP2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females MECP2-related disorders;Rett syndrome, MIM# 312750;Mental retardation, X-linked, syndromic 13, MIM# 300055 31970230;27050783 False 3 100;0;0 21.569 True ENSG00000169057 ENSG00000169057 HGNC:6990 MECP2 gene MECP2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Rett syndrome, MIM# 312750;Intellectual developmental disorder, X-linked, syndromic 13, MIM# 300055;Encephalopathy, neonatal severe, MIM# 300673 32469049 False 3 100;0;0 21.569 True ENSG00000169057 ENSG00000169057 HGNC:6990 MECR gene MECR Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities, MIM# 617282;MONDO:0015003 27817865;33401012;31137067;31070877 False 3 100;0;0 21.569 True ENSG00000116353 ENSG00000116353 HGNC:19691 MECR gene MECR Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities, MIM# 617282;MONDO:0015003 27817865;33401012;31137067;31070877 False 3 100;0;0 21.569 True ENSG00000116353 ENSG00000116353 HGNC:19691 MED11 gene MED11 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with developmental delay, early respiratory failure, myoclonic seizures, and brain abnormalities, MIM# 620327 36001086 False 3 100;0;0 21.569 True ENSG00000161920 ENSG00000161920 HGNC:32687 MED12 gene MED12 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Ohdo syndrome, X-linked MIM#300895;Lujan-Fryns syndrome MIM#309520;Opitz-Kaveggia syndrome MIM#305450 33244166;32174975;30006928;27312080;33244166 False 3 100;0;0 21.569 True ENSG00000184634 ENSG00000184634 HGNC:11957 MED13L gene MED13L Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Impaired intellectual development and distinctive facial features with or without cardiac defects MIM#616789" 32646507;29511999;25712080 False 3 100;0;0 21.569 True ENSG00000123066 ENSG00000123066 HGNC:22962 MED17 gene MED17 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, postnatal progressive, with seizures and brain atrophy, MIM#613668 30345598 False 3 100;0;0 21.569 True ENSG00000042429 ENSG00000042429 HGNC:2375 MED27 gene MED27 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MIM# 619286 33443317 False 3 100;0;0 21.569 True ENSG00000160563 ENSG00000160563 HGNC:2377 MED27 gene MED27 Expert Review Green;Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia MIM#619286" 33443317 False 3 100;0;0 21.569 True ENSG00000160563 ENSG00000160563 HGNC:2377 MED27 gene MED27 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual disability;cerebellar hypoplasia;dystonia 33443317 False 3 100;0;0 21.569 False ENSG00000160563 ENSG00000160563 HGNC:2377 MEF2C gene MEF2C Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, MIM# 613443;MONDO:0013266 19876902;19471318;19592390;19592390;20513142;34055696;34022131 False 3 100;0;0 21.569 True ENSG00000081189 ENSG00000081189 HGNC:6996 MEF2C gene MEF2C Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Mental retardation, stereotypic movements, epilepsy, and/or cerebral malformations, MIM# 613443" 27255693;20333642 False 3 100;0;0 21.569 True ENSG00000081189 ENSG00000081189 HGNC:6996 MFF gene MFF Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086 22499341;26783368;32181496 False 3 100;0;0 21.569 True ENSG00000168958 ENSG00000168958 HGNC:24858 MFF gene MFF Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy due to defective mitochondrial and peroxisomal fission 2, MIM# 617086 22499341;26783368;32181496 False 3 100;0;0 21.569 True ENSG00000168958 ENSG00000168958 HGNC:24858 MFN2 gene MFN2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2A2A 609260;Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087;Hereditary motor and sensory neuropathy VIA, MIM# 601152 15064763;15549395;16437557;20008656 False 3 100;0;0 21.569 True ENSG00000116688 ENSG00000116688 HGNC:16877 MFN2 gene MFN2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2A2A 609260;Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087;Hereditary motor and sensory neuropathy VIA, MIM# 601152 15064763;15549395;16437557;20008656 False 3 100;0;0 21.569 False ENSG00000116688 ENSG00000116688 HGNC:16877 MFSD8 gene MFSD8 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 7 610951 30249282;30144815;30301600;28586915 False 3 100;0;0 21.569 True ENSG00000164073 ENSG00000164073 HGNC:28486 MFSD8 gene MFSD8 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 7, MIM# 610951;MONDO:0012588;Macular dystrophy with central cone involvement, MIM# 616170;MONDO:0014515 17564970;19201763;25227500 False 3 100;0;0 21.569 True ENSG00000164073 ENSG00000164073 HGNC:28486 MGAT2 gene MGAT2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIa, MIM# 212066;MGAT2-CDG, MONDO:0008908 8808595;11228641;22105986;33044030;31420886 False 3 100;0;0 21.569 True ENSG00000168282 ENSG00000168282 HGNC:7045 MGME1 gene MGME1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 11, MIM# 615084 23313956;29572490;28711739 False 3 100;0;0 21.569 True ENSG00000125871 ENSG00000125871 HGNC:16205 MGME1 gene MGME1 Expert Review Green;Other;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial DNA depletion syndrome 11 MONDO:0014039 23313956;29572490;28711739 False 3 100;0;0 21.569 True ENSG00000125871 ENSG00000125871 HGNC:16205 MICU1 gene MICU1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy with extrapyramidal signs, MIM# 615673 24336167;29721912;32395406 False 3 100;0;0 21.569 True ENSG00000107745 ENSG00000107745 HGNC:1530 MINPP1 gene MINPP1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Pontocerebellar hypoplasia, type 16, MIM# 619527" 33257696 False 3 100;0;0 21.569 True ENSG00000107789 ENSG00000107789 HGNC:7102 MIPEP gene MIPEP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Combined oxidative phosphorylation deficiency 31, MIM# 617228" 27799064 False 3 100;0;0 21.569 True ENSG00000027001 ENSG00000027001 HGNC:7104 MKS1 gene MKS1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 28 False 3 100;0;0 21.569 False ENSG00000011143 ENSG00000011143 HGNC:7121 MLC1 gene MLC1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Megalencephalic leukoencephalopathy with subcortical cysts, MIM# 604004" 11254442;21419380;21624973 False 3 100;0;0 21.569 True ENSG00000100427 ENSG00000100427 HGNC:17082 MLC1 gene MLC1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Megalencephalic leukoencephalopathy with subcortical cysts (MIM#604004) 11254442;18757878;16652334 False 3 100;0;0 21.569 True ENSG00000100427 ENSG00000100427 HGNC:17082 MLIP gene MLIP Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy with myalgia, increased serum creatine kinase, and with or without episodic rhabdomyolysis, MIM# 620138 34581780 False 3 100;0;0 21.569 True ENSG00000146147 ENSG00000146147 HGNC:21355 MLYCD gene MLYCD Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Malonyl-CoA decarboxylase deficiency, MIM# 248360 12955715 False 3 100;0;0 21.569 True ENSG00000103150 ENSG00000103150 HGNC:7150 MMACHC gene MMACHC Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria and homocystinuria, cblC type MIM#277400 27604308;16311595 False 3 100;0;0 21.569 True ENSG00000132763 ENSG00000132763 HGNC:24525 MMACHC gene MMACHC NHS GMS;Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria and homocystinuria cblC type, 277400;Methylmalonic aciduria and homocystinuria, cblC type, 277400;Ataxia and hypogonadism False 3 100;0;0 21.569 False ENSG00000132763 ENSG00000132763 HGNC:24525 MMADHC gene MMADHC Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Homocystinuria, cblD type, variant 1 MIM#277410;Methylmalonic aciduria and homocystinuria, cblD type MIM#277410;Methylmalonic aciduria, cblD type, variant 2 MIM#277410 27604308;18385497 False 3 100;0;0 21.569 True ENSG00000168288 ENSG00000168288 HGNC:25221 MME gene MME GeneReviews;Royal Melbourne Hospital;Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2T, MIM# 617017;MONDO:0014866 26991897;27588448;33144514;31429185 False 3 100;0;0 21.569 False ENSG00000196549 ENSG00000196549 HGNC:7154 MOCOS gene MOCOS Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of molybdenum cofactor metabolism;xanthinuria type II MONDO:0011346 25370766, 17368066, 34356852 False 3 0;0;0 21.569 False ENSG00000075643 ENSG00000075643 HGNC:18234 MOCS1 gene MOCS1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of molybdenum cofactor metabolism;sulfite oxidase deficiency due to molybdenum cofactor deficiency type A MONDO:0009643 27604308, 9731530 False 3 0;0;0 21.569 False ENSG00000124615 ENSG00000124615 HGNC:7190 MOCS1 gene MOCS1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Molybdenum cofactor deficiency A MIM#252150;Disorders of molybdenum cofactor metabolism 27604308;9731530 False 3 100;0;0 21.569 True ENSG00000124615 ENSG00000124615 HGNC:7190 MOCS1 gene MOCS1 NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Molybdenum cofactor deficiency A, MIM# 252150 9921896;12754701;21031595 False 3 100;0;0 21.569 True ENSG00000124615 ENSG00000124615 HGNC:7190 MOCS2 gene MOCS2 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Molybdenum cofactor deficiency B MIM#252160;Disorders of molybdenum cofactor metabolism 27604308;10053004 False 3 100;0;0 21.569 True ENSG00000164172 ENSG00000164172 HGNC:7193 MOCS2 gene MOCS2 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Molybdenum cofactor deficiency B MIM#252160 False 3 100;0;0 21.569 True ENSG00000164172 ENSG00000164172 HGNC:7193 MOCS2 gene MOCS2 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal sulfite oxidase deficiency due to molybdenum cofactor deficiency type B MONDO:0009644;Disorders of molybdenum cofactor metabolism 27604308, 10053004 False 3 0;0;0 21.569 False ENSG00000164172 ENSG00000164172 HGNC:7193 MOGS gene MOGS Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIb, MIM# 606056 31925597;30587846;33058492 False 3 100;0;0 21.569 True ENSG00000115275 ENSG00000115275 HGNC:24862 MOGS gene MOGS Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIb, MIM# 606056 31925597;30587846;33058492 False 3 100;0;0 21.569 True ENSG00000115275 ENSG00000115275 HGNC:24862 MORC2 gene MORC2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090 32693025;26497905;26659848 False 3 100;0;0 21.569 True ENSG00000133422 ENSG00000133422 HGNC:23573 MORC2 gene MORC2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090;Charcot-Marie-Tooth disease, axonal, type 2Z, MIM# 616688. PMID: 32693025 False 3 50;0;50 21.569 True ENSG00000133422 ENSG00000133422 HGNC:23573 MORC2 gene MORC2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Axonal type CMT disease type 2Z, 616688;Cerebellar ataxia 28402445 False 3 50;0;50 21.569 True ENSG00000133422 ENSG00000133422 HGNC:23573 MPC1 gene MPC1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial pyruvate carrier deficiency, MIM# 614741 22628558;34873722 False 3 100;0;0 21.569 True ENSG00000060762 ENSG00000060762 HGNC:21606 MPDU1 gene MPDU1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type If, MIM# 609180;MPDU1-CDG, MONDO:0012211 11733564;11733556;31741824;29721919 False 3 100;0;0 21.569 True ENSG00000129255 ENSG00000129255 HGNC:7207 MPDU1 gene MPDU1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type If, MIM# 609180;MPDU1-CDG, MONDO:0012211 11733564;11733556;31741824;29721919 False 3 100;0;0 21.569 True ENSG00000129255 ENSG00000129255 HGNC:7207 MPI gene MPI Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ib, MIM# 602579;MPI-CDG MONDO:0011257 12414827;9585601;10980531;33098580;33204592;32905087;32266963;30242110 False 3 100;0;0 21.569 True ENSG00000178802 ENSG00000178802 HGNC:7216 MPV17 gene MPV17 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2EE, MIM# 618400 22508010;26437932;30298599 False 3 100;0;0 21.569 True ENSG00000115204 ENSG00000115204 HGNC:7224 MPV17 gene MPV17 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Charcot-Marie-Tooth disease, axonal, type 2EE, MIM# 618400 22508010;26437932;30298599 False 3 100;0;0 21.569 False ENSG00000115204 ENSG00000115204 HGNC:7224 MPZ gene MPZ Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot Marie Tooth disease, dominant intermediate D, 60779;Neuropathy, congenital hypomyelinating, 605253;Charcot Marie Tooth disease, type 2J, 607736;Dejerine Sottas disease, 145900;Charcot Marie Tooth disease, type 1B, 118200;Charcot Marie Tooth disease, type 2I, 607677;HMSN 19293842 False 3 100;0;0 21.569 False ENSG00000158887 ENSG00000158887 HGNC:7225 MRE11 gene MRE11 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-Telangiectasia-Like Disorder;Ataxia-telangiectasia-like disorder 1, 604391 False 3 100;0;0 21.569 False ENSG00000020922 ENSG00000020922 HGNC:7230 MRM2 gene MRM2 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial DNA depletion syndrome 17, MIM# 618567" 28973171;36002240 False 3 100;0;0 21.569 True ENSG00000122687 ENSG00000122687 HGNC:16352 MRPL3 gene MRPL3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 9;OMIM #614582 27815843;21786366 False 3 100;0;0 21.569 True ENSG00000114686 ENSG00000114686 HGNC:10379 MRPL39 gene MRPL39 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-59 (COXPD59), MIM#620646 PMID: 37133451 False 3 100;0;0 21.569 True ENSG00000154719 ENSG00000154719 HGNC:14027 MRPL44 gene MRPL44 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 16, MIM# 615395 23315540;25797485 False 3 100;0;0 21.569 True ENSG00000135900 ENSG00000135900 HGNC:16650 MRPL49 gene MRPL49 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 60, MIM# 621195 39417135 False 3 100;0;0 21.569 True ENSG00000149792 ENSG00000149792 HGNC:1176 MRPS2 gene MRPS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 36, MIM# 617950 29576219;34991560 False 3 100;0;0 21.569 True ENSG00000122140 ENSG00000122140 HGNC:14495 MRPS22 gene MRPS22 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 5, MIM# 611719 17873122;25663021;28752220 False 3 100;0;0 21.569 True ENSG00000175110 ENSG00000175110 HGNC:14508 MRPS23 gene MRPS23 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hepatic disease;Combined respiratory chain complex deficiencies;Cardiomyopathy;Tubulopathy;Lactic acidosis;Structural brain abnormalities;Combined oxidative phosphorylation deficiency 46, MIM618952 26741492;17873122;25663021;28752220 False 3 100;0;0 21.569 True ENSG00000181610 ENSG00000181610 HGNC:14509 MRPS34 gene MRPS34 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 32, MIM# 617664 28777931 False 3 100;0;0 21.569 True ENSG00000074071 ENSG00000074071 HGNC:16618 MSMO1 gene MSMO1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, congenital cataract, and psoriasiform dermatitis MIM#616834;Disorders of the metabolism of sterols;MONDO:0014793 27604308;21285510;24144731;33161406;28673550 False 3 100;0;0 21.569 True ENSG00000052802 ENSG00000052802 HGNC:10545 MSTO1 gene MSTO1 Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Myopathy, mitochondrial, and ataxia, MIM# 617675" 28554942;28544275;31604776;31463572;31130378;30684668;29339779 False 3 100;0;0 21.569 True ENSG00000125459 ENSG00000125459 HGNC:29678 MSTO1 gene MSTO1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy, mitochondrial, and ataxia MIM#617675 False 3 100;0;0 21.569 True ENSG00000125459 ENSG00000125459 HGNC:29678 MT-ATP6 gene MT-ATP6 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related 40112238 False 3 100;0;0 21.569 True ENSG00000198899 ENSG00000198899 HGNC:7414 MT-ATP6 gene MT-ATP6 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related 40112238 False 3 100;0;0 21.569 True ENSG00000198899 ENSG00000198899 HGNC:7414 MTCL1 gene MTCL1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal slowly progressive cerebellar ataxia, mild intellectual disability, seizures in childhood and episodic pain in the lower limbs 30548255;28283581 False 3 100;0;0 21.569 True ENSG00000168502 ENSG00000168502 HGNC:29121 MT-CO1 gene MT-CO1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related 30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519 False 3 100;0;0 21.569 True ENSG00000198804 ENSG00000198804 HGNC:7419 MT-CO1 gene MT-CO1 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related 30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519 False 3 100;0;0 21.569 True ENSG00000198804 ENSG00000198804 HGNC:7419 MT-CO1 gene MT-CO1 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related 30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519 False 3 100;0;0 21.569 True ENSG00000198804 ENSG00000198804 HGNC:7419 MT-CO2 gene MT-CO2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related 34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519 False 3 100;0;0 21.569 True ENSG00000198712 ENSG00000198712 HGNC:7421 MT-CO2 gene MT-CO2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related 34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519 False 3 100;0;0 21.569 True ENSG00000198712 ENSG00000198712 HGNC:7421 MT-CO2 gene MT-CO2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related 34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519 False 3 100;0;0 21.569 True ENSG00000198712 ENSG00000198712 HGNC:7421 MT-CO2 gene MT-CO2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related 34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519 False 3 100;0;0 21.569 True ENSG00000198712 ENSG00000198712 HGNC:7421 MT-CO3 gene MT-CO3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease MONDO:0044970, MT-CO3-related 20525945;11063732;33863631;34054915;8630495;9634511;12414820;21163656;16288875;8630495;9634511 False 3 100;0;0 21.569 True ENSG00000198938 ENSG00000198938 HGNC:7422 MT-CO3 gene MT-CO3 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease MONDO:0044970, MT-CO3-related 20525945;11063732;33863631;34054915;8630495;9634511;12414820;21163656;16288875;8630495;9634511 False 3 100;0;0 21.569 True ENSG00000198938 ENSG00000198938 HGNC:7422 MT-CYB gene MT-CYB Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related 39858655;34804306;26937408 False 3 100;0;0 21.569 True ENSG00000198727 ENSG00000198727 HGNC:7427 MT-CYB gene MT-CYB Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related 39858655;34804306;26937408 False 3 100;0;0 21.569 True ENSG00000198727 ENSG00000198727 HGNC:7427 MT-CYB gene MT-CYB Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related 39858655;34804306;26937408 False 3 100;0;0 21.569 True ENSG00000198727 ENSG00000198727 HGNC:7427 MTFMT gene MTFMT Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 15 MIM#614947;Mitochondrial complex I deficiency, nuclear type 27 MIM#618248 26060307;24461907 False 3 100;0;0 21.569 True ENSG00000103707 ENSG00000103707 HGNC:29666 MTFMT gene MTFMT Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 15;22499348;23499752;614947 False 3 0;0;0 21.569 False ENSG00000103707 ENSG00000103707 HGNC:29666 MTFMT gene MTFMT Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 15, MIM# 614947;Mitochondrial complex I deficiency, nuclear type 27, MIM# 618248 21907147;23499752;24461907;22499348 False 3 100;0;0 21.569 True ENSG00000103707 ENSG00000103707 HGNC:29666 MTHFR gene MTHFR Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Homocystinuria due to MTHFR deficiency MIM#236250;Disorders of folate metabolism and transport 27604308;7920641 False 3 100;0;0 21.569 True ENSG00000177000 ENSG00000177000 HGNC:7436 MTHFR gene MTHFR Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Homocystinuria due to MTHFR deficiency MIM#236250 27604308;7920641 False 3 100;0;0 21.569 True ENSG00000177000 ENSG00000177000 HGNC:7436 MTHFR gene MTHFR Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Homocystinuria due to MTHFR deficiency, 236250 29391032 False 3 100;0;0 21.569 False ENSG00000177000 ENSG00000177000 HGNC:7436 MTHFS gene MTHFS Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, epilepsy, and hypomyelination, 618367 30031689;31844630;22303332 False 3 100;0;0 21.569 True ENSG00000136371 ENSG00000136371 HGNC:7437 MTM1 gene MTM1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Myotubular myopathy, X-linked, 310400 False 3 100;0;0 21.569 False ENSG00000171100 ENSG00000171100 HGNC:7448 MTMR2 gene MTMR2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B1, 601382;HMSN;MONDO:0011066 10802647;16249189;33653949;32586600;32488727;31680794 False 3 100;0;0 21.569 False ENSG00000087053 ENSG00000087053 HGNC:7450 MT-ND1 gene MT-ND1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-ND1-related 39147111;36717040;34656796 False 3 100;0;0 21.569 True ENSG00000198888 ENSG00000198888 HGNC:7455 MT-ND2 gene MT-ND2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND2-related 26258512;16738010;15781840;12192017 False 3 100;0;0 21.569 True ENSG00000198763 ENSG00000198763 HGNC:7456 MT-ND3 gene MT-ND3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND3-related 1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403 False 3 100;0;0 21.569 True ENSG00000198840 ENSG00000198840 HGNC:7458 MT-ND3 gene MT-ND3 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND3-related 1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403 False 3 100;0;0 21.569 False ENSG00000198840 ENSG00000198840 HGNC:7458 MT-ND3 gene MT-ND3 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND3-related 1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403 False 3 100;0;0 21.569 False ENSG00000198840 ENSG00000198840 HGNC:7458 MT-ND4 gene MT-ND4 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND4-related 12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231 False 3 100;0;0 21.569 True ENSG00000198886 ENSG00000198886 HGNC:7459 MT-ND4 gene MT-ND4 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND4-related 12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231 False 3 100;0;0 21.569 True ENSG00000198886 ENSG00000198886 HGNC:7459 MT-ND4 gene MT-ND4 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND4-related 12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231 False 3 100;0;0 21.569 True ENSG00000198886 ENSG00000198886 HGNC:7459 MT-ND4 gene MT-ND4 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND4-related 12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231 False 3 100;0;0 21.569 True ENSG00000198886 ENSG00000198886 HGNC:7459 MT-ND4 gene MT-ND4 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND4-related 12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231 False 3 100;0;0 21.569 True ENSG00000198886 ENSG00000198886 HGNC:7459 MT-ND5 gene MT-ND5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND5-related 17400793;11938446;12624137;18495510;23918514;17535832;29506874;23034978;16816025;9299505;18977334 False 3 100;0;0 21.569 True ENSG00000198786 ENSG00000198786 HGNC:7461 MT-ND5 gene MT-ND5 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND5-related 17400793;11938446;12624137;18495510;23918514;17535832;29506874;23034978;16816025;9299505;18977334 False 3 100;0;0 21.569 True ENSG00000198786 ENSG00000198786 HGNC:7461 MT-ND5 gene MT-ND5 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND5-related 17400793;11938446;12624137;18495510;23918514;17535832;29506874;23034978;16816025;9299505;18977334 False 3 100;0;0 21.569 True ENSG00000198786 ENSG00000198786 HGNC:7461 MT-ND6 gene MT-ND6 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND6-related 5576045;20019223;21196529;10894222;14684687;17535832;19103152;21749722;23813926;25356405;14595656;19062322;11133798;30741831;21364701;2018041 False 3 100;0;0 21.569 True ENSG00000198695 ENSG00000198695 HGNC:7462 MTO1 gene MTO1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 10, OMIM #614702 26061759;29331171;23929671 False 3 100;0;0 21.569 True ENSG00000135297 ENSG00000135297 HGNC:19261 MTOR gene MTOR Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Smith-Kingsmore syndrome, MIM# 616638;Focal cortical dysplasia, type II, somatic, MIM# 607341;Overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes, MONDO:0100283 28892148;25878179;26018084 False 3 100;0;0 21.569 True Other ENSG00000198793 ENSG00000198793 HGNC:3942 MTPAP gene MTPAP Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 4, autosomal recessive 613672;Lethal encephalopathy 20970105;25008111;26319014;31779033 False 3 50;50;0 21.569 True ENSG00000107951 ENSG00000107951 HGNC:25532 MTR gene MTR NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Homocystinuria-megaloblastic anemia, cblG complementation type, MIM#250940 25526710;9683607;28666289 False 3 100;0;0 21.569 True ENSG00000116984 ENSG00000116984 HGNC:7468 MT-RNR1 gene MT-RNR1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-RNR1-related 20301595;7698299;16380089;12920080;24252789;9490575;8285309;9040738;7689389 False 3 100;0;0 21.569 True ENSG00000211459 ENSG00000211459 HGNC:7470 MTRR gene MTRR Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Homocystinuria-megaloblastic anemia, cbl E type MIM#236270;Disorders of the metabolism of sulphur amino acids 27604308;9501215 False 3 100;0;0 21.569 True ENSG00000124275 ENSG00000124275 HGNC:7473 MT-TA gene MT-TA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TA-related 11715067;17825557;14569122;27014581;20813205;25873012;16476954 False 3 100;0;0 21.569 True ENSG00000210127 ENSG00000210127 HGNC:7475 MT-TA gene MT-TA Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TA-related 11715067;17825557;14569122;27014581;20813205;25873012;16476954 False 3 100;0;0 21.569 True ENSG00000210127 ENSG00000210127 HGNC:7475 MT-TD gene MT-TD Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TD-related 9811342;10488907;16059939;18676632;23696415;25447692;27536005;30030363;3054486;19535463 False 3 100;0;0 21.569 True ENSG00000210154 ENSG00000210154 HGNC:7478 MT-TD gene MT-TD Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TD-related 9811342;10488907;16059939;18676632;23696415;25447692;27536005;30030363;3054486;19535463 False 3 100;0;0 21.569 True ENSG00000210154 ENSG00000210154 HGNC:7478 MT-TE gene MT-TE Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TE-related 8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256 False 3 100;0;0 21.569 True ENSG00000210194 ENSG00000210194 HGNC:7479 MT-TE gene MT-TE Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TE-related 8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256 False 3 100;0;0 21.569 True ENSG00000210194 ENSG00000210194 HGNC:7479 MT-TE gene MT-TE Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TE-related 8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256 False 3 100;0;0 21.569 True ENSG00000210194 ENSG00000210194 HGNC:7479 MT-TE gene MT-TE Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TE-related 8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256 False 3 100;0;0 21.569 True ENSG00000210194 ENSG00000210194 HGNC:7479 MT-TF gene MT-TF Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TF-related 14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334 False 3 100;0;0 21.569 True ENSG00000210049 ENSG00000210049 HGNC:7481 MT-TF gene MT-TF Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TF-related 14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334 False 3 100;0;0 21.569 True ENSG00000210049 ENSG00000210049 HGNC:7481 MT-TF gene MT-TF Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TF-related 14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334 False 3 100;0;0 21.569 True ENSG00000210049 ENSG00000210049 HGNC:7481 MT-TF gene MT-TF Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TF-related 14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334 False 3 100;0;0 21.569 True ENSG00000210049 ENSG00000210049 HGNC:7481 MT-TG gene MT-TG Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 21.569 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TG gene MT-TG Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 21.569 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TG gene MT-TG Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 21.569 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TG gene MT-TG Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 21.569 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TG gene MT-TG Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 21.569 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TH gene MT-TH Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TH-related 12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194 False 3 100;0;0 21.569 True ENSG00000210176 ENSG00000210176 HGNC:7487 MT-TH gene MT-TH Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TH-related 12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194 False 3 100;0;0 21.569 True ENSG00000210176 ENSG00000210176 HGNC:7487 MT-TH gene MT-TH Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TH-related 12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194 False 3 100;0;0 21.569 True ENSG00000210176 ENSG00000210176 HGNC:7487 MT-TI gene MT-TI Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TI-related 15121771;21982779;23395828;16120360;9473477;12767666;10065021;7646516;20884012;21292040;1632786;23696415;34607911 False 3 100;0;0 21.569 True ENSG00000210100 ENSG00000210100 HGNC:7488 MT-TK gene MT-TK Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL MERRF;Encephalopathy;Deafness;Cardiomyopathy False 3 100;0;0 21.569 True ENSG00000210156 ENSG00000210156 HGNC:7489 MT-TL1 gene MT-TL1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TL1-related 9323566;12221518;20471262;23220830;23273904;24338029;23582502;11271374;23258140 False 3 100;0;0 21.569 True ENSG00000209082 ENSG00000209082 HGNC:7490 MT-TL2 gene MT-TL2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TL2-related 8923013;12398839;19718780;18977334;21819490;15649400;15591266;23847141;20022607;29052516 False 3 100;0;0 21.569 True ENSG00000210191 ENSG00000210191 HGNC:7491 MT-TL2 gene MT-TL2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TL2-related 8923013;12398839;19718780;18977334;21819490;15649400;15591266;23847141;20022607;29052516 False 3 100;0;0 21.569 True ENSG00000210191 ENSG00000210191 HGNC:7491 MT-TL2 gene MT-TL2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TL2-related 8923013;12398839;19718780;18977334;21819490;15649400;15591266;23847141;20022607;29052516 False 3 100;0;0 21.569 True ENSG00000210191 ENSG00000210191 HGNC:7491 MT-TM gene MT-TM Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial disease (MONDO:0044970), MT-TM-related 9633749;24711008;25468263;30739820;11335700;31488384;31022467;29174468 False 3 100;0;0 21.569 True ENSG00000210112 ENSG00000210112 HGNC:7492 MT-TM gene MT-TM Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial disease (MONDO:0044970), MT-TM-related 9633749;24711008;25468263;30739820;11335700;31488384;31022467;29174468 False 3 100;0;0 21.569 True ENSG00000210112 ENSG00000210112 HGNC:7492 MT-TN gene MT-TN Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial myopathy False 3 100;0;0 21.569 True ENSG00000210135 ENSG00000210135 HGNC:7493 MTTP gene MTTP Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Abetalipoproteinemia, 200100;Abetalipoproteinemia False 3 100;0;0 21.569 False ENSG00000138823 ENSG00000138823 HGNC:7467 MTTP gene MTTP Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Abetalipoproteinemia (MIM#200100);Young onset;Abetalipoproteinaemia;hypocholesterloaemia leading to malabsorption of fat-soluble vitamins (vitamin E), acanthocytes, retinitis pigmentosa, progressive sensory axonal neuropathy 33994405 False 3 100;0;0 21.569 True ENSG00000138823 ENSG00000138823 HGNC:7467 MT-TP gene MT-TP Expert Review Red;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TP-related 7689388;11196116;19223931;23696415;19273760;27536729;27816331;32305257;32419253 False 3 100;0;0 21.569 True ENSG00000210196 ENSG00000210196 HGNC:7494 MT-TP gene MT-TP Expert list;Expert Review Green;Expert Review Red;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TP-related 7689388;11196116;19223931;23696415;19273760;27536729;27816331;32305257;32419253 False 3 100;0;0 21.569 False ENSG00000210196 ENSG00000210196 HGNC:7494 MT-TR gene MT-TR Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial disease (MONDO:0044970), MT-TR-related 15286228;17588757;19809478;22781096 False 3 100;0;0 21.569 False ENSG00000210174 ENSG00000210174 HGNC:7496 MT-TR gene MT-TR Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial disease (MONDO:0044970), MT-TR-related 15286228;17588757;19809478;22781096 False 3 100;0;0 21.569 True ENSG00000210174 ENSG00000210174 HGNC:7496 MT-TR gene MT-TR Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial disease (MONDO:0044970), MT-TR-related 15286228;17588757;19809478;22781096 False 3 100;0;0 21.569 True ENSG00000210174 ENSG00000210174 HGNC:7496 MT-TS1 gene MT-TS1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS1-related 7669057;9778262;14605505;23696415;33279600;7581383 False 3 100;0;0 21.569 True ENSG00000210151 ENSG00000210151 HGNC:7497 MT-TS1 gene MT-TS1 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS1-related 7669057;9778262;14605505;23696415;33279600;7581383 False 3 100;0;0 21.569 True ENSG00000210151 ENSG00000210151 HGNC:7497 MT-TS1 gene MT-TS1 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS1-related 7669057;9778262;14605505;23696415;33279600;7581383 False 3 100;0;0 21.569 True ENSG00000210151 ENSG00000210151 HGNC:7497 MT-TS2 gene MT-TS2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS2-related 9792552;10090882;16950817;21257182;22369973;22378285 False 3 100;0;0 21.569 True ENSG00000210184 ENSG00000210184 HGNC:7498 MT-TS2 gene MT-TS2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS2-related 9792552;10090882;16950817;21257182;22369973;22378285 False 3 100;0;0 21.569 True ENSG00000210184 ENSG00000210184 HGNC:7498 MT-TS2 gene MT-TS2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS2-related 9792552;10090882;16950817;21257182;22369973;22378285 False 3 100;0;0 21.569 True ENSG00000210184 ENSG00000210184 HGNC:7498 MT-TT gene MT-TT Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TT-related 32083134;8769114;9367299;1645537;8511015;22638997;29760464;30236074;28187756;35808913 False 3 50;50;0 21.569 True ENSG00000210195 ENSG00000210195 HGNC:7499 MT-TT gene MT-TT Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TT-related 32083134;8769114;9367299;1645537;8511015;22638997;29760464;30236074;28187756;35808913 False 3 50;50;0 21.569 True ENSG00000210195 ENSG00000210195 HGNC:7499 MT-TT gene MT-TT Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TT-related 32083134;8769114;9367299;1645537;8511015;22638997;29760464;30236074;28187756;35808913 False 3 50;50;0 21.569 True ENSG00000210195 ENSG00000210195 HGNC:7499 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 21.569 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 21.569 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 21.569 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 21.569 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 21.569 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TV gene MT-TV Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 21.569 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TW gene MT-TW Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 21.569 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TW gene MT-TW Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 21.569 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TW gene MT-TW Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 21.569 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TW gene MT-TW Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 21.569 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TW gene MT-TW Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 21.569 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TY gene MT-TY Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 21.569 True ENSG00000210144 ENSG00000210144 HGNC:7502 MT-TY gene MT-TY Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 21.569 True ENSG00000210144 ENSG00000210144 HGNC:7502 MT-TY gene MT-TY Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 21.569 True ENSG00000210144 ENSG00000210144 HGNC:7502 MT-TY gene MT-TY Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 21.569 True ENSG00000210144 ENSG00000210144 HGNC:7502 MT-TY gene MT-TY Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 21.569 True ENSG00000210144 ENSG00000210144 HGNC:7502 MTX2 gene MTX2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mandibuloacral dysplasia progeroid syndrome, MIM# 619127 38250156;32917887 False 3 100;0;0 21.569 True ENSG00000128654 ENSG00000128654 HGNC:7506 MVK gene MVK Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mevalonic aciduria MIM#610377;Disorders of sterol biosynthesis 27604308;1377680 False 3 100;0;0 21.569 True ENSG00000110921 ENSG00000110921 HGNC:7530 MVK gene MVK Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mevalonic aciduria 610377 12563048;10401001;28095071 False 3 100;0;0 21.569 True ENSG00000110921 ENSG00000110921 HGNC:7530 MYH14 gene MYH14 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Peripheral neuropathy, myopathy, hoarseness, and hearing loss MIM#614369 21480433;35274842;31231018;27875632 False 3 100;0;0 21.569 True ENSG00000105357 ENSG00000105357 HGNC:23212 MYH7 gene MYH7 Expert Review Green;Expert Review;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Laing distal myopathy (MIM#160500);Scapuloperoneal syndrome, myopathic type (MIM#181430) 27387980;20733148 False 3 50;50;0 21.569 True Other ENSG00000092054 ENSG00000092054 HGNC:7577 MYL2 gene MYL2 Expert Review Green;Other;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 12, infantile-onset, with cardiomyopathy (MIM#619424) 23365102;9673982 False 3 100;0;0 21.569 True ENSG00000111245 ENSG00000111245 HGNC:7583 MYOT gene MYOT Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Myopathy, myofibrillar, 3 (MIM#609200)" 30055862;21336781;15947064;10958653;15111675;16380616;33250842;32509353;29924655 False 3 0;100;0 21.569 True ENSG00000120729 ENSG00000120729 HGNC:12399 MYT1L gene MYT1L Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 39, MIM# 616521 32065501 False 3 100;0;0 21.569 True ENSG00000186487 ENSG00000186487 HGNC:7623 NAA10 gene NAA10 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females NAA10-related syndrome MONDO:0100124 11426460;29957440;34200686;30842225;34075687;21700266;37130971 False 3 60;20;20 21.569 True ENSG00000102030 ENSG00000102030 HGNC:18704 NAA15 gene NAA15 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787 38380600;36221186;35730864 False 3 100;0;0 21.569 True ENSG00000164134 ENSG00000164134 HGNC:30782 NAA60 gene NAA60 Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 9, autosomal recessive, MIM# 620786 False 3 100;0;0 21.569 True ENSG00000122390 ENSG00000122390 HGNC:25875 NACC1 gene NACC1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with epilepsy, cataracts, feeding difficulties, and delayed brain myelination - MIM#617393 28132692 False 3 100;0;0 21.569 True ENSG00000160877 ENSG00000160877 HGNC:20967 NACC1 gene NACC1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted chorea;dystonia;epilepsy;microcephaly;cataracts;dysautonomia;iron deficiency anemia;stereotypies 38698576 False 3 100;0;0 21.569 True ENSG00000160877 ENSG00000160877 HGNC:20967 NADK2 gene NADK2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "2,4-dienoyl-CoA reductase deficiency, MIM# 616034" 24847004;29388319;27940755 False 3 100;0;0 21.569 True ENSG00000152620 ENSG00000152620 HGNC:26404 NADK2 gene NADK2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "2,4-dienoyl-CoA reductase deficiency, MIM# 616034" 24847004;27940755;23212377;28923496 False 3 100;0;0 21.569 True ENSG00000152620 ENSG00000152620 HGNC:26404 NAGA gene NAGA Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kanzaki disease, MIM#609242 False 3 100;0;0 21.569 True ENSG00000198951 ENSG00000198951 HGNC:7631 NAGA gene NAGA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kanzaki disease, MIM# 609242;Schindler disease, type I and type II 609241;alpha-N-acetylgalactosaminidase deficiency MONDO:0017779 11313741;31468281;15619430;8782044 False 3 100;0;0 21.569 True ENSG00000198951 ENSG00000198951 HGNC:7631 NAGLU gene NAGLU Expert Review Green;Literature;Expert list;Expert Review Amber;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type IIIB (Sanfilippo B) - 252920;Seizures 34396902;25818867;8650226 False 3 67;33;0 21.569 True ENSG00000108784 ENSG00000108784 HGNC:7632 NAGLU gene NAGLU Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mucopolysaccharidosis type IIIB (Sanfilippo B), MIM# 252920;MONDO:0009656;Charcot-Marie-Tooth disease, axonal, type 2V MIM#616491;MONDO:0014665 25818867;8650226 False 3 100;0;0 21.569 True ENSG00000108784 ENSG00000108784 HGNC:7632 NALCN gene NALCN Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital contractures of the limbs and face, hypotonia, and developmental delay - MIM#616266;Hypotonia, infantile, with psychomotor retardation and characteristic facies 1 - MIM#615419 30167850;25683120;35388452;28327206;27473021;27558372 False 3 100;0;0 21.569 True ENSG00000102452 ENSG00000102452 HGNC:19082 NAPB gene NAPB Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 107 MIM#620033 26235277;28097321;33189936 False 3 100;0;0 21.569 True ENSG00000125814 ENSG00000125814 HGNC:15751 NARS gene NARS Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091;Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092;Abnormal muscle tone;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Ataxia;Abnormality of the face;Demyelinating peripheral neuropathy 32738225 False 3 100;0;0 21.569 True ENSG00000134440 ENSG00000134440 HGNC:7643 NARS gene NARS Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091;Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092;Abnormal muscle tone;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Ataxia;Abnormality of the face;Demyelinating peripheral neuropathy 32738225 False 3 100;0;0 21.569 True ENSG00000134440 ENSG00000134440 HGNC:7643 NARS2 gene NARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 24 - MIM#616239 25385316;25807530;30327238;28077841 False 3 100;0;0 21.569 True ENSG00000137513 ENSG00000137513 HGNC:26274 NARS2 gene NARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 24 - MIM#616239;Deafness, autosomal recessive 94 - MIM#618434 25385316;25807530;30327238;28077841 False 3 100;0;0 21.569 True ENSG00000137513 ENSG00000137513 HGNC:26274 NAXD gene NAXD Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 2 MIM#618321 30576410 False 3 100;0;0 21.569 True ENSG00000213995 ENSG00000213995 HGNC:25576 NAXD gene NAXD Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, 2, 618321 30576410;31755961;32462209 False 3 100;0;0 21.569 True ENSG00000213995 ENSG00000213995 HGNC:25576 NAXE gene NAXE Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain oedema and/or leukoencephalopathy, MIM# 617186 27122014;27616477;31758406 False 3 100;0;0 21.569 True ENSG00000163382 ENSG00000163382 HGNC:18453 NAXE gene NAXE Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain edema and/or leukoencephalopathy, MIM#617186 27122014;27616477;31758406 False 3 100;0;0 21.569 True ENSG00000163382 ENSG00000163382 HGNC:18453 NBEA gene NBEA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM# 619157;Intellectual disability;Seizures 30269351;28554332;12746398;12826745;11450821;3377648;23277425;22109531;23153818 False 3 100;0;0 21.569 True ENSG00000172915 ENSG00000172915 HGNC:7648 NCDN gene NCDN Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with infantile epileptic spasms (NEDIES), MIM#619373 33711248 False 3 100;0;0 21.569 True ENSG00000020129 ENSG00000020129 HGNC:17597 NCKAP1 gene NCKAP1 Expert Review Green;Genetic Health Queensland;Genetic Health Queensland Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092) , NCKAP1-related 33157009 False 3 100;0;0 21.569 True ENSG00000061676 ENSG00000061676 HGNC:7666 NDC1 gene NDC1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328 39003500;19782045 False 3 100;0;0 21.569 True ENSG00000058804 ENSG00000058804 HGNC:25525 NDE1 gene NDE1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly with lissencephaly and/or hydranencephaly, MONDO:0700116 30637988 False 3 100;0;0 21.569 True ENSG00000072864 ENSG00000072864 HGNC:17619 NDRG1 gene NDRG1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Charcot Marie Tooth disease, type 4D, 601455;MONDO:0011085 10831399;24136616;33334662;29724652;29174527;28776325 False 3 100;0;0 21.569 False ENSG00000104419 ENSG00000104419 HGNC:7679 NDST1 gene NDST1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 46 - MIM#616116 25125150;21937992;32878022;28211985 False 3 100;0;0 21.569 True ENSG00000070614 ENSG00000070614 HGNC:7680 NDUFA1 gene NDUFA1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mitochondrial complex I deficiency, nuclear type 12 MIM#301020 29506883;19185523;17262856;21596602 False 3 100;0;0 21.569 True ENSG00000125356 ENSG00000125356 HGNC:7683 NDUFA1 gene NDUFA1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mitochondrial complex I deficiency, nuclear type 12 MIM#301020 29506883;19185523;17262856;21596602 False 3 100;0;0 21.569 True ENSG00000125356 ENSG00000125356 HGNC:7683 NDUFA10 gene NDUFA10 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 22 - MIM#618243 21150889;26741492;28247337 False 3 100;0;0 21.569 True ENSG00000130414 ENSG00000130414 HGNC:7684 NDUFA12 gene NDUFA12 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 23 618244 21617257;33715266 False 3 50;0;50 21.569 True ENSG00000184752 ENSG00000184752 HGNC:23987 NDUFA13 gene NDUFA13 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 28, MIM# 618249 25901006;32722639 False 3 50;50;0 21.569 True ENSG00000186010 ENSG00000186010 HGNC:17194 NDUFA2 gene NDUFA2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 13 - MIM#618235 28857146;32154054;18513682 False 3 100;0;0 21.569 True ENSG00000131495 ENSG00000131495 HGNC:7685 NDUFA3 gene NDUFA3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970,NDUFA3-related 41038977;39661167 False 3 100;0;0 21.569 True ENSG00000170906 ENSG00000170906 HGNC:7686 NDUFA4 gene NDUFA4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 21, MIM#619065;Leigh syndrome 30361421;28988874;23746447 False 3 100;0;0 21.569 True ENSG00000189043 ENSG00000189043 HGNC:7687 NDUFA5 gene NDUFA5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970, NDUFA5-related 41916321 False 3 100;0;0 21.569 True ENSG00000128609 ENSG00000128609 HGNC:7688 NDUFA6 gene NDUFA6 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial complex I deficiency, nuclear type 33, MIM# 618253" 30245030 False 3 100;0;0 21.569 True ENSG00000184983 ENSG00000184983 HGNC:7690 NDUFA9 gene NDUFA9 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 26 28671271 False 3 100;0;0 21.569 True ENSG00000139180 ENSG00000139180 HGNC:7693 NDUFAF1 gene NDUFAF1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000137806 ENSG00000137806 HGNC:18828 NDUFAF1 gene NDUFAF1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 11 - MIM#618234 17557076;21931170;16218961;24963768;34975718 False 3 100;0;0 21.569 True ENSG00000137806 ENSG00000137806 HGNC:18828 NDUFAF2 gene NDUFAF2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 10 - MIM#618233 33528536;34364746;16200211;19384974;20571988 False 3 100;0;0 21.569 True ENSG00000164182 ENSG00000164182 HGNC:28086 NDUFAF2 gene NDUFAF2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 10 - MIM#618233 33528536;34364746;16200211;19384974;20571988 False 3 100;0;0 21.569 True ENSG00000164182 ENSG00000164182 HGNC:28086 NDUFAF3 gene NDUFAF3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 18 - MIM#618240 27986404;29344937;19463981 False 3 100;0;0 21.569 True ENSG00000178057 ENSG00000178057 HGNC:29918 NDUFAF3 gene NDUFAF3 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency 252010 False 3 0;0;0 21.569 False ENSG00000178057 ENSG00000178057 HGNC:29918 NDUFAF4 gene NDUFAF4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 15 - MIM#618237 32949790;28853723 False 3 100;0;0 21.569 True ENSG00000123545 ENSG00000123545 HGNC:21034 NDUFAF5 gene NDUFAF5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 3 MIM#618224 34797029 False 3 100;0;0 21.569 True ENSG00000101247 ENSG00000101247 HGNC:15899 NDUFAF5 gene NDUFAF5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 3 MIM#618224 34797029 False 3 100;0;0 21.569 True ENSG00000101247 ENSG00000101247 HGNC:15899 NDUFAF6 gene NDUFAF6 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 17 (MIM#618239) 30642748 False 3 100;0;0 21.569 True ENSG00000156170 ENSG00000156170 HGNC:28625 NDUFAF8 gene NDUFAF8 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome 31866046 False 3 100;0;0 21.569 True ENSG00000224877 ENSG00000224877 HGNC:33551 NDUFB10 gene NDUFB10 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal fatal infantile lactic acidosis;cardiomyopathy;Mitochondrial complex I deficiency nuclear type 35 (MC1DN35), MIM#619003 28040730;32025618;33169436 False 3 50;50;0 21.569 True ENSG00000140990 ENSG00000140990 HGNC:7696 NDUFB11 gene NDUFB11 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Linear skin defects with multiple congenital anomalies 3, XLD (MIM#300952);MONDO:0010494;Mitochondrial complex I deficiency, nuclear type 30, XLR (MIM#301021);MONDO:0026721 28050600;27488349;30423443;27488349 False 3 100;0;0 21.569 True ENSG00000147123 ENSG00000147123 HGNC:20372 NDUFB3 gene NDUFB3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 25, MIM# 618246;MONDO:0032629 22499348;27091925 False 3 100;0;0 21.569 True ENSG00000119013 ENSG00000119013 HGNC:7698 NDUFB7 gene NDUFB7 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency nuclear type 39 (MC1DN39), MIM#620135 33502047;27626371;40025060 False 3 50;50;0 21.569 True ENSG00000099795 ENSG00000099795 HGNC:7702 NDUFB8 gene NDUFB8 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 32 - MIM#618252 29429571 False 3 100;0;0 21.569 True ENSG00000166136 ENSG00000166136 HGNC:7703 NDUFS1 gene NDUFS1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 5 - MIM#618226 33751534;24952175;20382551;21203893;20797884;15824269;25615419;11349233;22399432 False 3 100;0;0 21.569 True ENSG00000023228 ENSG00000023228 HGNC:7707 NDUFS1 gene NDUFS1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency;General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial complex I disorders;MITOCHONDRIAL RESPIRATORY CHAIN COMPLEX I DEFICIENCY;Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000023228 ENSG00000023228 HGNC:7707 NDUFS2 gene NDUFS2 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I disorders;Leigh syndrome;Mitochondrial Leukoencephalopathy;Leigh syndrome associated with mitochondrial complex I deficiency False 3 0;0;0 21.569 False ENSG00000158864 ENSG00000158864 HGNC:7708 NDUFS2 gene NDUFS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 6 - MIM#618228 28031252;31411514;22036843;20819849;11220739;23266820;31411514 False 3 100;0;0 21.569 True ENSG00000158864 ENSG00000158864 HGNC:7708 NDUFS3 gene NDUFS3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 8 - MIM#618230 22499348;30140060;14729820;33097395 False 3 100;0;0 21.569 True ENSG00000213619 ENSG00000213619 HGNC:7710 NDUFS4 gene NDUFS4 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency;Mitochondrial complex I disorders;MITOCHONDRIAL RESPIRATORY CHAIN COMPLEX I DEFICIENCY;Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000164258 ENSG00000164258 HGNC:7711 NDUFS4 gene NDUFS4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 1, 252010;Leigh syndrome, MIM#252010 10944442;27079373;19107570;12616398 False 3 100;0;0 21.569 True ENSG00000164258 ENSG00000164258 HGNC:7711 NDUFS4 gene NDUFS4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 1 - MIM#252010 11181577;11165261;16478720;10944442;24295889;22326555;27079373;15975579;19364667;27671926;33093004;29264396;34484776 False 3 100;0;0 21.569 True ENSG00000164258 ENSG00000164258 HGNC:7711 NDUFS6 gene NDUFS6 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 9 - MIM#618232 15372108;19259137;30948790 False 3 100;0;0 21.569 True ENSG00000145494 ENSG00000145494 HGNC:7713 NDUFS7 gene NDUFS7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 3 (MIM# 618224) 22644603 False 3 100;0;0 21.569 True ENSG00000115286 ENSG00000115286 HGNC:7714 NDUFS7 gene NDUFS7 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal General Leukodystrophy & Mitochondrial Leukoencephalopathy;Mitochondrial respiratory chain complex I deficiency;Leigh syndrome;Genetic leukoencephalopathies: mitochondrial disorders;Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000115286 ENSG00000115286 HGNC:7714 NDUFS8 gene NDUFS8 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 2 MIM#618222 23430795;9837812;15159508;22499348;20818383;20819849 False 3 100;0;0 21.569 True ENSG00000110717 ENSG00000110717 HGNC:7715 NDUFS8 gene NDUFS8 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 2 MIM#618222 23430795;9837812;15159508;22499348;20818383;20819849 False 3 100;0;0 21.569 True ENSG00000110717 ENSG00000110717 HGNC:7715 NDUFS8 gene NDUFS8 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I disorders;Leigh syndrome due to mitochondrial complex I deficiency;Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000110717 ENSG00000110717 HGNC:7715 NDUFV1 gene NDUFV1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 4 MIM#618225 34807224 False 3 100;0;0 21.569 True ENSG00000167792 ENSG00000167792 HGNC:7716 NDUFV1 gene NDUFV1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 4 MIM#618225 34807224 False 3 100;0;0 21.569 True ENSG00000167792 ENSG00000167792 HGNC:7716 NDUFV1 gene NDUFV1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000167792 ENSG00000167792 HGNC:7716 NDUFV2 gene NDUFV2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial complex I deficiency, nuclear type 7 (MIM#618229)" 33811136 False 3 100;0;0 21.569 True ENSG00000178127 ENSG00000178127 HGNC:7717 NDUFV2 gene NDUFV2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 7 (MIM#618229) 12754703;19167255;26008862;30770271;33811136;34405929 False 3 67;33;0 21.569 True ENSG00000178127 ENSG00000178127 HGNC:7717 NEB gene NEB Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal distal myopathy MONDO:0018949 21724397;17525139;33458580;25205138 False 3 75;25;0 21.569 True ENSG00000183091 ENSG00000183091 HGNC:7720 NEDD4L gene NEDD4L Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Periventricular nodular heterotopia 7, MIM#617201 28515470;23934111;28212375;27694961 False 3 100;0;0 21.569 True ENSG00000049759 ENSG00000049759 HGNC:7728 NEFH gene NEFH Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal, type 2CC, 616924;HMSN 30992180;27040688;28709447 False 3 100;0;0 21.569 False ENSG00000100285 ENSG00000100285 HGNC:7737 NEFL gene NEFL Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot Marie Tooth disease, type 2E, 607684;Charcot-Marie-Tooth disease, dominant intermediate G, 617882;HMSN;Charcot Marie Tooth disease, type 1F, 607734 10841809;12393795;14733962;24887401;25877835;20039262;12566280;29191368;28902413 False 3 100;0;0 21.569 False ENSG00000104725 ENSG00000277586 HGNC:7739 NEK1 gene NEK1 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis, susceptibility to, 24 MIM#617892 31768050;26945885;27455347;29929116 False 3 100;0;0 21.569 True ENSG00000137601 ENSG00000137601 HGNC:7744 NEMF gene NEMF Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Intellectual developmental disorder with speech delay and axonal peripheral neuropathy, MIM# 619099;Intellectual disability;neuropathy 32934225 False 3 100;0;0 21.569 True ENSG00000165525 ENSG00000165525 HGNC:10663 NEU1 gene NEU1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sialidosis, type I/II MIM#256550 25401298;14517945 False 3 100;0;0 21.569 True ENSG00000204386 ENSG00000204386 HGNC:7758 NEU1 gene NEU1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sialidosis, type I and type II, MIM# 256550;MONDO:0009738 8985184;9054950;11063730 False 3 100;0;0 21.569 True ENSG00000204386 ENSG00000204386 HGNC:7758 NEUROD2 gene NEUROD2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 72, MIM# 618374" 30323019 False 3 100;0;0 21.569 True ENSG00000171532 ENSG00000171532 HGNC:7763 NEXMIF gene NEXMIF Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation, X-linked 98, MIM# 300912 27358180 False 3 100;0;0 21.569 True ENSG00000050030 ENSG00000050030 HGNC:29433 NF1 gene NF1 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Moyamoya disease;Neurofibromatosis, type 1 162200 10754001 False 3 75;0;25 21.569 True ENSG00000196712 ENSG00000196712 HGNC:7765 NFE2L2 gene NFE2L2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Immunodeficiency, developmental delay, and hypohomocysteinemia MONDO:0060591;Disorders of glutathione metabolism 29018201 False 3 100;0;0 21.569 True Other ENSG00000116044 ENSG00000116044 HGNC:7782 NFS1 gene NFS1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 52, MIM#619386;Complex II/III deficiency;multisystem organ failure 24498631;33457206 False 3 50;0;50 21.569 True ENSG00000244005 ENSG00000244005 HGNC:15910 NFU1 gene NFU1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 1, MIM#605711 29441221;21944046;22077971;32747156 False 3 100;0;0 21.569 True ENSG00000169599 ENSG00000169599 HGNC:16287 NFU1 gene NFU1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 1 (MIM#605711);Spastic paraplegia 93, autosomal recessive, MIM# 620938 36256512 False 3 100;0;0 21.569 True ENSG00000169599 ENSG00000169599 HGNC:16287 NFU1 gene NFU1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 1, MIM# 605711 21944046;22077971;32747156;29441221 False 3 100;0;0 21.569 True ENSG00000169599 ENSG00000169599 HGNC:16287 NGF gene NGF Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type V, 608654;HSAN 5;Congenital sensory neuropathy with selective loss of small myelinated fibers;Hereditary sensory neuropathy type V 26562335;20978020;14976160;15131306 False 3 0;0;0 21.569 False ENSG00000134259 ENSG00000134259 HGNC:7808 NGF gene NGF Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Neuropathy, hereditary sensory and autonomic, type V, MIM# 608654;MONDO:0012092 14976160;20978020;33884296;32693191;31685654;30296891 False 3 100;0;0 21.569 False ENSG00000134259 ENSG00000134259 HGNC:7808 NGLY1 gene NGLY1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of deglycosylation, MIM# 615273;alacrima, movement disorder, microcephaly, abnormal LFTs 24651605;27388694;32259258;29550355 False 3 100;0;0 21.569 True ENSG00000151092 ENSG00000151092 HGNC:17646 NGLY1 gene NGLY1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of deglycosylation, MIM# 615273 32259258;24651605;27388694 False 3 100;0;0 21.569 True ENSG00000151092 ENSG00000151092 HGNC:17646 NGLY1 gene NGLY1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of deglycosylation 1 (CDDG1) (MIM#615273);Developmental delay, choreoathetosis, alacrimia, seizures, microcephaly, transaminitis, neuropathy 22581936;27388694;29419975 False 3 100;0;0 21.569 True ENSG00000151092 ENSG00000151092 HGNC:17646 NHLRC1 gene NHLRC1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora) 254780 21505799;12958597 False 3 100;0;0 21.569 True ENSG00000187566 ENSG00000187566 HGNC:21576 NHLRC1 gene NHLRC1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora) 254780 21505799;12958597 False 3 100;0;0 21.569 True ENSG00000187566 ENSG00000187566 HGNC:21576 NHLRC1 gene NHLRC1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2B, Lafora, 254780;Epilepsy, progressive myoclonic 2B (Lafora) 254780 False 3 100;0;0 21.569 False ENSG00000187566 ENSG00000187566 HGNC:21576 NHLRC1 gene NHLRC1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora Disease) MIM#254780 28556688;34117373 False 3 100;0;0 21.569 True ENSG00000187566 ENSG00000187566 HGNC:21576 NIPA1 gene NIPA1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 6 21419568 False 3 100;0;0 21.569 True ENSG00000170113 ENSG00000170113 HGNC:17043 NIPA1 gene NIPA1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 6, autosomal dominant, MIM# 600363" 14508710;15711826 False 3 100;0;0 21.569 True ENSG00000170113 ENSG00000170113 HGNC:17043 NIT1 gene NIT1 Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brain small vessel disease 4, MIM# 621313 38430071 False 3 100;0;0 21.569 False ENSG00000158793 ENSG00000158793 HGNC:7828 NKX2-1 gene NKX2-1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chorea, hereditary benign MIM#118700;Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978 24714694;30186310 False 3 100;0;0 21.569 True ENSG00000136352 ENSG00000136352 HGNC:11825 NKX2-1 gene NKX2-1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Choreoathetosis, hypothyroidism, and neonatal respiratory distress 610978;Choreoathetosis, hypothyroidism and neonatal respiratory distress, 610978;Chorea, hereditary benign 118700;Hereditary bening chorea, 118700 10931427;27066577;26839702;26103969 False 3 100;0;0 21.569 True ENSG00000136352 ENSG00000136352 HGNC:11825 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic ataxia 8 with hypomyelinating leukodystrophy, 617560;Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560 False 3 100;0;0 21.569 False ENSG00000148826 ENSG00000148826 HGNC:19321 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy, 617560;MONDO:0033043 28575651;15601927;32246862;32004679 False 3 100;0;0 21.569 True ENSG00000148826 ENSG00000148826 HGNC:19321 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy MIM#617560 30285346;28575651;28969374 False 3 100;0;0 21.569 True ENSG00000148826 ENSG00000148826 HGNC:19321 NKX6-2 gene NKX6-2 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560 False 3 0;0;0 21.569 False ENSG00000148826 ENSG00000148826 HGNC:19321 NNT gene NNT Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glucocorticoid deficiency 4, with or without mineralocorticoid deficiency MIM#614736 26309815;22634753 False 3 67;33;0 21.569 True ENSG00000112992 ENSG00000112992 HGNC:7863 NOTCH1 gene NOTCH1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related 35947102 False 3 100;0;0 21.569 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NOTCH1 gene NOTCH1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related 35947102 False 3 100;0;0 21.569 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NOTCH1 gene NOTCH1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related 35947102 False 3 100;0;0 21.569 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NOTCH3 gene NOTCH3 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal neurodevelopmental disorder MONDO:0700092, NOTCH3-related;Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 MIM#125310 False 3 100;0;0 21.569 False ENSG00000074181 ENSG00000074181 HGNC:7883 NOTCH3 gene NOTCH3 Expert Review Green;Literature;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodevelopmental disorder MONDO:0700092, NOTCH3-related;Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 - 125310 33020014;30776699;21414809;30056822;17675836 False 3 50;0;50 21.569 True ENSG00000074181 ENSG00000074181 HGNC:7883 NOTCH3 gene NOTCH3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Cerebral arteriopathy with subcortical infarcts and leukoencephalopathy 1 125310 31960911 False 3 100;0;0 21.569 True ENSG00000074181 ENSG00000074181 HGNC:7883 NOVA2 gene NOVA2 Expert Review Green;Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, OMIM #618859 PMID: 32197073 False 3 100;0;0 21.569 True ENSG00000104967 ENSG00000104967 HGNC:7887 NOVA2 gene NOVA2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, MIM# 618859 32197073;35607920 False 3 67;33;0 21.569 True ENSG00000104967 ENSG00000104967 HGNC:7887 NPC1 gene NPC1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 MONDO:0009757 12555942;20301473 False 3 100;0;0 21.569 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 (MIM#257220;MONDO:0009757) 20301473;11182931 False 3 0;100;0 21.569 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 and type D, MIM# 257220;MONDO:0009757 9211849;11333381 False 3 100;0;0 21.569 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C1, 257220;Niemann-Pick disease types C1 and D (#257220) 10480349;17003072;25497598;33228797 False 3 100;0;0 21.569 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Niemann-Pick disease, type C1/D, MIM# 257220" 26910362;29406968 False 3 100;0;0 21.569 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Niemann-Pick disease, MIM# 257220;Parkinsonism 24035292;30369906 False 3 100;0;0 21.569 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC2 gene NPC2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-pick disease, type C2 MIM#607625 27792009;20525256 False 3 100;0;0 21.569 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPC2 gene NPC2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C2 MONDO:0011873;Dystonia 34993563;17470133 False 3 100;0;0 21.569 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPC2 gene NPC2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann Pick C2, OMIM 607625;Parkinsonism PMID: 35695805 False 3 100;0;0 21.569 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPC2 gene NPC2 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C2, 607625;Niemann-Pick disease type C2 (#607625) False 3 100;0;0 21.569 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPC2 gene NPC2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-pick disease, type C2, MIM# 607625;MONDO:0011873 11125141;17470133 False 3 100;0;0 21.569 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPHP1 gene NPHP1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 4 False 3 100;0;0 21.569 False ENSG00000144061 ENSG00000144061 HGNC:7905 NPRL2 gene NPRL2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epilepsy, familial focal, with variable foci 2 617116;focal seizures;frontal lobe epilepsy;nocturnal frontal lobe epilepsy;temporal lobe epilepsy;focal cortical dysplasia" 26505888;27173016;28199897;31594065 False 3 100;0;0 21.569 True ENSG00000114388 ENSG00000114388 HGNC:24969 NPRL3 gene NPRL3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial focal, with variable foci 3- MIM#617118 27173016;26285051;33461085 False 3 100;0;0 21.569 True ENSG00000103148 ENSG00000103148 HGNC:14124 NPTX1 gene NPTX1 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cerebellar ataxia MONDO#0000437, NPTX1-related 34788392;35288776;35285082;35560436 False 3 100;0;0 21.569 False ENSG00000171246 ENSG00000171246 HGNC:7952 NR2F1 gene NR2F1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Bosch-Boonstra-Schaaf optic atrophy syndrome, MIM# 615722 32275123 False 3 100;0;0 21.569 True ENSG00000175745 ENSG00000175745 HGNC:7975 NR4A2 gene NR4A2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 31922365 False 3 100;0;0 21.569 True ENSG00000153234 ENSG00000153234 HGNC:7981 NR4A2 gene NR4A2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 31922365 False 3 100;0;0 21.569 True ENSG00000153234 ENSG00000153234 HGNC:7981 NR4A2 gene NR4A2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 31428396;32366965 False 3 100;0;0 21.569 True ENSG00000153234 ENSG00000153234 HGNC:7981 NRDC gene NRDC Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, NRDC-related 41449824;28017472;34582790;19935654;41734767;41449824 False 3 50;50;0 21.569 True ENSG00000078618 ENSG00000078618 HGNC:7995 NRROS gene NRROS Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodegeneration;intracranial calcification;epilepsy 32100099;32197075 False 3 100;0;0 21.569 True ENSG00000174004 ENSG00000174004 HGNC:24613 NRROS gene NRROS Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodegeneration;intracranial calcification;epilepsy 32100099;32197075 False 3 100;0;0 21.569 True ENSG00000174004 ENSG00000174004 HGNC:24613 NRXN1 gene NRXN1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pitt-Hopkins-like syndrome 2 - MIM#614325 25486015;19896112;21964664;30873608;35101781;22337556;22670139 False 3 100;0;0 21.569 True ENSG00000179915 ENSG00000179915 HGNC:8008 NSD1 gene NSD1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Sotos syndrome 1 (MIM#117550), AD 16010675;15942875 False 3 100;0;0 21.569 True ENSG00000165671 ENSG00000165671 HGNC:14234 NSDHL gene NSDHL Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) CHILD syndrome MIM#308050;Disorders of sterol biosynthesis 27604308;10710235 False 3 100;0;0 21.569 True ENSG00000147383 ENSG00000147383 HGNC:13398 NSDHL gene NSDHL Expert Review Green;NHS GMS;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females CK syndrome (MIM#300831) 21129721;15689440;25900314 False 3 100;0;0 21.569 True ENSG00000147383 ENSG00000147383 HGNC:13398 NSF gene NSF Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 96, MIM# 619340;Seizures;EEG with burst suppression;Global developmental delay;Intellectual disability 31675180 False 3 100;0;0 21.569 True ENSG00000073969 ENSG00000073969 HGNC:8016 NSRP1 gene NSRP1 Expert Review Green;Literature;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy;Cerebral palsy;microcephaly;Intellectual disability 34385670 False 3 50;50;0 21.569 True ENSG00000126653 ENSG00000126653 HGNC:25305 NSUN3 gene NSUN3 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 48, MIM# 619012 27356879;32488845;40465263 False 3 33;67;0 21.569 True ENSG00000178694 ENSG00000178694 HGNC:26208 NT5C2 gene NT5C2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 45, autosomal recessive, MIM# 613162;MONDO:0013165 24482476;32153630;29123918;28884889;28327087 False 3 100;0;0 21.569 True ENSG00000076685 ENSG00000076685 HGNC:8022 NT5C3A gene NT5C3A Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Anemia, hemolytic, due to UMPH1 deficiency MIM#266120;disorder of pyrimidine metabolism 11369620;11369620 False 3 100;0;0 21.569 True ENSG00000122643 ENSG00000122643 HGNC:17820 NTRK1 gene NTRK1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary sensory and autonomic neuropathy type 4 MONDO:0009746 20301726;11310631 False 3 100;0;0 21.569 True ENSG00000198400 ENSG00000198400 HGNC:8031 NTRK1 gene NTRK1 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN 4;Insensitivity to pain, congenital, with anhidrosis, 256800;Hereditary sensory neuropathy type IV 11668614;8696348;18077166 False 3 0;0;0 21.569 False ENSG00000198400 ENSG00000198400 HGNC:8031 NTRK2 gene NTRK2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 58, MIM# 617830" 29100083 False 3 100;0;0 21.569 True ENSG00000148053 ENSG00000148053 HGNC:8032 NUBPL gene NUBPL Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency;Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000151413 ENSG00000151413 HGNC:20278 NUBPL gene NUBPL Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 21, OMIM # 618242 23553477;32518176 False 3 100;0;0 21.569 True ENSG00000151413 ENSG00000151413 HGNC:20278 NUBPL gene NUBPL Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 21 - MIM#618242 20818383;32518176;23553477;31917109;32518176;31787496;30897263;22826544 False 3 100;0;0 21.569 True ENSG00000151413 ENSG00000151413 HGNC:20278 NUDT2 gene NUDT2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular hypotonia;Global developmental delay;Intellectual disability;Polyneuropathy 33058507;27431290;30059600;33058507 False 3 100;0;0 21.569 True ENSG00000164978 ENSG00000164978 HGNC:8049 NUDT2 gene NUDT2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with or without peripheral neuropathy MIM#619844 27431290;30059600;33058507 False 3 100;0;0 21.569 True ENSG00000164978 ENSG00000164978 HGNC:8049 NUP214 gene NUP214 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, acute, infection-induced, susceptibility to, 9, MIM# 618426;epileptic encephalopathy;developmental regression;microcephaly 31178128;30758658 False 3 100;0;0 21.569 True ENSG00000126883 ENSG00000126883 HGNC:8064 NUS1 gene NUS1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder, autosomal dominant 55, with seizures, MIM# 617831;Parkinsonism;Developmental delay;Intellectual disability;Ataxia;Myoclonus" PMID: 32485575;30348779 False 3 100;0;0 21.569 True ENSG00000153989 ENSG00000153989 HGNC:21042 NUS1 gene NUS1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 55, with seizures, MIM# 617831 31656175;29100083 False 3 100;0;0 21.569 True ENSG00000153989 ENSG00000153989 HGNC:21042 NUS1 gene NUS1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Epilepsy, myoclonus, ataxia and scoliosis;Mental retardation, autosomal dominant 55, with seizures, 617831 PMID: 31656175;29100083 False 3 100;0;0 21.569 True ENSG00000153989 ENSG00000153989 HGNC:21042 OAT gene OAT Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gyrate atrophy of choroid and retina with or without ornithinemia - MIM#258870 33068755;1618792;2220818;3339136;3417397;2916581;1737786;33463379 False 3 100;0;0 21.569 True ENSG00000065154 ENSG00000065154 HGNC:8091 OBSCN gene OBSCN Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Rhabdomyolysis, MONDO:0005290, OBSCN-related PMID: 34957489 False 3 33;0;67 21.569 True ENSG00000154358 ENSG00000154358 HGNC:15719 OCLN gene OCLN Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pseudo-TORCH syndrome 1, MIM#251290 20727516;32240828;29192239;28386946 False 3 100;0;0 21.569 True ENSG00000197822 ENSG00000197822 HGNC:8104 OCLN gene OCLN Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pseudo-TORCH syndrome 1, MIM#251290 20727516;32240828;29192239;28386946 False 3 100;0;0 21.569 True ENSG00000197822 ENSG00000197822 HGNC:8104 OFD1 gene OFD1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 10 False 3 100;0;0 21.569 False ENSG00000046651 ENSG00000046651 HGNC:2567 OGDH gene OGDH Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Oxoglutarate dehydrogenase deficiency, MIM# 203740;Developmental delay;ataxia;seizure;raised lactate 32383294 False 3 50;50;0 21.569 True ENSG00000105953 ENSG00000105953 HGNC:8124 OGDHL gene OGDHL Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Yoon-Bellen neurodevelopmental syndrome, MIM# 619701;Neurodevelopmental disorder featuring epilepsy, hearing loss, visual impairment, and ataxia 34800363 False 3 100;0;0 21.569 True ENSG00000197444 ENSG00000197444 HGNC:25590 OGT gene OGT Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Mental retardation, X-linked 106, MIM# 300997" 28302723;28584052;31296563;31627256;29769320;29606577 False 3 100;0;0 21.569 True ENSG00000147162 ENSG00000147162 HGNC:8127 OPA1 gene OPA1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal OPA1-related optic atrophy with or without extraocular features, MONDO:0800181 30165240;28494813 False 3 100;0;0 21.569 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA1 gene OPA1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal OPA1-related optic atrophy with or without extraocular features, MONDO:0800181 30165240 False 3 100;0;0 21.569 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA1 gene OPA1 Expert Review Green;Literature;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted optic atrophy with or without deafness, ophthalmoplegia, myopathy, ataxia, and neuropathy MONDO:0007429 30165240;20301426 False 3 50;50;0 21.569 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA1 gene OPA1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Optic atrophy plus syndrome (MIM#125250) 16240368;18065439;20157015;21112924 False 3 100;0;0 21.569 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA3 gene OPA3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III (MGA3) (MIM#258501), AR;Optic atrophy 3 with cataract (MIM#165300), AD 25159689;31119193;31928268 False 3 100;0;0 21.569 True ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, 258501;Optic atrophy 3 with cataract, 165300;3-methylglutaconic aciduria type III, 258501;Costeff syndrome False 3 100;0;0 21.569 False ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "3-methylglutaconic aciduria, type III, MIM# 258501" False 3 100;0;0 21.569 True ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, MIM# 258501;developmental delay, hypotonia;dystonia and chorea;ataxia, optic atrophy;spastic paraplegia 20301646;7510656;2494568;11668429 False 3 100;0;0 21.569 True ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Optic atrophy 3 MONDO:0008133 31119193;28050599 False 3 100;0;0 21.569 True Other ENSG00000125741 ENSG00000125741 HGNC:8142 OPHN1 gene OPHN1 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked mental retardation with cerebellar hypoplasia and distinctive facial appearance, 300486;Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 False 3 100;0;0 21.569 True ENSG00000079482 ENSG00000079482 HGNC:8148 OPHN1 gene OPHN1 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, MIM#300486 20528889;9582072;12807966;16221952 False 3 100;0;0 21.569 True ENSG00000079482 ENSG00000079482 HGNC:8148 OPTN gene OPTN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MONDO: 0013264, MIM#613435) 20428114;31838784;27493188 False 3 100;0;0 21.569 True ENSG00000123240 ENSG00000123240 HGNC:17142 OPTN gene OPTN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MIM#613435) 31838784;20428114;20301623 False 3 100;0;0 21.569 True ENSG00000123240 ENSG00000123240 HGNC:17142 ORAI1 gene ORAI1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, tubular aggregate, 2 (MIM#615883) 31448844 False 3 33;67;0 21.569 True ENSG00000182500 ENSG00000276045 HGNC:25896 OSGEP gene OSGEP Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 3, MIM#617729 PMID: 28805828;33333793 False 3 100;0;0 21.569 True ENSG00000092094 ENSG00000092094 HGNC:18028 OTUD6B gene OTUD6B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies, OMIM #617452 28343629;32924626;31147255 False 3 100;0;0 21.569 True ENSG00000155100 ENSG00000155100 HGNC:24281 OTUD7A gene OTUD7A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia and seizures, MIM# 620790 31997314;29395075;29395074;33381903;36180924;41028987 False 3 25;50;25 21.569 True ENSG00000169918 ENSG00000169918 HGNC:20718 OXA1L gene OXA1L Expert Review Green;NHS GMS;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal OXA1L-related combined oxidative phosphorylation deficiency MONDO:0000732 30201738;40551575;16435202 False 3 50;50;0 21.569 True ENSG00000155463 ENSG00000155463 HGNC:8526 OXCT1 gene OXCT1 Expert Review Green;Expert Review Green;Literature;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinyl CoA:3-oxoacid CoA transferase deficiency MIM#245050 25778941;10964512;8751852;23420214 False 3 100;0;0 21.569 True ENSG00000083720 ENSG00000083720 HGNC:8527 OXCT1 gene OXCT1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinyl CoA:3-oxoacid CoA transferase deficiency MIM#245050 8751852;10964512;28178565;11757586;8844009 False 3 100;0;0 21.569 True ENSG00000083720 ENSG00000083720 HGNC:8527 OXR1 gene OXR1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebellar hypoplasia/atrophy, epilepsy, and global developmental delay, MIM# 213000" 31785787;22028674 False 3 100;0;0 21.569 True ENSG00000164830 ENSG00000164830 HGNC:15822 P4HTM gene P4HTM Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypotonia, hypoventilation, impaired intellectual development, dysautonomia, epilepsy, and eye abnormalities;OMIM #618493 25078763;30940925 False 3 100;0;0 21.569 True ENSG00000178467 ENSG00000178467 HGNC:28858 PABPC1 gene PABPC1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, PABPC1-related (MONDO#0700092) 35511136 False 3 100;0;0 21.569 True ENSG00000070756 ENSG00000070756 HGNC:8554 PABPN1 gene PABPN1 Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal oculopharyngeal muscular dystrophy MONDO:0008116 19080757;33805441;16648376 False 3 100;0;0 21.569 True ENSG00000100836 ENSG00000100836 HGNC:8565 PACS1 gene PACS1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Schuurs-Hoeijmakers syndrome (MIM# 615009) 26842493;23159249 False 3 100;0;0 21.569 True ENSG00000175115 ENSG00000175115 HGNC:30032 PACS2 gene PACS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 66 - MIM#618067 29656858;34894068;34859793 False 3 100;0;0 21.569 True ENSG00000179364 ENSG00000179364 HGNC:23794 PAFAH1B1 gene PAFAH1B1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lissencephaly 1, MIM# 607432;Subcortical laminar heterotopia, MIM# 607432;MONDO:0011830 11754098;18285425 False 3 100;0;0 21.569 True ENSG00000007168 ENSG00000007168 HGNC:8574 PAFAH1B1 gene PAFAH1B1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Lissencephaly 1, MIM# 607432;Subcortical laminar heterotopia, MIM# 607432;MONDO:0011830" 31370080;30568308;20301752 False 3 100;0;0 21.569 True ENSG00000007168 ENSG00000007168 HGNC:8574 PAH gene PAH Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phenylketonuria MIM#261600;Disorders of phenylalanine or tyrosine metabolism 27604308;3008810 False 3 100;0;0 21.569 True ENSG00000171759 ENSG00000171759 HGNC:8582 PAH gene PAH Expert Review Green;NHS GMS;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phenylketonuria, MIM#261600 False 3 100;0;0 21.569 True ENSG00000171759 ENSG00000171759 HGNC:8582 PAH gene PAH Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phenylketonuria, [Hyperphenylalaninemia, non-PKU mild], 261600 31636599;32141105 False 3 100;0;0 21.569 False ENSG00000171759 ENSG00000171759 HGNC:8582 PAH gene PAH Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phenylketonuria MIM#261600 PMID: 25614310, PMID: 15390012, PMID: 30369906 False 3 100;0;0 21.569 True ENSG00000171759 ENSG00000171759 HGNC:8582 PAK1 gene PAK1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with macrocephaly, seizures, and speech delay (MIM 618158) 30290153;31504246 False 3 100;0;0 21.569 True ENSG00000149269 ENSG00000149269 HGNC:8590 PAM16 gene PAM16 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive spondylometaphyseal dysplasia, Megarbane type MONDO:0013223;Disorders of mitochondrial protein import 29884839;24786642;35385740;36438081;27354339 False 3 100;0;0 21.569 True ENSG00000217930 ENSG00000217930 HGNC:29679 PANK2 gene PANK2 Expert Review Green;NHS GMS;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HARP syndrome MIM#607236;Neurodegeneration with brain iron accumulation 1 MIM#234200 25778941;11479594;12510040;28863176 False 3 100;0;0 21.569 True ENSG00000125779 ENSG00000125779 HGNC:15894 PANK2 gene PANK2 GeneReviews;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pantothenate kinase-associated neurodegeneration (PKAN) False 3 100;0;0 21.569 False ENSG00000125779 ENSG00000125779 HGNC:15894 PANK2 gene PANK2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pantothenate kinase-associated neurodegeneration MONDO:0009319 23447832;20301663 False 3 0;0;0 21.569 True ENSG00000125779 ENSG00000125779 HGNC:15894 PANK2 gene PANK2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 1 (MIM#234200) 24600523;23447832;19480328 False 3 100;0;0 21.569 True ENSG00000125779 ENSG00000125779 HGNC:15894 PANK2 gene PANK2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pantothenate kinase-associated neurodegeneration MONDO:0009319;Dystonia 15911822 False 3 100;0;0 21.569 True ENSG00000125779 ENSG00000125779 HGNC:15894 PARK7 gene PARK7 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 21.569 False ENSG00000116288 ENSG00000116288 HGNC:16369 PARK7 gene PARK7 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive early-onset Parkinson disease 7 MONDO:0011658 20301402 False 3 100;0;0 21.569 True ENSG00000116288 ENSG00000116288 HGNC:16369 PARK7 gene PARK7 Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Parkinson disease 7, autosomal recessive early-onset MIM#606324" 29644727 False 3 100;0;0 21.569 False ENSG00000116288 ENSG00000116288 HGNC:16369 PARP6 gene PARP6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;Epilepsy;Microcephaly 34067418 False 3 100;0;0 21.569 True ENSG00000137817 ENSG00000137817 HGNC:26921 PARS2 gene PARS2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 75, MIM# 618437" 29410512;28077841;25629079;29915213 False 3 100;0;0 21.569 True ENSG00000162396 ENSG00000162396 HGNC:30563 PARS2 gene PARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 75, MIM# 618437 29410512;28077841;25629079;29915213 False 3 100;0;0 21.569 True ENSG00000162396 ENSG00000162396 HGNC:30563 PC gene PC Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyruvate carboxylase deficiency, MIM#266150 False 3 100;0;0 21.569 True ENSG00000173599 ENSG00000173599 HGNC:8636 PC gene PC Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Pyruvate carboxylase deficiency, MIM# 266150" False 3 100;0;0 21.569 True ENSG00000173599 ENSG00000173599 HGNC:8636 PCCA gene PCCA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Propionicacidemia, MIM# 606054" 30879957 False 3 100;0;0 21.569 True ENSG00000175198 ENSG00000175198 HGNC:8653 PCCA gene PCCA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Propionicacidemia - MIM#606054 17966092;10101253;9887338 False 3 100;0;0 21.569 True ENSG00000175198 ENSG00000175198 HGNC:8653 PCCB gene PCCB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Propionicacidemia - MIM#606054 7386459;9683601;10502773 False 3 100;0;0 21.569 True ENSG00000114054 ENSG00000114054 HGNC:8654 PCCB gene PCCB Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Propionicacidemia, MIM# 606054" 30879957 False 3 100;0;0 21.569 True ENSG00000114054 ENSG00000114054 HGNC:8654 PCDH12 gene PCDH12 Expert Review Green;Royal Melbourne Hospital;GeneReviews;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280 27164683;30178464;30459466 False 3 50;0;50 21.569 True ENSG00000113555 ENSG00000113555 HGNC:8657 PCDH12 gene PCDH12 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Diencephalic-mesencephalic junction dysplasia syndrome 1, MIM# 251280 28804758;34773825;30178464 False 3 100;0;0 21.569 True ENSG00000113555 ENSG00000113555 HGNC:8657 PCDH19 gene PCDH19 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders Other Epileptic encephalopathy, early infantile, 9 300088;PCDH19-related epilepsy (early seizure onset, generalised or focused seizures);cognitive impairment 18469813;30287595 False 3 100;0;0 21.569 True ENSG00000165194 ENSG00000165194 HGNC:14270 PCDHGC4 gene PCDHGC4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with poor growth and skeletal anomalies, MIM# 619880 34244665 False 3 100;0;0 21.569 True ENSG00000242419 ENSG00000242419 HGNC:8717 PCK1 gene PCK1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phosphoenolpyruvate carboxykinase deficiency, cytosolic MIM#261680;Disorders of gluconeogenesis 24863970;28216384;26971250;27604308 False 3 100;0;0 21.569 True ENSG00000124253 ENSG00000124253 HGNC:8724 PCNT gene PCNT Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephalic osteodysplastic primordial dwarfism, type II 210720;Moyamoya disease 15368497;34978779;19839044;37234811;34923567 False 3 50;50;0 21.569 True ENSG00000160299 ENSG00000160299 HGNC:16068 PCYT2 gene PCYT2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy 31637422 False 3 100;0;0 21.569 True ENSG00000185813 ENSG00000185813 HGNC:8756 PCYT2 gene PCYT2 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal intellectual disability;regression;spastic para-/tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy 31637422 False 3 50;0;50 21.569 True ENSG00000185813 ENSG00000185813 HGNC:8756 PDCD10 gene PDCD10 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebral cavernous malformations-3 MIM#603285 25354366;26246098 False 3 50;50;0 21.569 True ENSG00000114209 ENSG00000114209 HGNC:8761 PDCD10 gene PDCD10 Expert Review Green;Genomics England PanelApp;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebral Cavernous Malformations;Cerebral cavernous malformations 3;Cerebral cavernous malformations 3, 603285;Cerebral Cavernous Malformation;Familial Cerebral Cavernous Malformation 15543491;20301470 False 3 100;0;0 21.569 False Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000114209 ENSG00000114209 HGNC:8761 PDE10A gene PDE10A Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Early onset chorea without epilepsy;infantile onset limb and orofacial dyskinesia (OMIM 616921) PMID 27058447 False 3 100;0;0 21.569 False ENSG00000112541 ENSG00000112541 HGNC:8772 PDE12 gene PDE12 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease MONDO:0044970, PDE12-related PMID: 39567835 False 3 100;0;0 21.569 True ENSG00000174840 ENSG00000174840 HGNC:25386 PDE1B gene PDE1B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related 40492975 False 3 100;0;0 21.569 True ENSG00000123360 ENSG00000123360 HGNC:8775 PDE1B gene PDE1B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related 40492975 False 3 100;0;0 21.569 True ENSG00000123360 ENSG00000123360 HGNC:8775 PDE2A gene PDE2A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder with paroxysmal dyskinesia or seizures MIM#619150" 32467598;32196122;37317634 False 3 50;50;0 21.569 True ENSG00000186642 ENSG00000186642 HGNC:8777 PDE8B gene PDE8B Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Striatal degeneration, autosomal dominant, MIM#609161 20085714;26769607;26475694 False 3 100;0;0 21.569 True ENSG00000113231 ENSG00000113231 HGNC:8794 PDGFB gene PDGFB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5, MIM# 615483 23913003 False 3 100;0;0 21.569 True ENSG00000100311 ENSG00000100311 HGNC:8800 PDGFB gene PDGFB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5 , MIM#615483 23913003;30952898;30609140 False 3 100;0;0 21.569 True ENSG00000100311 ENSG00000100311 HGNC:8800 PDGFB gene PDGFB Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5 615483 False 3 100;0;0 21.569 False ENSG00000100311 ENSG00000100311 HGNC:8800 PDGFRB gene PDGFRB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 4, MIM# 615007;MONDO:0014004 31004414;30979360;32613555;34494111 False 3 100;0;0 21.569 True ENSG00000113721 ENSG00000113721 HGNC:8804 PDGFRB gene PDGFRB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 4, MIM# 615007 23255827;30979360 False 3 100;0;0 21.569 True ENSG00000113721 ENSG00000113721 HGNC:8804 PDGFRB gene PDGFRB Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted aneurysm;scoliosis;atrophic skin;stroke;infantile myofibromatosis False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000113721 ENSG00000113721 HGNC:8804 PDHA1 gene PDHA1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Pyruvate dehydrogenase E1-alpha deficiency - MIM#312170 8504309 False 3 100;0;0 21.569 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDHA1 gene PDHA1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Primary Pyruvate Dehydrogenase Complex Deficiency MIM 312170 36693417;33661577 False 3 100;0;0 21.569 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDHA1 gene PDHA1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Pyruvate dehydrogenase E1-alpha deficiency MIM#312170 20002125 False 3 100;0;0 21.569 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDHA1 gene PDHA1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Pyruvate dehydrogenase E1-alpha deficiency - MIM#312170 8504309 False 3 100;0;0 21.569 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDHB gene PDHB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase E1-beta deficiency - MIM#614111 False 3 100;0;0 21.569 True ENSG00000168291 ENSG00000168291 HGNC:8808 PDHX gene PDHX Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lactic acidaemia due to PDX1 deficiency MIM#245349 20002125;34873726;33092611;30981218;25087164;22766002 False 3 100;0;0 21.569 True ENSG00000110435 ENSG00000110435 HGNC:21350 PDHX gene PDHX Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lactic acidaemia due to PDX1 deficiency MIM#245349 20002125;34873726;33092611;30981218;25087164;22766002 False 3 100;0;0 21.569 True ENSG00000110435 ENSG00000110435 HGNC:21350 PDHX gene PDHX Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lacticacidemia due to PDX1 deficiency MIM#245349" 20002125;16566017;17152059 False 3 100;0;0 21.569 True ENSG00000110435 ENSG00000110435 HGNC:21350 PDK3 gene PDK3 Expert list;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Charcot-Marie-Tooth disease, X-linked dominant, 6, MIM# 300905 23297365;28902413;26801680 False 3 100;0;0 21.569 True ENSG00000067992 ENSG00000067992 HGNC:8811 PDK3 gene PDK3 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Charcot-Marie-Tooth disease, X-linked dominant, 6 MIM#300905;HMSN 23297365;26801680;27388934;28902413 False 3 100;0;0 21.569 False ENSG00000067992 ENSG00000067992 HGNC:8811 PDP1 gene PDP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase phosphatase deficiency - MIM#608782 31392110;19184109;15855260 False 3 100;0;0 21.569 True ENSG00000164951 ENSG00000164951 HGNC:9279 PDSS1 gene PDSS1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 2 MIM#614651 17332895;22494076;33285023 False 3 100;0;0 21.569 True ENSG00000148459 ENSG00000148459 HGNC:17759 PDSS2 gene PDSS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 3 MIM#614652 29032433;25349199;17186472;21723727;10972372 False 3 100;0;0 21.569 True ENSG00000164494 ENSG00000164494 HGNC:23041 PDXK gene PDXK Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Axonal polyneuropathy;optic atrophy 32522499;31187503;27604308 False 3 50;50;0 21.569 True ENSG00000160209 ENSG00000160209 HGNC:8819 PDXK gene PDXK Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary motor and sensory, type VIC, with optic atrophy MIM#618511;Disorders of pyridoxine metabolism 32522499;31187503;27604308 False 3 100;0;0 21.569 True ENSG00000160209 ENSG00000160209 HGNC:8819 PDYN gene PDYN Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23 (MIM#610245);Cerebellar ataxia, sensory-motor axonal neuropathy;Spinocerebellar ataxia 23 21035104 False 3 50;50;0 21.569 True ENSG00000101327 ENSG00000101327 HGNC:8820 PDYN gene PDYN Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245 False 3 100;0;0 21.569 False ENSG00000101327 ENSG00000101327 HGNC:8820 PEPD gene PEPD Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Prolidase deficiency MIM#170100;disorders of peptide metabolism 27604308;2365824 False 3 100;0;0 21.569 True ENSG00000124299 ENSG00000124299 HGNC:8840 PET100 gene PET100 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055 24462369;25293719;31406627 False 3 100;0;0 21.569 True ENSG00000229833 ENSG00000229833 HGNC:40038 PET100 gene PET100 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 12, MIM# 619055 24462369;25293719;31406627 False 3 100;0;0 21.569 True ENSG00000229833 ENSG00000229833 HGNC:40038 PEX1 gene PEX1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 1A (Zellweger) 214100 26387595 False 3 100;0;0 21.569 True ENSG00000127980 ENSG00000127980 HGNC:8850 PEX1 gene PEX1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 1B (NALD/IRD), 601539 False 3 0;0;0 21.569 False ENSG00000127980 ENSG00000127980 HGNC:8850 PEX1 gene PEX1 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000127980 ENSG00000127980 HGNC:8850 PEX10 gene PEX10 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Failure to thrive, facial dimorphism, agenesis of the corpus callosum, death in first year of life, axonal motor neuropathy, progressive ataxia and sensory-motor axonal neuropathy in adulthood described 27230853;20695019 False 3 100;0;0 21.569 True ENSG00000157911 ENSG00000157911 HGNC:8851 PEX10 gene PEX10 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 6A (Zellweger), MIM#614870 32069232 False 3 50;0;50 21.569 True ENSG00000157911 ENSG00000157911 HGNC:8851 PEX10 gene PEX10 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 6B, 614871 False 3 0;0;0 21.569 False ENSG00000157911 ENSG00000157911 HGNC:8851 PEX10 gene PEX10 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000157911 ENSG00000157911 HGNC:8851 PEX11B gene PEX11B Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Peroxisome biogenesis disorder 14B, 614920 False 3 0;0;0 21.569 False ENSG00000131779 ENSG00000131779 HGNC:8853 PEX11B gene PEX11B Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 14B - MIM#614920 20301621;22581968;38423277;31724321;28129423 False 3 100;0;0 21.569 True ENSG00000131779 ENSG00000131779 HGNC:8853 PEX12 gene PEX12 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 3A, 614859;Peroxisome biogenesis disorder 3B, 266510 False 3 0;0;0 21.569 False ENSG00000108733 ENSG00000108733 HGNC:8854 PEX12 gene PEX12 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 3A (Zellweger), 614859;HMSN 24627108;33123925 False 3 100;0;0 21.569 True ENSG00000108733 ENSG00000108733 HGNC:8854 PEX12 gene PEX12 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000108733 ENSG00000108733 HGNC:8854 PEX12 gene PEX12 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 3A (Zellweger) - MIM#614859;Peroxisome biogenesis disorder 3B - MIM#266510 False 3 100;0;0 21.569 True ENSG00000108733 ENSG00000108733 HGNC:8854 PEX13 gene PEX13 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 11A (Zellweger) 19449432;37962062;34055681;37962062;30919572;33547378;35854306 False 3 100;0;0 21.569 True ENSG00000162928 ENSG00000162928 HGNC:8855 PEX13 gene PEX13 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 11B, 614885;Peroxisome biogenesis disorder 11A (Zellweger), 614883 False 3 0;0;0 21.569 False ENSG00000162928 ENSG00000162928 HGNC:8855 PEX13 gene PEX13 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000162928 ENSG00000162928 HGNC:8855 PEX14 gene PEX14 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal peroxisome biogenesis disorder due to PEX14 defect MONDO:0100268 37493040 False 3 100;0;0 21.569 True ENSG00000142655 ENSG00000142655 HGNC:8856 PEX14 gene PEX14 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 13A (Zellweger), 614887 False 3 0;0;0 21.569 False ENSG00000142655 ENSG00000142655 HGNC:8856 PEX16 gene PEX16 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 8A (Zellweger), 614876;Peroxisome biogenesis disorder 8B, 614877 False 3 0;0;0 21.569 False ENSG00000121680 ENSG00000121680 HGNC:8857 PEX16 gene PEX16 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Zellweger syndrome (614876);Peroxisome biogenesis disorder 8B (#614877) infantile progressive ataxia and spastic paresis;Peroxisome biogenesis disorder 8A, 614876;Peroxisome biogenesis disorder 8B, 614877 False 3 100;0;0 21.569 False ENSG00000121680 ENSG00000121680 HGNC:8857 PEX16 gene PEX16 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000121680 ENSG00000121680 HGNC:8857 PEX19 gene PEX19 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 12A (Zellweger), 614886 False 3 0;0;0 21.569 False ENSG00000162735 ENSG00000162735 HGNC:9713 PEX19 gene PEX19 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 12A (Zellweger) - MIM#614886 10051604;20683989;11883941;28391327;39757991;36931687;29282281 False 3 100;0;0 21.569 True ENSG00000162735 ENSG00000162735 HGNC:9713 PEX19 gene PEX19 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 12A (Zellweger) - MIM#614886 10051604;20683989;11883941;28391327 False 3 100;0;0 21.569 True ENSG00000162735 ENSG00000162735 HGNC:9713 PEX2 gene PEX2 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000164751 ENSG00000164751 HGNC:9717 PEX2 gene PEX2 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 5B, 614867;Peroxisome biogenesis disorder 5A (Zellweger) 614866 False 3 0;0;0 21.569 False ENSG00000164751 ENSG00000164751 HGNC:9717 PEX2 gene PEX2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 5A (Zellweger), MIM#614866 14630978;23430938;17041890 False 3 50;50;0 21.569 True ENSG00000164751 ENSG00000164751 HGNC:9717 PEX26 gene PEX26 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 7A (Zellweger), MIM#614872 34430430;28823628 False 3 50;50;0 21.569 True ENSG00000215193 ENSG00000215193 HGNC:22965 PEX26 gene PEX26 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000215193 ENSG00000215193 HGNC:22965 PEX26 gene PEX26 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 7A (Zellweger), 614872;Peroxisome biogenesis disorder 7B, 614873 False 3 0;0;0 21.569 False ENSG00000215193 ENSG00000215193 HGNC:22965 PEX3 gene PEX3 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000034693 ENSG00000034693 HGNC:8858 PEX3 gene PEX3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 10A (Zellweger), MIM# 614882;Peroxisome biogenesis disorder 10B , MIM# 617370 10942428;10958759;10968777;27557811;33101983 False 3 100;0;0 21.569 True ENSG00000034693 ENSG00000034693 HGNC:8858 PEX3 gene PEX3 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 10A (Zellweger), 614882;?Peroxisome biogenesis disorder 10B, 617370 False 3 0;0;0 21.569 False ENSG00000034693 ENSG00000034693 HGNC:8858 PEX5 gene PEX5 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 2A (Zellweger), 214110;Peroxisome biogenesis disorder 2B, 202370 False 3 0;0;0 21.569 False ENSG00000139197 ENSG00000139197 HGNC:9719 PEX5 gene PEX5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 2A (Zellweger), MIM# 214110;Peroxisome biogenesis disorder 2B, MIM# 202370 7719337;26220973;20301621 False 3 100;0;0 21.569 True ENSG00000139197 ENSG00000139197 HGNC:9719 PEX5 gene PEX5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 2A (Zellweger), MIM# 214110;Peroxisome biogenesis disorder 2B, MIM# 202370;Rhizomelic chondrodysplasia punctata, type 5, MIM# 616716 7719337;26220973;20301621 False 3 100;0;0 21.569 True ENSG00000139197 ENSG00000139197 HGNC:9719 PEX6 gene PEX6 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Peroxisome biogenesis disorder 4A (Zellweger), MIM# 614862" 29220678 False 3 50;0;50 21.569 True ENSG00000124587 ENSG00000124587 HGNC:8859 PEX6 gene PEX6 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000124587 ENSG00000124587 HGNC:8859 PEX6 gene PEX6 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Peroxisome biogenesis disorder 4A (Zellweger), 614862;Peroxisome biogenesis disorder 4B, 614863 False 3 0;0;0 21.569 False ENSG00000124587 ENSG00000124587 HGNC:8859 PEX7 gene PEX7 Expert Review Green;Royal Melbourne Hospital;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum disease;Peroxisome biogenesis disorder 9B, MIM#614879 False 3 100;0;0 21.569 True ENSG00000112357 ENSG00000112357 HGNC:8860 PEX7 gene PEX7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 9B, MIM# 614879 11781871;12522768;12325024 False 3 100;0;0 21.569 True ENSG00000112357 ENSG00000112357 HGNC:8860 PEX7 gene PEX7 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 9B, MIM# 614879;Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100 11781871;12522768;12325024 False 3 100;0;0 21.569 True ENSG00000112357 ENSG00000112357 HGNC:8860 PEX7 gene PEX7 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 9B, 614879 False 3 0;0;0 21.569 False ENSG00000112357 ENSG00000112357 HGNC:8860 PFKM gene PFKM Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease VII, MIM# 232800 2140573;8444874;7513946;7550225 False 3 100;0;0 21.569 True ENSG00000152556 ENSG00000152556 HGNC:8877 PFKM gene PFKM Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease VII (MIM#232800) 24427140;27066546;30792690 False 3 100;0;0 21.569 True ENSG00000152556 ENSG00000152556 HGNC:8877 PFN1 gene PFN1 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 67;33;0 21.569 False ENSG00000108518 ENSG00000108518 HGNC:8881 PGAM2 gene PGAM2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease X, MIM# 261670 8447317;34237446;30310767 False 3 100;0;0 21.569 True ENSG00000164708 ENSG00000164708 HGNC:8889 PGAM2 gene PGAM2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease X, MIM# 261670 8447317 False 3 100;0;0 21.569 True ENSG00000164708 ENSG00000164708 HGNC:8889 PGAP2 gene PGAP2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 3, MIM# 614207, MONDO:0013628 23561846;23561847;31805394;29119105;27871432 False 3 100;0;0 21.569 True ENSG00000148985 ENSG00000148985 HGNC:17893 PGAP3 gene PGAP3 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 4, MIM# 615716, MONDO:0014318 24439110;29620724;30345601;30217754 False 3 100;0;0 21.569 True ENSG00000161395 ENSG00000161395 HGNC:23719 PGAP3 gene PGAP3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 4, MIM# 615716, MONDO:0014318 24439110;29620724;30345601;30217754 False 3 100;0;0 21.569 True ENSG00000161395 ENSG00000161395 HGNC:23719 PGBD5 gene PGBD5 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482" 41533792 False 3 100;0;0 21.569 True ENSG00000177614 ENSG00000177614 HGNC:19405 PGBD5 gene PGBD5 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482" 41533792 False 3 100;0;0 21.569 True ENSG00000177614 ENSG00000177614 HGNC:19405 PGK1 gene PGK1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Phosphoglycerate kinase 1 deficiency, MIM# 300653;MONDO:0010392 6933565;1547346;7577653;9512313 False 3 100;0;0 21.569 True ENSG00000102144 ENSG00000102144 HGNC:8896 PGK1 gene PGK1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Phosphoglycerate kinase 1 deficiency 300653;MONDO:0010392 6933565;1547346;7577653;9512313 False 3 100;0;0 21.569 True ENSG00000102144 ENSG00000102144 HGNC:8896 PGK1 gene PGK1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Phosphoglycerate kinase 1 deficiency, MIM# 300653;Haemolytic anaemia;Rhabdomyolysis;Myopathy;Juvenile Parkinsonism;OMIM 300653 PMID: 30975619 False 3 100;0;0 21.569 True ENSG00000102144 ENSG00000102144 HGNC:8896 PGM1 gene PGM1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type It 614921;Glycogen storage disorder XIV 19625727;24499211 False 3 100;0;0 21.569 True ENSG00000079739 ENSG00000079739 HGNC:8905 PGM1 gene PGM1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type It 614921 24499211 False 3 100;0;0 21.569 True ENSG00000079739 ENSG00000079739 HGNC:8905 PGM1 gene PGM1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type It, MIM# 614921 31563034;26303607;24878975;27206562;29858906;32681750;19625727;24499211 False 3 100;0;0 21.569 True ENSG00000079739 ENSG00000079739 HGNC:8905 PGM2L1 gene PGM2L1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, PGM2L1-related 33979636 False 3 100;0;0 21.569 True ENSG00000165434 ENSG00000165434 HGNC:20898 PGM3 gene PGM3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 23, MIM# 615816;PGM3-CDG, MONDO:0014353 30578875;31231132;33098103;30157810;28704707 False 3 100;0;0 21.569 True ENSG00000013375 ENSG00000013375 HGNC:8907 PHACTR1 gene PHACTR1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 70, MIM# 618298" 23033978;30256902 False 3 100;0;0 21.569 True ENSG00000112137 ENSG00000112137 HGNC:20990 PHF6 gene PHF6 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Borjeson-Forssman-Lehmann syndrome MIM#301900" 32399860 False 3 100;0;0 21.569 True ENSG00000156531 ENSG00000156531 HGNC:18145 PHGDH gene PHGDH Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neu-Laxova syndrome 1 256520;Phosphoglycerate dehydrogenase deficiency 601815 24836451;25152457;11055895;19235232 False 3 100;0;0 21.569 True ENSG00000092621 ENSG00000092621 HGNC:8923 PHGDH gene PHGDH Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neu-Laxova syndrome 1, MIM# 256520;Phosphoglycerate dehydrogenase deficiency, MIM# 601815 24836451;25152457;11055895;19235232 False 3 100;0;0 21.569 True ENSG00000092621 ENSG00000092621 HGNC:8923 PHKA1 gene PHKA1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Muscle glycogenosis, MIM# 300559 7874115;12825073;9731190 False 3 100;0;0 21.569 True ENSG00000067177 ENSG00000067177 HGNC:8925 PHKA1 gene PHKA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Muscle glycogenosis, MIM# 300559 7874115;12825073;9731190 False 3 100;0;0 21.569 True ENSG00000067177 ENSG00000067177 HGNC:8925 PHKA2 gene PHKA2 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 21.569 False ENSG00000044446 ENSG00000044446 HGNC:8926 PHKB gene PHKB Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phosphorylase kinase deficiency of liver and muscle, autosomal recessive 261750;Glycogen storage disease IXb, MONDO:0009868 9215682;25266922;30659246 False 3 100;0;0 21.569 True ENSG00000102893 ENSG00000102893 HGNC:8927 PHKG2 gene PHKG2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IXc, MIM# 613027 8896567;9384616;10905889 False 3 100;0;0 21.569 True ENSG00000156873 ENSG00000156873 HGNC:8931 PHYH gene PHYH Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum disease, MIM# 266500 9326939;9326940 False 3 100;0;0 21.569 True ENSG00000107537 ENSG00000107537 HGNC:8940 PHYH gene PHYH Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum Disease MIM#266500 2433405;20301527 False 3 50;50;0 21.569 True ENSG00000107537 ENSG00000107537 HGNC:8940 PHYH gene PHYH Expert Review Green;Royal Melbourne Hospital;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Refsum disease, MIM# 266500" False 3 100;0;0 21.569 True ENSG00000107537 ENSG00000107537 HGNC:8940 PI4K2A gene PI4K2A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hyperkinetic movements, seizures and structural brain abnormalities, MIM# 620732 30564627;35880319;19581584 False 3 100;0;0 21.569 True ENSG00000155252 ENSG00000155252 HGNC:30031 PI4KA gene PI4KA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental syndrome with hypomyelinating leukodystrophy;Spastic paraplegia 84, autosomal recessive, MIM# 619621 PMID: 34415322 False 3 100;0;0 21.569 True ENSG00000241973 ENSG00000241973 HGNC:8983 PI4KA gene PI4KA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental syndrome with hypomyelinating leukodystrophy PMID: 34415322 False 3 100;0;0 21.569 True ENSG00000241973 ENSG00000241973 HGNC:8983 PIDD1 gene PIDD1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 75, with neuropsychiatric features and variant lissencephaly, MIM# 619827 28397838;29302074;33414379;34163010 False 3 100;0;0 21.569 True ENSG00000177595 ENSG00000177595 HGNC:16491 PIGA gene PIGA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466;Neurodevelopmental disorder with epilepsy and haemochromatosis, MIM# 301072 22305531;24357517;24706016;26545172;33333793;32694024;34875027 False 3 100;0;0 21.569 True ENSG00000165195 ENSG00000165195 HGNC:8957 PIGA gene PIGA Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Neurodevelopmental disorder with epilepsy and hemochromatosis, MIM# 301072 34875027 False 3 100;0;0 21.569 True ENSG00000165195 ENSG00000165195 HGNC:8957 PIGA gene PIGA Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Multiple congenital anomalies-hypotonia-seizures syndrome 2, MIM# 300868, MONDO:0010466 22305531;24357517;24706016;26545172;33333793;32694024 False 3 100;0;0 21.569 True ENSG00000165195 ENSG00000165195 HGNC:8957 PIGB gene PIGB Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Developmental and epileptic encephalopathy 80 618580" 31256876 False 3 100;0;0 21.569 True ENSG00000069943 ENSG00000069943 HGNC:8959 PIGB gene PIGB Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 80, MIM# 618580 31256876 False 3 100;0;0 21.569 True ENSG00000069943 ENSG00000069943 HGNC:8959 PIGC gene PIGC Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 16, MIM# 617816 27694521;32707268 False 3 100;0;0 21.569 True ENSG00000135845 ENSG00000135845 HGNC:8960 PIGG gene PIGG Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with or without hypotonia, seizures, and cerebellar atrophy MIM#616917" 26996948 False 3 100;0;0 21.569 True ENSG00000174227 ENSG00000174227 HGNC:25985 PIGH gene PIGH Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010 33156547;29573052;29603516 False 3 100;0;0 21.569 True ENSG00000100564 ENSG00000100564 HGNC:8964 PIGH gene PIGH Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 17, MIM# 618010 29573052;29603516;33156547 False 3 100;0;0 21.569 True ENSG00000100564 ENSG00000100564 HGNC:8964 PIGK gene PIGK Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures, MIM# 618879" 32220290 False 3 100;0;0 21.569 True ENSG00000142892 ENSG00000142892 HGNC:8965 PIGK gene PIGK Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia and cerebellar atrophy, with or without seizures, MIM# 618879 32220290 False 3 100;0;0 21.569 True ENSG00000142892 ENSG00000142892 HGNC:8965 PIGL gene PIGL Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal CHIME syndrome, MIM# 280000, MONDO:0010221 22444671;31535386;30023290;29473937;28371479;25706356 False 3 100;0;0 21.569 True ENSG00000108474 ENSG00000108474 HGNC:8966 PIGM gene PIGM Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol deficiency, MIM# 610293;portal vein thrombosis;persistent absence seizures;macrocephaly;infantile-onset cerebrovascular thrombotic events;portal vein thrombosis;persistent absence seizures;macrocephaly;infantile-onset cerebrovascular thrombotic events 31445883;16767100;41782195;39912323;39425582;39119839 False 3 33;67;0 21.569 True ENSG00000143315 ENSG00000143315 HGNC:18858 PIGM gene PIGM Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glycosylphosphatidylinositol deficiency, MIM# 610293;portal vein thrombosis;persistent absence seizures;macrocephaly;infantile-onset cerebrovascular thrombotic events" 31445883;16767100;41782195;39912323;39425582;39119839 False 3 33;67;0 21.569 True ENSG00000143315 ENSG00000143315 HGNC:18858 PIGN gene PIGN Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple congenital anomalies-hypotonia-seizures syndrome 1, MIM# 614080, MONDO:0013563 21493957;24253414;26364997;26394714;33193741;32585529;29330547 False 3 100;0;0 21.569 True ENSG00000197563 ENSG00000197563 HGNC:8967 PIGN gene PIGN Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple congenital anomalies-hypotonia-seizures syndrome 1, MIM# 614080, MONDO:0013563 21493957;24253414;26364997;26394714;33193741;32585529;29330547 False 3 100;0;0 21.569 True ENSG00000197563 ENSG00000197563 HGNC:8967 PIGO gene PIGO Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 2, MIM# 614749, MONDO:0013882 22683086;31698102;28900819;28545593;28337824 False 3 100;0;0 21.569 True ENSG00000165282 ENSG00000165282 HGNC:23215 PIGO gene PIGO Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 2, MIM# 614749, MONDO:0013882 22683086;31698102;28900819;28545593;28337824 False 3 100;0;0 21.569 True ENSG00000165282 ENSG00000165282 HGNC:23215 PIGP gene PIGP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Developmental and epileptic encephalopathy 55, MIM# 617599" 31139695;32042915;28334793 False 3 100;0;0 21.569 True ENSG00000185808 ENSG00000185808 HGNC:3046 PIGP gene PIGP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 55, MIM# 617599 28334793;31139695;32042915 False 3 50;50;0 21.569 True ENSG00000185808 ENSG00000185808 HGNC:3046 PIGQ gene PIGQ Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Epileptic encephalopathy, early infantile, 77, MIM# 618548" 25558065;24463883;31148362;32588908 False 3 100;0;0 21.569 True ENSG00000007541 ENSG00000007541 HGNC:14135 PIGS gene PIGS Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glycosylphosphatidylinositol biosynthesis defect 18 618143" 30269814 False 3 100;0;0 21.569 True ENSG00000087111 ENSG00000087111 HGNC:14937 PIGS gene PIGS Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glycosylphosphatidylinositol biosynthesis defect 18 618143" 30269814, False 3 100;0;0 21.569 True ENSG00000087111 ENSG00000087111 HGNC:14937 PIGS gene PIGS Expert Review Green;Literature;Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 95, OMIM # 618143 30269814;33410539 False 3 100;0;0 21.569 True ENSG00000087111 ENSG00000087111 HGNC:14937 PIGT gene PIGT Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165 30976099;25943031;24906948;24906948;24906948;28728837;28728837;28728837 False 3 100;0;0 21.569 True ENSG00000124155 ENSG00000124155 HGNC:14938 PIGT gene PIGT Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Multiple congenital anomalies-hypotonia-seizures syndrome 3, MIM# 615398, MONDO:0014165" 30976099;25943031;24906948;24906948;24906948;28728837;28728837;28728837 False 3 100;0;0 21.569 True ENSG00000124155 ENSG00000124155 HGNC:14938 PIGV gene PIGV Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 1, MIM# 239300, MONDO:0009398 20802478;22315194;28817240;24129430 False 3 100;0;0 21.569 True ENSG00000060642 ENSG00000060642 HGNC:26031 PIGV gene PIGV Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphosphatasia with mental retardation syndrome 1, MIM# 239300, MONDO:0009398 20802478;22315194;28817240;24129430 False 3 100;0;0 21.569 True ENSG00000060642 ENSG00000060642 HGNC:26031 PIGW gene PIGW Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glycosylphosphatidylinositol biosynthesis defect 11, MIM# 616025" 24367057;27626616;30813920;32198969 False 3 100;0;0 21.569 True ENSG00000184886 ENSG00000277161 HGNC:23213 PIGW gene PIGW Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 11, MIM# 616025 24367057;27626616;30813920;32198969 False 3 100;0;0 21.569 True ENSG00000184886 ENSG00000277161 HGNC:23213 PIK3CA gene PIK3CA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Megalencephaly-capillary malformation-polymicrogyria syndrome, somatic, MIM#602501 False 3 100;0;0 21.569 True Other ENSG00000121879 ENSG00000121879 HGNC:8975 PIK3CA gene PIK3CA Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cerebral cavernous malformations 4, MIM#619538 34496175 False 3 100;0;0 21.569 True ENSG00000121879 ENSG00000121879 HGNC:8975 PIK3R2 gene PIK3R2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 1, MIM# 603387 22729224;23745724;33604570 False 3 100;0;0 21.569 True ENSG00000105647 ENSG00000105647 HGNC:8980 PINK1 gene PINK1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 6, early onset;Dystonia False 3 0;0;0 21.569 False ENSG00000158828 ENSG00000158828 HGNC:14581 PINK1 gene PINK1 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 21.569 False ENSG00000158828 ENSG00000158828 HGNC:14581 PINK1 gene PINK1 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 6, early onset, MIM# 605909 27604308;15087508;16207731;18003639;18524835 False 3 100;0;0 21.569 True ENSG00000158828 ENSG00000158828 HGNC:14581 PINK1 gene PINK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 6, early onset MIM#605909 28980524 False 3 100;0;0 21.569 True ENSG00000158828 ENSG00000158828 HGNC:14581 PIP5K1C gene PIP5K1C Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder and microcephaly, MONDO:0700092, PIP5K1C-related 37451268 False 3 100;0;0 21.569 True ENSG00000186111 ENSG00000186111 HGNC:8996 PISD gene PISD Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Liberfarb syndrome, MIM# 618889;Intellectual disability;cataracts;retinal degeneration;microcephaly;deafness;short stature;white matter abnormalities 38801004;31263216;30858161 False 3 100;0;0 21.569 True ENSG00000241878 ENSG00000241878 HGNC:8999 PITRM1 gene PITRM1 Expert Review Green;Literature;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis 26697887;29764912 False 3 100;0;0 21.569 True ENSG00000107959 ENSG00000107959 HGNC:17663 PITRM1 gene PITRM1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis 26697887;29764912 False 3 100;0;0 21.569 True ENSG00000107959 ENSG00000107959 HGNC:17663 PKD1 gene PKD1 Expert Review Green;Expert Review Green;Genomics England PanelApp;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Polycystic kidney disease, adult type I 173900 False 3 100;0;0 21.569 False ENSG00000008710 ENSG00000008710 HGNC:9008 PLA2G16 gene PLA2G16 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipodystrophy, familial partial, type 9, MIM# 620683 PMID: 37919452 False 3 100;0;0 21.569 True ENSG00000176485 ENSG00000176485 HGNC:17825 PLA2G6 gene PLA2G6 GeneReviews;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal PLA2G6-associated neurodegeneration (PLAN) False 3 100;0;0 21.569 False ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 2B MIM#610217 30340910 False 3 100;0;0 21.569 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Infantile neuroaxonal dystrophy 1 MIM#256600;Neurodegeneration with brain iron accumulation 2B MIM#610217;Parkinson disease 14, autosomal recessive MIM#612953" 25348461;26001724;26506412;30528460;16783378 False 3 100;0;0 21.569 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive Parkinson disease 14, 612953;Parkinson disease 14 (#612953);Infantile neuroaxonal dystrophy 1 (#256600);Infantile neuroaxonal dystrophy 1, 256600;Neurodegeneration with brain iron accumulation 2B (#610217);Neurodegeneration with brain iron accumulation 2B, 610217 False 3 100;0;0 21.569 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile neuroaxonal dystrophy 1 (MIM#256600);Neurodegeneration with brain iron accumulation 2B (MIM#610217) 29859652 False 3 100;0;0 21.569 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 14, autosomal recessive, MIM# 612953 25634434;26836416;22406380;20938027 False 3 0;100;0 21.569 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive Parkinson disease 14 MONDO:0013060 20301718 False 3 100;0;0 21.569 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 14, autosomal recessive 612953;PLA2G6-associated neurodegeneration;Neurodegeneration with brain iron accumulation 2B 610217;Infantile neuroaxonal dystrophy 1 256600 False 3 0;0;0 21.569 False ENSG00000184381 ENSG00000184381 HGNC:9039 PLAA gene PLAA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive microcephaly, spasticity, and brain anomalies, MIM# 617527 28007986;28413018;31322726 False 3 100;0;0 21.569 True ENSG00000137055 ENSG00000137055 HGNC:9043 PLCB1 gene PLCB1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 12 (MIM#613722) 24684524;20833646;22690784;26818157 False 3 100;0;0 21.569 True ENSG00000182621 ENSG00000182621 HGNC:15917 PLEC gene PLEC Expert Review Green;Expert Review;Expert Review Green;Expert Review;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy with epidermolysis bullosa simplex, 226670 22144912 False 3 100;0;0 21.569 True ENSG00000178209 ENSG00000178209 HGNC:9069 PLEKHG5 gene PLEKHG5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary peripheral neuropathy MONDO:0020127, PLEKHG5-related 17564964;23777631;23844677;33492783;33275839;33220101;23777631 False 3 100;0;0 21.569 False ENSG00000171680 ENSG00000171680 HGNC:29105 PLK1 gene PLK1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, PLK1-related, MONDO:0700092 33875846 False 3 100;0;0 21.569 True ENSG00000166851 ENSG00000166851 HGNC:9077 PLP1 gene PLP1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Pelizaeus-Merzbacher disease, MIM# 312080" False 3 100;0;0 21.569 True ENSG00000123560 ENSG00000123560 HGNC:9086 PLP1 gene PLP1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Spastic paraplegia 2, X-linked, MIM# 312920" 15627202;8012387 False 3 100;0;0 21.569 True ENSG00000123560 ENSG00000123560 HGNC:9086 PLP1 gene PLP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Pelizaeus-Merzbacher Disease, MIM#312080 7512350;11071483;21679407;28133555;29486744;35346287;37637647 False 3 100;0;0 21.569 True ENSG00000123560 ENSG00000123560 HGNC:9086 PLPBP gene PLPBP Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, early-onset, vitamin B6-dependent, MIM# 617290 27912044;31741821;30668673 False 3 100;0;0 21.569 True ENSG00000147471 ENSG00000147471 HGNC:9457 PLXNA1 gene PLXNA1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dworschak-Punetha neurodevelopmental syndrome, MIM# 619955 34054129 False 3 100;0;0 21.569 True ENSG00000114554 ENSG00000114554 HGNC:9099 PMM2 gene PMM2 Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ia (MIM#212065);Hyperinsulinaemic Hypoglycaemia and Polycystic Kidney Disease (HIPKD), MONDO:0020642, PMM2-related 28108845;28373276;32595772 False 3 50;50;0 21.569 True ENSG00000140650 ENSG00000140650 HGNC:9115 PMM2 gene PMM2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neonatal-onset, leukodystrophy, abnormal serum glycoproteins, mental retardation, hypotonia, ataxia, retinitis pigmentosa, seizures, slowly progressive neuropathy with SNCV, severe infections, hepatic insufficiency and cardiomyopathy 20301507;20301289 False 3 100;0;0 21.569 True ENSG00000140650 ENSG00000140650 HGNC:9115 PMM2 gene PMM2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ia 212065 21541725 False 3 100;0;0 21.569 True ENSG00000140650 ENSG00000140650 HGNC:9115 PMP2 gene PMP2 Expert Review Green;Royal Melbourne Hospital;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN;Charcot-Marie-Tooth disease, demyelinating, type 1G, 618279 26257172;26828946;27009151 False 3 67;33;0 21.569 False Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000147588 ENSG00000147588 HGNC:9117 PMP22 gene PMP22 Expert Review Green;Victorian Clinical Genetics Services;Royal Melbourne Hospital;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 1A, MIM# 118220;Charcot-Marie-Tooth disease, type 1E, MIM# 118300;Dejerine-Sottas disease, MIM# 145900;Neuropathy, recurrent, with pressure palsies 162500;Roussy-Levy syndrome 180800 32412171;31777123;32719652;32356557 False 3 100;0;0 21.569 True ENSG00000109099 ENSG00000109099 HGNC:9118 PMPCA gene PMPCA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200 25808372;26657514;33272776;30617178 False 3 100;0;0 21.569 True ENSG00000165688 ENSG00000165688 HGNC:18667 PMPCA gene PMPCA Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200 25808372;26657514;33272776;30617178 False 3 100;0;0 21.569 True ENSG00000165688 ENSG00000165688 HGNC:18667 PMPCB gene PMPCB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 6, MIM# 617954 29576218 False 3 100;0;0 21.569 True ENSG00000105819 ENSG00000105819 HGNC:9119 PMPCB gene PMPCB Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 6, 617954 29576218 False 3 100;0;0 21.569 True ENSG00000105819 ENSG00000105819 HGNC:9119 PMPCB gene PMPCB Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Multiple mitochondrial dysfunctions syndrome 6, MIM# 617954" 29576218 False 3 100;0;0 21.569 True ENSG00000105819 ENSG00000105819 HGNC:9119 PNKD gene PNKD Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Paroxysmal nonkinesigenic dyskinesia 1, 118800 False 3 100;0;0 21.569 True ENSG00000127838 ENSG00000127838 HGNC:9153 PNKD gene PNKD Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800 15496428 False 3 100;0;0 21.569 True ENSG00000127838 ENSG00000127838 HGNC:9153 PNKD gene PNKD Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800;MONDO:0007326 15262732;15496428;15824259;19124534;21487022 False 3 100;0;0 21.569 False ENSG00000127838 ENSG00000127838 HGNC:9153 PNKP gene PNKP Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Microcephaly, seizures, and developmental delay, MIM# 613402" 31436889;31707899 False 3 100;0;0 21.569 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNKP gene PNKP Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, seizures and developmental delay, 613402;Ataxia-oculomotor apraxia 4, 616267;Ataxia with oculomotor apraxia 4 (#616267) 31436889;31707899 False 3 100;0;0 21.569 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNKP gene PNKP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia-oculomotor apraxia 4, MIM# 616267" 28552035;25728773 False 3 100;0;0 21.569 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNKP gene PNKP Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2B2 (MIM#605589);Ataxia-oculomotor apraxia 4 (MIM#616267) 30039206;27066567;25728773 False 3 100;0;0 21.569 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNP gene PNP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Immunodeficiency due to purine nucleoside phosphorylase deficiency, MIM# 613179" 3029074;1384322;11453975;32695102;32514656 False 3 100;0;0 21.569 True ENSG00000198805 ENSG00000198805 HGNC:7892 PNPLA2 gene PNPLA2 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neutral lipid storage disease with myopathy 610717" PMID: 32269696;21544567 False 3 100;0;0 21.569 True ENSG00000177666 ENSG00000177666 HGNC:30802 PNPLA2 gene PNPLA2 Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neutral lipid storage disease with myopathy MIM#610717" 18952067;25287355;25956450 False 3 67;0;33 21.569 True ENSG00000177666 ENSG00000177666 HGNC:30802 PNPLA6 gene PNPLA6 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Laurence-Moon Syndrome (LMS) MIM#245800;Spastic Paraplegia Type 39 MIM#612020 25299038;18313024 False 3 100;0;0 21.569 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA6 gene PNPLA6 Expert Review Green;Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Boucher-Neuhauser syndrome MIM#215470;Laurence-Moon syndrome MIM#245800;Oliver-McFarlane syndrome MIM#275400;Spastic paraplegia 39, autosomal recessive MIM#612020 False 3 100;0;0 21.569 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA8 gene PNPLA8 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related;Mitochondrial myopathy with lactic acidosis (MIM#251950), AR 29681094;25512002 False 3 100;0;0 21.569 True ENSG00000135241 ENSG00000135241 HGNC:28900 PNPLA8 gene PNPLA8 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related PMID: 39082157 False 3 100;0;0 21.569 True ENSG00000135241 ENSG00000135241 HGNC:28900 PNPLA8 gene PNPLA8 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related PMID: 39082157 False 3 100;0;0 21.569 True ENSG00000135241 ENSG00000135241 HGNC:28900 PNPLA8 gene PNPLA8 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related PMID: 39082157 False 3 100;0;0 21.569 True ENSG00000135241 ENSG00000135241 HGNC:28900 PNPO gene PNPO Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyridoxamine 5'-phosphate oxidase deficiency, MIM# 610090 False 3 100;0;0 21.569 True ENSG00000108439 ENSG00000108439 HGNC:30260 PNPO gene PNPO Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyridoxamine 5'-phosphate oxidase deficiency, MIM# 610090 34769443;33981986;33748042;32888189 False 3 100;0;0 21.569 True ENSG00000108439 ENSG00000108439 HGNC:30260 PNPT1 gene PNPT1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 13 (MIM#614932);Deafness, autosomal recessive 70 (MIM#614934) 31752325;28645153 False 3 67;33;0 21.569 True ENSG00000138035 ENSG00000138035 HGNC:23166 PNPT1 gene PNPT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 13, MIM# 614932 33158637;31752325 False 3 100;0;0 21.569 True ENSG00000138035 ENSG00000138035 HGNC:23166 PNPT1 gene PNPT1 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 25, MIM# 608703" 35411967;37935417;39729134;39899068;39924761;40757543 False 3 60;40;0 21.569 False ENSG00000138035 ENSG00000138035 HGNC:23166 POGLUT1 gene POGLUT1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 21 (MIM#617232) 27807076;29034878;31897643 False 3 67;33;0 21.569 True ENSG00000163389 ENSG00000163389 HGNC:22954 POGZ gene POGZ Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted White-Sutton syndrome MIM#616364 PMIS: 34645992;31136090;28490548;26739615;27824329 False 3 100;0;0 21.569 True ENSG00000143442 ENSG00000143442 HGNC:18801 POLA2 gene POLA2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Telomere biology syndrome MONDO:0100137 39616267 False 3 100;0;0 21.569 True ENSG00000014138 ENSG00000014138 HGNC:30073 POLG gene POLG Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant progressive external ophthalmoplegia MONDO:0008003 20301791;15351195 False 3 100;0;0 21.569 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450 30451971 False 3 100;0;0 21.569 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM# 613662 30451971 False 3 100;0;0 21.569 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459 20301791 False 3 100;0;0 21.569 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4B (MNGIE type), MIM# 613662 False 3 100;0;0 21.569 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4B (MNGIE type) 613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459;Progressive external ophthalmoplegia, autosomal dominant 1 157640;Mitochondrial DNA depletion syndrome 4A (Alpers type) 203700;Progressive external ophthalmoplegia, autosomal recessive 1 258450 30451971 False 3 100;0;0 21.569 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450 False 3 100;0;0 21.569 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG2 gene POLG2 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4, MIM# 610131 16685652;21555342;27592148;31778857 False 3 50;50;0 21.569 True ENSG00000256525 ENSG00000256525 HGNC:9180 POLG2 gene POLG2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4, MIM# 610131;Mitochondrial DNA depletion syndrome 16 , MIM# 618528 16685652;21555342;27592148;31778857 False 3 100;0;0 21.569 True ENSG00000256525 ENSG00000256525 HGNC:9180 POLR1C gene POLR1C Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 11, MIM# 616494" 26151409;32042905 False 3 100;0;0 21.569 True ENSG00000171453 ENSG00000171453 HGNC:20194 POLR3A gene POLR3A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 False 3 100;0;0 21.569 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 32600288;32373668;31940116;31932101;29618326 False 3 100;0;0 21.569 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 PMID: 33652360 False 3 100;0;0 21.569 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 21855841 False 3 100;0;0 21.569 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 31637490 False 3 100;0;0 21.569 False ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3B gene POLR3B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, demyelinating, type 1I, MIM# 619742 PMID: 33417887 False 3 100;0;0 21.569 True ENSG00000013503 ENSG00000013503 HGNC:30348 POLR3B gene POLR3B Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM# 614381" 27512013;22036171;22036172 False 3 100;0;0 21.569 True ENSG00000013503 ENSG00000013503 HGNC:30348 POLR3B gene POLR3B Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ataxia, spasticity, and demyelinating neuropathy 33417887 False 3 100;0;0 21.569 True ENSG00000013503 ENSG00000013503 HGNC:30348 POLR3B gene POLR3B Expert Review Green;Royal Melbourne Hospital;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#614381 22036171;22036172 False 3 100;0;0 21.569 True ENSG00000013503 ENSG00000013503 HGNC:30348 POLR3K gene POLR3K Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3-related leukodystrophy MONDO:0700282 30584594;33659930;https://doi.org/10.1155/2024/8807171 False 3 50;50;0 21.569 True ENSG00000161980 ENSG00000161980 HGNC:14121 POLRMT gene POLRMT Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 55, MIM# 619743;intellectual disability;hypotonia 33602924 False 3 100;0;0 21.569 True ENSG00000099821 ENSG00000099821 HGNC:9200 POMGNT1 gene POMGNT1 Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle) type C, 8 MIM#618135 27391550;26908613;30961548;30937090 False 3 100;0;0 21.569 True ENSG00000085998 ENSG00000085998 HGNC:19139 POMGNT1 gene POMGNT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 8 MIM#614830 27391550;26908613;30961548;30937090 False 3 100;0;0 21.569 True ENSG00000085998 ENSG00000085998 HGNC:19139 POMGNT1 gene POMGNT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy caused by variation in POMGNT1 MONDO:0700068 False 3 100;0;0 21.569 True ENSG00000085998 ENSG00000085998 HGNC:19139 POMGNT2 gene POMGNT2 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 8, 614830 False 3 100;0;0 21.569 False ENSG00000144647 ENSG00000144647 HGNC:25902 POMGNT2 gene POMGNT2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy caused by variation in POMGNT2 MONDO:0700069 False 3 100;0;0 21.569 True ENSG00000144647 ENSG00000144647 HGNC:25902 POMK gene POMK Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 21.569 True ENSG00000185900 ENSG00000185900 HGNC:26267 POMT1 gene POMT1 Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type False 3 100;0;0 21.569 False ENSG00000130714 ENSG00000130714 HGNC:9202 POMT1 gene POMT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy caused by variation in POMT1 MONDO:0700070 False 3 100;0;0 21.569 True ENSG00000130714 ENSG00000130714 HGNC:9202 POMT1 gene POMT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 1, MIM# 236670 False 3 100;0;0 21.569 True ENSG00000130714 ENSG00000130714 HGNC:9202 POMT2 gene POMT2 Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type False 3 100;0;0 21.569 False ENSG00000009830 ENSG00000009830 HGNC:19743 POMT2 gene POMT2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2 613150;Muscular dystrophy-dystroglycanopathy (congenital with mental retardation), type B, 2 613156;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 2 613158 False 3 100;0;0 21.569 True ENSG00000009830 ENSG00000009830 HGNC:19743 POPDC3 gene POPDC3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy, limb-girdle, autosomal recessive 26, MIM# 618848" 31610034 False 3 100;0;0 21.569 True ENSG00000132429 ENSG00000132429 HGNC:17649 POR gene POR Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis 201750;Disordered steroidogenesis due to cytochrome P450 oxidoreductase 613571 27604308;14758361;15793702;15220035;15483095;16470797 False 3 100;0;0 21.569 True ENSG00000127948 ENSG00000127948 HGNC:9208 POU4F1 gene POU4F1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia;intention tremor;hypotonia 33783914;8876243 False 3 100;0;0 21.569 True ENSG00000152192 ENSG00000152192 HGNC:9218 PPA2 gene PPA2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sudden cardiac failure, alcohol-induced, 617223;Sudden cardiac failure, infantile, 617222 27523598;34400813 False 3 100;0;0 21.569 True ENSG00000138777 ENSG00000138777 HGNC:28883 PPCS gene PPCS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cardiomyopathy, dilated, 2C, MIM# 618189 29754768;35616428 False 3 50;50;0 21.569 True ENSG00000127125 ENSG00000127125 HGNC:25686 PPFIA3 gene PPFIA3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paul-Chao neurodevelopmental syndrome, MIM# 621122 38723631 False 3 100;0;0 21.569 True ENSG00000177380 ENSG00000177380 HGNC:9247 PPFIBP1 gene PPFIBP1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures, microcephaly, and brain abnormalities, MIM# 620024 35830857 False 3 100;0;0 21.569 True ENSG00000110841 ENSG00000110841 HGNC:9249 PPIL1 gene PPIL1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 14, MIM# 619301;microcephaly;seizures 33220177 False 3 100;0;0 21.569 True ENSG00000137168 ENSG00000137168 HGNC:9260 PPOX gene PPOX Expert Review Green;Expert Review Green;NHS GMS;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Porphyria variegata MIM#176200" 25778941;9811936;12859407;30476629 False 3 100;0;0 21.569 True ENSG00000143224 ENSG00000143224 HGNC:9280 PPOX gene PPOX Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Porphyria variegata, MIM# 176200;Variegate porphyria, childhood-onset, MIM# 620483" 9811936;11286631;33159949 False 3 100;0;0 21.569 True ENSG00000143224 ENSG00000143224 HGNC:9280 PPP1R21 gene PPP1R21 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, facial dysmorphism, and brain abnormalities, MIM# 619383;Hypotonia;intellectual disability;white matter abnormalities 30520571 False 3 100;0;0 21.569 True ENSG00000162869 ENSG00000162869 HGNC:30595 PPP2CA gene PPP2CA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder and language delay with or without structural brain abnormalities, MIM#618354 30595372 False 3 100;0;0 21.569 True ENSG00000113575 ENSG00000113575 HGNC:9299 PPP2R1A gene PPP2R1A Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Mental retardation, autosomal dominant 36, MIM#616362;Microcephaly-corpus callosum hypoplasia-intellectual disability-facial dysmorphism syndrome, MONDO:0014605 PMID: 33106617;26168268 False 3 100;0;0 21.569 True Other ENSG00000105568 ENSG00000105568 HGNC:9302 PPP2R5D gene PPP2R5D Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early onset Parkinsonism;Houge-Janssens syndrome 1, MIM#616355 33338668;32743835 False 3 100;0;0 21.569 True ENSG00000112640 ENSG00000112640 HGNC:9312 PPP2R5D gene PPP2R5D Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Houge-Janssens syndrome 1 MIM#616355 26168268;29296277;26576547 False 3 100;0;0 21.569 True ENSG00000112640 ENSG00000112640 HGNC:9312 PPP3CA gene PPP3CA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 91, MIM#617711 29432562;32593294 False 3 100;0;0 21.569 True ENSG00000138814 ENSG00000138814 HGNC:9314 PPT1 gene PPT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 1, MIM# 256730;MONDO:0009744 7637805;9425237;9664077 False 3 100;0;0 21.569 True ENSG00000131238 ENSG00000131238 HGNC:9325 PPT1 gene PPT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 1, MIM# 256730;MONDO:0009744 7637805;9425237;9664077 False 3 100;0;0 21.569 True ENSG00000131238 ENSG00000131238 HGNC:9325 PRDM12 gene PRDM12 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal insensitivity to pain;Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488;MONDO:0014662 26975306;25891934;26005867;33789102;33010785;32828702 False 3 100;0;0 21.569 True ENSG00000130711 ENSG00000130711 HGNC:13997 PRDM12 gene PRDM12 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488;MONDO:0014662;HSAN/SFN 26005867;33789102;33010785;32828702 False 3 100;0;0 21.569 False ENSG00000130711 ENSG00000130711 HGNC:13997 PRDX3 gene PRDX3 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia MONDO:0000437, PRDX3-related 33889951 False 3 100;0;0 21.569 True ENSG00000165672 ENSG00000165672 HGNC:9354 PRDX3 gene PRDX3 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia MONDO:0000437, PRDX3-related 33889951 False 3 100;0;0 21.569 True ENSG00000165672 ENSG00000165672 HGNC:9354 PREPL gene PREPL Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 22 MIM#616224;hypotonia-cystinuria syndrome;Disorders of amino acid transport 28726805;27604308 False 3 100;0;0 21.569 True ENSG00000138078 ENSG00000138078 HGNC:30228 PREPL gene PREPL Expert Review Green;Victorian Clinical Genetics Services;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 22 MIM#616224;hypotonia-cystinuria syndrome 28726805;27604308;24610330;34888501 False 3 100;0;0 21.569 True ENSG00000138078 ENSG00000138078 HGNC:30228 PRKAG2 gene PRKAG2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Wolff-Parkinson-White syndrome 194200;Cardiomyopathy, hypertrophic 6 600858;Glycogen storage disease of heart, lethal congenital 261740 15766830;31049239 False 3 100;0;0 21.569 True ENSG00000106617 ENSG00000106617 HGNC:9386 PRKAG2 gene PRKAG2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glycogen storage disease of heart, lethal congenital, MIM# 261740 15877279;17667862;32646569 False 3 100;0;0 21.569 True ENSG00000106617 ENSG00000106617 HGNC:9386 PRKCG gene PRKCG Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14, MIM# 605361;Myoclonus;Parkinsonism PMID: 29603387 False 3 100;0;0 21.569 True ENSG00000126583 ENSG00000126583 HGNC:9402 PRKN gene PRKN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive juvenile Parkinson disease 2 MONDO:0010820 False 3 100;0;0 21.569 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRKN gene PRKN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease, juvenile, type 2 MIM#600116 False 3 100;0;0 21.569 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRKN gene PRKN Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile parkinsonism/dystonia;Parkinson disease, juvenile, type 2;Dystonia False 3 0;0;0 21.569 False ENSG00000185345 ENSG00000185345 HGNC:8607 PRKN gene PRKN Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of mitochondrial protein quality control;Parkinson disease MONDO:0005180 29884839;38069350 False 3 100;0;0 21.569 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRKRA gene PRKRA Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 16, MIM# 612067;MONDO:0012789 18243799;25142429;29279192 False 3 100;0;0 21.569 False ENSG00000180228 ENSG00000180228 HGNC:9438 PRKRA gene PRKRA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dystonia 16 MONDO:0012789 33502045 False 3 100;0;0 21.569 True ENSG00000180228 ENSG00000180228 HGNC:9438 PRMT1 gene PRMT1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder, MONDO:0700092, PRMT1-related 39937650 False 3 100;0;0 21.569 True ENSG00000126457 ENSG00000126457 HGNC:5187 PRMT7 gene PRMT7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Short stature, brachydactyly, intellectual developmental disability, and seizures, MIM# 617157 26437029;27718516;30513135 False 3 100;0;0 21.569 True ENSG00000132600 ENSG00000132600 HGNC:25557 PRMT9 gene PRMT9 Literature;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, PRMT9-related 38561334;41260215 False 3 100;0;0 21.569 False ENSG00000164169 ENSG00000164169 HGNC:25099 PRNP gene PRNP Other;Expert Review Green;Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted fatal familial insomnia MONDO:0010808 25220284;24252267 False 3 100;0;0 21.569 False Other ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease 2564168;34324063;20301407 False 3 100;0;0 21.569 False ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 1 MONDO:0011299 30713928;27400454 False 3 100;0;0 21.569 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Prion diseases;peripheral neuropathy;chronic diarrhea;dementia 31953922;31907995;29928661;27716661;26926995;24224623;26768678 False 3 50;0;50 21.569 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Prion Disease (MIM#176640);Creutzfeldt-Jakob disease (MIM#123400) 27910931;19571725, 20301407;6351815 False 3 100;0;0 21.569 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted inherited Creutzfeldt-Jakob disease MONDO:0007403;Gerstmann-Straussler-Scheinker syndrome MONDO:0007656 20301407 False 3 100;0;0 21.569 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Cerebral amyloid angiopathy, PRNP-related, 137440" 27716661;24224623;25287017;26768678 False 3 0;0;0 21.569 False ENSG00000171867 ENSG00000171867 HGNC:9449 PRODH gene PRODH Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hyperprolinemia, type I 239500;Proline oxidase deficiency" 17412540;12217952 False 3 100;0;0 21.569 True ENSG00000100033 ENSG00000100033 HGNC:9453 PRPF8 gene PRPF8 Expert Review Green;Literature;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, PRPF8-related;Retinitis pigmentosa 13 - MIM#600059 35543142 False 3 100;0;0 21.569 True ENSG00000174231 ENSG00000174231 HGNC:17340 PRPS1 gene PRPS1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Arts syndrome 301835;Charcot-Marie-Tooth disease, X-linked recessive, 5 311070;Deafness, X-linked 1 304500;Gout, PRPS-related 300661;Phosphoribosylpyrophosphate synthetase superactivity 300661 False 3 100;0;0 21.569 True ENSG00000147224 ENSG00000147224 HGNC:9462 PRPS1 gene PRPS1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot Marie Tooth disease, X linked recessive, 5, 311070;HMSN 17701900;24285972;25491489;25182139 False 3 100;0;0 21.569 False ENSG00000147224 ENSG00000147224 HGNC:9462 PRRT2 gene PRRT2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic kinesigenic dyskinesia 1, MIM# 128200;MONDO:0007494 22101681;22120146;22744660;22399141 False 3 100;0;0 21.569 False ENSG00000167371 ENSG00000167371 HGNC:30500 PRRT2 gene PRRT2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal PRRT2-associated paroxysmal movement disorder MONDO:0100556 30501978;30713971;27423591;25595153;33126500 False 3 100;0;0 21.569 True ENSG00000167371 ENSG00000167371 HGNC:30500 PRRT2 gene PRRT2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal PRRT2-associated paroxysmal movement disorder MONDO:0100556 26598494;31193310;30501978;30713971 False 3 100;0;0 21.569 True ENSG00000167371 ENSG00000167371 HGNC:30500 PRRT2 gene PRRT2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal PRRT2-associated paroxysmal movement disorder MONDO:0100556 33126500 False 3 100;0;0 21.569 True ENSG00000167371 ENSG00000167371 HGNC:30500 PRUNE1 gene PRUNE1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies MIM#617481 PMID: 28334956;26539891;30556349;29940663;29797509 False 3 100;0;0 21.569 True ENSG00000143363 ENSG00000143363 HGNC:13420 PRX gene PRX Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease type 4 MONDO:0018995 11133365;11157804;15197604;21079185;22847150;10839370;32460404;31523542;31426691 False 3 100;0;0 21.569 False ENSG00000105227 ENSG00000105227 HGNC:13797 PSAP gene PSAP Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined SAP deficiency, MIM# 611721;Encephalopathy due to prosaposin deficiency, MONDO:0012719;Krabbe disease, atypical, MIM# 611722;MONDO:0012720;Metachromatic leukodystrophy due to SAP-b deficiency, MIM# 249900;MONDO:0009590;Gaucher disease, atypical, MIM# 610539;MONDO:0012517 10682309;1371116;15773042;31061751;30632081 False 3 100;0;0 21.569 True ENSG00000197746 ENSG00000197746 HGNC:9498 PSAP gene PSAP Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Combined SAP deficiency, MIM# 611721;Encephalopathy due to prosaposin deficiency, MONDO:0012719;Krabbe disease, atypical, MIM# 611722;MONDO:0012720;Metachromatic leukodystrophy due to SAP-b deficiency, MIM# 249900;MONDO:0009590;Gaucher disease, atypical, MIM# 610539;MONDO:0012517 32201884;10682309;1371116;15773042;31061751;30632081 False 3 100;0;0 21.569 True ENSG00000197746 ENSG00000197746 HGNC:9498 PSAP gene PSAP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Metachromatic leukodystrophy due to SAP-b deficiency, MIM# 249900" False 3 100;0;0 21.569 True ENSG00000197746 ENSG00000197746 HGNC:9498 PSAP gene PSAP Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491 32201884 False 3 100;0;0 21.569 True ENSG00000197746 ENSG00000197746 HGNC:9498 PSAT1 gene PSAT1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phosphoserine aminotransferase deficiency MIM#610992;Neu-Laxova syndrome 2 MIM#616038 32077105 False 3 100;0;0 21.569 True ENSG00000135069 ENSG00000135069 HGNC:19129 PSEN1 gene PSEN1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Frontotemporal dementia, MIM# 600274;Dystonia 28664294;12810495;15159497;29316780 False 3 100;0;0 21.569 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN1 gene PSEN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 3 MONDO:0011913 3548932;34843019;36825052 False 3 100;0;0 21.569 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN1 gene PSEN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, type 3 (MIM#607822;MONDO:0011913) 22503161;20301340 False 3 100;0;0 21.569 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN1 gene PSEN1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, type 3, with spastic paraparesis and apraxia, MIM# 607822 33274538 False 3 100;0;0 21.569 False ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN1 gene PSEN1 Other;Expert Review Green;Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted early-onset autosomal dominant Alzheimer disease MONDO:0015140 36845656 False 3 100;0;0 21.569 False Other ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN2 gene PSEN2 Other;Expert Review Green;Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted early-onset autosomal dominant Alzheimer disease MONDO:0015140 36845656 False 3 100;0;0 21.569 False Other ENSG00000143801 ENSG00000143801 HGNC:9509 PSEN2 gene PSEN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease-4 (MIM#606889) 22503161;20301340;25323700;35491795 False 3 100;0;0 21.569 True ENSG00000143801 ENSG00000143801 HGNC:9509 PSMF1 gene PSMF1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 False 3 100;0;0 21.569 True ENSG00000125818 ENSG00000125818 HGNC:9571 PSPH gene PSPH Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phosphoserine phosphatase deficiency MIM#614023;Disorders of serine, glycine or glycerate metabolism 14673469;25080166;27604308;26888760;25152457 False 3 100;0;0 21.569 True ENSG00000146733 ENSG00000146733 HGNC:9577 PTCD3 gene PTCD3 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-51, MIM#619057;Mental retardation;optic atrophy;Leigh-like syndrome 30607703;19427859;36450274 False 3 50;50;0 21.569 True ENSG00000132300 ENSG00000132300 HGNC:24717 PTEN gene PTEN Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cowden syndrome 1, MIM# 158350 29720545;29152901;30664625 False 3 100;0;0 21.569 True ENSG00000171862 ENSG00000171862 HGNC:9588 PTEN gene PTEN Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cowden syndrome 1, MIM#158350 9832032;29033429;29444762 False 3 100;0;0 21.569 True ENSG00000171862 ENSG00000171862 HGNC:9588 PTPMT1 gene PTPMT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with ataxia and brain abnormalities, MIM# 621199 39279645;37672386 False 3 100;0;0 21.569 True ENSG00000110536 ENSG00000110536 HGNC:26965 PTPN23 gene PTPN23 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder and structural brain anomalies with or without seizures and spasticity, MIM# 618890 31395947;29899372;29090338;27848944;25558065 False 3 100;0;0 21.569 True ENSG00000076201 ENSG00000076201 HGNC:14406 PTRH2 gene PTRH2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile multi-system neurologic, endocrine, and pancreatic disease, 616263 25558065;25574476;31057140;27129381 False 3 100;0;0 21.569 True ENSG00000141378 ENSG00000141378 HGNC:24265 PTRH2 gene PTRH2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile multisystem neurologic, endocrine, and pancreatic disease (IMNPED) (MIM#616263);Infantile-onset multisystem disease with intellectual disability, microcephaly, progressive ataxia, sensory neuronal hearing loss, hepatomegaly, pancreatic insufficiency, proximal placement of thumb, SNCV neuropathy 25574476;27129381;28328138 False 3 100;0;0 21.569 True ENSG00000141378 ENSG00000141378 HGNC:24265 PTRH2 gene PTRH2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Miscellaneous disorders associated with mitochondrial dysfunction;neurologic, endocrine, and pancreatic disease, multisystem, infantile-onset 1 MONDO:8000012 29884839;37239392;25558065;25574476;31057140;27129381 False 3 100;0;0 21.569 True ENSG00000141378 ENSG00000141378 HGNC:24265 PTRHD1 gene PTRHD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747 27753167;27134041;30398675;29143421 False 3 100;0;0 21.569 True ENSG00000184924 ENSG00000184924 HGNC:33782 PTS gene PTS Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640 9222755 False 3 100;0;0 21.569 True ENSG00000150787 ENSG00000150787 HGNC:9689 PTS gene PTS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 21.569 True ENSG00000150787 ENSG00000150787 HGNC:9689 PTS gene PTS Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, A, 261640;6-Pyruvoyltetrahydropterin Synthase Deficiency;Dystonia False 3 0;0;0 21.569 False ENSG00000150787 ENSG00000150787 HGNC:9689 PTS gene PTS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, A, MIM# 261640 False 3 100;0;0 21.569 True ENSG00000150787 ENSG00000150787 HGNC:9689 PUM1 gene PUM1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with motor abnormalities, seizures, and facial dysmorphism, MIM# 620719 29474920;25768905;30903679;31859446 False 3 100;0;0 21.569 True ENSG00000134644 ENSG00000134644 HGNC:14957 PUM1 gene PUM1 Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 47, 617931 False 3 100;0;0 21.569 False ENSG00000134644 ENSG00000134644 HGNC:14957 PURA gene PURA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158) 25439098;25342064;12972605 False 3 100;0;0 21.569 True ENSG00000185129 ENSG00000185129 HGNC:9701 PUS1 gene PUS1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, lactic acidosis, and sideroblastic anaemia 1, MIM# 600462 25227147;17056637;15108122;32287105;31641589;28832011 False 3 100;0;0 21.569 True ENSG00000177192 ENSG00000177192 HGNC:15508 PUS1 gene PUS1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal myopathy, lactic acidosis, and sideroblastic anemia 1 MONDO:0024553 25227147;17056637;15108122;32287105;31641589;28832011 False 3 100;0;0 21.569 True ENSG00000177192 ENSG00000177192 HGNC:15508 PUS3 gene PUS3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with microcephaly and gray sclerae, MIM# 617051" 36125428;30308082;28454995;27055666;30697592;31444731 False 3 100;0;0 21.569 True ENSG00000110060 ENSG00000110060 HGNC:25461 PYCR1 gene PYCR1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IIB MIM#612940;Cutis laxa, autosomal recessive, type IIIB MIM#614438;Disorders of ornithine or proline metabolism 19576563;27604308 False 3 100;0;0 21.569 True ENSG00000183010 ENSG00000183010 HGNC:9721 PYCR2 gene PYCR2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 10, MIM# 616420 25865492;27130255 False 3 100;0;0 21.569 True ENSG00000143811 ENSG00000143811 HGNC:30262 PYGL gene PYGL Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease VI, MIM# 232700 9529348;9536091;33505429;32961316;32892177 False 3 100;0;0 21.569 True ENSG00000100504 ENSG00000100504 HGNC:9725 PYGM gene PYGM Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal McArdle disease, MIM# 232600;Disorder of glycogen metabolism MONDO:0002412, PYGM-related, AD 32386344 False 3 100;0;0 21.569 True ENSG00000068976 ENSG00000068976 HGNC:9726 PYGM gene PYGM Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease V McArdle disease 232600 AR 32386344 False 3 100;0;0 21.569 True ENSG00000068976 ENSG00000068976 HGNC:9726 PYROXD1 gene PYROXD1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 8, 617258;adult-onset limb girdle muscular dystrophy 30345904;30515627;27745833 False 3 0;100;0 21.569 True ENSG00000121350 ENSG00000121350 HGNC:26162 QARS gene QARS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, progressive, seizures, and cerebral and cerebellar atrophy, MIM# 615760 28620870;25471517;25432320;25041233;24656866;32042906 False 3 100;0;0 21.569 True ENSG00000172053 ENSG00000172053 HGNC:9751 QARS gene QARS Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, progressive, seizures, and cerebral and cerebellar atrophy, MIM# 615760 28620870;25471517;25432320;25041233;24656866;32042906 False 3 100;0;0 21.569 True ENSG00000172053 ENSG00000172053 HGNC:9751 QDPR gene QDPR Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, MIM# 261630 11153907 False 3 100;0;0 21.569 True ENSG00000151552 ENSG00000151552 HGNC:9752 QDPR gene QDPR Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, MIM#261630 26006720 False 3 100;0;0 21.569 True ENSG00000151552 ENSG00000151552 HGNC:9752 QDPR gene QDPR Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, MIM#261630;Dehydropteridin reductase deficiency, Infantile-onset dystonia;Parkinsonism;Epilepsy;Autonomic dysfunction;Hyperphenylalaninemia PMID: 28413401 False 3 100;0;0 21.569 True ENSG00000151552 ENSG00000151552 HGNC:9752 QDPR gene QDPR Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, 261630;Dihydropteridine reductase deficiency;Dystonia False 3 0;0;0 21.569 False ENSG00000151552 ENSG00000151552 HGNC:9752 QRSL1 gene QRSL1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 40 MIM#618835 26741492;29440775;30283131;30642647 False 3 100;0;0 21.569 True ENSG00000130348 ENSG00000130348 HGNC:21020 RAB11B gene RAB11B Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807 29106825 False 3 100;0;0 21.569 False ENSG00000185236 ENSG00000185236 HGNC:9761 RAB11B gene RAB11B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with ataxic gait, absent speech, and decreased cortical white matter 617807 29106825 False 3 100;0;0 21.569 True ENSG00000185236 ENSG00000185236 HGNC:9761 RAB18 gene RAB18 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Warburg micro syndrome 3, MIM# 614222 11237903;23420520 False 3 100;0;0 21.569 True ENSG00000099246 ENSG00000099246 HGNC:14244 RAB1A gene RAB1A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, RAB1A-related 37924809 False 3 100;0;0 21.569 False ENSG00000138069 ENSG00000138069 HGNC:9758 RAB32 gene RAB32 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Parkinson disease 26, autosomal dominant, susceptibility to}, MIM# 620923 38858457;38614108;38293014;40118982;40568674;41103171 False 3 33;33;33 21.569 True Other ENSG00000118508 ENSG00000118508 HGNC:9772 RAB39B gene RAB39B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Early-onset parkinsonism-intellectual disability syndrome MONDO:0010709 25434005;26399558;26739247 False 3 100;0;0 21.569 True ENSG00000155961 ENSG00000155961 HGNC:16499 RAB39B gene RAB39B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked 72 MIM#300271;Waisman syndrome MIM#311510 4025396;11050621;20159109 False 3 100;0;0 21.569 True ENSG00000155961 ENSG00000155961 HGNC:16499 RAB3A gene RAB3A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 52, MIM# 621535 40166812 False 3 100;0;0 21.569 True ENSG00000105649 ENSG00000105649 HGNC:9777 RAB3A gene RAB3A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092 40166812 False 3 100;0;0 21.569 True ENSG00000105649 ENSG00000105649 HGNC:9777 RAB3GAP2 gene RAB3GAP2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Martsolf syndrome 212720" PMID: 32376645 False 3 100;0;0 21.569 True ENSG00000118873 ENSG00000118873 HGNC:17168 RAB5C gene RAB5C Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder MONDO:0700092, RAB5C-related PMID: 37552066 False 3 100;0;0 21.569 True ENSG00000108774 ENSG00000108774 HGNC:9785 RAB7A gene RAB7A Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 2B, MIM# 600882;MONDO:0010949 17060578;15455439;12545426 False 3 100;0;0 21.569 True ENSG00000075785 ENSG00000075785 HGNC:9788 RAB7A gene RAB7A Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Disorders of autophagy;Charcot-Marie-Tooth disease type 2 MONDO:0018993 35159308;36449254;29884839 False 3 0;0;0 21.569 False ENSG00000075785 ENSG00000075785 HGNC:9788 RAB7A gene RAB7A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 2B, MIM# 600882;MONDO:0010949 12545426;17060578;32326241;29130394;25614874 False 3 100;0;0 21.569 False ENSG00000075785 ENSG00000075785 HGNC:9788 RAC3 gene RAC3 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with structural brain anomalies and dysmorphic facies, MIM#618577 35851598 False 3 100;0;0 21.569 True ENSG00000169750 ENSG00000169750 HGNC:9803 RAI1 gene RAI1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Smith-Magenis syndrome MIM#182290 36256819;11404004;12652298;15788730 False 3 100;0;0 21.569 True ENSG00000108557 ENSG00000108557 HGNC:9834 RALA gene RALA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hiatt-Neu-Cooper neurodevelopmental syndrome, MIM# 619311;Intellectual disability;Seizures 30500825 False 3 100;0;0 21.569 True ENSG00000006451 ENSG00000006451 HGNC:9839 RALGAPA1 gene RALGAPA1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, neonatal respiratory insufficiency, and thermodysregulation MIM#618797 32004447 False 3 100;0;0 21.569 True ENSG00000174373 ENSG00000174373 HGNC:17770 RANBP2 gene RANBP2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Encephalopathy, acute, infection-induced, 3, susceptibility to} MIM#608033 False 3 100;0;0 21.569 True ENSG00000153201 ENSG00000153201 HGNC:9848 RANBP2 gene RANBP2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Encephalopathy, acute, infection-induced, 3, susceptibility to} MIM#608033 32426208;35485383;33777149;19118815;25128471;25522933;32048120 False 3 100;0;0 21.569 True ENSG00000153201 ENSG00000153201 HGNC:9848 RARS gene RARS Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Australian Genomcis Health Alliance Leukodystrophy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 9 616140 False 3 100;0;0 21.569 False ENSG00000113643 ENSG00000113643 HGNC:9870 RARS gene RARS Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 9 (# 616140) 31814314 False 3 100;0;0 21.569 True ENSG00000113643 ENSG00000113643 HGNC:9870 RARS2 gene RARS2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 6 MIM#611523 31536827 False 3 67;0;33 21.569 True ENSG00000146282 ENSG00000146282 HGNC:21406 RARS2 gene RARS2 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 6, MIM# 611523 17847012;25809939;20635367;31429931 False 3 50;0;50 21.569 True ENSG00000146282 ENSG00000146282 HGNC:21406 RASA1 gene RASA1 Genomics England PanelApp;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Parkes Weber syndrome;Capillary malformation-arteriovenous malformation, 608354;Parkes Weber Syndrome;Parkes Weber syndrome (PKWS);Parkes Weber syndrome, 608355;Capillary Malformation-Arteriovenous Malformation Syndrome 14639529 False 3 100;0;0 21.569 False ENSG00000145715 ENSG00000145715 HGNC:9871 RBCK1 gene RBCK1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body myopathy 1 with or without immunodeficiency 615895 29260357;29695863 False 3 100;0;0 21.569 True ENSG00000125826 ENSG00000125826 HGNC:15864 RBCK1 gene RBCK1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body myopathy 1 with or without immunodeficiency MIM#615895 23798481;23104095 False 3 100;0;0 21.569 True ENSG00000125826 ENSG00000125826 HGNC:15864 RBFOX1 gene RBFOX1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), RBFOX1-related PMID: 37962958 False 3 100;0;0 21.569 True ENSG00000078328 ENSG00000078328 HGNC:18222 RBP4 gene RBP4 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Microphthalmia, isolated, with coloboma 10, MIM# 616428;Retinal dystrophy, iris coloboma, and comedogenic acne syndrome, MIM# 615147" 9888420;23189188;25910211;32323592;29847795;29178648;27892788 False 3 100;0;0 21.569 True ENSG00000138207 ENSG00000138207 HGNC:9922 RCC1 gene RCC1 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infection-induced acute-onset axonal neuropathy, MIM# 621333 40683276 False 3 100;0;0 21.569 False ENSG00000180198 ENSG00000180198 HGNC:1913 REEP1 gene REEP1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Spinal muscular atrophy, distal, autosomal recessive, 6, MIM#620011;Neuronopathy, distal hereditary motor, type VB MIM#614751;Spastic paraplegia 31, autosomal dominant MIM#610250 27066569;31872057;22703882;29124833 False 3 100;0;0 21.569 False Other ENSG00000068615 ENSG00000068615 HGNC:25786 REEP1 gene REEP1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 31, autosomal dominant, MIM# 610250" 16826527;19034539 False 3 100;0;0 21.569 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP1 gene REEP1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 31, autosomal dominant MIM#610250 23108492;22703882 False 3 100;0;0 21.569 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP2 gene REEP2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 72, dominant and recessive, MIM# 615625;MONDO:0014282 33526816;28491902;24388663 False 3 100;0;0 21.569 True ENSG00000132563 ENSG00000132563 HGNC:17975 RELN gene RELN Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Epilepsy, familial temporal lobe, 7}, MIM# 616436;MONDO:0014639 28142128 False 3 33;67;0 21.569 True ENSG00000189056 ENSG00000189056 HGNC:9957 RERE gene RERE Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart, MIM# 616975 30896913;27087320;23451234;30558068 False 3 100;0;0 21.569 True ENSG00000142599 ENSG00000142599 HGNC:9965 RETREG1 gene RETREG1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type IIB, 613115;HSAN/SFN 19838196;24327336;31737055;31596031 False 3 100;0;0 21.569 False ENSG00000154153 ENSG00000154153 HGNC:25964 RETREG1 gene RETREG1 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type IIB, MIM# 613115;MONDO:0013142 19838196;21115472;24327336;24327336;31737055;31596031 False 3 100;0;0 21.569 True ENSG00000154153 ENSG00000154153 HGNC:25964 RFC1 gene RFC1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome OMIM 614575 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 21.569 True Other ENSG00000035928 ENSG00000035928 HGNC:9969 RFC1 gene RFC1 Literature;Expert list;Expert Review Green;Expert Review Green;Expert list;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 21.569 False ENSG00000035928 ENSG00000035928 HGNC:9969 RFT1 gene RFT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type In, MIM# 612015;RFT1-CDG, MONDO:0012783 18313027;19701946;19856127;23111317;30071302;29923091;27927990;26892341 False 3 100;0;0 21.569 True ENSG00000163933 ENSG00000163933 HGNC:30220 RFT1 gene RFT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type In, MIM# 612015;RFT1-CDG, MONDO:0012783 18313027;19701946;19856127;23111317;30071302;29923091;27927990;26892341 False 3 100;0;0 21.569 True ENSG00000163933 ENSG00000163933 HGNC:30220 RHEB gene RHEB Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders Other Neurodevelopmental disorder MONDO:0700092, RHEB-related;Intellectual disability;Macrocephaly;Focal cortical dysplasia 31337748;29051493;39993836 False 3 100;0;0 21.569 True ENSG00000106615 ENSG00000106615 HGNC:10011 RHOBTB2 gene RHOBTB2 Expert Review Green;Other Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 64, MIM# 618004;Dystonia, hypertonia, movement disorder;truncal hypotonia;hemiparesis;developmental and epileptic encephalopathy" PMID: 29276004 False 3 0;0;0 21.569 True ENSG00000008853 ENSG00000008853 HGNC:18756 RHOBTB2 gene RHOBTB2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 64, MIM#618004 29768694;29276004;37165955 False 3 100;0;0 21.569 True ENSG00000008853 ENSG00000008853 HGNC:18756 RINT1 gene RINT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, MONDO:0019064, RINT1-related 37463447;38990652 False 3 50;50;0 21.569 True ENSG00000135249 ENSG00000135249 HGNC:21876 RMND1 gene RMND1 Expert Review Green;Other;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation defect type 11 MONDO:0013969 23022099;25604853;27843092 False 3 100;0;0 21.569 False ENSG00000155906 ENSG00000155906 HGNC:21176 RMND1 gene RMND1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 11 MIM#614922 23022098;25604853;26395190 False 3 100;0;0 21.569 True ENSG00000155906 ENSG00000155906 HGNC:21176 RMND1 gene RMND1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 11 MIM#614922 18835491;23022099;23022098;25604853;26395190 False 3 100;0;0 21.569 True ENSG00000155906 ENSG00000155906 HGNC:21176 RMRP gene RMRP Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of ribosomal biogenesis;cartilage-hair hypoplasia MONDO:0009595 29884839;38337186;16244706;21396580;22420014;11940090;16252239 False 3 100;0;0 21.569 True ENSG00000269900 ENSG00000269900 HGNC:10031 RNASEH1 gene RNASEH1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2 MIM#616479 26094573;31258551 False 3 100;0;0 21.569 True ENSG00000171865 ENSG00000171865 HGNC:18466 RNASEH2A gene RNASEH2A Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 4, MIM# 610333 17846997;16845400;23592335;27643693 False 3 100;0;0 21.569 True ENSG00000104889 ENSG00000104889 HGNC:18518 RNASEH2A gene RNASEH2A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 4 MIM#610333 15870678;25604658;23592335;20301648 False 3 100;0;0 21.569 True ENSG00000104889 ENSG00000104889 HGNC:18518 RNASEH2A gene RNASEH2A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Aicardi-Goutieres syndrome 4, MIM# 610333" 16845400;23592335;17846997 False 3 100;0;0 21.569 True ENSG00000104889 ENSG00000104889 HGNC:18518 RNASEH2B gene RNASEH2B Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Aicardi-Goutieres syndrome 2, MIM# 610181" 16845400 False 3 100;0;0 21.569 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNASEH2B gene RNASEH2B Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 2 MIM#610181 20131292;26860721 False 3 100;0;0 21.569 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNASEH2B gene RNASEH2B Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi Goutieres syndrome 2, MIM# 610181 29691679;30223285;29239743;28762473 False 3 100;0;0 21.569 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNASEH2B gene RNASEH2B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 2, MIM# 610181 16845400;33307271;29239743 False 3 100;0;0 21.569 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNASEH2B gene RNASEH2B Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 2, MIM# 610181 16845400;33307271;29239743 False 3 100;0;0 21.569 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNASEH2C gene RNASEH2C Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 3, MIM# 610329 16845400;29239743;29150899;27643693 False 3 100;0;0 21.569 True ENSG00000172922 ENSG00000172922 HGNC:24116 RNASEH2C gene RNASEH2C Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 3 (MIM# 610329) 24183309;23322642 False 3 100;0;0 21.569 True ENSG00000172922 ENSG00000172922 HGNC:24116 RNASEH2C gene RNASEH2C Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Aicardi-Goutieres syndrome 3, MIM# 610329" 16845400;23322642 False 3 100;0;0 21.569 True ENSG00000172922 ENSG00000172922 HGNC:24116 RNASEH2C gene RNASEH2C Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 3 MIM#610329 20131292;23322642 False 3 100;0;0 21.569 True ENSG00000172922 ENSG00000172922 HGNC:24116 RNASET2 gene RNASET2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951" 19525954 False 3 100;0;0 21.569 True ENSG00000026297 ENSG00000026297 HGNC:21686 RNASET2 gene RNASET2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy, cystic, without megalencephaly, MIM# 612951" 19525954 False 3 100;0;0 21.569 True ENSG00000026297 ENSG00000026297 HGNC:21686 RNASET2 gene RNASET2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, cystic, without megalencephaly MIM#612951 31349848;19525954;27091087;29336640;18545798;15851732 False 3 100;0;0 21.569 True ENSG00000026297 ENSG00000026297 HGNC:21686 RNF113A gene RNF113A Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Trichothiodystrophy 5, nonphotosensitive, MIM#300953 25612912;31880405;31793730;29133357;30506991;15256591;24026126;23555887 False 3 100;0;0 21.569 True ENSG00000125352 ENSG00000125352 HGNC:12974 RNF13 gene RNF13 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 73, MIM# 618379" 30595371 False 3 100;0;0 21.569 True Other ENSG00000082996 ENSG00000082996 HGNC:10057 RNF170 gene RNF170 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 85, autosomal recessive, MIM# 619686 31636353 False 3 100;0;0 21.569 True ENSG00000120925 ENSG00000120925 HGNC:25358 RNF170 gene RNF170 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia, sensory, 1, autosomal dominant, MIM# 608984 32943585;21115467 False 3 100;0;0 21.569 False ENSG00000120925 ENSG00000120925 HGNC:25358 RNF2 gene RNF2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lou-Schoch-Yamamoto syndrome , MIM#619460;epilepsy;intellectual disability;intrauterine growth retardation 33864376;40831499 False 3 50;50;0 21.569 True ENSG00000121481 ENSG00000121481 HGNC:10061 RNF213 gene RNF213 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Moyamoya disease, MONDO:0016820;pediatric arterial ischemic stroke, MONDO:0018585 37924258 False 3 100;0;0 21.569 True ENSG00000173821 ENSG00000173821 HGNC:14539 RNF213 gene RNF213 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted susceptibility to Moyamoya disease 2, (MIM# 607151) 21048783;28635953 False 3 100;0;0 21.569 True ENSG00000173821 ENSG00000173821 HGNC:14539 RNF216 gene RNF216 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 False 3 100;0;0 21.569 True ENSG00000011275 ENSG00000011275 HGNC:21698 RNF216 gene RNF216 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 23656588;25841028;27995769 False 3 100;0;0 21.569 True ENSG00000011275 ENSG00000011275 HGNC:21698 RNF220 gene RNF220 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum 33964137;10881263 False 3 100;0;0 21.569 True ENSG00000187147 ENSG00000187147 HGNC:25552 RNF220 gene RNF220 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum 33964137;10881263 False 3 100;0;0 21.569 True ENSG00000187147 ENSG00000187147 HGNC:25552 RNH1 gene RNH1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, acute, infection-induced, susceptibility to, 12 MIM#620461 PMID: 36935417;37191094 False 3 33;0;67 21.569 True ENSG00000023191 ENSG00000023191 HGNC:10074 RNU2-2P gene RNU2-2P Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 119, MIM# 621304 40210679;40442284;40950445 False 3 100;0;0 21.569 True ENSG00000222328 ENSG00000222328 HGNC:10152 RNU4-2 gene RNU4-2 Expert Review Green;Expert list;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, brain anomalies, distinctive facies, and absent language, MIM# 620851 38991538;40297424 False 3 100;0;0 21.569 True ENSG00000202538 ENSG00000202538 HGNC:10193 RNU4ATAC gene RNU4ATAC Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephalic osteodysplastic primordial dwarfism, type I (MIM# 210710);Roifman syndrome (MIM# 616651);Lowry-Wood syndrome, MIM# 226960 23794361;26522830;30455926;29265708;12605445 False 3 100;0;0 21.569 True ENSG00000264229 ENSG00000264229 HGNC:34016 RNU6ATAC gene RNU6ATAC Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Syndromic disease, MONDO:0002254, RNU6ATAC-related 41808409;40975062;41864208 False 3 33;33;33 21.569 True ENSG00000221676 ENSG00000221676 HGNC:34017 RNU7-1 gene RNU7-1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 9, MIM# 619487 33230297 False 3 100;0;0 21.569 True ENSG00000238923 ENSG00000238923 HGNC:34033 RNU7-1 gene RNU7-1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 9, MIM# 619487 33230297 False 3 100;0;0 21.569 True ENSG00000238923 ENSG00000238923 HGNC:34033 RNU7-1 gene RNU7-1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 9, MIM# 619487 33230297 False 3 100;0;0 21.569 True ENSG00000238923 ENSG00000238923 HGNC:34033 ROGDI gene ROGDI Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kohlschutter-Tonz syndrome, MIM# 226750 22424600;23086778;33866847 False 3 100;0;0 21.569 True ENSG00000067836 ENSG00000067836 HGNC:29478 RORA gene RORA Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, 618060 29656859 False 3 100;0;0 21.569 True ENSG00000069667 ENSG00000069667 HGNC:10258 RORA gene RORA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, MIM# 618060 29656859 False 3 100;0;0 21.569 True ENSG00000069667 ENSG00000069667 HGNC:10258 RORB gene RORB Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Epilepsy, idiopathic generalized, susceptibility to, 15} (MIM#618357), AD;Genetic generalized epilepsy (GGE);Photosensitive generalized and occipital epilepsy 27352968;32162308 False 3 100;0;0 21.569 True ENSG00000198963 ENSG00000198963 HGNC:10259 RPGRIP1L gene RPGRIP1L Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 7, MIM# 611560" False 3 100;0;0 21.569 True ENSG00000103494 ENSG00000103494 HGNC:29168 RPH3A gene RPH3A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO#0700092), RPH3A-related 37403762;29441694 False 3 100;0;0 21.569 True ENSG00000089169 ENSG00000089169 HGNC:17056 RPIA gene RPIA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ribose 5-phosphate isomerase deficiency, MIM# 608611" 31247379;14988808;31056085 False 3 100;0;0 21.569 True ENSG00000153574 ENSG00000153574 HGNC:10297 RPIA gene RPIA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ribose 5-phosphate isomerase deficiency, MIM# 608611;Leukoencephalopathy" 14988808;31056085;31247379 False 3 100;0;0 21.569 True ENSG00000153574 ENSG00000153574 HGNC:10297 RPS6KA3 gene RPS6KA3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Coffin-Lowry syndrome MIM# 303600;Intellectual disability;short stature;delayed bone age;hearing deficit;hypotonia;tapering fingers;abnormal facies (hypertelorism, anteverted nares, prominent frontal region) 12210291;6879200 False 3 100;0;0 21.569 True ENSG00000177189 ENSG00000177189 HGNC:10432 RPS6KC1 gene RPS6KC1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460 41130203 False 3 100;0;0 21.569 True ENSG00000136643 ENSG00000136643 HGNC:10439 RPS6KC1 gene RPS6KC1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460 41130203 False 3 100;0;0 21.569 True ENSG00000136643 ENSG00000136643 HGNC:10439 RRM2B gene RRM2B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075 24741716 False 3 100;0;0 21.569 True ENSG00000048392 ENSG00000048392 HGNC:17296 RRM2B gene RRM2B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) MIM#612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075 32827185;24741716 False 3 100;0;0 21.569 True ENSG00000048392 ENSG00000048392 HGNC:17296 RRM2B gene RRM2B Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy), 612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type), 612075;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 5, 613077 32827185;24741716 False 3 100;0;0 21.569 True ENSG00000048392 ENSG00000048392 HGNC:17296 RRM2B gene RRM2B Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy) 612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type) 612075 False 3 0;0;0 21.569 False ENSG00000048392 ENSG00000048392 HGNC:17296 RTN2 gene RTN2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 12, autosomal dominant, 604805;MONDO:0011489 22232211;27165006 False 3 100;0;0 21.569 True ENSG00000125744 ENSG00000125744 HGNC:10468 RTN2 gene RTN2 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 11, with spasticity, MIM# 620854 38527963 False 3 100;0;0 21.569 False ENSG00000125744 ENSG00000125744 HGNC:10468 RTN4IP1 gene RTN4IP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Optic atrophy 10 with or without ataxia, mental retardation, and seizures, MIM#616732 26593267;31077085 False 3 100;0;0 21.569 True ENSG00000130347 ENSG00000130347 HGNC:18647 RTN4IP1 gene RTN4IP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Optic atrophy 10 with or without ataxia, mental retardation, and seizures, MIM#616732 26593267;31077085 False 3 100;0;0 21.569 True ENSG00000130347 ENSG00000130347 HGNC:18647 RTTN gene RTTN Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, short stature, and polymicrogyria with seizures, MIM# 614833 30879067 False 3 100;0;0 21.569 True ENSG00000176225 ENSG00000176225 HGNC:18654 RUBCN gene RUBCN Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Royal Melbourne Hospital Clinical Genetics Department Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 15, MIM#615705 20826435;23728897 False 3 100;0;0 21.569 True ENSG00000145016 ENSG00000145016 HGNC:28991 RYR1 gene RYR1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Malignant hyperthermia susceptibility 1}, 145600;Central core disease, 117000;King-Denborough syndrome, 145600;Neuromuscular disease, congenital, with uniform type 1 fiber, 117000;Minicore myopathy with external ophthalmoplegia, 255320 20301325;23553484 False 3 67;33;0 21.569 True ENSG00000196218 ENSG00000196218 HGNC:10483 RYR1 gene RYR1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal calf predominant distal myopathy;distal myopathy MONDO:0018949 30842289;33458580 False 3 100;0;0 21.569 True ENSG00000196218 ENSG00000196218 HGNC:10483 SACS gene SACS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic ataxia, Charlevoix-Saguenay type, MIM@ 270550" False 3 100;0;0 21.569 True ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charlevoix-Saguenay spastic ataxia (MONDO:0010041;MIM#270550) 20301432;20876471 False 3 100;0;0 21.569 True ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type MIM#270550 False 3 100;0;0 21.569 True ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic ataxia, Charlevoix-Saguenay type, MIM# 270550" 22307627;20876471 False 3 100;0;0 21.569 True ENSG00000151835 ENSG00000151835 HGNC:10519 SAMD9L gene SAMD9L Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550 35310830;33884299;28570036 False 3 100;0;0 21.569 False ENSG00000177409 ENSG00000177409 HGNC:1349 SAMHD1 gene SAMHD1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi Goutieres syndrome 5, MIM# 612952 False 3 100;0;0 21.569 True ENSG00000101347 ENSG00000101347 HGNC:15925 SAMHD1 gene SAMHD1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 5, MIM# 612952 19525956;21102625;33307271 False 3 100;0;0 21.569 True ENSG00000101347 ENSG00000101347 HGNC:15925 SAMHD1 gene SAMHD1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Aicardi-Goutieres syndrome 5, MIM# 612952" 19525956 False 3 100;0;0 21.569 True ENSG00000101347 ENSG00000101347 HGNC:15925 SAMHD1 gene SAMHD1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 5, MIM# 612952 19525956;21102625;33307271;20301648 False 3 100;0;0 21.569 True ENSG00000101347 ENSG00000101347 HGNC:15925 SAMHD1 gene SAMHD1 Genomics England PanelApp;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Moyamoya disease 20653736;21402907 False 3 100;0;0 21.569 False ENSG00000101347 ENSG00000101347 HGNC:15925 SAR1B gene SAR1B Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Chylomicron retention disease, MIM# 246700" 12692552 False 3 100;0;0 21.569 True ENSG00000152700 ENSG00000152700 HGNC:10535 SARS gene SARS Literature;Expert Review Green;Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic peripheral neuropathy MONDO#0020127, SARS1-related 36088542 False 3 100;0;0 21.569 False ENSG00000031698 ENSG00000031698 HGNC:10537 SARS2 gene SARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis, MIM#613845 33751860;24034276;21255763 False 3 100;0;0 21.569 True ENSG00000104835 ENSG00000104835 HGNC:17697 SART3 gene SART3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO#0700092), SART3-related;46,XY disorder of sex development (MONDO:0020040), SART3-related PMID: 37296101 False 3 100;0;0 21.569 True ENSG00000075856 ENSG00000075856 HGNC:16860 SATB1 gene SATB1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Kohlschutter-Tonz syndrome-like, MIM# 619229;Neurodevelopmental disorder;Intellectual disability;Epilepsy;Microcephaly;Regression PMID: 33513338;33057194 False 3 67;33;0 21.569 True Other ENSG00000182568 ENSG00000182568 HGNC:10541 SATB2 gene SATB2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Glass syndrome, MIM# 612313;MONDO:0100147 32446642 False 3 100;0;0 21.569 True ENSG00000119042 ENSG00000119042 HGNC:21637 SBF1 gene SBF1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B3 , MIM#615284;MONDO:0014117 23749797;23749797;32444983;30039846;28005197 False 3 100;0;0 21.569 True ENSG00000100241 ENSG00000100241 HGNC:10542 SBF2 gene SBF2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Charcot Marie Tooth disease, type 4B2, MIM#604563 12554688;15477569;12687498;15304601;31772832;31070812 False 3 100;0;0 21.569 False ENSG00000133812 ENSG00000133812 HGNC:2135 SC5D gene SC5D Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lathosterolosis, MIM# 607330" 17853487;12189593;12812989;24142275 False 3 100;0;0 21.569 True ENSG00000109929 ENSG00000109929 HGNC:10547 SCAF4 gene SCAF4 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Fliedner-Zweier syndrome, MIM#620511 32730804 False 3 100;0;0 21.569 True ENSG00000156304 ENSG00000156304 HGNC:19304 SCAMP5 gene SCAMP5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, SCAMP5-related 31439720;33390987 False 3 100;0;0 21.569 True Other ENSG00000198794 ENSG00000198794 HGNC:30386 SCARB2 gene SCARB2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive Myoclonus Epilepsy, MONDO:0020074;Epilepsy, progressive myoclonic 4, with or without renal failure, MIM #254900 18308289;18424452;23659519;19847901;18022370;19933215 False 3 100;0;0 21.569 True ENSG00000138760 ENSG00000138760 HGNC:1665 SCARB2 gene SCARB2 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal action myoclonus-renal failure syndrome MONDO:0009699;Other disorders of complex molecule degradation 26677510;29884839 False 3 0;0;0 21.569 False ENSG00000138760 ENSG00000138760 HGNC:1665 SCN10A gene SCN10A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown HSAN/SFN;Episodic pain syndrome, familial, 2, 615551 23115331;33775738;30731422;30554136 False 3 100;0;0 21.569 False ENSG00000185313 ENSG00000185313 HGNC:10582 SCN10A gene SCN10A Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Small fibre neuropathy;Episodic pain syndrome, familial, 2, MIM# 615551 33775738;30731422;30554136;23115331;26711856;24776970;25316021;25250524;24006052;28665811;27598514;24813307 False 3 100;0;0 21.569 True ENSG00000185313 ENSG00000185313 HGNC:10582 SCN11A gene SCN11A Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic pain syndrome, familial, 3, MIM# 615552 30554136;28298626;24776970;25316021;24207120;27503742;24036948;28665811;24813307;26645915 False 3 100;0;0 21.569 True Other ENSG00000168356 ENSG00000168356 HGNC:10583 SCN11A gene SCN11A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuropathy, hereditary sensory and autonomic, type VII, MIM# 615548;MONDO:0014244 24036948;25118027;30395542;33884296;32831372;30046661 False 3 100;0;0 21.569 False ENSG00000168356 ENSG00000168356 HGNC:10583 SCN1A gene SCN1A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epilepsy, generalized, with febrile seizures plus, type 2 604403;Epileptic encephalopathy, early infantile, 6 (Dravet syndrome) 607208;Developmental and epileptic encephalopathy 6B, non-Dravet, MIM# 619317;Febrile seizures, familial, 3A 604403 30368457;12754708;25754450;32928894 False 3 67;33;0 21.569 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN1A gene SCN1A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 6 (Dravet syndrome), MIM# 607208 27264139;27817982;28732259 False 3 67;33;0 21.569 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN1A gene SCN1A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dravet syndrome, MIM# 607208;Epilepsy, Paekinsonism PMID: 28186331;24850485 False 3 100;0;0 21.569 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN1A gene SCN1A Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dravet syndrome 607208;Epilepsy, generalized, with febrile seizures plus, type 2 604403;Febrile seizures, familial, 3A 604403;Migraine, familial hemiplegic, 3 609634 False 3 100;0;0 21.569 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN1B gene SCN1B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy (MONDO:0100062);generalized epilepsy with febrile seizures plus (MONDO:0018214) 19710327;28218389;23148524 False 3 100;0;0 21.569 True ENSG00000105711 ENSG00000105711 HGNC:10586 SCN2A gene SCN2A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Seizures, benign familial infantile, 3, MIM# 607745;Developmental and epileptic encephalopathy 11, MIM# 613721 19786696;23662938;15028761;30185235;20956790;24650168;23935176;22495306 False 3 100;0;0 21.569 True ENSG00000136531 ENSG00000136531 HGNC:10588 SCN2A gene SCN2A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Early infantile epileptic encephalopathy 11, MIM# 613721 False 3 100;0;0 21.569 True ENSG00000136531 ENSG00000136531 HGNC:10588 SCN3A gene SCN3A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial focal, with variable foci 4, MIM# 617935;Epileptic encephalopathy, early infantile, 62, MIM# 617938;Intellectual disability;Malformations of cortical development 32515017 False 3 100;0;0 21.569 True Other ENSG00000153253 ENSG00000153253 HGNC:10590 SCN4A gene SCN4A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Paramyotonia congenita, 168300;Myotonia congenita, atypical, acetazolamide-responsive, 608390;Hypokalemic periodic paralysis, type 2, 613345;Myasthenic syndrome, congenital, 16, 614198;Hyperkalemic periodic paralysis, type 2, 170500 23801527;28779239;32978841 False 3 100;0;0 21.569 True ENSG00000007314 ENSG00000007314 HGNC:10591 SCN8A gene SCN8A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy 13, 614558;Cognitive impairment with or without cerebellar ataxia, 614306 31904124;31887642;31675620 False 3 100;0;0 21.569 True ENSG00000196876 ENSG00000196876 HGNC:10596 SCN8A gene SCN8A Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myoclonus, familial, 2, MIM# 618364;epilepsy;paroxysmal kinesigenic dyskinesias 29726066;27098556 False 3 100;0;0 21.569 True ENSG00000196876 ENSG00000196876 HGNC:10596 SCN8A gene SCN8A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 13, MIM# 614558;dominant and recessive 31625145;30842224;24888894 False 3 67;33;0 21.569 True Other ENSG00000196876 ENSG00000196876 HGNC:10596 SCN9A gene SCN9A Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal HSAN2D, autosomal recessive, AR, 243000;Erythermalgia, primary, AD, 133020;Small fiber neuropathy, AD,133020;Insensitivity to pain, congenital, AR, 243000;Paroxysmal extreme pain disorder, AD, 167400 16392115;17167479;17470132;17145499;17679678;25316021;15958509;28665811;23596073;24817410;28235406;16216943;24813307;14985375;1536168 False 3 0;0;0 21.569 False ENSG00000169432 ENSG00000169432 HGNC:10597 SCN9A gene SCN9A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Erythermalgia, primary, MIM# 133020;Insensitivity to pain, congenital, MIM# 243000;Neuropathy, hereditary sensory and autonomic, type IID, MIM# 243000;Paroxysmal extreme pain disorder, MIM# 167400;Small fiber neuropathy,MIM# 133020 False 3 100;0;0 21.569 False ENSG00000169432 ENSG00000169432 HGNC:10597 SCO1 gene SCO1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency 220110 False 3 0;0;0 21.569 False ENSG00000133028 ENSG00000133028 HGNC:10603 SCO1 gene SCO1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 4, MIM# 619048 11013136;19295170;31352446;23878101 False 3 100;0;0 21.569 True ENSG00000133028 ENSG00000133028 HGNC:10603 SCO2 gene SCO2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377 10545952;11673586;18924171;20159436;29351582;26427993;31844624 False 3 67;33;0 21.569 True ENSG00000130489 ENSG00000130489 HGNC:10604 SCO2 gene SCO2 Expert Review Green;Other;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1 MONDO:0011451 23719228 False 3 100;0;0 21.569 True ENSG00000130489 ENSG00000130489 HGNC:10604 SCO2 gene SCO2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 2, MIM# 604377 False 3 67;33;0 21.569 True ENSG00000130489 ENSG00000130489 HGNC:10604 SCO2 gene SCO2 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1 604377 False 3 0;0;0 21.569 False ENSG00000130489 ENSG00000130489 HGNC:10604 SCO2 gene SCO2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive axonal charcot-marie-tooth disease due to copper metabolism defect MONDO:0033850 29351582;31844624;35112411 False 3 100;0;0 21.569 False ENSG00000130489 ENSG00000130489 HGNC:10604 SCYL1 gene SCYL1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 21 (MIM#616719);acute infantile liver failure-cerebellar ataxia-peripheral sensory motor neuropathy syndrome (MONDO:0014744);Spinocerebellar ataxia, autosomal recessive 21;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy 26581903;30531813 False 3 100;0;0 21.569 True ENSG00000142186 ENSG00000142186 HGNC:14372 SCYL1 gene SCYL1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 21, 616719;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy 29419818;17571074;26581903;30531813 False 3 100;0;0 21.569 True ENSG00000142186 ENSG00000142186 HGNC:14372 SCYL2 gene SCYL2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita 4, neurogenic, with agenesis of the corpus callosum, MIM# 618766 31960134;26203146;40243816;39169672 False 3 100;0;0 21.569 True ENSG00000136021 ENSG00000136021 HGNC:19286 SDHA gene SDHA Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial respiratory chain complex II deficiency, MIM#252011 False 3 100;0;0 21.569 False ENSG00000073578 ENSG00000073578 HGNC:10680 SDHA gene SDHA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial complex II deficiency, nuclear type 1, MIM# 252011;Cardiomyopathy, dilated, 1GG, MIM# 613642;Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259 10976639;27683074;7550341;22972948;20551992;21752896 False 3 100;0;0 21.569 True ENSG00000073578 ENSG00000073578 HGNC:10680 SDHAF1 gene SDHAF1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex II deficiency 252011 False 3 0;0;0 21.569 False ENSG00000205138 ENSG00000205138 HGNC:33867 SDHAF1 gene SDHAF1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex II deficiency, nuclear type 2, MIM# 619166 19465911;26749241;22995659 False 3 100;0;0 21.569 True ENSG00000205138 ENSG00000205138 HGNC:33867 SDHB gene SDHB Expert Review Green;Royal Melbourne Hospital;Australian Genomcis Health Alliance Leukodystrophy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinate dehydrogenase-deficient leukoencephalopathy;Mitochondrial complex II deficiency, nuclear type 4, MIM# 619224;Complex II deficiency;mitochondrial leucoencephalopathy 22972948;26925370;27604842 False 3 100;0;0 21.569 True ENSG00000117118 ENSG00000117118 HGNC:10681 SDHB gene SDHB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex II deficiency, nuclear type 4, MIM# 619224;Complex II deficiency;mitochondrial leucoencephalopathy 22972948;26925370;27604842 False 3 100;0;0 21.569 True ENSG00000117118 ENSG00000117118 HGNC:10681 SDHD gene SDHD Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex II deficiency, nuclear type 3, MIM# 619167 24367056;26008905 False 3 100;0;0 21.569 True ENSG00000204370 ENSG00000204370 HGNC:10683 SEC23B gene SEC23B Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dyserythropoietic anemia, congenital, type II 224100;COPII component SEC23B (Disorders of multiple glycosylation and other glycosylation pathways, V-ATPase deficiencies) 19561605;19621418 False 3 100;0;0 21.569 True ENSG00000101310 ENSG00000101310 HGNC:10702 SEC31A gene SEC31A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with spastic quadriplegia, optic atrophy, seizures, and structural brain anomalies, MIM# 618651;congenital neurodevelopmental syndrome;spastic paraplegia;multiple contractures;profound developmental delay;epilepsy;failure to thrive" 30464055;40508110;39725565 False 3 100;0;0 21.569 True ENSG00000138674 ENSG00000138674 HGNC:17052 SEC31A gene SEC31A Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Halperin-Birk syndrome, MIM# 618651" 30464055;40508110 False 3 100;0;0 21.569 True ENSG00000138674 ENSG00000138674 HGNC:17052 SECISBP2 gene SECISBP2 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal thyroid hormone metabolism, abnormal 1 MONDO:0800046;Other disorders of trace element metabolism 16228000, 19602558, 21084748, 22247018 False 3 0;0;0 21.569 False ENSG00000187742 ENSG00000187742 HGNC:30972 SECISBP2 gene SECISBP2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thyroid hormone metabolism, abnormal, 1, MIM# 609698 39315526 False 3 100;0;0 21.569 True ENSG00000187742 ENSG00000187742 HGNC:30972 SELENOI gene SELENOI Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 81, autosomal recessive, MIM# 618768 28052917;39806532;29500230;33454747 False 3 100;0;0 21.569 True ENSG00000138018 ENSG00000138018 HGNC:29361 SELENOI gene SELENOI Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 81, autosomal recessive 618768 28052917;29500230;39806532;33454747 False 3 100;0;0 21.569 True ENSG00000138018 ENSG00000138018 HGNC:29361 SEMA6B gene SEMA6B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive myoclonic epilepsy 32169168 False 3 100;0;0 21.569 True Other ENSG00000167680 ENSG00000167680 HGNC:10739 SEPSECS gene SEPSECS Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2D, MIM# 613811 20920667;25044680;31748115;29464431 False 3 50;0;50 21.569 True ENSG00000109618 ENSG00000109618 HGNC:30605 SEPSECS gene SEPSECS Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pontocerebellar hypoplasia type 2D MONDO:0013438;Other disorders of trace element metabolism 20920667, 25044680, 31748115, 29464431 False 3 0;0;0 21.569 False ENSG00000109618 ENSG00000109618 HGNC:30605 SEPT9 gene SEPT9 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophy, hereditary neuralgic, MIM# 162100;HMSN 16186812;19451530;19939853;19139049 False 3 100;0;0 21.569 False ENSG00000184640 ENSG00000184640 HGNC:7323 SEPT9 gene SEPT9 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophy, hereditary neuralgic, 162100;Hereditary neuralgic amyotrophy 21556032;16186812;19451530 False 3 100;0;0 21.569 True ENSG00000184640 ENSG00000184640 HGNC:7323 SERAC1 gene SERAC1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-MEthylGlutaconic aciduria, Dystonia-Deafness, Hepatopathy, Encephalopathy, Leigh-like syndrome;3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, 614739;Lesions in the basal ganglia False 3 0;0;0 21.569 False ENSG00000122335 ENSG00000122335 HGNC:21061 SERAC1 gene SERAC1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739 29205472;32684373;24741715 False 3 100;0;0 21.569 True ENSG00000122335 ENSG00000122335 HGNC:21061 SERAC1 gene SERAC1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739;Parkinsonism PMID: 29332177;16527507 False 3 100;0;0 21.569 True ENSG00000122335 ENSG00000122335 HGNC:21061 SERAC1 gene SERAC1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739 False 3 100;0;0 21.569 True ENSG00000122335 ENSG00000122335 HGNC:21061 SERAC1 gene SERAC1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome MIM#614739" PMID: 27186703;24997715 False 3 0;100;0 21.569 True ENSG00000122335 ENSG00000122335 HGNC:21061 SERPINI1 gene SERPINI1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Encephalopathy, familial, with neuroserpin inclusion bodies MIM#604218 28631894;25401298;12103288 False 3 100;0;0 21.569 True ENSG00000163536 ENSG00000163536 HGNC:8943 SETBP1 gene SETBP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Schinzel-Giedion midface retraction syndrome, MIM# 269150;Intellectual disability, autosomal dominant 29, MIM# 616078 20436468;25217958;34807554 False 3 100;0;0 21.569 True ENSG00000152217 ENSG00000152217 HGNC:15573 SETD1A gene SETD1A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, early-onset, with or without developmental delay, MIM# 618832;Neurodevelopmental disorder with speech impairment and dysmorphic facies, MIM# 619056 31197650;32346159 False 3 100;0;0 21.569 True ENSG00000099381 ENSG00000099381 HGNC:29010 SETD1B gene SETD1B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy with myoclonic absences;intellectual disability;Intellectual developmental disorder with seizures and language delay (IDDSELD), MIM#619000 29322246;31440728;31685013 False 3 100;0;0 21.569 True ENSG00000139718 ENSG00000139718 HGNC:29187 SETD5 gene SETD5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability, autosomal dominant 23 (MIM # 615761) 29484850 False 3 0;0;0 21.569 True ENSG00000168137 ENSG00000168137 HGNC:25566 SETX gene SETX Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis 4, juvenile (MIM#602433) 15106121;9497266 False 3 100;0;0 21.569 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002 False 3 100;0;0 21.569 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2, MIM# 606002" 19696032 False 3 100;0;0 21.569 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal dHMN/dSMA;Amyotrophic lateral sclerosis 4, juvenile MIM# 602433;Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 23129421;16644229;30052327 False 3 100;0;0 21.569 True ENSG00000107290 ENSG00000107290 HGNC:445 SFXN4 gene SFXN4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 18, MIM#615578 24119684;31059822 False 3 100;0;0 21.569 True ENSG00000183605 ENSG00000183605 HGNC:16088 SGCA gene SGCA Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 3 MIM#608099 27297959;26453141;23989969 False 3 100;0;0 21.569 True ENSG00000108823 ENSG00000108823 HGNC:10805 SGCA gene SGCA Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Limb-girdle muscular dystrophy;Muscular dystrophy, limb-girdle, type 2D, 608099;autosomal recessive limb-girdle muscular dystrophy, MONDO:0015152 30007747;9192266;34404573 False 3 100;0;0 21.569 True ENSG00000108823 ENSG00000108823 HGNC:10805 SGCB gene SGCB Expert Review;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2E, 604286 False 3 100;0;0 21.569 False ENSG00000163069 ENSG00000163069 HGNC:10806 SGCD gene SGCD Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2F, 601287 False 3 67;0;33 21.569 False ENSG00000170624 ENSG00000170624 HGNC:10807 SGCE gene SGCE Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Dystonia-11, myoclonic, MIM# 159900;MONDO:0008044 11528394;12821748;16227522 False 3 100;0;0 21.569 False ENSG00000127990 ENSG00000127990 HGNC:10808 SGCE gene SGCE Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Dystonia-11, myoclonic, MIM# 159900 15389977;12821748;24297365 False 3 100;0;0 21.569 True ENSG00000127990 ENSG00000127990 HGNC:10808 SGCG gene SGCG Expert Review Green;Expert Review;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2C, 253700 30838351;25802879 False 3 100;0;0 21.569 True ENSG00000102683 ENSG00000102683 HGNC:10809 SGSH gene SGSH Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type IIIA (Sanfilippo A), 252900 21061399;30593151 False 3 100;0;0 21.569 True ENSG00000181523 ENSG00000181523 HGNC:10818 SGSH gene SGSH Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis type IIIA (Sanfilippo A), MIM# 252900;MONDO:0009655 7493035;9158154;9401012;9554748 False 3 100;0;0 21.569 True ENSG00000181523 ENSG00000181523 HGNC:10818 SH3TC2 gene SH3TC2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal HMSN;Charcot Marie Tooth disease, type 4C, 601596;Mononeuropathy of the median nerve, mild, 613353 19744956;20220177;19744956;20028792 False 3 100;0;0 21.569 False ENSG00000169247 ENSG00000169247 HGNC:29427 SHANK3 gene SHANK3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Phelan-McDermid syndrome MIM#606232 PMID: 37655421 False 3 100;0;0 21.569 True ENSG00000251322 ENSG00000251322 HGNC:14294 SHH gene SHH Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders Other Hypothalamic hamartoma False 3 100;0;0 21.569 True ENSG00000164690 ENSG00000164690 HGNC:10848 SHMT2 gene SHMT2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121;Congenital microcephaly;Infantile axial hypotonia;Spastic paraparesis;Global developmental delay;Intellectual disability;Abnormality of the corpus callosum;Abnormal cortical gyration;Hypertrophic cardiomyopathy;Abnormality of the face;Proximal placement of thumb;2-3 toe syndactyly 33015733 False 3 100;0;0 21.569 True ENSG00000182199 ENSG00000182199 HGNC:10852 SHMT2 gene SHMT2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121;Congenital microcephaly;Infantile axial hypotonia;Spastic paraparesis;Global developmental delay;Intellectual disability;Abnormality of the corpus callosum;Abnormal cortical gyration;Hypertrophic cardiomyopathy;Abnormality of the face;Proximal placement of thumb;2-3 toe syndactyly 33015733 False 3 100;0;0 21.569 True ENSG00000182199 ENSG00000182199 HGNC:10852 SHQ1 gene SHQ1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 35, childhood-onset , MIM# 619921;Neurodevelopmental disorder with dystonia and seizures, MIM# 619922 34542157;29178645;36847845;37475611 False 3 100;0;0 21.569 True ENSG00000144736 ENSG00000144736 HGNC:25543 SHROOM4 gene SHROOM4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females epilepsy, idiopathic generalised, SHROOM4-related, MONDO:0005579 35663265 False 3 100;0;0 21.569 True ENSG00000158352 ENSG00000158352 HGNC:29215 SI gene SI Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Sucrase-isomaltase deficiency, congenital, MIM# 222900" False 3 100;0;0 21.569 True ENSG00000090402 ENSG00000090402 HGNC:10856 SIGMAR1 gene SIGMAR1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 67;33;0 21.569 False ENSG00000147955 ENSG00000147955 HGNC:8157 SIGMAR1 gene SIGMAR1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Distal spinal muscular atrophy, autosomal recessive 2;dHMN/dSMA;Distal hereditary motor neuropathy of Jerash type (HMNJ) 31511340 False 3 100;0;0 21.569 False ENSG00000147955 ENSG00000147955 HGNC:8157 SIK1 gene SIK1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 30, MIM#616341;developmental and epileptic encephalopathy, MONDO#0100062 25839329;27966542;35267137 False 3 100;0;0 21.569 True ENSG00000142178 ENSG00000142178 HGNC:11142 SIL1 gene SIL1 Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Marinesco-Sjogren syndrome 248800 False 3 100;0;0 21.569 False ENSG00000120725 ENSG00000120725 HGNC:24624 SIL1 gene SIL1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Marinesco-Sjogren syndrome, 248800 False 3 100;0;0 21.569 False ENSG00000120725 ENSG00000120725 HGNC:24624 SKOR2 gene SKOR2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Valence-Farazi cerebellar ataxia syndrome, MIM# 621386 40890458;29997391;21937600 False 3 100;0;0 21.569 True ENSG00000215474 ENSG00000215474 HGNC:32695 SLC10A1 gene SLC10A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Familial hypercholanemia-2, MIM#619256 24867799;27882152;28835676;29290974;31201272 False 3 100;0;0 21.569 True ENSG00000100652 ENSG00000100652 HGNC:10905 SLC10A7 gene SLC10A7 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Short stature, amelogenesis imperfecta, and skeletal dysplasia with scoliosis, MIM# 618363 30082715;29878199;31191616 False 3 100;0;0 21.569 True ENSG00000120519 ENSG00000120519 HGNC:23088 SLC11A2 gene SLC11A2 NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal AHMIO1;206100 Anemia, hypochromic microcytic, with iron overload 1;AHMIO1 DMT1-related anemia;206100 ANEMIA, HYPOCHROMIC MICROCYTIC, WITH IRON OVERLOAD 1;DMT1-related anemia 16439678;15459009;16160008 False 3 100;0;0 21.569 False ENSG00000110911 ENSG00000110911 HGNC:10908 SLC12A3 gene SLC12A3 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of magnesium metabolism;Gitelman syndrome MONDO:0009904 34604137, 35170241 False 3 0;0;0 21.569 False ENSG00000070915 ENSG00000070915 HGNC:10912 SLC12A5 gene SLC12A5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Developmental and epileptic encephalopathy 34, MIM# 616645;{Epilepsy, idiopathic generalized, susceptibility to, 14}, MIM# 616685 26333769;27436767;24928908;30763027;24668262 False 3 50;50;0 21.569 True ENSG00000124140 ENSG00000124140 HGNC:13818 SLC12A6 gene SLC12A6 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Andermann syndrome;Hereditary Motor and Sensory Neuropathy with Agenesis of the Corpus Callosum;Charcot-Marie-Tooth disease, axonal, type 2II , MIM#620068 31439721 False 3 100;0;0 21.569 True ENSG00000140199 ENSG00000140199 HGNC:10914 SLC13A3 gene SLC13A3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384) 30635937;35527102;https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID) False 3 100;0;0 21.569 True ENSG00000158296 ENSG00000158296 HGNC:14430 SLC13A3 gene SLC13A3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384) https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID) False 3 100;0;0 21.569 True ENSG00000158296 ENSG00000158296 HGNC:14430 SLC13A3 gene SLC13A3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384) 30635937;35527102;https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID) False 3 100;0;0 21.569 True ENSG00000158296 ENSG00000158296 HGNC:14430 SLC13A5 gene SLC13A5 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 25, with amelogenesis imperfecta MIM#615905;MONDO:0014392 24995870;26384929 False 3 100;0;0 21.569 True ENSG00000141485 ENSG00000141485 HGNC:23089 SLC16A1 gene SLC16A1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Monocarboxylate transporter 1 deficiency, MIM# 616095" 25390740 False 3 100;0;0 21.569 True ENSG00000155380 ENSG00000155380 HGNC:10922 SLC16A2 gene SLC16A2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, MIM# 300523 15980113;31410843;20301789 False 3 100;0;0 21.569 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC16A2 gene SLC16A2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, 300523, XL 15980113;31410843;20301789 False 3 100;0;0 21.569 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC16A2 gene SLC16A2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, MIM# 300523;Hypomyelination 15980113;31410843;20301789 False 3 100;0;0 21.569 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC16A2 gene SLC16A2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, MIM# 300523 15980113;31410843;20301789 False 3 100;0;0 21.569 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC17A5 gene SLC17A5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Salla disease 604369;MONDO:0011449;Sialic acid storage disorder, infantile 269920;MONDO:0010027 10581036;10947946 False 3 100;0;0 21.569 True ENSG00000119899 ENSG00000119899 HGNC:10933 SLC17A5 gene SLC17A5 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Salla disease;Sialic acid storage disease, severe infantile type, MIM# 269920 26171070 False 3 100;0;0 21.569 True ENSG00000119899 ENSG00000119899 HGNC:10933 SLC17A5 gene SLC17A5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Salla disease 604369;Sialic acid storage disorder, infantile 269920" 16417876 False 3 100;0;0 21.569 True ENSG00000119899 ENSG00000119899 HGNC:10933 SLC18A2 gene SLC18A2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Parkinsonism-dystonia, infantile, 2, MIM# 618049" 23363473;31240161;26497564;9427250;11463816;9427251 False 3 100;0;0 21.569 True ENSG00000165646 ENSG00000165646 HGNC:10935 SLC18A2 gene SLC18A2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Parkinsonism-dystonia, infantile, 2, MIM# 618049" 23363473;31240161;26497564 False 3 100;0;0 21.569 True ENSG00000165646 ENSG00000165646 HGNC:10935 SLC18A2 gene SLC18A2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 2 , MIM# 618049;Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism 33983693;23363473;31240161;26497564 False 3 100;0;0 21.569 True ENSG00000165646 ENSG00000165646 HGNC:10935 SLC19A2 gene SLC19A2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine-responsive megaloblastic anaemia syndrome, MIM# 249270 10391221;10978358 False 3 100;0;0 21.569 True ENSG00000117479 ENSG00000117479 HGNC:10938 SLC19A3 gene SLC19A3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483 15871139;20065143;23482991;24878502;23589815;24166474;26975589;27896110 False 3 100;0;0 21.569 True ENSG00000135917 ENSG00000135917 HGNC:16266 SLC19A3 gene SLC19A3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483;Childhood onset Dystonia and Parkinsonism PMID: 24260777 False 3 100;0;0 21.569 True ENSG00000135917 ENSG00000135917 HGNC:16266 SLC19A3 gene SLC19A3 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2) 607483;Dystonia False 3 0;0;0 21.569 False ENSG00000135917 ENSG00000135917 HGNC:16266 SLC19A3 gene SLC19A3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2) MIM#607483 PMID: 37670342;23269594;26863430 False 3 100;0;0 21.569 True ENSG00000135917 ENSG00000135917 HGNC:16266 SLC1A2 gene SLC1A2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 41, MIM# 617105 27476654;28777935;30937933;23934111 False 3 100;0;0 21.569 True Other ENSG00000110436 ENSG00000110436 HGNC:10940 SLC1A3 gene SLC1A3 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Episodic ataxia, type 6;Episodic ataxia type 6, 612656 False 3 100;0;0 21.569 False ENSG00000079215 ENSG00000079215 HGNC:10941 SLC1A3 gene SLC1A3 Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 6 MIM#612656 16116111;23107647;19139306;29741614;25497598;29208948;29062094 False 3 100;0;0 21.569 True ENSG00000079215 ENSG00000079215 HGNC:10941 SLC1A3 gene SLC1A3 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 6, MIM# 612656 19139306;16116111;29208948;27829685;32741053 False 3 100;0;0 21.569 True ENSG00000079215 ENSG00000079215 HGNC:10941 SLC1A4 gene SLC1A4 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, 616657;MONDO:0014725 25930971;26138499;26041762;27193218;29989513 False 3 100;0;0 21.569 True ENSG00000115902 ENSG00000115902 HGNC:10942 SLC1A4 gene SLC1A4 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, MIM# 616657;MONDO:0014725" 29989513;27193218;26138499;26041762;25930971 False 3 100;0;0 21.569 True ENSG00000115902 ENSG00000115902 HGNC:10942 SLC20A2 gene SLC20A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 1, MIM# 213600 22327515;23334463 False 3 100;0;0 21.569 True ENSG00000168575 ENSG00000168575 HGNC:10947 SLC20A2 gene SLC20A2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 1 213600;Dystonia 22327515;23334463;24411498 False 3 100;0;0 21.569 True ENSG00000168575 ENSG00000168575 HGNC:10947 SLC20A2 gene SLC20A2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 1, MIM# 213600 22327515;23334463;28162874;31267306;35850697;34025715 False 3 100;0;0 21.569 True ENSG00000168575 ENSG00000168575 HGNC:10947 SLC22A5 gene SLC22A5 Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine deficiency, systemic primary 212140 9916797;10072434;10051646;10425211;10480371;10679939;9837751;23379544;31399326 False 3 100;0;0 21.569 True ENSG00000197375 ENSG00000197375 HGNC:10969 SLC22A5 gene SLC22A5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine deficiency, systemic primary, MIM# 212140 False 3 100;0;0 21.569 True ENSG00000197375 ENSG00000197375 HGNC:10969 SLC22A5 gene SLC22A5 Expert Review Green;Literature;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine deficiency, systemic primary MIM#212140 9916797;25778941;17884651 False 3 100;0;0 21.569 True ENSG00000197375 ENSG00000197375 HGNC:10969 SLC25A1 gene SLC25A1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072 26870663;31527857;31808147;23561848;23393310 False 3 100;0;0 21.569 True ENSG00000100075 ENSG00000100075 HGNC:10979 SLC25A1 gene SLC25A1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined D-2- and L-2-hydroxyglutaric aciduria MIM#: 615182, MONDO:0014072;Myasthenic syndrome, congenital, 23, presynaptic, MIM#618197, MONDO:0032596 26870663;31527857;31808147;23561848;23393310 False 3 100;0;0 21.569 True ENSG00000100075 ENSG00000100075 HGNC:10979 SLC25A12 gene SLC25A12 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 39, MIM# 612949 19641205;24515575;35008954;32700846;31766059;31514314 False 3 100;0;0 21.569 True ENSG00000115840 ENSG00000115840 HGNC:10982 SLC25A12 gene SLC25A12 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 39, MIM# 612949 19641205;24515575;35008954;32700846;31766059;31514314 False 3 100;0;0 21.569 True ENSG00000115840 ENSG00000115840 HGNC:10982 SLC25A12 gene SLC25A12 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelination, global cerebral 612949 False 3 0;0;0 21.569 False ENSG00000115840 ENSG00000115840 HGNC:10982 SLC25A15 gene SLC25A15 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome MIM#238970 16376511;22465082;28592010 False 3 100;0;0 21.569 False ENSG00000102743 ENSG00000102743 HGNC:10985 SLC25A19 gene SLC25A19 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive demyelinating neuropathy with bilateral striatal necrosis MONDO:0013382 20301539 False 3 100;0;0 21.569 True ENSG00000125454 ENSG00000125454 HGNC:14409 SLC25A19 gene SLC25A19 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, Amish type, MIM#607196;Thiamine metabolism dysfunction syndrome 4 (progressive polyneuropathy type), MIM#613710 31506564;31295743;12185364;19798730 False 3 100;0;0 21.569 True ENSG00000125454 ENSG00000125454 HGNC:14409 SLC25A20 gene SLC25A20 Expert Review Green;Expert Review Green;NHS GMS;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine-acylcarnitine translocase deficiency MIM#212138 9399886;31108048;25778941 False 3 100;0;0 21.569 True ENSG00000178537 ENSG00000178537 HGNC:1421 SLC25A20 gene SLC25A20 Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine-acylcarnitine translocase deficiency MIM#212138 24088670 False 3 100;0;0 21.569 True ENSG00000178537 ENSG00000178537 HGNC:1421 SLC25A20 gene SLC25A20 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine-acylcarnitine translocase deficiency, MIM# 212138 15363639;15365988;24088670 False 3 100;0;0 21.569 True ENSG00000178537 ENSG00000178537 HGNC:1421 SLC25A22 gene SLC25A22 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 3, MIM# 609304 15592994;19780765;24596948;33821742;33342683;31285529 False 3 100;0;0 21.569 True ENSG00000177542 ENSG00000177542 HGNC:19954 SLC25A24 gene SLC25A24 Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Fontaine progeroid syndrome MIM#612289" 29100094;29100093 False 3 100;0;0 21.569 True ENSG00000085491 ENSG00000085491 HGNC:20662 SLC25A26 gene SLC25A26 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 28, MIM# 616794 26522469 False 3 100;0;0 21.569 True ENSG00000144741 ENSG00000144741 HGNC:20661 SLC25A3 gene SLC25A3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial phosphate carrier deficiency, MIM# 610773 17273968;21763135;25681081 False 3 100;0;0 21.569 True ENSG00000075415 ENSG00000075415 HGNC:10989 SLC25A32 gene SLC25A32 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Exercise intolerance, riboflavin-responsive, MIM# 616839 26933868;28443623 False 3 100;0;0 21.569 True ENSG00000164933 ENSG00000164933 HGNC:29683 SLC25A32 gene SLC25A32 Expert Review Green;Literature;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Exercise intolerance, riboflavin-responsive MONDO:0014795 26933868;35727412;34764427;28443623 False 3 100;0;0 21.569 True ENSG00000164933 ENSG00000164933 HGNC:29683 SLC25A36 gene SLC25A36 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperinsulinemic hypoglycemia, familial, 8 - MIM#620211 34971397;34576089;31036718 False 3 100;0;0 21.569 True ENSG00000114120 ENSG00000114120 HGNC:25554 SLC25A38 gene SLC25A38 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Anemia, sideroblastic, 2, pyridoxine-refractory, MIM# 205950" 19412178 False 3 100;0;0 21.569 True ENSG00000144659 ENSG00000144659 HGNC:26054 SLC25A38 gene SLC25A38 NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 205950 Anemia, sideroblastic, 2, pyridoxine-refractory;Sideroblastic anaemia - increased serum ferritin 21393332;19412178;24323989 False 3 0;0;0 21.569 False ENSG00000144659 ENSG00000144659 HGNC:26054 SLC25A4 gene SLC25A4 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000151729 ENSG00000151729 HGNC:10990 SLC25A4 gene SLC25A4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 12A (cardiomyopathic type) AD, MIM#617184;Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type) AR, MIM#615418;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 2, MIM#609283 30046662;30013777;29654543;28823815 False 3 100;0;0 21.569 True ENSG00000151729 ENSG00000151729 HGNC:10990 SLC25A4 gene SLC25A4 Expert Review Green;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type) AR MIM#615418 28823815 False 3 100;0;0 21.569 True ENSG00000151729 ENSG00000151729 HGNC:10990 SLC25A42 gene SLC25A42 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metabolic crises, recurrent, with variable encephalomyopathic features and neurologic regression , MIM#618416 26541337;29327420;29923093;34258143 False 3 100;0;0 21.569 True ENSG00000181035 ENSG00000181035 HGNC:28380 SLC25A46 gene SLC25A46 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neuropathy, hereditary motor and sensory, type VIB, MIM# 616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303" 26168012;27543974 False 3 100;0;0 21.569 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC25A46 gene SLC25A46 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary motor and sensory neuropathy type VIB, MIM#616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303 30178502;26168012;27543974;27430653;27390132;28934388;28558379 False 3 100;0;0 21.569 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC25A46 gene SLC25A46 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary motor and sensory, type VIB, MIM# 616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303 30178502;26168012;27543974;27430653;27390132;28934388;28558379 False 3 100;0;0 21.569 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC2A1 gene SLC2A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal GLUT1 deficiency syndrome 1, infantile onset, severe, 606777;GLUT1 deficiency syndrome 2, childhood onset, 612126;Disorders of glucose transport False 3 100;0;0 21.569 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal dystonia 9;GLUT1 deficiency syndrome 2, 612126;GLUT1 DEFICIENCY SYNDROME 1;paroxysmal exertion-induced dyskinesia with or without epilepsy and/or hemolytic anemia;GLUT1 deficiency syndrome 1, 606777;Dystonia 9, 601042;EPILEPSY, IDIOPATHIC GENERALIZED False 3 100;0;0 21.569 False ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal GLUT1 deficiency syndrome 1, infantile onset, severe, 606777;GLUT1 deficiency syndrome 2, childhood onset, 612126 18451999;20129935;10980529;20221955;31196579 False 3 100;0;0 21.569 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted GLUT1-deficiency syndrome, MONDO:0000188;Dystonia 9 601042;GLUT1 deficiency syndrome 1, infantile onset, severe 606777;GLUT1 deficiency syndrome 2, childhood onset 612126;Stomatin-deficient cryohydrocytosis with neurologic defects 608885 32913944 False 3 100;0;0 21.569 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal GLUT1 deficiency syndrome 1, infantile onset, severe, MIM# 606777;Developmental delay;autosomal dominant, complicated hereditary spastic paraplegia (HSP);paroxysmal choreoathetosis;spastic paraplegia;seizure False 3 100;0;0 21.569 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 9, MIM# 601042;MONDO:0010983 False 3 100;0;0 21.569 False ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A10 gene SLC2A10 Expert Review Green;Genomics England PanelApp;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 208050;Moyamoya disease;Arterial tortuosity syndrome 16550171 False 3 100;0;0 21.569 False ENSG00000197496 ENSG00000197496 HGNC:13444 SLC2A2 gene SLC2A2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fanconi-Bickel syndrome (MIM#227810) 30950137;22145468 False 3 100;0;0 21.569 True ENSG00000163581 ENSG00000163581 HGNC:11006 SLC30A10 gene SLC30A10 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hypermanganesemia with dystonia 1, MIM# 613280" 22341972 False 3 100;0;0 21.569 True ENSG00000196660 ENSG00000196660 HGNC:25355 SLC30A10 gene SLC30A10 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome MONDO:0013208 22341971;22341972 False 3 100;0;0 21.569 True ENSG00000196660 ENSG00000196660 HGNC:25355 SLC30A10 gene SLC30A10 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia/Parkinsonism, Hypermanganesemia, Polycythemia, and Chronic Liver Disease;Hypermanganesemia with dystonia, polycythemia, and cirrhosis, 613280 False 3 0;0;0 21.569 False ENSG00000196660 ENSG00000196660 HGNC:25355 SLC30A10 gene SLC30A10 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hypermanganesemia syndrome MONDO:0013208;Disorders of magnesium metabolism 22341972, 22341971, 29193034 False 3 0;0;0 21.569 False ENSG00000196660 ENSG00000196660 HGNC:25355 SLC30A2 gene SLC30A2 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Zinc deficiency, transient neonatal , MIM#608118;Disorders of zinc metabolism 17065149, 22733820, 32278324, 30450693, 28665435 False 3 0;0;0 21.569 False ENSG00000158014 ENSG00000158014 HGNC:11013 SLC30A9 gene SLC30A9 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Birk-Landau-Perez syndrome (MIM#617595);Disorders of zinc metabolism 37041080 False 3 0;0;0 21.569 False ENSG00000014824 ENSG00000014824 HGNC:1329 SLC30A9 gene SLC30A9 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Birk-Landau-Perez syndrome (MIM#617595)" 37041080 False 3 100;0;0 21.569 True ENSG00000014824 ENSG00000014824 HGNC:1329 SLC31A1 gene SLC31A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration and seizures due to copper transport defect, MIM# 620306 PMID: 35913762;36562171;41040850 False 3 33;67;0 21.569 True ENSG00000136868 ENSG00000136868 HGNC:11016 SLC31A1 gene SLC31A1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration and seizures due to copper transport defect, MIM# 620306 35913762;36562171;41040850 False 3 67;33;0 21.569 True ENSG00000136868 ENSG00000136868 HGNC:11016 SLC32A1 gene SLC32A1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Generalized epilepsy with febrile seizures plus, type 12, MIM# 620755;Developmental and epileptic encephalopathy 114, MIM# 620774 34038384;36073542 False 3 100;0;0 21.569 True ENSG00000101438 ENSG00000101438 HGNC:11018 SLC33A1 gene SLC33A1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of copper metabolism;Huppke-Brendel syndrome MONDO:0013772 31194315 False 3 0;0;0 21.569 False ENSG00000169359 ENSG00000169359 HGNC:95 SLC35A1 gene SLC35A1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIf, MIM# 603585 28856833;23873973;11157507 False 3 100;0;0 21.569 True ENSG00000164414 ENSG00000164414 HGNC:11021 SLC35A2 gene SLC35A2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Congenital disorder of glycosylation, type IIm (MIM #300896) 23561849;24115232;27743886;25778940;30817854 False 3 100;0;0 21.569 True ENSG00000102100 ENSG00000102100 HGNC:11022 SLC35A2 gene SLC35A2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Congenital disorder of glycosylation, type IIm (MIM #300896) 30817854;Mild malformation of cortical development with oligodendroglial hyperplasia in epilepsy (MOGHE) 23561849;24115232;27743886;25778940;33407896 False 3 100;0;0 21.569 True ENSG00000102100 ENSG00000102100 HGNC:11022 SLC35A3 gene SLC35A3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, mental retardation, and seizures OMIM #615553;Skeletal dysplasia;Congenital disorder of glycosylation 28328131;24031089;28777481 False 3 100;0;0 21.569 True ENSG00000117620 ENSG00000117620 HGNC:11023 SLC35C1 gene SLC35C1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIc, MIM# 266265, MONDO:0009953 11326279;12116250;33098347;32313197;24403049 False 3 100;0;0 21.569 True ENSG00000181830 ENSG00000181830 HGNC:20197 SLC35D1 gene SLC35D1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Schneckenbecken dysplasia 269250, MONDO:0010013;O-xylosyl/N-acetylgalactosaminylglycan synthesis deficiencies (Disorders of protein O-glycosylation) 17952091;19508970;31423530 False 3 100;0;0 21.569 True ENSG00000116704 ENSG00000116704 HGNC:20800 SLC37A4 gene SLC37A4 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease Ib (MIM#232220);Glycogen storage disease Ic (MIM#232240) 28224773;31508908;32005221 False 3 100;0;0 21.569 True ENSG00000137700 ENSG00000137700 HGNC:4061 SLC37A4 gene SLC37A4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital disorder of glycosylation, type IIw, MIM# 619525 32884905;33728255;33964207 False 3 50;25;25 21.569 True ENSG00000137700 ENSG00000137700 HGNC:4061 SLC38A3 gene SLC38A3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 102, MIM# 619881 34605855 False 3 100;0;0 21.569 True ENSG00000188338 ENSG00000188338 HGNC:18044 SLC39A13 gene SLC39A13 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, spondylocheirodysplastic type MONDO:0012873;Disorders of zinc metabolism 18985159, 18513683 False 3 0;0;0 21.569 False ENSG00000165915 ENSG00000165915 HGNC:20859 SLC39A14 gene SLC39A14 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hypermanganesemia with dystonia 2 MONDO:0014864;Disorders of magnesium metabolism 27231142, 29685658 False 3 0;0;0 21.569 False ENSG00000104635 ENSG00000104635 HGNC:20858 SLC39A14 gene SLC39A14 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hypermanganesemia with dystonia 2, MIM# 617013" 27231142;29685658 False 3 100;0;0 21.569 True ENSG00000104635 ENSG00000104635 HGNC:20858 SLC39A14 gene SLC39A14 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermanganesemia with dystonia 2 617013 False 3 0;0;0 21.569 False ENSG00000104635 ENSG00000104635 HGNC:20858 SLC39A14 gene SLC39A14 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermanganesemia with dystonia 2 (MIM# 617013) 27231142;32626807;29685658;30232769 False 3 100;0;0 21.569 True ENSG00000104635 ENSG00000104635 HGNC:20858 SLC39A4 gene SLC39A4 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Acrodermatitis enteropathica MIM#201100;(Disorder of zinc metabolism) 27604308;12068297 False 3 100;0;0 21.569 True ENSG00000147804 ENSG00000147804 HGNC:17129 SLC39A4 gene SLC39A4 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal acrodermatitis enteropathica MONDO:0008713;Disorders of zinc metabolism 19370757 False 3 0;0;0 21.569 False ENSG00000147804 ENSG00000147804 HGNC:17129 SLC39A8 gene SLC39A8 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal SLC39A8-CDG MONDO:0014746;Other disorders of trace element metabolism 26637978, 26637979 False 3 0;0;0 21.569 False ENSG00000138821 ENSG00000138821 HGNC:20862 SLC39A8 gene SLC39A8 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIn , MIM#616721 26637978;26637979 False 3 100;0;0 21.569 True ENSG00000138821 ENSG00000138821 HGNC:20862 SLC39A8 gene SLC39A8 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIn , MIM#616721 26637978;26637979 False 3 100;0;0 21.569 True ENSG00000138821 ENSG00000138821 HGNC:20862 SLC40A1 gene SLC40A1 NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown 606069 HEMOCHROMATOSIS, TYPE 4;HFE4;606069 Hemochromatosis, type 4 16351644;11431687 False 3 0;0;0 21.569 False ENSG00000138449 ENSG00000138449 HGNC:10909 SLC44A1 gene SLC44A1 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration;progressive ataxia tremor cognitive decline dysphagia optic atrophy dysarthria 31855247 False 3 100;0;0 21.569 True ENSG00000070214 ENSG00000070214 HGNC:18798 SLC46A1 gene SLC46A1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Folate malabsorption, hereditary MIM# 229050;Decreased Ig levels;megaloblastic anaemia;failure to thrive;Immunodeficiency;if untreated for prolonged periods results in intellectual disability;oral mucositis;hypoimmunoglobulinaemia;recurrent infections;seizures;motor impairment;leukopaenia;thrombocytopaenia 20301716 False 3 100;0;0 21.569 True ENSG00000076351 ENSG00000076351 HGNC:30521 SLC46A1 gene SLC46A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Folate malabsorption, hereditary, MIM# 229050 33146883;28685492;24534056;27938595 False 3 100;0;0 21.569 True ENSG00000076351 ENSG00000076351 HGNC:30521 SLC46A1 gene SLC46A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Folate malabsorption, hereditary, MIM# 229050" 17446347;17129779;21333572 False 3 100;0;0 21.569 True ENSG00000076351 ENSG00000076351 HGNC:30521 SLC52A2 gene SLC52A2 Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-Van Laere syndrome 2 MIM#614707 29053833;29193829 False 3 100;0;0 21.569 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-van Laere syndrome 2 (BVVLS2) (MONDO:0013867) 22740598;24253200 False 3 100;0;0 21.569 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bwon-Vialetto-Van Laere syndrome 2, 614707 False 3 100;0;0 21.569 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 21.569 False ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Brown-Vialetto-Van Laere syndrome 2, MIM# 614707" False 3 100;0;0 21.569 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-van Laere syndrome 2 MONDO:0013867 29193829;31868069;29053833;26072523 False 3 100;0;0 21.569 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A3 gene SLC52A3 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-van Laere syndrome 1 MONDO:0024537 29193829;31868069;29053833;26072523 False 3 100;0;0 21.569 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC52A3 gene SLC52A3 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-Van Laere syndrome 1 (MIM#211530);dHMN;Brown-Vialetto-Van Laere syndrome 1;Fazio-Londe disease 20206331 False 3 100;0;0 21.569 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC52A3 gene SLC52A3 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amytrophic Lateral Sclerosis (ALS);Brown-Vialetto-van Laere syndrome 1 (MIM# 211530) 26072523 False 3 100;0;0 21.569 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC52A3 gene SLC52A3 Expert Review Green;Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-Van Laere syndrome 1 MIM#211530 29053833;29193829 False 3 100;0;0 21.569 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC52A3 gene SLC52A3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Brown-Vialetto-Van Laere syndrome 1, MIM# 211530" False 3 100;0;0 21.569 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC5A1 gene SLC5A1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glucose/galactose malabsorption MIM# 606824;(Disorders of glucose transport) 27604308;2008213;8195156;20486940 False 3 100;0;0 21.569 True ENSG00000100170 ENSG00000100170 HGNC:11036 SLC5A6 gene SLC5A6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Developmental delay;epilepsy;neurodegeneration;Neurodegeneration, infantile-onset, biotin-responsive, MIM# 618973" 31754459;27904971 False 3 100;0;0 21.569 True ENSG00000138074 ENSG00000138074 HGNC:11041 SLC5A6 gene SLC5A6 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, infantile-onset, biotin-responsive, MIM# 618973 29669219;23104561;31754459;27904971;31392107 False 3 100;0;0 21.569 True ENSG00000138074 ENSG00000138074 HGNC:11041 SLC5A6 gene SLC5A6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peripheral motor neuropathy, childhood-onset, biotin-responsive, MIM# 619903 35013551 False 3 100;0;0 21.569 True ENSG00000138074 ENSG00000138074 HGNC:11041 SLC5A7 gene SLC5A7 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, type VIIA, MIM# 158580;MONDO:0008024 23141292;15173594;29782645;29582019 False 3 100;0;0 21.569 False ENSG00000115665 ENSG00000115665 HGNC:14025 SLC6A1 gene SLC6A1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myoclonic-atonic epilepsy MONDO:0014633 34028503 False 3 0;0;0 21.569 False ENSG00000157103 ENSG00000157103 HGNC:11042 SLC6A1 gene SLC6A1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myoclonic-atonic epilepsy, MIM#616421 29315614 False 3 100;0;0 21.569 True ENSG00000157103 ENSG00000157103 HGNC:11042 SLC6A19 gene SLC6A19 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Hartnup disorder, MIM# 234500;Hyperglycinuria, MIM# 138500;Iminoglycinuria, MIM# 242600" False 3 100;0;0 21.569 True ENSG00000174358 ENSG00000174358 HGNC:27960 SLC6A19 gene SLC6A19 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hartnup disorder, MIM# 234500 False 3 100;0;0 21.569 True ENSG00000174358 ENSG00000174358 HGNC:27960 SLC6A3 gene SLC6A3 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dopamine transporter deficiency;Parkinsonism-dystonia, infantile, 613135 False 3 0;0;0 21.569 False ENSG00000142319 ENSG00000142319 HGNC:11049 SLC6A3 gene SLC6A3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 1, MIM# 613135 21112253 False 3 100;0;0 21.569 True ENSG00000142319 ENSG00000142319 HGNC:11049 SLC6A3 gene SLC6A3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 1, MIM# 613135 21112253 False 3 100;0;0 21.569 True ENSG00000142319 ENSG00000142319 HGNC:11049 SLC6A5 gene SLC6A5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 3, MIM# 614618 31604777;30847549;29859229;16751771 False 3 100;0;0 21.569 True ENSG00000165970 ENSG00000165970 HGNC:11051 SLC6A5 gene SLC6A5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 3, MIM# 614618 16751771 False 3 100;0;0 21.569 True ENSG00000165970 ENSG00000165970 HGNC:11051 SLC6A8 gene SLC6A8 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Cerebral creatine deficiency syndrome 1, MIM# 300352 27604308;16738945 False 3 100;0;0 21.569 True ENSG00000130821 ENSG00000130821 HGNC:11055 SLC6A8 gene SLC6A8 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Cerebral creatine deficiency syndrome 1, MIM# 300352" 27604308;16738945 False 3 100;0;0 21.569 True ENSG00000130821 ENSG00000130821 HGNC:11055 SLC6A9 gene SLC6A9 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Atypical glycine encephalopathy MONDO:0015010;Glycine neurotransmitter disorders 27481395;27773429;14622582;33269555 False 3 0;0;0 21.569 False ENSG00000196517 ENSG00000196517 HGNC:11056 SLC9A1 gene SLC9A1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lichtenstein-Knorr Syndrome, MIM# 616291" 25205112;30018422;25760855 False 3 50;50;0 21.569 True ENSG00000090020 ENSG00000090020 HGNC:11071 SLC9A6 gene SLC9A6 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation, X-linked syndromic, Christianson type, 300243 False 3 100;0;0 21.569 False ENSG00000198689 ENSG00000198689 HGNC:11079 SLC9A6 gene SLC9A6 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked syndromic, Christianson type, MIM# 300243;MONDO:0010278 18342287;19377476;25044251;33278113;32569089;31879735 False 3 100;0;0 21.569 True ENSG00000198689 ENSG00000198689 HGNC:11079 SLC9A6 gene SLC9A6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142 35198730;39810750;35198730;31192222 False 3 100;0;0 21.569 True ENSG00000198689 ENSG00000198689 HGNC:11079 SLC9A6 gene SLC9A6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142" 35198730;39810750;35198730;31192222 False 3 100;0;0 21.569 True ENSG00000198689 ENSG00000198689 HGNC:11079 SLITRK2 gene SLITRK2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked 111, MIM# 301107 35840571 False 3 100;0;0 21.569 True ENSG00000185985 ENSG00000185985 HGNC:13449 SMAD4 gene SMAD4 Expert Review Green;Genomics England PanelApp;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome 175050 False 3 100;0;0 21.569 False ENSG00000141646 ENSG00000141646 HGNC:6770 SMARCA2 gene SMARCA2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Nicolaides-Baraitser syndrome, MIM# 601358 22366787;22426308;27665729 False 3 100;0;0 21.569 True ENSG00000080503 ENSG00000080503 HGNC:11098 SMARCB1 gene SMARCB1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 3, MIM# 614608;Epilepsy 33006724;22426308;23906836;23929686 False 3 50;0;50 21.569 True ENSG00000099956 ENSG00000099956 HGNC:11103 SMARCC2 gene SMARCC2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coffin-Siris syndrome 8;OMIM #618362 30580808 False 3 100;0;0 21.569 True ENSG00000139613 ENSG00000139613 HGNC:11105 SMC1A gene SMC1A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders Other Epileptic encephalopathy, early infantile, 85, with or without midline brain defects, MIM# 301044 31334757;28166369 False 3 100;0;0 21.569 True ENSG00000072501 ENSG00000072501 HGNC:11111 SMCHD1 gene SMCHD1 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Facioscapulohumeral muscular dystrophy MONDO:0001347 20301616 False 3 100;0;0 21.569 True ENSG00000101596 ENSG00000101596 HGNC:29090 SMN1 gene SMN1 Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy-1, MIM# 253300 20301623 False 3 100;0;0 21.569 True ENSG00000172062 ENSG00000172062 HGNC:11117 SMN1 gene SMN1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy-1, MIM# 253300;Spinal muscular atrophy-2, MIM# 253550;Spinal muscular atrophy-3, MIM# 253400;Spinal muscular atrophy-4, MIM# 271150 False 3 100;0;0 21.569 False ENSG00000172062 ENSG00000172062 HGNC:11117 SMPD1 gene SMPD1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type A, MIM# 257200;MONDO:0009756;Niemann-Pick disease, type B, MIM# 607616;MONDO:0011871 32292456;32280632;28164782 False 3 100;0;0 21.569 True ENSG00000166311 ENSG00000166311 HGNC:11120 SMPX gene SMPX Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Myopathy, distal, 7, adult-onset, X-linked, MIM# 301075 33974137 False 3 100;0;0 21.569 True Other ENSG00000091482 ENSG00000091482 HGNC:11122 SMS gene SMS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation X-linked Snyder-Robinson type, 309583 30237987 False 3 100;0;0 21.569 True ENSG00000102172 ENSG00000102172 HGNC:11123 SNAP25 gene SNAP25 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, SNAP25-related 25003006;29100083;28135719;29491473;25381298;17283335 False 3 100;0;0 21.569 True ENSG00000132639 ENSG00000132639 HGNC:11132 SNAP25 gene SNAP25 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Myasthenic syndrome, congenital, 18, 616330;cerebellar ataxia and seizures 29491473;25381298;17283335 False 3 100;0;0 21.569 True ENSG00000132639 ENSG00000132639 HGNC:11132 SNAP29 gene SNAP29 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (CEDNIK) Syndrome (MONDO:0012290) (MIM#609528);Cerebral Dysgenesis and severe psychomotor retardation, axonal sensory-motor Neuropathy, Ichthyosis, palmoplantar Keratoderma, fatal by second decade of life 33977139 False 3 0;100;0 21.569 True ENSG00000099940 ENSG00000099940 HGNC:11133 SNAP29 gene SNAP29 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome MIM#609528 PMID: 33977139 False 3 100;0;0 21.569 True ENSG00000099940 ENSG00000099940 HGNC:11133 SNAPC4 gene SNAPC4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with motor regression, progressive spastic paraplegia, and oromotor dysfunction, MIM# 620515 36965478 False 3 100;0;0 21.569 True ENSG00000165684 ENSG00000165684 HGNC:11137 SNCA gene SNCA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543) 32849182;26858591;32740728 False 3 100;0;0 21.569 True ENSG00000145335 ENSG00000145335 HGNC:11138 SNCA gene SNCA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543) 32849182;26858591;32740728 False 3 100;0;0 21.569 True ENSG00000145335 ENSG00000145335 HGNC:11138 SNF8 gene SNF8 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 115, MIM#620783 38423010 False 3 50;50;0 21.569 True ENSG00000159210 ENSG00000159210 HGNC:17028 SNORD118 gene SNORD118 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukoencephalopathy, brain calcifications, and cysts 614561" 27571260 False 3 100;0;0 21.569 True ENSG00000200463 ENSG00000200463 HGNC:32952 SNORD118 gene SNORD118 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, brain calcifications, and cysts MIM#614561 27571260 False 3 100;0;0 21.569 True ENSG00000200463 ENSG00000200463 HGNC:32952 SNORD118 gene SNORD118 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, brain calcifications, and cysts, MIM#614561 27571260 False 3 100;0;0 21.569 True ENSG00000200463 ENSG00000200463 HGNC:32952 SNORD118 gene SNORD118 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, brain calcifications, and cysts, MIM#614561 27571260;34220662;28177126;34986804 False 3 100;0;0 21.569 True ENSG00000200463 ENSG00000200463 HGNC:32952 SNUPN gene SNUPN Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 29, MIM# 620793 PMID: 38413582;PMID: 38366623 False 3 100;0;0 21.569 True ENSG00000169371 ENSG00000169371 HGNC:14245 SNW1 gene SNW1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), SNW1-related 40608414 False 3 100;0;0 21.569 True ENSG00000100603 ENSG00000100603 HGNC:16696 SNX14 gene SNX14 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of autophagy;autosomal recessive spinocerebellar ataxia 20 MONDO:0014601 34130600;29884839 False 3 0;0;0 21.569 False ENSG00000135317 ENSG00000135317 HGNC:14977 SNX14 gene SNX14 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 20, 616354;Autosomal recessive spinocerebellar ataxia (#616354) False 3 100;0;0 21.569 False ENSG00000135317 ENSG00000135317 HGNC:14977 SNX27 gene SNX27 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder MONDO:0700092, SNX27-related 25894286;31721175;21300787;23524343 False 3 100;0;0 21.569 True ENSG00000143376 ENSG00000143376 HGNC:20073 SOD1 gene SOD1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic tetraplegia and axial hypotonia, progressive, MIM#618598 PMID: 31314961;31332433;34788402 False 3 100;0;0 21.569 True ENSG00000142168 ENSG00000142168 HGNC:11179 SOD1 gene SOD1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 1 (105400 AD, AR);Spastic tetraplegia and axial hypotonia, progressive (618598 AR) 8625408;21545237;16503123 False 3 100;0;0 21.569 True ENSG00000142168 ENSG00000142168 HGNC:11179 SOD1 gene SOD1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary peripheral neuropathy, MONDO:0020127, SOD1-related 39932579 False 3 100;0;0 21.569 False ENSG00000142168 ENSG00000142168 HGNC:11179 SON gene SON Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ZTTK syndrome MIM#617140 PMID: 37488749;27545680 False 3 100;0;0 21.569 True ENSG00000159140 ENSG00000159140 HGNC:11183 SORD gene SORD Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal isolated hereditary neuropathy;Sorbitol dehydrogenase deficiency with peripheral neuropathy (SORDDPN), MIM#618912 32367058 False 3 100;0;0 21.569 False ENSG00000140263 ENSG00000140263 HGNC:11184 SOX10 gene SOX10 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown PCWH Syndrome (MIM#609136;MONDO:0012198);Waardenburg syndrome, type 4C, 613266;Hypopigmentation of the hair and skin, sensory hearing loss, demyelinating neuropathy, dysmyelinating leukodystrophy, developmental delay, spasticity, ataxia, Hirschsprung disease;Waardenburg syndrome, type 2E, with or without neurologic involvement, 611584;HMSN 15004559 False 3 0;100;0 21.569 True ENSG00000100146 ENSG00000100146 HGNC:11190 SOX10 gene SOX10 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy;PERIPHERAL DEMYELINATING NEUROPATHY, CENTRAL DYSMYELINATING LEUKODYSTROPHY, WAARDENBURG SYNDROME, AND HIRSCHSPRUNG DISEASE;General Leukodystrophy & Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000100146 ENSG00000100146 HGNC:11190 SOX6 gene SOX6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Tolchin-Le Caignec syndrome, MIM# 618971;Developmental delay;ID;ASD;ADHD;Parkinsonism;Syringomyelia" 24453155;25127144 False 3 100;0;0 21.569 True ENSG00000110693 ENSG00000110693 HGNC:16421 SP9 gene SP9 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, SP9-related PMID: 38288683 False 3 100;0;0 21.569 True ENSG00000217236 ENSG00000217236 HGNC:30690 SPART gene SPART Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Troyer syndrome 275900 28875386;15372254 False 3 100;0;0 21.569 False ENSG00000133104 ENSG00000133104 HGNC:18514 SPART gene SPART Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Troyer syndrome, MIM# 275900;SPG20;MONDO:0010156 12134148;20437587;26003402;27112432;31535723;31535723;28875386;28679690 False 3 100;0;0 21.569 True ENSG00000133104 ENSG00000133104 HGNC:18514 SPART gene SPART Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 21.569 False ENSG00000133104 ENSG00000133104 HGNC:18514 SPAST gene SPAST Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 4, autosomal dominant, MIM# 182601;Cerebral Palsy MONDO:0006497, SPAST-related, AR 41000004 False 3 100;0;0 21.569 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPAST gene SPAST Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 16765570;19364936 False 3 100;0;0 21.569 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPAST gene SPAST Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 4, autosomal dominant;Spasticity;Hereditary Neuropathies False 3 100;0;0 21.569 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPATA5 gene SPATA5 Expert Review Green;NHS GMS;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, hearing loss, and mental retardation syndrome MIM#616577 30009132;29343804 False 3 100;0;0 21.569 True ENSG00000145375 ENSG00000145375 HGNC:18119 SPATA5 gene SPATA5 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, hearing loss, and mental retardation syndrome, MIM# 616577 27246907;29343804;26299366 False 3 100;0;0 21.569 True ENSG00000145375 ENSG00000145375 HGNC:18119 SPATA5L1 gene SPATA5L1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616 34626583 False 3 100;0;0 21.569 True ENSG00000171763 ENSG00000171763 HGNC:28762 SPATA5L1 gene SPATA5L1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616 34626583 False 3 100;0;0 21.569 True ENSG00000171763 ENSG00000171763 HGNC:28762 SPG11 gene SPG11 Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 5, juvenile, MIM# 602099 20110243 False 3 100;0;0 21.569 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 11, autosomal recessive, MIM# 604360" 18067136 False 3 100;0;0 21.569 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 11, autosomal recessive, MIM# 604360" 18067136 False 3 100;0;0 21.569 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary spastic paraplegia 11 MONDO:0011445 35036589;23121729;21381113;27217339 False 3 100;0;0 21.569 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 11, autosomal recessive MIM#604360;Charcot-Marie-Tooth disease, axonal, type 2X MIM#616668;Amyotrophic lateral sclerosis 5, juvenile MIM#602099 27318863;28237315;18079167 False 3 100;0;0 21.569 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of autophagy;hereditary spastic paraplegia 11 MONDO:0011445 37871017;37709208;29884839 False 3 0;0;0 21.569 False ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Hereditary Neuropathies;axonal Charcot-Marie-Tooth disease type 2X;MONDO:0014726 26556829;33581793 False 3 100;0;0 21.569 False ENSG00000104133 ENSG00000104133 HGNC:11226 SPG21 gene SPG21 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome, 248900;Spastic Paraplegia, autosomal recessive 14564668;24451228;28752238;26978163 False 3 100;0;0 21.569 False ENSG00000090487 ENSG00000090487 HGNC:20373 SPG21 gene SPG21 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome 248900 14564668 False 3 100;0;0 21.569 False ENSG00000090487 ENSG00000090487 HGNC:20373 SPG21 gene SPG21 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome, MIM# 248900 14564668;24451228;28752238;26978163 False 3 100;0;0 21.569 True ENSG00000090487 ENSG00000090487 HGNC:20373 SPG7 gene SPG7 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 7, autosomal recessive, MIM# 607259;Ataxia;Progressive external opthalmoplegia;Parkinsonism" PMID: 31433872 False 3 100;0;0 21.569 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive, MIM# 607259;Autosomal dominant optic atrophy, MONDO:0020250 9635427;9635427;16534102;18799786;22571692;34500365;33598982;32548275;24727571 False 3 100;0;0 21.569 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive MIM#607259 16765570;19364936 False 3 100;0;0 21.569 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 7, autosomal recessive, MIM# 607259" 22571692 False 3 100;0;0 21.569 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259 False 3 100;0;0 21.569 False ENSG00000197912 ENSG00000197912 HGNC:11237 SPNS1 gene SPNS1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lysosomal disorder, SPNS1-related, MONDO:0002561 40608416;38451736 False 3 50;50;0 21.569 True ENSG00000169682 ENSG00000169682 HGNC:30621 SPOUT1 gene SPOUT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with poor growth, seizures, and brain abnormalities, MIM# 621154 39962046 False 3 100;0;0 21.569 True ENSG00000198917 ENSG00000198917 HGNC:26933 SPR gene SPR Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716;MONDO:0012994 11443547;18502672;22522443;16532389;31777525;29147684;28189489 False 3 100;0;0 21.569 False ENSG00000116096 ENSG00000116096 HGNC:11257 SPR gene SPR Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716 22522443;16650784;21431957;28189489 False 3 100;0;0 21.569 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPR gene SPR Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716 22522443 False 3 100;0;0 21.569 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPR gene SPR Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994 22522443;11920285;14663042;16443856;21782285;32813147 False 3 0;100;0 21.569 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPR gene SPR Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716 22522443;16650784;21431957;28189489 False 3 100;0;0 21.569 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPR gene SPR Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiaterin reductase deficiency, 612716;Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716 False 3 100;0;0 21.569 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPTAN1 gene SPTAN1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 5, MIM# 613477 20493457;22258530;32811770 False 3 100;0;0 21.569 True ENSG00000197694 ENSG00000197694 HGNC:11273 SPTAN1 gene SPTAN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic Paraplegia MONDO:0019064, SPTAN1-related;Autosomal dominant spastic paraplegia-91, with or without cerebellar ataxia (SPG91), MIM#620538 PMID: 35150594;34526651;31515523 False 3 100;0;0 21.569 True ENSG00000197694 ENSG00000197694 HGNC:11273 SPTAN1 gene SPTAN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted distal myopathy MONDO:0018949 40023774 False 3 100;0;0 21.569 True ENSG00000197694 ENSG00000197694 HGNC:11273 SPTAN1 gene SPTAN1 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, 11, autosomal dominant, MIM# 620528 33578420;31332438 False 3 100;0;0 21.569 False ENSG00000197694 ENSG00000197694 HGNC:11273 SPTAN1 gene SPTAN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia MONDO:0957813 36331550 False 3 100;0;0 21.569 True Other ENSG00000197694 ENSG00000197694 HGNC:11273 SPTBN1 gene SPTBN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Developmental delay, impaired speech, and behavioural abnormalities, MIM# 619475 PMID: 34211179 PMID: 33847457 False 3 100;0;0 21.569 True ENSG00000115306 ENSG00000115306 HGNC:11275 SPTBN2 gene SPTBN2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386;Spinocerebellar ataxia 5, MIM# 600224" 23236289;23838597;22781464;31617442;31066025 False 3 100;0;0 21.569 True ENSG00000173898 ENSG00000173898 HGNC:11276 SPTBN4 gene SPTBN4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, neuropathy, and deafness MIM#617519 28540413;29861105 False 3 100;0;0 21.569 False ENSG00000160460 ENSG00000160460 HGNC:14896 SPTBN4 gene SPTBN4 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, neuropathy, and deafness MIM#617519 28540413;28940097;29861105;31230720;31857255 False 3 100;0;0 21.569 True ENSG00000160460 ENSG00000160460 HGNC:14896 SPTLC1 gene SPTLC1 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hereditary sensory neuropathy type IA;HSAN 1;Neuropathy, hereditary sensory and autonomic, type IA, 162400 11242114;11242106;15037712 False 3 0;0;0 21.569 False ENSG00000090054 ENSG00000090054 HGNC:11277 SPTLC1 gene SPTLC1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neuropathy, hereditary sensory and autonomic, type IA, MIM# 162400;Serine palmitoyl transferase deficiency (Disorders of complex lipid synthesis)" 27604308;20097765;21618344;20097765;30420926 False 3 100;0;0 21.569 True ENSG00000090054 ENSG00000090054 HGNC:11277 SPTLC1 gene SPTLC1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted juvenile amyotrophic lateral sclerosis MONDO:0017593 34059824;35900868;34459874 False 3 100;0;0 21.569 True Other ENSG00000090054 ENSG00000090054 HGNC:11277 SPTLC1 gene SPTLC1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Juvenile amyotrophic lateral sclerosis-27, MIM#620285;HSAN/SFN;Hereditary Sensory and Autonomic Neuropathy, Type II;Neuropathy, hereditary sensory and autonomic, type IA, 162400 11242114;11242106;15037712;26681808 False 3 100;0;0 21.569 False ENSG00000090054 ENSG00000090054 HGNC:11277 SPTLC2 gene SPTLC2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuropathy, hereditary sensory and autonomic, type IC, 613640;MONDO:0013337;HSAN/SFN 20920666;23658386;31509666;30866134 False 3 100;0;0 21.569 False ENSG00000100596 ENSG00000100596 HGNC:11278 SPTLC2 gene SPTLC2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neuropathy, hereditary sensory and autonomic, type IC, MIM# 613640;Serine palmitoyl transferase deficiency (Disorders of complex lipid synthesis)" 27604308;20920666 False 3 100;0;0 21.569 True ENSG00000100596 ENSG00000100596 HGNC:11278 SPTLC2 gene SPTLC2 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hereditary sensory and autonomic neuropathy type IC;HSAN 1;Neuropathy, hereditary sensory and autonomic, type IC, 613640 26681808;23658386;12207934;27025386;20920666 False 3 0;0;0 21.569 False ENSG00000100596 ENSG00000100596 HGNC:11278 SQSTM1 gene SQSTM1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 PMID: 27545679 False 3 100;0;0 21.569 True ENSG00000161011 ENSG00000161011 HGNC:11280 SQSTM1 gene SQSTM1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 27545679 False 3 100;0;0 21.569 True ENSG00000161011 ENSG00000161011 HGNC:11280 SRCAP gene SRCAP Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Developmental delay, hypotonia, musculoskeletal defects, and behavioral abnormalities MIM#619595;Floating-Harbor syndrome MIM#136140 23193612;23621943 False 3 0;100;0 21.569 True ENSG00000080603 ENSG00000080603 HGNC:16974 SRD5A3 gene SRD5A3 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kahrizi syndrome, 612713;Congenital disorder of glycosylation, type Iq, 612379;Congenital disorder of glycosylation type Iq, 612379 False 3 100;0;0 21.569 True ENSG00000128039 ENSG00000128039 HGNC:25812 SRD5A3 gene SRD5A3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Iq, MIM# 612379;Kahrizi syndrome, MIM# 612713 32424323 False 3 100;0;0 21.569 True ENSG00000128039 ENSG00000128039 HGNC:25812 SSBP1 gene SSBP1 Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Optic atrophy with or without extraocular phenotypes;Optic atrophy-13 with retinal and foveal abnormalities, MIM#165510 31298765;31479473;31550237;31550240 False 3 100;0;0 21.569 True ENSG00000106028 ENSG00000106028 HGNC:11317 SSPO gene SSPO Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, SSPOP-related PMID: 41077560 False 3 100;0;0 21.569 True ENSG00000197558 ENSG00000197558 HGNC:21998 SSR4 gene SSR4 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Congenital disorder of glycosylation, type Iy, MIM#300934 False 3 100;0;0 21.569 True ENSG00000180879 ENSG00000180879 HGNC:11326 ST3GAL3 gene ST3GAL3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual disability, autosomal recessive 12 MIM# 611090 23252400;21907012;31584066 False 3 50;50;0 21.569 True ENSG00000126091 ENSG00000126091 HGNC:10866 ST3GAL5 gene ST3GAL5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Salt and pepper developmental regression syndrome 609056;GM3 synthase deficiency, MONDO:0018274;Lactosylceramide alpha-2,3-sialyltransferase deficiency (Disorders of glycosphingolipid and glycosylphosphatidylinositol anchor glycosylation) 23436467;22990144;15502825;27232954;30691927;30688114;30576498 False 3 100;0;0 21.569 True ENSG00000115525 ENSG00000115525 HGNC:10872 ST3GAL5 gene ST3GAL5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Salt and pepper developmental regression syndrome 609056;GM3 synthase deficiency, MONDO:0018274;Lactosylceramide alpha-2,3-sialyltransferase deficiency (Disorders of glycosphingolipid and glycosylphosphatidylinositol anchor glycosylation) 23436467;22990144;15502825;27232954;30691927;30688114;30576498 False 3 100;0;0 21.569 True ENSG00000115525 ENSG00000115525 HGNC:10872 ST5 gene ST5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), DENND2B-related PMID: 40717498 False 3 100;0;0 21.569 True ENSG00000166444 ENSG00000166444 HGNC:11350 STAB1 gene STAB1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperferritinemia, MIM# 620729 37490907;28052375 False 3 100;0;0 21.569 True ENSG00000010327 ENSG00000010327 HGNC:18628 STAG1 gene STAG1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability, autosomal dominant 47, MIM# 617635 28119487;34440290 False 3 100;0;0 21.569 True ENSG00000118007 ENSG00000118007 HGNC:11354 STAMBP gene STAMBP Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly-capillary malformation syndrome, MIM# 614261;MONDO:0013659 23542699;31638258;29907875;27531570;25692795;25266620 False 3 100;0;0 21.569 True ENSG00000124356 ENSG00000124356 HGNC:16950 STAT2 gene STAT2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 44, MIM# 616636 23391734;26122121 False 3 100;0;0 21.569 True ENSG00000170581 ENSG00000170581 HGNC:11363 STIM1 gene STIM1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Myopathy, tubular aggregate, 1 (MIM#160565);Stormorken syndrome (MIM#185070)" 31448844 False 3 67;33;0 21.569 True Other ENSG00000167323 ENSG00000167323 HGNC:11386 STN1 gene STN1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebroretinal microangiopathy with calcifications and cysts 2, MIM# 617341" 27432940;32627942;34110109 False 3 100;0;0 21.569 True ENSG00000107960 ENSG00000107960 HGNC:26200 STRADA gene STRADA Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyhydramnios, megalencephaly, and symptomatic epilepsy, OMIM:611087;Polyhydramnios, megalencephaly, and symptomatic epilepsy, MONDO:0012611 17522105;27170158;28688840 False 3 100;0;0 21.569 True ENSG00000266173 ENSG00000266173 HGNC:30172 STS gene STS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Ichthyosis, X-linked 308100;Sterol metabolism disorder" False 3 100;0;0 21.569 True ENSG00000101846 ENSG00000101846 HGNC:11425 STT3A gene STT3A Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Iw, AR, OMIM #615596;Congenital disorder of glycosylation, type Iw, autosomal dominant, MIM# 619714 23842455;30701557;28424003;34653363 False 3 100;0;0 21.569 True ENSG00000134910 ENSG00000134910 HGNC:6172 STUB1 gene STUB1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768" 25258038;24742043 False 3 100;0;0 21.569 True ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar Ataxia 48, OMIM 618093;Parkinsonism 30381368;32285148;32337344 False 3 100;0;0 21.569 True ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768" 32342324;32337344 False 3 100;0;0 21.569 False ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spinocerebellar ataxia 48 MIM#618093;cognitive impairment;Spinocerebellar ataxia, autosomal recessive 16 MIM#615768" 32713943 False 3 100;0;0 21.569 False ENSG00000103266 ENSG00000103266 HGNC:11427 STX1A gene STX1A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal neurodevelopmental disorder MONDO#0700092, STX1A-related 37029317;36564538 False 3 100;0;0 21.569 True ENSG00000106089 ENSG00000106089 HGNC:11433 STX1B gene STX1B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Generalized epilepsy with febrile seizures plus, type 9, MIM# 616172 25362483;33677401 False 3 100;0;0 21.569 True ENSG00000099365 ENSG00000099365 HGNC:18539 STXBP1 gene STXBP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 4, MIM# 612164;Juvenile onset Parkinsonism 25418441;32643187;29929108 False 3 100;0;0 21.569 True ENSG00000136854 ENSG00000136854 HGNC:11444 STXBP1 gene STXBP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 4, MIM# 612164 31855252 False 3 67;33;0 21.569 True Other ENSG00000136854 ENSG00000136854 HGNC:11444 SUCLA2 gene SUCLA2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria);Dystonia False 3 0;0;0 21.569 False ENSG00000136143 ENSG00000136143 HGNC:11448 SUCLA2 gene SUCLA2 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5;Mitochondrial Leukoencephalopathy;Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria) False 3 0;0;0 21.569 False ENSG00000136143 ENSG00000136143 HGNC:11448 SUCLA2 gene SUCLA2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria), MIM# 612073, MONDO:0012791 15877282;17287286;17301081;23759946;33231368;33230181;28243576;27913098;27651038 False 3 100;0;0 21.569 True ENSG00000136143 ENSG00000136143 HGNC:11448 SUCLA2 gene SUCLA2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria), MIM# 612073, MONDO:0012791 15877282;17287286;17301081;23759946;33231368;33230181;28243576;27913098;27651038 False 3 100;0;0 21.569 True ENSG00000136143 ENSG00000136143 HGNC:11448 SUCLA2 gene SUCLA2 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria) 612073 15877282;17287286;17301081;23759946;33231368;33230181;28243576;27913098;27651038 False 3 100;0;0 21.569 True ENSG00000136143 ENSG00000136143 HGNC:11448 SUCLG1 gene SUCLG1 Expert Review Green;Other;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial DNA depletion syndrome 9 MONDO:0009504 30560055;29217198 False 3 100;0;0 21.569 True ENSG00000163541 ENSG00000163541 HGNC:11449 SUCLG1 gene SUCLG1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 9 (encephalomyopathic type with methylmalonic aciduria) MIM#245400 33230783;28358460 False 3 100;0;0 21.569 True ENSG00000163541 ENSG00000163541 HGNC:11449 SUFU gene SUFU Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Joubert syndrome 32, MIM#617757;Neurodevelopmental disorder, MONDO:0700092, SUFU-related 33024317 False 3 100;0;0 21.569 True ENSG00000107882 ENSG00000107882 HGNC:16466 SUMF1 gene SUMF1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple sulfatase deficiency (MIM#272200) 17360554;25885655;28566233 False 3 100;0;0 21.569 True ENSG00000144455 ENSG00000144455 HGNC:20376 SUMF1 gene SUMF1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal General Leukodystrophy & Mitochondrial Leukoencephalopathy;Multiple sulfatase deficiency False 3 0;0;0 21.569 False ENSG00000144455 ENSG00000144455 HGNC:20376 SUOX gene SUOX Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sulfite oxidase deficiency, MIM# 272300 9428520;15952210;31127934 False 3 100;0;0 21.569 True ENSG00000139531 ENSG00000139531 HGNC:11460 SUOX gene SUOX Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sulfite oxidase deficiency, MIM# 272300 27289259;23250141;24384336 False 3 100;0;0 21.569 True ENSG00000139531 ENSG00000139531 HGNC:11460 SUOX gene SUOX Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Sulfite oxidase deficiency, MIM# 272300" 9428520;15952210;31127934] False 3 100;0;0 21.569 True ENSG00000139531 ENSG00000139531 HGNC:11460 SUOX gene SUOX Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sulfite oxidase deficiency MIM#272300 9600976;28933809;16140720 False 3 100;0;0 21.569 True ENSG00000139531 ENSG00000139531 HGNC:11460 SURF1 gene SURF1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leigh syndrome, due to COX IV deficiency, MIM# 256000" 19780766 False 3 100;0;0 21.569 True ENSG00000148290 ENSG00000148290 HGNC:11474 SURF1 gene SURF1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 1, MIM# 220110 9843204;9837813;24027061 False 3 100;0;0 21.569 True ENSG00000148290 ENSG00000148290 HGNC:11474 SURF1 gene SURF1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome, due to COX IV deficiency;Mitochondrial Leukoencephalopathy;Mitochondrial complex IV disorder False 3 0;0;0 21.569 False ENSG00000148290 ENSG00000148290 HGNC:11474 SURF1 gene SURF1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome, due to COX IV deficiency, 256000;HMSN;Leigh syndrome (early onset progressive neurodegeneration of the brain stem, basal ganglia and spinal cord), neuropathy with SNCV False 3 100;0;0 21.569 False ENSG00000148290 ENSG00000148290 HGNC:11474 SURF1 gene SURF1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4K MIM#616684;Mitochondrial complex IV deficiency, nuclear type 1 MIM#220110 9843204;9837813;24027061 False 3 100;0;0 21.569 True ENSG00000148290 ENSG00000148290 HGNC:11474 SVBP gene SVBP Expert Review Green;Expert list;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, 618569 31363758;30607023 False 3 100;0;0 21.569 True ENSG00000177868 ENSG00000177868 HGNC:29204 SYN1 gene SYN1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Epilepsy, X-linked, with variable learning disabilities and behaviour disorders, MIM# 300491;Intellectual developmental disorder, X-linked 50, MIM# 300115 14985377;21441247;28973667;21441247;34243774 False 3 100;0;0 21.569 True ENSG00000008056 ENSG00000008056 HGNC:11494 SYNE1 gene SYNE1 Expert Review;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Emery-Dreifuss muscular dystrophy 4, autosomal dominant 612998 False 3 100;0;0 21.569 False ENSG00000131018 ENSG00000131018 HGNC:17089 SYNE1 gene SYNE1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 8, MIM# 610743" 23325900;27086870 False 3 100;0;0 21.569 True ENSG00000131018 ENSG00000131018 HGNC:17089 SYNGAP1 gene SYNGAP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability, autosomal dominant 5, MIM # 612621 26079862 False 3 100;0;0 21.569 True ENSG00000197283 ENSG00000197283 HGNC:11497 SYNJ1 gene SYNJ1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 53, MIM# 617389 32435303;27435091;23804563;23804577;27496670;33841314 False 3 100;0;0 21.569 True ENSG00000159082 ENSG00000159082 HGNC:11503 SYNJ1 gene SYNJ1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 20, early-onset, MIM# 615530 23804563;23804577;27496670;33841314 False 3 100;0;0 21.569 True ENSG00000159082 ENSG00000159082 HGNC:11503 SYNJ1 gene SYNJ1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile Parkinsonism;Parkinson disease 20, early-onset False 3 0;0;0 21.569 False ENSG00000159082 ENSG00000159082 HGNC:11503 SYT1 gene SYT1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Baker-Gordon syndrome MIM#618218 30107533 False 3 100;0;0 21.569 True ENSG00000067715 ENSG00000067715 HGNC:11509 SYT2 gene SYT2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myasthenic syndrome, congenital, 7, presynaptic;HMSN 25192047;30533528;26519543 False 3 100;0;0 21.569 False ENSG00000143858 ENSG00000143858 HGNC:11510 SZT2 gene SZT2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 18, OMIM #615476 23932106;30560016;30359774;28556953;32402703 False 3 100;0;0 21.569 True ENSG00000198198 ENSG00000198198 HGNC:29040 TACO1 gene TACO1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000136463 ENSG00000136463 HGNC:24316 TACO1 gene TACO1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial complex IV deficiency, nuclear type 8, MIM# 619052" 19503089;20727754;25044680;27319982 False 3 100;0;0 21.569 True ENSG00000136463 ENSG00000136463 HGNC:24316 TAF1C gene TAF1C Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder, TAF1C-related, MONDO:0100038 40371665;32779182 False 3 100;0;0 21.569 True ENSG00000103168 ENSG00000103168 HGNC:11534 TAF8 gene TAF8 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with severe motor impairment, absent language, cerebral hypomyelination, and brain atrophy, MIM# 619972 29648665;35759269 False 3 100;0;0 21.569 True ENSG00000137413 ENSG00000137413 HGNC:17300 TALDO1 gene TALDO1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Transaldolase deficiency , MIM#606003" False 3 100;0;0 21.569 True ENSG00000177156 ENSG00000177156 HGNC:11559 TAMM41 gene TAMM41 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-56 (COXPD56), MIM#620139;hypotonia;developmental delay;myopathy;ptosis 35321494;29253589 False 3 100;0;0 21.569 True ENSG00000144559 ENSG00000144559 HGNC:25187 TAMM41 gene TAMM41 Expert Review Green;Other;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-56 (COXPD56), MIM#620139 35321494;29253589 False 3 100;0;0 21.569 True ENSG00000144559 ENSG00000144559 HGNC:25187 TANC2 gene TANC2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with autistic features and language delay, with or without seizures MIM#618906 PMID: 31616000 False 3 100;0;0 21.569 True ENSG00000170921 ENSG00000170921 HGNC:30212 TANGO2 gene TANGO2 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, 616878 26805781 False 3 100;0;0 21.569 True ENSG00000183597 ENSG00000183597 HGNC:25439 TANGO2 gene TANGO2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, MIM# 616878" False 3 100;0;0 21.569 True ENSG00000183597 ENSG00000183597 HGNC:25439 TANGO2 gene TANGO2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metabolic encephalomyopathic crises recurrent with rhabdomyolysis cardiac arrhythmias and neurodegeneration, 616878 26805782;30245509 False 3 100;0;0 21.569 True ENSG00000183597 ENSG00000183597 HGNC:25439 TARDBP gene TARDBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 10, with or without FTD (MIM#612069) 20301761;21803454 False 3 100;0;0 21.569 True ENSG00000120948 ENSG00000120948 HGNC:11571 TARDBP gene TARDBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 10, with or without FTD;Frontotemporal lobar degeneration, TARDBP-related (MIM#612069;MONDO: 0012790) 20301761;18309045;19609911 False 3 100;0;0 21.569 True ENSG00000120948 ENSG00000120948 HGNC:11571 TARS2 gene TARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 21, MIM# 615918 24827421;26811336;33153448;34508595 False 3 50;50;0 21.569 True ENSG00000143374 ENSG00000143374 HGNC:30740 TARS2 gene TARS2 Expert Review Green;Expert Review Green;Literature;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 21 - 615918;Epilepsy 33153448;24827421;34508595 False 3 50;50;0 21.569 True ENSG00000143374 ENSG00000143374 HGNC:30740 TAT gene TAT Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Tyrosinemia, type II, MIM# 276600" False 3 100;0;0 21.569 True ENSG00000198650 ENSG00000198650 HGNC:11573 TAZ gene TAZ Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Barth syndrome, MIM# 302060 False 3 100;0;0 21.569 True ENSG00000102125 ENSG00000102125 HGNC:11577 TAZ gene TAZ Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Barth syndrome, MIM# 302060 False 3 100;0;0 21.569 True ENSG00000102125 ENSG00000102125 HGNC:11577 TAZ gene TAZ Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Barth syndrome MIM#302060 26845103 False 3 100;0;0 21.569 True ENSG00000102125 ENSG00000102125 HGNC:11577 TBC1D23 gene TBC1D23 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 11, 617695 28823707;28823706 False 3 100;0;0 21.569 True ENSG00000036054 ENSG00000036054 HGNC:25622 TBC1D24 gene TBC1D24 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 16, MIM# 615338;Intellectual disability;Parkinsonism;Seizures;Psychosis PMID: 28663785;21087195 False 3 100;0;0 21.569 True ENSG00000162065 ENSG00000162065 HGNC:29203 TBC1D24 gene TBC1D24 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 16 MIM#615338;DOORS syndrome MIM#220500;Epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer's cramp MIM#608105;Myoclonic epilepsy, infantile, familial MIM#605021 False 3 100;0;0 21.569 True ENSG00000162065 ENSG00000162065 HGNC:29203 TBC1D2B gene TBC1D2B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with seizures and gingival overgrowth (NEDSGO), MIM#619323;Global developmental delay;Intellectual disability;Seizures;Gingival overgrowth;Behavioral abnormality;Abnormality of the mandible;Abnormality of brain morphology;Abnormality of the eye;Hearing abnormality 32623794 False 3 100;0;0 21.569 True ENSG00000167202 ENSG00000167202 HGNC:29183 TBCD gene TBCD Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain atrophy and thin corpus callosum, MIM#617193 27666370;27666374 False 3 100;0;0 21.569 True ENSG00000141556 ENSG00000141556 HGNC:11581 TBCE gene TBCE Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, with amyotrophy and optic atrophy, OMIM #617207 PubMed: 27666369 False 3 100;0;0 21.569 True ENSG00000116957 ENSG00000116957 HGNC:11582 TBCE gene TBCE Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Encephalopathy, progressive, with amyotrophy and optic atrophy 617207" PMID: 27666369 False 3 100;0;0 21.569 True ENSG00000116957 ENSG00000116957 HGNC:11582 TBCE gene TBCE Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypoparathyroidism-retardation-dysmorphism syndrome, MIM# 241410 28138323;35935360 False 3 50;50;0 21.569 True ENSG00000116957 ENSG00000116957 HGNC:11582 TBCK gene TBCK Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypotonia, infantile, with psychomotor retardation and characteristic facies 3, MIM# 616900 27040692;30103036;27040691 False 3 100;0;0 21.569 True ENSG00000145348 ENSG00000145348 HGNC:28261 TBK1 gene TBK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 4, MIM# 616439 20301623 False 3 100;0;0 21.569 True ENSG00000183735 ENSG00000183735 HGNC:11584 TBK1 gene TBK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 4 (MIM#616439;MONDO:0011223) 20301623;25803835 False 3 100;0;0 21.569 True ENSG00000183735 ENSG00000183735 HGNC:11584 TBK1 gene TBK1 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia with motor neuron disease MONDO:0017161;Disorders of autophagy 38168426;38517332;29884839 False 3 0;0;0 21.569 False ENSG00000183735 ENSG00000183735 HGNC:11584 TBL1XR1 gene TBL1XR1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability, autosomal dominant 41, MIM# 616944;Pierpont syndrome, MIM# 602342 26769062;30365874;25425123;9450851;23160955;28687524;23176139;16007632 False 3 100;0;0 21.569 True ENSG00000177565 ENSG00000177565 HGNC:29529 TBX19 gene TBX19 Expert Review Green;Literature;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Adrenocorticotropic hormone deficiency - 201400 31998673 False 3 100;0;0 21.569 True ENSG00000143178 ENSG00000143178 HGNC:11596 TCAP gene TCAP Expert Review Green;Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2G, 601954 25055047;22029105;18948002 False 3 100;0;0 21.569 True ENSG00000173991 ENSG00000173991 HGNC:11610 TCF4 gene TCF4 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pitt-Hopkins syndrome, MIM# 610954 18728071;22934316 False 3 100;0;0 21.569 True ENSG00000196628 ENSG00000196628 HGNC:11634 TCP1 gene TCP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with polymicrogyria and seizures, MIM# 621021 39480921 False 3 100;0;0 21.569 True ENSG00000120438 ENSG00000120438 HGNC:11655 TCTN1 gene TCTN1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 13, MIM# 614173" 31302911;28631893;21725307;26477546;26489806 False 3 100;0;0 21.569 True ENSG00000204852 ENSG00000204852 HGNC:26113 TCTN2 gene TCTN2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 24, MIM# 616654" 25118024;21565611 False 3 100;0;0 21.569 True ENSG00000168778 ENSG00000168778 HGNC:25774 TCTN3 gene TCTN3 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 18, MIM# 614815;Orofaciodigital syndrome IV, MIM# 258860 22883145;25118024 False 3 100;0;0 21.569 True ENSG00000119977 ENSG00000119977 HGNC:24519 TDP2 gene TDP2 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 23 31410782;30109272;24658003 False 3 100;0;0 21.569 True ENSG00000111802 ENSG00000111802 HGNC:17768 TDP2 gene TDP2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 23, 616949 24658003;30109272;31410782 False 3 100;0;0 21.569 True ENSG00000111802 ENSG00000111802 HGNC:17768 TECPR2 gene TECPR2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 49, autosomal recessive, 615031;Autonomic-sensory neuropathy 23176824;26542466 False 3 100;0;0 21.569 True ENSG00000196663 ENSG00000196663 HGNC:19957 TECPR2 gene TECPR2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 49, autosomal recessive;HSAN/SFN False 3 100;0;0 21.569 False ENSG00000196663 ENSG00000196663 HGNC:19957 TECPR2 gene TECPR2 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of autophagy;hereditary spastic paraplegia 49 MONDO:0014016 33213269;34130600;29884839 False 3 0;0;0 21.569 False ENSG00000196663 ENSG00000196663 HGNC:19957 TEFM gene TEFM Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 58, MIM# 620451 36823193 False 3 100;0;0 21.569 True ENSG00000172171 ENSG00000172171 HGNC:26223 TEFM gene TEFM Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 58, MIM# 620451 36823193 False 3 100;0;0 21.569 True ENSG00000172171 ENSG00000172171 HGNC:26223 TET3 gene TET3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Beck-Fahrner syndrome MIM#618798 36192301 False 3 50;50;0 21.569 True ENSG00000187605 ENSG00000187605 HGNC:28313 TF gene TF NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 209300 Atransferrinemia;209300 Atransferrinemia, Hypoferritinaemia 15466165;11110675 False 3 100;0;0 21.569 False ENSG00000091513 ENSG00000091513 HGNC:11740 TFAM gene TFAM Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial DNA depletion syndrome 15 (hepatocerebral type) MIM#617156" 27448789;29021295;9500544;32399598;34647195;34647195 False 3 50;50;0 21.569 True ENSG00000108064 ENSG00000108064 HGNC:11741 TFE3 gene TFE3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked, syndromic, with pigmentary mosaicism and coarse facies, MIM# 301066;Intellectual disability;Epilepsy;Coarse facial features 30595499;31833172;32409512 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000068323 ENSG00000068323 HGNC:11752 TFG gene TFG Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 57, autosomal recessive, MIM# 615658 30467354;30157421;28124177;27601211;27492651;23479643 False 3 100;0;0 21.569 True ENSG00000114354 ENSG00000114354 HGNC:11758 TFG gene TFG Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary motor and sensory neuropathy, Okinawa type, MIM# 604484 25098539;23553329;22883144;31449671;31111683 False 3 100;0;0 21.569 False ENSG00000114354 ENSG00000114354 HGNC:11758 TFR2 gene TFR2 NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 604250 Hemochromatosis, type 3;HFE3;604250 HEMOCHROMATOSIS, TYPE 3 11313241;10802645 False 3 0;0;0 21.569 False ENSG00000106327 ENSG00000106327 HGNC:11762 TH gene TH Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Tyrosine hydroxylase deficiency MONDO:0100064 20301334;20301610 False 3 100;0;0 21.569 True ENSG00000180176 ENSG00000180176 HGNC:11782 TH gene TH Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Segawa syndrome, recessive , MIM#605407 17696123;11246459;10585338 False 3 100;0;0 21.569 True ENSG00000180176 ENSG00000180176 HGNC:11782 TH gene TH Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Segawa syndrome, recessive, MIM# 605407;MONDO:0011551 False 3 100;0;0 21.569 False ENSG00000180176 ENSG00000180176 HGNC:11782 THAP1 gene THAP1 Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Dystonia 6, torsion, 602629;Dystonia;MONDO:0011264 21793105;22377579;36205328;21425335;20211909 False 3 100;0;0 21.569 False ENSG00000131931 ENSG00000131931 HGNC:20856 TIAM1 gene TIAM1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with language delay and seizures, MIM# 619908 False 3 100;0;0 21.569 True ENSG00000156299 ENSG00000156299 HGNC:11805 TIMM50 gene TIMM50 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type IX, MIM# 617698 27573165;32369862;30190335;31058414 False 3 100;0;0 21.569 True ENSG00000105197 ENSG00000105197 HGNC:23656 TIMM50 gene TIMM50 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type IX, MIM#617698 27573165;30190335;31058414 False 3 100;0;0 21.569 True ENSG00000105197 ENSG00000105197 HGNC:23656 TIMM8A gene TIMM8A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Deafness-Dystonia-Optic Neuronopathy Syndrome;Mohr-Tranebjaerg syndrome, MIM# 304700 11803487;11405816;32820032 False 3 100;0;0 21.569 True ENSG00000126953 ENSG00000126953 HGNC:11817 TIMM8A gene TIMM8A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mohr-Tranebjaerg syndrome, MIM# 304700 11803487;11405816;32820032 False 3 100;0;0 21.569 True ENSG00000126953 ENSG00000126953 HGNC:11817 TIMMDC1 gene TIMMDC1 Expert Review Green;Expert Review Green;NHS GMS;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 31 MIM#618251 28604674;30981218 False 3 33;67;0 21.569 True ENSG00000113845 ENSG00000113845 HGNC:1321 TINF2 gene TINF2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Revesz syndrome, MIM# 268130" 21477109;18252230 False 3 100;0;0 21.569 True ENSG00000092330 ENSG00000092330 HGNC:11824 TINF2 gene TINF2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant dyskeratosis congenita 3, 613990;Revesz syndrome, 268130 18252230;21477109;18979121 False 3 100;0;0 21.569 True ENSG00000092330 ENSG00000092330 HGNC:11824 TK2 gene TK2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 2 (myopathic type), MIM# 609560;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 3, MIM# 617069 11687801;12391347;12873860;35286480;35280287;35094997 False 3 100;0;0 21.569 True ENSG00000166548 ENSG00000166548 HGNC:11831 TK2 gene TK2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 2 (myopathic type), 609560 33457207 False 3 100;0;0 21.569 True ENSG00000166548 ENSG00000166548 HGNC:11831 TK2 gene TK2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 2 (myopathic type), MIM#609560;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 3, MIM# 617069 25446393;16504786 False 3 100;0;0 21.569 True ENSG00000166548 ENSG00000166548 HGNC:11831 TMEM106B gene TMEM106B Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypomyelinating leukodystrophy 16, 617964 29186371;29444210 False 3 100;0;0 21.569 True ENSG00000106460 ENSG00000106460 HGNC:22407 TMEM106B gene TMEM106B Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Australian Genomcis Health Alliance Leukodystrophy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, hypomyelinating 16, MIM#617964 False 3 100;0;0 21.569 False ENSG00000106460 ENSG00000106460 HGNC:22407 TMEM126A gene TMEM126A Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of complex I subunits and assembly factors;autosomal recessive optic atrophy, OPA7 type MONDO:0013069 29884839;33879611;31119195;30961538;19327736;20405026 False 3 100;0;0 21.569 True ENSG00000171202 ENSG00000171202 HGNC:25382 TMEM126B gene TMEM126B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 29, MIM# 618250 27374774;27374773 False 3 100;0;0 21.569 True ENSG00000171204 ENSG00000171204 HGNC:30883 TMEM126B gene TMEM126B Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial complex 1 deficiency, nuclear type 29 MONDO:0032633 27374774;27374773 False 3 100;0;0 21.569 True ENSG00000171204 ENSG00000171204 HGNC:30883 TMEM163 gene TMEM163 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hypomyelinating leukodystrophy, MONDO:0019046 PMID: 35953447;35455965 False 3 100;0;0 21.569 True ENSG00000152128 ENSG00000152128 HGNC:25380 TMEM163 gene TMEM163 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hypomyelinating leukodystrophy, MONDO:0019046 PMID: 35953447 False 3 100;0;0 21.569 True ENSG00000152128 ENSG00000152128 HGNC:25380 TMEM165 gene TMEM165 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IIk, MIM# 614727;TMEM165-CDG, MONDO:0013870 22683087;28323990;27401145;27008884;26238249;25609749 False 3 100;0;0 21.569 True ENSG00000134851 ENSG00000134851 HGNC:30760 TMEM167A gene TMEM167A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, epilepsy, and diabetes syndrome MONDO:0100328, TMEM167A-related PMID: 40924476 False 3 100;0;0 21.569 True ENSG00000174695 ENSG00000174695 HGNC:28330 TMEM184B gene TMEM184B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder (MONDO:0700092), TMEM184B-related 39006436 False 3 100;0;0 21.569 True ENSG00000198792 ENSG00000198792 HGNC:1310 TMEM199 gene TMEM199 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Congenital disorder of glycosylation, type IIp MIM# 616829" 26833330;29321044 False 3 100;0;0 21.569 True ENSG00000244045 ENSG00000244045 HGNC:18085 TMEM216 gene TMEM216 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 2, MIM# 608091" 20036350;20512146 False 3 100;0;0 21.569 True ENSG00000187049 ENSG00000187049 HGNC:25018 TMEM222 gene TMEM222 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with motor and speech delay and behavioural abnormalities, MIM# 619470;Motor delay;Delayed speech and language development;Intellectual disability;Generalized hypotonia;Broad-based gait;Abnormality of nervous system morphology;Seizures;Microcephaly;Behavioral abnormality 33824500 False 3 50;50;0 21.569 True ENSG00000186501 ENSG00000186501 HGNC:25363 TMEM237 gene TMEM237 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 14, MIM# 614424" False 3 100;0;0 21.569 True ENSG00000155755 ENSG00000155755 HGNC:14432 TMEM240 gene TMEM240 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 21, MIM# 607454" 25070513 False 3 100;0;0 21.569 True ENSG00000205090 ENSG00000205090 HGNC:25186 TMEM251 gene TMEM251 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dysostosis multiplex, Ain-Naz type 619345 33252156;40171858 False 3 50;50;0 21.569 True ENSG00000153485 ENSG00000153485 HGNC:20218 TMEM5 gene TMEM5 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041, MONDO:0014022 23217329;23519211;30017359;27733679;27212206 False 3 100;0;0 21.569 True ENSG00000118600 ENSG00000118600 HGNC:13530 TMEM63A gene TMEM63A Expert Review Green;Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukodystrophy, hypomyelinating, 19, transient infantile 618688 31587869 False 3 100;0;0 21.569 False ENSG00000196187 ENSG00000196187 HGNC:29118 TMEM63B gene TMEM63B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 118, MIM# 621250 37421948 False 3 100;0;0 21.569 True ENSG00000137216 ENSG00000137216 HGNC:17735 TMEM63C gene TMEM63C Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 87, autosomal recessive, MIM# 619966 PMID: 35718349 False 3 100;0;0 21.569 True ENSG00000165548 ENSG00000165548 HGNC:23787 TMEM67 gene TMEM67 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 6, MIM# 610688" False 3 100;0;0 21.569 True ENSG00000164953 ENSG00000164953 HGNC:28396 TMEM70 gene TMEM70 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2, MIM# 614052 18953340;21147908;30950220 False 3 100;0;0 21.569 True ENSG00000175606 ENSG00000175606 HGNC:26050 TMPRSS6 gene TMPRSS6 NHS Genomic Medicine Service;Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal IRIDA;206200 Iron-refractory iron deficiency anemia;206200 IRON-REFRACTORY IRON DEFICIENCY ANEMIA 19357398;18408718 False 3 100;0;0 21.569 False ENSG00000187045 ENSG00000187045 HGNC:16517 TMTC3 gene TMTC3 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lissencephaly 8, MIM#617255 27773428;28973161;32973946 False 3 100;0;0 21.569 True ENSG00000139324 ENSG00000139324 HGNC:26899 TMX2 gene TMX2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly;ID;brain malformations;seizures 31735293;31586943 False 3 100;0;0 21.569 True ENSG00000213593 ENSG00000213593 HGNC:30739 TNPO2 gene TNPO2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM# 619556" 34314705 False 3 100;0;0 21.569 True ENSG00000105576 ENSG00000105576 HGNC:19998 TNPO2 gene TNPO2 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM# 619556 34314705 False 3 100;0;0 21.569 True Other ENSG00000105576 ENSG00000105576 HGNC:19998 TNPO3 gene TNPO3 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Muscular dystrophy, limb-girdle, autosomal dominant 2, 608423 23667635;23543484;31071488;31192305 False 3 100;0;0 21.569 True Other ENSG00000064419 ENSG00000064419 HGNC:17103 TOMM7 gene TOMM7 Expert Review Green;Literature;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Garg-Mishra progeroid syndrome, MIM# 620601 36299998;36282599;39615461 False 3 50;50;0 21.569 True ENSG00000196683 ENSG00000196683 HGNC:21648 TOP3A gene TOP3A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, growth restriction, and increased sister chromatid exchange 2, MIM# 618097;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 5, MIM#618098 30057030;33631320;29290614 False 3 100;0;0 21.569 True ENSG00000177302 ENSG00000177302 HGNC:11992 TOR1A gene TOR1A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant or sporadic dystonia (DYT1);Early-Onset Primary Dystonia;Dystonia-1, torsion, 128100 9288096;19955557;18477710;32243914;31583275;31347572 False 3 100;0;0 21.569 False ENSG00000136827 ENSG00000136827 HGNC:3098 TPK1 gene TPK1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type) MIM#614458 PMID: 37622082 False 3 100;0;0 21.569 True ENSG00000196511 ENSG00000196511 HGNC:17358 TPK1 gene TPK1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type);Dystonia False 3 0;0;0 21.569 False ENSG00000196511 ENSG00000196511 HGNC:17358 TPK1 gene TPK1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type), MIM# 614458 22152682;33626592;33231275;33086386 False 3 100;0;0 21.569 True ENSG00000196511 ENSG00000196511 HGNC:17358 TPP1 gene TPP1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 7, 609270;Neuronal ceroid lipofuscinosis, 204500;Spinocerebellar ataxia, autosomal recessive 7, 609270;Ceroid lipofuscinosis, neuronal, 2, 204500 False 3 100;0;0 21.569 False ENSG00000166340 ENSG00000166340 HGNC:2073 TPP1 gene TPP1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;MONDO:0008769;Spinocerebellar ataxia, autosomal recessive 7, MIM# 609270;MONDO:0012235 9295267;18684116;23418007;26224725;31283065 False 3 100;0;0 21.569 True ENSG00000166340 ENSG00000166340 HGNC:2073 TPP1 gene TPP1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;MONDO:0008769 9295267;18684116;23418007;26224725;31283065 False 3 100;0;0 21.569 True ENSG00000166340 ENSG00000166340 HGNC:2073 TPP1 gene TPP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;Parkinsonism PMID: 21940688 False 3 100;0;0 21.569 True ENSG00000166340 ENSG00000166340 HGNC:2073 TPP2 gene TPP2 Expert Review;Expert Review Green;Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Immunodeficiency 78 with autoimmunity and developmental delay, MIM# 619220 25414442 False 3 100;0;0 21.569 False ENSG00000134900 ENSG00000134900 HGNC:12016 TRA2B gene TRA2B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Ramond-Elliott neurodevelopmental syndrome, MIM# 621421 PMID: 36549593 False 3 100;0;0 21.569 True ENSG00000136527 ENSG00000136527 HGNC:10781 TRAF7 gene TRAF7 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cardiac, facial, and digital anomalies with developmental delay, MIM#618164 29961569;27479843;28135719;25363760;25961944;38569228 False 3 50;50;0 21.569 True ENSG00000131653 ENSG00000131653 HGNC:20456 TRAK1 gene TRAK1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 68, MIM# 618201 28940097;28364549;29846532;28924745 False 3 100;0;0 21.569 True ENSG00000182606 ENSG00000182606 HGNC:29947 TRAK1 gene TRAK1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 68, MIM# 618201 28940097;28364549;29846532;28924745 False 3 100;0;0 21.569 True ENSG00000182606 ENSG00000182606 HGNC:29947 TRAPPC10 gene TRAPPC10 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, short stature, and speech delay, MIM# 620027 PMID: 35298461;30167849 False 3 100;0;0 21.569 True ENSG00000160218 ENSG00000160218 HGNC:11868 TRAPPC11 gene TRAPPC11 Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2S, 615356 23830518;26322222;29855340;30105108 False 3 100;0;0 21.569 True ENSG00000168538 ENSG00000168538 HGNC:25751 TRAPPC12 gene TRAPPC12 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with brain atrophy and spasticity, MIM#617669 28777934 False 3 0;100;0 21.569 True ENSG00000171853 ENSG00000171853 HGNC:24284 TRAPPC4 gene TRAPPC4 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with epilepsy, spasticity, and brain atrophy, MIM# 618741 31794024 False 3 100;0;0 21.569 True ENSG00000196655 ENSG00000196655 HGNC:19943 TRAPPC6B gene TRAPPC6B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, epilepsy, and brain atrophy, MIM# 617862 28626029;28397838;31687267 False 3 100;0;0 21.569 True ENSG00000182400 ENSG00000182400 HGNC:23066 TRAPPC9 gene TRAPPC9 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder, autosomal recessive 13 MIM#613192" PMID: 35042660 False 3 50;50;0 21.569 True ENSG00000167632 ENSG00000167632 HGNC:30832 TREM2 gene TREM2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193" 12080485;15883308 False 3 100;0;0 21.569 True ENSG00000095970 ENSG00000095970 HGNC:17761 TREM2 gene TREM2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, MIM# 618193;{Alzhieimer disease 17, susceptibility to}, MIM# 615080 12080485;15883308 False 3 100;0;0 21.569 True ENSG00000095970 ENSG00000095970 HGNC:17761 TREM2 gene TREM2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2, 618193 12080485;15883308 False 3 100;0;0 21.569 False ENSG00000095970 ENSG00000095970 HGNC:17761 TREM2 gene TREM2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 2 MIM#618193 PMID: 36820836;24910390 False 3 100;0;0 21.569 True ENSG00000095970 ENSG00000095970 HGNC:17761 TREX1 gene TREX1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Retinal vasculopathy with cerebral leukoencephalopathy and systemic manifestations MONDO:0008641" 29380913;35699195;36586737;35307828 False 3 100;0;0 21.569 True ENSG00000213689 ENSG00000213689 HGNC:12269 TREX1 gene TREX1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Aicardi-Goutieres syndrome 1, dominant and recessive, MIM# 225750;Disorder of nucleotide metabolism" False 3 100;0;0 21.569 True ENSG00000213689 ENSG00000213689 HGNC:12269 TREX1 gene TREX1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 1, dominant and recessive MIM#225750 20131292 False 3 100;0;0 21.569 True ENSG00000213689 ENSG00000213689 HGNC:12269 TREX1 gene TREX1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aicardi-Goutieres syndrome 1, dominant and recessive;Chilblain lupus;{Systemic lupus erythematosus, susceptibility to};Vasculopathy, retinal, with cerebral leukodystrophy 21937424 False 3 100;0;0 21.569 True ENSG00000213689 ENSG00000213689 HGNC:12269 TREX1 gene TREX1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 1, dominant and recessive, MIM# 225750 17846997 False 3 100;0;0 21.569 True ENSG00000213689 ENSG00000213689 HGNC:12269 TREX1 gene TREX1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Aicardi-Goutieres syndrome 1, dominant and recessive, MIM# 225750" False 3 100;0;0 21.569 True ENSG00000213689 ENSG00000213689 HGNC:12269 TRIM2 gene TRIM2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 2R, MIM# 615490;MONDO:0014208;HMSN 23562820;25893792;18687884;32815244;32205255;25893792 False 3 100;0;0 21.569 False ENSG00000109654 ENSG00000109654 HGNC:15974 TRIM32 gene TRIM32 Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2H, 254110 False 3 50;0;50 21.569 False ENSG00000119401 ENSG00000119401 HGNC:16380 TRIM37 gene TRIM37 Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 21.569 False ENSG00000108395 ENSG00000108395 HGNC:7523 TRIM8 gene TRIM8 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Focal segmental glomerulosclerosis and neurodevelopmental syndrome, MIM# 619428;Intellectual disability;Seizures 30244534;27346735;23934111 False 3 100;0;0 21.569 True ENSG00000171206 ENSG00000171206 HGNC:15579 TRIO gene TRIO Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 44, with microcephaly MIM#617061;Intellectual developmental disorder, autosomal dominant 63, with macrocephaly MIM#618825 False 3 100;0;0 21.569 True ENSG00000038382 ENSG00000038382 HGNC:12303 TRIP4 gene TRIP4 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 1, MIM# 616866 26924529 False 3 100;0;0 21.569 True ENSG00000103671 ENSG00000103671 HGNC:12310 TRIT1 gene TRIT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 35, MIM#617873 32088416;24901367;28185376;30977854 False 3 100;0;0 21.569 True ENSG00000043514 ENSG00000043514 HGNC:20286 TRIT1 gene TRIT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 35 MIM#617873 PMID: 36047296;36049610 False 3 100;0;0 21.569 True ENSG00000043514 ENSG00000043514 HGNC:20286 TRMT1 gene TRMT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Intellectual developmental disorder, autosomal recessive 68 MIM#618302" PMID: 31898845;26308914;30289604 False 3 100;0;0 21.569 True ENSG00000104907 ENSG00000104907 HGNC:25980 TRMT10A gene TRMT10A Expert Review Green;Expert list;Expert Review;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, short stature, and impaired glucose metabolism 1, MIM# 616033 26535115;4995728 False 3 100;0;0 21.569 True ENSG00000145331 ENSG00000145331 HGNC:28403 TRMT10C gene TRMT10C Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 30, MIM# 616974 27132592;33886802 False 3 100;0;0 21.569 True ENSG00000174173 ENSG00000174173 HGNC:26022 TRMT5 gene TRMT5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 26, MIM# 616539 26189817;35342985;35109800;29021354 False 3 100;0;0 21.569 True ENSG00000126814 ENSG00000126814 HGNC:23141 TRMU gene TRMU Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Liver failure, transient infantile, MIM# 613070 19732863 False 3 100;0;0 21.569 True ENSG00000100416 ENSG00000100416 HGNC:25481 TRNT1 gene TRNT1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Retinitis pigmentosa and erythrocytic microcytosis, MIM# 616959;Sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay, MIM# 616084 25193871;23553769;29170023;27389523;26494905 False 3 100;0;0 21.569 True ENSG00000072756 ENSG00000072756 HGNC:17341 TRPM3 gene TRPM3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224 31278393;35146895 False 3 100;0;0 21.569 True ENSG00000083067 ENSG00000083067 HGNC:17992 TRPM3 gene TRPM3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224 31278393 False 3 100;0;0 21.569 True ENSG00000083067 ENSG00000083067 HGNC:17992 TRPM6 gene TRPM6 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomagnesemia 1, intestinal, MIM#602014 False 3 100;0;0 21.569 True ENSG00000119121 ENSG00000119121 HGNC:17995 TRPM6 gene TRPM6 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomagnesemia 1, intestinal MONDO:0011176, Disorders of magnesium metabolism 23942199 False 3 0;0;0 21.569 False ENSG00000119121 ENSG00000119121 HGNC:17995 TRPM7 gene TRPM7 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Familial primary hypomagnesaemia, MONDO:0018100, TRPM7-related 35561741;35712613;39099563;37188671 False 3 100;0;0 21.569 True ENSG00000092439 ENSG00000092439 HGNC:17994 TRPV4 gene TRPV4 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN, dHMN/dSMA;Hereditary motor and sensory neuropathy, type IIc, MIM# 606071;Neuronopathy, distal hereditary motor, type VIII, MIM# 600175 False 3 100;0;0 21.569 False ENSG00000111199 ENSG00000111199 HGNC:18083 TRRAP gene TRRAP Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay with or without dysmorphic facies and autism, MIM#618454 30827496;28628100 False 3 100;0;0 21.569 True ENSG00000196367 ENSG00000196367 HGNC:12347 TSC1 gene TSC1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tuberous sclerosis 1, MIM# 191100 False 3 100;0;0 21.569 True ENSG00000165699 ENSG00000165699 HGNC:12362 TSC1 gene TSC1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tuberous sclerosis 1, MIM# 191100 False 3 100;0;0 21.569 True ENSG00000165699 ENSG00000165699 HGNC:12362 TSC2 gene TSC2 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tuberous sclerosis 2, MIM# 613254 21175459;30628968;19258292;28786492 False 3 100;0;0 21.569 True ENSG00000103197 ENSG00000103197 HGNC:12363 TSC2 gene TSC2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Tuberous sclerosis 2, MIM# 613254 False 3 100;0;0 21.569 True ENSG00000103197 ENSG00000103197 HGNC:12363 TSEN2 gene TSEN2 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 2F, MIM#617026 23562994;18711368;20952379 False 3 50;0;50 21.569 True ENSG00000154743 ENSG00000154743 HGNC:28422 TSEN54 gene TSEN54 Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2A, MIM# 277470 False 3 50;0;50 21.569 True ENSG00000182173 ENSG00000182173 HGNC:27561 TSFM gene TSFM Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3, MIM#610505 False 3 100;0;0 21.569 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSFM gene TSFM Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3 610505 31267352;17033963 False 3 100;0;0 21.569 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSFM gene TSFM Expert Review Green;Royal Melbourne Hospital;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3 False 3 100;0;0 21.569 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSFM gene TSFM Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3, MIM# 610505 25037205;22499341 False 3 100;0;0 21.569 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSPOAP1 gene TSPOAP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 22, MIM# 620453 33539324 False 3 100;0;0 21.569 True ENSG00000005379 ENSG00000005379 HGNC:16831 TSPOAP1 gene TSPOAP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, intellectual disability and cerebellar atrophy 33539324 False 3 100;0;0 21.569 True ENSG00000005379 ENSG00000005379 HGNC:16831 TSPYL1 gene TSPYL1 Expert Review Green;Literature;Expert list;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sudden infant death with dysgenesis of the testes syndrome - 608800;sudden infant death-dysgenesis of the testes syndrome MONDO:0012124 32885560;15273283;33075815;36082874 False 3 75;25;0 21.569 True ENSG00000189241 ENSG00000189241 HGNC:12382 TTBK2 gene TTBK2 Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11 False 3 50;50;0 21.569 False ENSG00000128881 ENSG00000128881 HGNC:19141 TTC19 gene TTC19 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 2, MIM#615157 40946707;37927170;25652355 False 3 100;0;0 21.569 True ENSG00000011295 ENSG00000011295 HGNC:26006 TTC19 gene TTC19 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 2, MIM#615157 21278747;23532514;24368687;24397319 False 3 100;0;0 21.569 True ENSG00000011295 ENSG00000011295 HGNC:26006 TTC19 gene TTC19 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency nuclear type II, 615157;Mitochondrial complex III deficiency, nuclear type 2, 615157 False 3 100;0;0 21.569 True ENSG00000011295 ENSG00000011295 HGNC:26006 TTI1 gene TTI1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445 26539891;30315573;36724785 False 3 50;25;25 21.569 True ENSG00000101407 ENSG00000101407 HGNC:29029 TTN gene TTN Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dilated cardiomyopathy;Distal myopathy;HMERF;Myofibrillar myopathy;Congenital myopathy;Muscular dystrophy, limb-girdle, type 2J, 608807;arthrogryposis False 3 100;0;0 21.569 False ENSG00000155657 ENSG00000155657 HGNC:12403 TTPA gene TTPA Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia with vitamin E deficiency;Early-onset ataxia and sensory axonal neuropathy similar to Friedreich s ataxia, head titubation, normal fat absorption unlike abetalipoproteinemia, rarely retinitis pigmentosa False 3 100;0;0 21.569 False ENSG00000137561 ENSG00000137561 HGNC:12404 TTPA gene TTPA Expert Review Green;NHS GMS Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia with isolated vitamin E deficiency MIM#277460;disorders of vitamins and cofactors 27604308;7719340 False 3 100;0;0 21.569 True ENSG00000137561 ENSG00000137561 HGNC:12404 TTPA gene TTPA NHS GMS;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia with isolated vitamin E deficiency, MIM# 277460" False 3 100;0;0 21.569 True ENSG00000137561 ENSG00000137561 HGNC:12404 TTR gene TTR Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, hereditary, transthyretin-related, MIM# 105210 20301373 False 3 100;0;0 21.569 True ENSG00000118271 ENSG00000118271 HGNC:12405 TTR gene TTR Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, hereditary, transthyretin-related MIM#105210;Cardiomyopathy;Amyloidogenic transthyretin amyloidosis;HSAN/SFN 20301373;8071954;19180884;24101130 False 3 100;0;0 21.569 True ENSG00000118271 ENSG00000118271 HGNC:12405 TTR gene TTR Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hereditary amyloidosis;Amyloidosis, hereditary, transthyretin-related, 105210;Familial amyloid polyneuropathy;Carpal tunnel syndrome, familial, 115430 14640030;26800456;12771253;30120737;16433699;25069833;30878017;31111153;31118583;28678039;19365058;31131842;8309582;The Metabolic and Molecular Bases of Inherited Disease. Vol. IV. 8th ed.Benson, M. D. Amyloidosis. In: Scriver, C. R et al.: New York: McGraw-Hill . 2001;3011930 False 3 0;0;0 21.569 False ENSG00000118271 ENSG00000118271 HGNC:12405 TUBA1A gene TUBA1A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Lissencephaly 3, MIM# 611603 False 3 67;0;33 21.569 True ENSG00000167552 ENSG00000167552 HGNC:20766 TUBA4A gene TUBA4A Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 25374358;25893256;28069311;38463699;38884572;26675813 False 3 50;50;0 21.569 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 25374358;28069311;35327632;34169147;38884572;33760283;26675813 False 3 50;50;0 21.569 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic ataxia 11, autosomal dominant, MIM# 621226 38884572;37418012 False 3 100;0;0 21.569 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309, TUBA4A-related 38884572;37418012 False 3 100;0;0 21.569 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBB gene TUBB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 6, MIM# 615771 23246003;32085672 False 3 100;0;0 21.569 True ENSG00000196230 ENSG00000196230 HGNC:20778 TUBB2A gene TUBB2A Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 5, MIM#615763 24702957;25326637 False 3 50;0;50 21.569 True ENSG00000137267 ENSG00000137267 HGNC:12412 TUBB2B gene TUBB2B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 7, MIM# 610031 19465910;22333901;26732629;33082561 False 3 100;0;0 21.569 True ENSG00000137285 ENSG00000137285 HGNC:30829 TUBB3 gene TUBB3 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fibrosis of extraocular muscles, congenital, 3A (MIM#600638);Neuropathy 20074521;34652576 False 3 50;50;0 21.569 True ENSG00000258947 ENSG00000258947 HGNC:20772 TUBB3 gene TUBB3 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 1, MIM# 614039 20829227;25059107;33318778 False 3 100;0;0 21.569 True ENSG00000258947 ENSG00000258947 HGNC:20772 TUBB4A gene TUBB4A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Leukodystrophy, hypomyelinating, 6, MIM# 612438" 23582646;24850488 False 3 100;0;0 21.569 True ENSG00000104833 ENSG00000104833 HGNC:20774 TUBB4A gene TUBB4A Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukodystrophy, hypomyelinating, 6, 612438;Dystonia 4, 128101, Hypomyelinating leukodystrophy 6, 612438;Dystonia 4, torsion, autosomal dominant, 128101 False 3 100;0;0 21.569 False ENSG00000104833 ENSG00000104833 HGNC:20774 TUBB4A gene TUBB4A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, hypomyelinating, 6, OMIM # 612438 24850488;23582646;23424103;23595291;33084096;32943487 False 3 100;0;0 21.569 True ENSG00000104833 ENSG00000104833 HGNC:20774 TUBB4A gene TUBB4A Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Leukodystrophy, hypomyelinating, 6, MIM# 612438" 24850488;23582646 False 3 100;0;0 21.569 True ENSG00000104833 ENSG00000104833 HGNC:20774 TUBB4A gene TUBB4A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted hereditary whispering dysphonia;Dystonia 4, torsion, autosomal dominant, 128101;Dystonia 23424103;23595291;33084096;32943487 False 3 100;0;0 21.569 False ENSG00000104833 ENSG00000104833 HGNC:20774 TUBG1 gene TUBG1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 4, MIM# 615412 23603762;31086189 False 3 100;0;0 21.569 True ENSG00000131462 ENSG00000131462 HGNC:12417 TUBGCP2 gene TUBGCP2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pachygyria, microcephaly, developmental delay, and dysmorphic facies, with or without seizures, OMIM # 618737 31630790 False 3 100;0;0 21.569 True ENSG00000130640 ENSG00000130640 HGNC:18599 TUBGCP6 gene TUBGCP6 Expert Review Green;Literature;Expert list;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly and chorioretinopathy, autosomal recessive, 1 - 251270;Epilepsy 22279524;33453472 False 3 100;0;0 21.569 True ENSG00000128159 ENSG00000128159 HGNC:18127 TUFM gene TUFM Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 4, MIM# 610678;Mitochondrial Leukoencephalopathy 28132884;26741492;17160893 False 3 100;0;0 21.569 True ENSG00000178952 ENSG00000178952 HGNC:12420 TUFM gene TUFM Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 4, OMIM #610678;MONDO:0012534 28132884;26741492;17160893;30903008 False 3 100;0;0 21.569 True ENSG00000178952 ENSG00000178952 HGNC:12420 TUSC3 gene TUSC3 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 7, MIM# 611093, MONDO:0012615;TUSC3-CDG (Disorders of protein N-glycosylation) 18452889;18455129;21739581;27148795;31606977 False 3 100;0;0 21.569 True ENSG00000104723 ENSG00000104723 HGNC:30242 TWNK gene TWNK Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286 20880070 False 3 100;0;0 21.569 True ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Perrault syndrome (MIM#616138);Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, MIM# 609286 25254289;25355836;27650058;28178980;35011763 False 3 100;0;0 21.569 True ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 7 (hepatocerebral type) 271245;Perrault syndrome 5 616138;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 609286 32234020;18593709 False 3 100;0;0 21.569 True ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 7, 271245;Ataxia Neuropathy Spectrum Disorders, Dominant;Progressive external ophthalmoplegia with mitochondrial DNA deletions, 609286;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, 609286;Perrault syndrome 5, 616138;Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), 271245;Spinocerebellar Ataxia, Recessive False 3 100;0;0 21.569 False ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286 24076137;22949510;22580846;19353676 False 3 100;0;0 21.569 True ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 7 (hepatocerebral type) MIM#271245;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286 PMID: 19304794 False 3 100;0;0 21.569 True ENSG00000107815 ENSG00000107815 HGNC:1160 TYMP gene TYMP Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 1 (MNGIE type);HMSN False 3 0;100;0 21.569 True ENSG00000025708 ENSG00000025708 HGNC:3148 TYMP gene TYMP Royal Melbourne Hospital;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 1 (MNGIE type);Mitochondrial Leukoencephalopathy False 3 0;0;0 21.569 False ENSG00000025708 ENSG00000025708 HGNC:3148 TYMP gene TYMP Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM# 603041 9924029;14757860;21933806 False 3 100;0;0 21.569 True ENSG00000025708 ENSG00000025708 HGNC:3148 TYROBP gene TYROBP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, MIM# 221770" 30242731;11402114 False 3 100;0;0 21.569 True ENSG00000011600 ENSG00000011600 HGNC:12449 TYROBP gene TYROBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1 (MIM#221770) 20301376 False 3 100;0;0 21.569 True ENSG00000011600 ENSG00000011600 HGNC:12449 TYROBP gene TYROBP Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy 1, 221770 False 3 100;0;0 21.569 False ENSG00000011600 ENSG00000011600 HGNC:12449 U2AF2 gene U2AF2 Expert Review Green;Literature;Expert list;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay, dysmorphic facies, and brain anomalies, MIM# 620535 34112922;37092751;36747105;37134193 False 3 33;33;33 21.569 True ENSG00000063244 ENSG00000063244 HGNC:23156 UBA1 gene UBA1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females dHMN/dSMA;Spinal muscular atrophy, X-linked 2, MIM# 301830 18179898;32181232;31932168;29034082;27699224;26028276;23518311 False 3 100;0;0 21.569 False ENSG00000130985 ENSG00000130985 HGNC:12469 UBA5 gene UBA5 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 44 (MIM#617132) 28965491;27545674;27545681 False 3 100;0;0 21.569 True ENSG00000081307 ENSG00000081307 HGNC:23230 UBAP1 gene UBAP1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Childhood-onset hereditary spastic paraplegia;Spastic paraplegia 80, autosomal dominant 618418" 31696996 False 3 100;0;0 21.569 True Other ENSG00000165006 ENSG00000165006 HGNC:12461 UBAP2L gene UBAP2L Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with impaired language, behavioral abnormalities, and dysmorphic facies, MIM# 620494;Delayed speech and language development;Motor delay;Intellectual disability;Autistic behavior;Seizures;Microcephaly;Abnormality of head or neck;Short stature;Abnormality of the skeletal system 35977029 False 3 50;50;0 21.569 True ENSG00000143569 ENSG00000143569 HGNC:29877 UBE2A gene UBE2A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Intellectual developmental disorder, X-linked syndromic, Nascimento type 300860 24053514;16909393 False 3 100;0;0 21.569 True ENSG00000077721 ENSG00000077721 HGNC:12472 UBE3A gene UBE3A Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, paternally imprinted (maternal allele expressed) Angelman syndrome, MIM#105830 30842224 False 3 50;50;0 21.569 True ENSG00000114062 ENSG00000114062 HGNC:12496 UBQLN2 gene UBQLN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amyotrophic lateral sclerosis 15, with or without frontotemporal dementia (MIM#300857) 20301623;31319884;21857683;30348461 False 3 0;100;0 21.569 True ENSG00000188021 ENSG00000188021 HGNC:12509 UBQLN2 gene UBQLN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amyotrophic lateral sclerosis type 15 (MONDO:0010459;MIM#300857) 20301623;21857683 False 3 100;0;0 21.569 True ENSG00000188021 ENSG00000188021 HGNC:12509 UBR5 gene UBR5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with speech delay and behavioral abnormalities, MIM# 621372 39721588 False 3 100;0;0 21.569 True ENSG00000104517 ENSG00000104517 HGNC:16806 UBR7 gene UBR7 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Li-Campeau syndrome, MIM# 619189;Intellectual disability;epilepsy;hypothyroidism;congenital anomalies;dysmorphic features 33340455 False 3 100;0;0 21.569 True ENSG00000012963 ENSG00000012963 HGNC:20344 UBTF gene UBTF Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;Parkinsonism;Dystonia;Chorea;Brain atrophy PubMed: 28777933;29300972 False 3 100;0;0 21.569 True ENSG00000108312 ENSG00000108312 HGNC:12511 UBTF gene UBTF Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701 28777933;29300972 False 3 100;0;0 21.569 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000108312 ENSG00000108312 HGNC:12511 UBTF gene UBTF Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701 29300972 False 3 100;0;0 21.569 True ENSG00000108312 ENSG00000108312 HGNC:12511 UCHL1 gene UCHL1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegenerative disease, MONDO:0005559, UCHL1-related 35986737 False 3 100;0;0 21.569 True ENSG00000154277 ENSG00000154277 HGNC:12513 UCHL1 gene UCHL1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 79A, autosomal dominant, MIM# 620221;Spastic paraplegia 79, autosomal recessive, 615491;MONDO:0014209;Neurodegenerative disease, MONDO:0005559, UCHL1-related 23359680;3340629;28007905;32656641;29735986;28007905;35986737 False 3 100;0;0 21.569 True ENSG00000154277 ENSG00000154277 HGNC:12513 UCHL1 gene UCHL1 Expert Review Green;Expert list;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 79, autosomal recessive, MIM#615491;Neurodegenerative disease, MONDO:0005559, UCHL1-related 28007905;23359680;11555633;35986737 False 3 100;0;0 21.569 True ENSG00000154277 ENSG00000154277 HGNC:12513 UFM1 gene UFM1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 14, MIM# 617899 28931644;29868776 False 3 100;0;0 21.569 True ENSG00000120686 ENSG00000120686 HGNC:20597 UFM1 gene UFM1 Expert Review Green;Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 14 617899 29868776 False 3 100;0;0 21.569 True ENSG00000120686 ENSG00000120686 HGNC:20597 UFSP2 gene UFSP2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 106, MIM# 620028;Abnormal muscle tone;Seizures;Global developmental delay;Delayed speech and language development;Intellectual disability;Strabismus 33473208 False 3 50;50;0 21.569 True ENSG00000109775 ENSG00000109775 HGNC:25640 UGDH gene UGDH Expert Review Green;Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 84 - MIM #618792 32001716 False 3 100;0;0 21.569 True ENSG00000109814 ENSG00000109814 HGNC:12525 UGGT1 gene UGGT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IICC, MIM# 621381 PMID: 40267907 False 3 100;0;0 21.569 True ENSG00000136731 ENSG00000136731 HGNC:15663 UGGT1 gene UGGT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type IICC, MIM# 621381 40267907 False 3 67;0;33 21.569 True ENSG00000136731 ENSG00000136731 HGNC:15663 UGP2 gene UGP2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy;intellectual disability;microcephaly 31820119 False 3 100;0;0 21.569 True ENSG00000169764 ENSG00000169764 HGNC:12527 UGT1A1 gene UGT1A1 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bilirubin UDP-glucuronosyltransferase 1 deficiency (Disorders of bile acid metabolism and transport);Crigler-Najjar syndrome, type I 218800;Crigler-Najjar syndrome, type II 606785 False 3 100;0;0 21.569 True ENSG00000241635 ENSG00000241635 HGNC:12530 UMPS gene UMPS Expert Review Green;Literature;Expert list;Expert Review Green;Expert Review;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Orotic aciduria - 258900;Epilepsy 25757096;33489760 False 3 100;0;0 21.569 True ENSG00000114491 ENSG00000114491 HGNC:12563 UMPS gene UMPS Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Orotic aciduria, MIM# 258900" False 3 100;0;0 21.569 True ENSG00000114491 ENSG00000114491 HGNC:12563 UNC13A gene UNC13A Expert Review Green;Literature;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456;Neurodevelopmental disorder with hypotonia, epilepsy, and absent speech, MIM# 621455;Intellectual development disorder with seizures and dysmorphic facies, MIM# 621457 27648472;28192369;41125872 False 3 100;0;0 21.569 True ENSG00000130477 ENSG00000130477 HGNC:23150 UNC13A gene UNC13A Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456 27648472;28192369;41125872 False 3 100;0;0 21.569 True Other ENSG00000130477 ENSG00000130477 HGNC:23150 UNC45B gene UNC45B Expert Review Green;Other;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myofibrillar myopathy 11 (MIM#619178) 33217308;31852522 False 3 100;0;0 21.569 True ENSG00000141161 ENSG00000141161 HGNC:14304 UNC79 gene UNC79 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder (MONDO:0700092), UNC79-related PMID:37183800 False 3 0;100;0 21.569 True ENSG00000133958 ENSG00000133958 HGNC:19966 UNC80 gene UNC80 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypotonia, infantile, with psychomotor retardation and characteristic facies 2, MIM# 616801;MONDO:0014777 26708751;26708753;26545877;32620897;30167850;30167850 False 3 100;0;0 21.569 True ENSG00000144406 ENSG00000144406 HGNC:26582 UPB1 gene UPB1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Beta-ureidopropionase deficiency, MIM# 613161" 27604308;24526388;25638458;22525402;15385443;17964839 False 3 100;0;0 21.569 True ENSG00000100024 ENSG00000100024 HGNC:16297 UQCC2 gene UQCC2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 7 - MIM#615824 24385928;28804536 False 3 100;0;0 21.569 True ENSG00000137288 ENSG00000137288 HGNC:21237 UQCRB gene UQCRB Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 3, MIM# 615158 23281071;28275242;12709789;25446085;23454382 False 3 100;0;0 21.569 True ENSG00000156467 ENSG00000156467 HGNC:12582 UQCRC2 gene UQCRC2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 5, MIM# 615160 28275242;23281071;33865955 False 3 50;50;0 21.569 True ENSG00000140740 ENSG00000140740 HGNC:12586 UQCRFS1 gene UQCRFS1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Complex III deficiency;lactic acidosis;fetal bradycardia;hypertrophic cardiomyopathy;alopecia totalis 31883641 False 3 100;0;0 21.569 True ENSG00000169021 ENSG00000169021 HGNC:12587 USP18 gene USP18 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pseudo-TORCH syndrome 2, MIM# 617397 31940699;27325888 False 3 100;0;0 21.569 True ENSG00000184979 ENSG00000184979 HGNC:12616 USP18 gene USP18 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pseudo-TORCH syndrome 2, MIM#617397 12833411;27325888;31940699 False 3 100;0;0 21.569 True ENSG00000184979 ENSG00000184979 HGNC:12616 VAC14 gene VAC14 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Striatonigral degeneration, childhood-onset 617054 False 3 0;0;0 21.569 False ENSG00000103043 ENSG00000103043 HGNC:25507 VAC14 gene VAC14 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Striatonigral degeneration, childhood-onset, MIM# 617054;Dystonia;Parkinsonism PMID: 31392254;28502045 False 3 100;0;0 21.569 True ENSG00000103043 ENSG00000103043 HGNC:25507 VAMP2 gene VAMP2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760;Dystonia;Cortical visual impairment;Seizures;Stereotypic behaviour;Generalized hypotonia;Intellectual disability 30929742 False 3 100;0;0 21.569 True ENSG00000220205 ENSG00000220205 HGNC:12643 VAMP2 gene VAMP2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760;Cortical visual impairment;Seizures;Stereotypic behaviour;Generalized hypotonia;Intellectual disability" 30929742 False 3 100;0;0 21.569 True ENSG00000220205 ENSG00000220205 HGNC:12643 VAPB gene VAPB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, late-onset, Finkel type (MIM# 182980);Amyotrophic lateral sclerosis 8 20301623;15372378 False 3 100;0;0 21.569 True ENSG00000124164 ENSG00000124164 HGNC:12649 VAPB gene VAPB Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Adult proximal spinal muscular atrophy, autosomal dominant;dHMN/dSMA;Spinal muscular atrophy, late-onset, Finkel type, MIM# 182980 15372378;32162544;28993872;28173107;26566915 False 3 100;0;0 21.569 False ENSG00000124164 ENSG00000124164 HGNC:12649 VARS gene VARS Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, seizures, and cortical atrophy;OMIM #617802 30755616;30755602;26539891;29691655;30275004 False 3 100;0;0 21.569 True ENSG00000204394 ENSG00000204394 HGNC:12651 VARS2 gene VARS2 Expert Review Green;Expert Review Green;Literature;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 20, 615917;Epilepsy 27502409;29137650;31064326;31623496 False 3 100;0;0 21.569 True ENSG00000137411 ENSG00000137411 HGNC:21642 VARS2 gene VARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 20;OMIM #615917 24827421;25058219;29137650;29314548;31064326;31623496 False 3 100;0;0 21.569 True ENSG00000137411 ENSG00000137411 HGNC:21642 VCP gene VCP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 (MIM#167320);Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (MIM#613954) 15034582;30103325;21145000 False 3 100;0;0 21.569 True ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 167320 False 3 0;0;0 21.569 False ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (ALS) (MIM#613954) 20301649;20301623;21145000 False 3 100;0;0 21.569 True ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507 38283104;38145206 False 3 100;0;0 21.569 True Other ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 2Y, MIM# 616687 25125609;25878907;32165109 False 3 50;50;0 21.569 False Other ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507;Disorders of mitochondrial protein quality control 29884839;35273561;37678339;15034582;30103325;21145000 False 3 100;0;0 21.569 True ENSG00000165280 ENSG00000165280 HGNC:12666 VIPAS39 gene VIPAS39 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Arthrogryposis, renal dysfunction, and cholestasis 2, MIM# 613404" 22753090;26808426 False 3 100;0;0 21.569 True ENSG00000151445 ENSG00000151445 HGNC:20347 VLDLR gene VLDLR Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation and dysequilibirum syndrome 1, 224050;Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, 224050 False 3 100;0;0 21.569 False ENSG00000147852 ENSG00000147852 HGNC:12698 VMA21 gene VMA21 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Myopathy, X-linked, with excessive autophagy (MIM#310440) 27916343;25809233;23315026 False 3 0;100;0 21.569 True ENSG00000160131 ENSG00000160131 HGNC:22082 VMA21 gene VMA21 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Myopathy, X-linked, with excessive autophagy (MIM#310440) 27916343;25809233;23315026 False 3 100;0;0 21.569 True ENSG00000160131 ENSG00000160131 HGNC:22082 VPS11 gene VPS11 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 12, MIM#616683 27120463;26307567;27473128 False 3 100;0;0 21.569 True ENSG00000160695 ENSG00000160695 HGNC:14583 VPS11 gene VPS11 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 12, MIM#616683 27120463;26307567;27473128 False 3 100;0;0 21.569 True ENSG00000160695 ENSG00000160695 HGNC:14583 VPS13A gene VPS13A Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Choreoacanthocytosis MIM#200150 False 3 100;0;0 21.569 False ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13A gene VPS13A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Choreoacanthocytosis MIM#200150 26813249;30140251;31192303 False 3 100;0;0 21.569 True ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13A gene VPS13A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal chorea-acanthocytosis MONDO:0008695 33652783;20301561 False 3 100;0;0 21.569 True ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13A gene VPS13A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal chorea-acanthocytosis MONDO:0008695 20301561;37636221 False 3 100;0;0 21.569 True ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13A gene VPS13A Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex parkinsonism;Choreoacanthocytosis 200150 False 3 0;0;0 21.569 False ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13C gene VPS13C Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Early-onset Parkinson disease-23, MIM# 616840 26942284 False 3 100;0;0 21.569 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS13C gene VPS13C Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 23, autosomal recessive, early onset MIM#616840 26942284;30452786;28862745 False 3 100;0;0 21.569 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS13C gene VPS13C Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "autosomal recessive early-onset Parkinson disease 23 MONDO:0014796" 33579389;37330543;34875562 False 3 100;0;0 21.569 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS13D gene VPS13D Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317 29604224;29518281 False 3 100;0;0 21.569 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS13D gene VPS13D Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317" 29604224;29518281 False 3 100;0;0 21.569 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS13D gene VPS13D Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317" 29604224;29518281 False 3 100;0;0 21.569 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS16 gene VPS16 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mucopolysaccharidosis-like disorder, VPS16-related MONDO#0100365 33938619;34013567;34901436 False 3 100;0;0 21.569 True ENSG00000215305 ENSG00000215305 HGNC:14584 VPS16 gene VPS16 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 30, MIM#619291 32808683 False 3 100;0;0 21.569 True ENSG00000215305 ENSG00000215305 HGNC:14584 VPS33A gene VPS33A Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mucopolysaccharidosis-plus syndrome (MIM#617303) 28013294;27547915 False 3 50;50;0 21.569 True ENSG00000139719 ENSG00000139719 HGNC:18179 VPS33B gene VPS33B Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Arthrogryposis, renal dysfunction, and cholestasis 1, MIM# 208085" 16896922 False 3 100;0;0 21.569 True ENSG00000184056 ENSG00000184056 HGNC:12712 VPS35 gene VPS35 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown {Parkinson disease 17} MIM#614203;Cognitive decline False 3 0;0;0 21.569 False ENSG00000069329 ENSG00000069329 HGNC:13487 VPS35 gene VPS35 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 17, MIM# 614203 21763482;21763483;22801713;34704029 False 3 100;0;0 21.569 True ENSG00000069329 ENSG00000069329 HGNC:13487 VPS41 gene VPS41 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay 32808683;33764426 False 3 100;0;0 21.569 True ENSG00000006715 ENSG00000006715 HGNC:12713 VPS41 gene VPS41 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay 32808683;33764426 False 3 100;0;0 21.569 True ENSG00000006715 ENSG00000006715 HGNC:12713 VPS4A gene VPS4A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CIMDAG syndrome MIM# 619273 33186543;33186545 False 3 100;0;0 21.569 True Other ENSG00000132612 ENSG00000132612 HGNC:13488 VPS4A gene VPS4A Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CIMDAG syndrome MIM# 619273 33186543;33186545 False 3 100;0;0 21.569 True Other ENSG00000132612 ENSG00000132612 HGNC:13488 VPS50 gene VPS50 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, seizures, and neonatal cholestasis , MIM#619685;Neonatal cholestatic liver disease;Failure to thrive;Profound global developmental delay;Postnatal microcephaly;Seizures;Abnormality of the corpus callosum 34037727;38876772 False 3 33;67;0 21.569 True ENSG00000004766 ENSG00000004766 HGNC:25956 VPS51 gene VPS51 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Pontocerebellar hypoplasia, type 13, MIM# 618606" 40565173;30624672;31207318;40176246 False 3 100;0;0 21.569 True ENSG00000149823 ENSG00000149823 HGNC:1172 VRK1 gene VRK1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 10, MIM# 620542 31560180;32242460;31178479;31837156;30847374 False 3 100;0;0 21.569 False ENSG00000100749 ENSG00000100749 HGNC:12718 VWA1 gene VWA1 Literature;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary motor neuropathy 33459760;33693694;33559681 False 3 0;0;0 21.569 False ENSG00000179403 ENSG00000179403 HGNC:30910 VWA3B gene VWA3B Expert Review Green;GeneReviews;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 22 MIM#616948 26157035 False 3 50;0;50 21.569 True ENSG00000168658 ENSG00000168658 HGNC:28385 WAC gene WAC Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Desanto-Shinawi syndrome MIM#616708 PMID: 36420948 False 3 100;0;0 21.569 True ENSG00000095787 ENSG00000095787 HGNC:17327 WARS gene WARS Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder withmicrocephaly and speech delay, with or without brain abnormalities,MIM# 620317 PMID: 35815345 PMID: 35790048 False 3 100;0;0 21.569 True ENSG00000140105 ENSG00000140105 HGNC:12729 WARS2 gene WARS2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 21.569 True ENSG00000116874 ENSG00000116874 HGNC:12730 WARS2 gene WARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 21.569 True ENSG00000116874 ENSG00000116874 HGNC:12730 WARS2 gene WARS2 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM#617710 31282308;28650581;30920170 False 3 100;0;0 21.569 True ENSG00000116874 ENSG00000116874 HGNC:12730 WARS2 gene WARS2 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 21.569 True ENSG00000116874 ENSG00000116874 HGNC:12730 WARS2 gene WARS2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738 PMID: 29120065;34890876;31970218 False 3 100;0;0 21.569 True ENSG00000116874 ENSG00000116874 HGNC:12730 WARS2 gene WARS2 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM#617710 29783990;28236339;29120065;28650581;28905505 False 3 100;0;0 21.569 True ENSG00000116874 ENSG00000116874 HGNC:12730 WASF1 gene WASF1 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with absent language and variable seizures , MIM#618707 29961568;34845217;34478686;34356165 False 3 100;0;0 21.569 True ENSG00000112290 ENSG00000112290 HGNC:12732 WASHC5 gene WASHC5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 8, autosomal dominant, 603563;MONDO:0011339 23455931;17160902;31814071;26572744 False 3 100;0;0 21.569 False ENSG00000164961 ENSG00000164961 HGNC:28984 WDR26 gene WDR26 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Skraban-Deardorff syndrome MIM# 617616 28686853;33675273 False 3 100;0;0 21.569 True ENSG00000162923 ENSG00000162923 HGNC:21208 WDR37 gene WDR37 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurooculocardiogenitourinary syndrome, MIM# 618652 31327508;31327508 False 3 100;0;0 21.569 True ENSG00000047056 ENSG00000047056 HGNC:31406 WDR45 gene WDR45 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) "Neurodegeneration with brain iron accumulation 5, MIM# 300894" 23176820 False 3 100;0;0 21.569 True ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45 gene WDR45 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegeneration with brain iron accumulation 5 300894;beta-propeller protein-associated neurodegeneration;Dystonia False 3 0;0;0 21.569 False ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45 gene WDR45 GeneReviews;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Beta-propeller protein-associated neurodegeneration (BPAN) False 3 100;0;0 21.569 False ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45 gene WDR45 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked complex neurodevelopmental disorder MONDO:0100148 28211668 False 3 100;0;0 21.569 True ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45 gene WDR45 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegeneration with brain iron accumulation 5 MIM#300894 23435086 False 3 100;0;0 21.569 False ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45 gene WDR45 Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegeneration with brain iron accumulation 5, MIM# 300894;Rett syndrome;Rett-like phenotypes 23176820;30842224 False 3 100;0;0 21.569 True ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45 gene WDR45 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Disorders of autophagy;X-linked complex neurodevelopmental disorder MONDO:0100148 38465922;29884839 False 3 0;0;0 21.569 False ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45B gene WDR45B Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Profound developmental delay, early-onset refractory epilepsy, progressive spastic quadriplegia and contractures, and brain malformations;Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM#617977 21937992;28503735;27431290 False 3 100;0;0 21.569 True ENSG00000141580 ENSG00000141580 HGNC:25072 WDR45B gene WDR45B Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM# 617977 21937992;28503735;27431290 False 3 100;0;0 21.569 True ENSG00000141580 ENSG00000141580 HGNC:25072 WDR47 gene WDR47 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder MONDO:0100038, WDR47-related 39609633 False 3 100;0;0 21.569 True ENSG00000085433 ENSG00000085433 HGNC:29141 WDR62 gene WDR62 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly 2, primary, autosomal recessive, with or without cortical malformations, MIM# 604317;MONDO:0011435 21834044;20890278;20729831 False 3 100;0;0 21.569 True ENSG00000075702 ENSG00000075702 HGNC:24502 WDR73 gene WDR73 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 1 MIM#251300 25466283;26123727;25873735;26070982;30315938 False 3 100;0;0 21.569 True ENSG00000177082 ENSG00000177082 HGNC:25928 WDR73 gene WDR73 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway Mowat syndrome, when patients are ambulant ataxia is a recognisednfeature;Galloway-Mowat Syndrome 1, 251300 False 3 100;0;0 21.569 False ENSG00000177082 ENSG00000177082 HGNC:25928 WDR73 gene WDR73 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 1, 251300 False 3 0;0;0 21.569 False ENSG00000177082 ENSG00000177082 HGNC:25928 WDR81 gene WDR81 Expert Review Red;Expert Review Red;Expert list;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital hydrocephalus 3 with brain anomalies, 617967;Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Cerebellar ataxia, mental retardation and dysequilibrium syndrome 2, 610185 21885617;28556411;28969387 False 3 33;0;67 21.569 True ENSG00000167716 ENSG00000167716 HGNC:26600 WFS1 gene WFS1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wolfram syndrome 1, 222300 25211237 False 3 100;0;0 21.569 True ENSG00000109501 ENSG00000109501 HGNC:12762 WNK1 gene WNK1 Expert Review Green;Genomics England PanelApp Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type II, 201300;HSAN 2;Hereditary sensory and autonomic neuropathy type IIA 15911806;16636245;16946995;21625937;15455397;18521183;15060842 False 3 0;0;0 21.569 False ENSG00000060237 ENSG00000060237 HGNC:14540 WNK1 gene WNK1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Neuropathy, hereditary sensory and autonomic, type II, MIM# 201300;MONDO:0024309 15060842;15911806;15455397;16534117 False 3 100;0;0 21.569 False ENSG00000060237 ENSG00000060237 HGNC:14540 WNK3 gene WNK3 Expert Review Green;Literature;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Prieto syndrome, MIM# 309610 35678782 False 3 100;0;0 21.569 True ENSG00000196632 ENSG00000196632 HGNC:14543 WSB2 gene WSB2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Luo-Agrawal neurodevelopmental syndrome, MIM# 621552 PMID: 40374945 False 3 100;0;0 21.569 True ENSG00000176871 ENSG00000176871 HGNC:19222 WWOX gene WWOX Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 12, 6143232;Early infantile epileptic encephalopathy 28, 616211;Autosomal recessive spinocerebellar ataxia 12, 614322 False 3 100;0;0 21.569 False ENSG00000186153 ENSG00000186153 HGNC:12799 WWOX gene WWOX Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 28, MIM# 616211 24456803;25411445;32051108;32037574;30356099;29808465 False 3 100;0;0 21.569 True ENSG00000186153 ENSG00000186153 HGNC:12799 XK gene XK Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) McLeod syndrome with or without chronic granulomatous disease MIM#300842 11761473 False 3 100;0;0 21.569 True ENSG00000047597 ENSG00000047597 HGNC:12811 XK gene XK Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females McLeod syndrome with or without chronic granulomatous disease (MIM#300842) 12899725 False 3 100;0;0 21.569 True ENSG00000047597 ENSG00000047597 HGNC:12811 XK gene XK Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females McLeod syndrome with or without chronic granulomatous disease (MIM#300842) 11761473 False 3 100;0;0 21.569 True ENSG00000047597 ENSG00000047597 HGNC:12811 XPR1 gene XPR1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 6, MIM# 616413 25938945 False 3 100;0;0 21.569 True ENSG00000143324 ENSG00000143324 HGNC:12827 XPR1 gene XPR1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 6, MIM# 616413 25938945;27230854;29955172;33433330 False 3 100;0;0 21.569 True ENSG00000143324 ENSG00000143324 HGNC:12827 XRCC1 gene XRCC1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 26 MIM#617633 28002403;29472272 False 3 100;0;0 21.569 False ENSG00000073050 ENSG00000073050 HGNC:12828 XRCC1 gene XRCC1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 26 MIM#617633 28002403;29472272 False 3 100;0;0 21.569 True ENSG00000073050 ENSG00000073050 HGNC:12828 XYLT1 gene XYLT1 Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Desbuquois dysplasia 2, MIM# 615777;Baratela-Scott syndrome 30554721;24581741;23982343 False 3 100;0;0 21.569 True ENSG00000103489 ENSG00000103489 HGNC:15516 XYLT2 gene XYLT2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spondyloocular syndrome MIM# 605822 26027496;26987875;30891060;28484880 False 3 100;0;0 21.569 True ENSG00000015532 ENSG00000015532 HGNC:15517 YARS gene YARS Royal Melbourne Hospital;Expert Review Green;Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, dominant intermediate C, MIM# 608323;MONDO:0012012 16429158;24354524;31587308;26725087 False 3 100;0;0 21.569 False ENSG00000134684 ENSG00000134684 HGNC:12840 YARS2 gene YARS2 Expert Review Green;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, lactic acidosis, and sideroblastic anemia 2 MIM#613561 28395030 False 3 100;0;0 21.569 True ENSG00000139131 ENSG00000139131 HGNC:24249 YARS2 gene YARS2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, lactic acidosis, and sideroblastic anaemia 2 MIM# 613561;sideroblastic anaemia;muscle atrophy;myopathy;lactic acidosis;Hypertrophic cardiomyopathy;Hepatomegaly;Decreased cytochrome C oxidase activity 24430573;24344687 False 3 100;0;0 21.569 True ENSG00000139131 ENSG00000139131 HGNC:24249 YIF1B gene YIF1B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement 32006098;26077767 False 3 100;0;0 21.569 True ENSG00000167645 ENSG00000167645 HGNC:30511 YIF1B gene YIF1B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement 32006098 False 3 50;50;0 21.569 True ENSG00000167645 ENSG00000167645 HGNC:30511 YIPF5 gene YIPF5 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, epilepsy, and diabetes syndrome 2 , MIM#619278 33164986 False 3 100;0;0 21.569 True ENSG00000145817 ENSG00000145817 HGNC:24877 YWHAG gene YWHAG Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 56, (MIMI#617665) 33393734;33590706;31926053;33767733 False 3 100;0;0 21.569 True ENSG00000170027 ENSG00000170027 HGNC:12852 YY1 gene YY1 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Gabriele-de Vries syndrome 617557 False 3 0;0;0 21.569 False ENSG00000100811 ENSG00000100811 HGNC:12856 YY1AP1 gene YY1AP1 Genomics England PanelApp;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Grange syndrome, 602531 False 3 100;0;0 21.569 False ENSG00000163374 ENSG00000163374 HGNC:30935 ZBTB18 gene ZBTB18 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 22, MIM# 612337 29573576 False 3 100;0;0 21.569 True ENSG00000179456 ENSG00000179456 HGNC:13030 ZBTB20 gene ZBTB20 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Primrose syndrome, MIM# 259050 32734340;25017102 False 3 100;0;0 21.569 True ENSG00000181722 ENSG00000181722 HGNC:13503 ZBTB47 gene ZBTB47 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder (MONDO#0700092), ZBTB47-related 37743782 False 3 100;0;0 21.569 True ENSG00000114853 ENSG00000114853 HGNC:26955 ZDHHC9 gene ZDHHC9 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked syndromic, Raymond type, MIM#300799 26000327 False 3 100;0;0 21.569 True ENSG00000188706 ENSG00000188706 HGNC:18475 ZEB2 gene ZEB2 Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Epilepsy Flagship Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mowat-Wilson syndrome, MIM# 235730;MONDO:0009341 29300384;27831545;24715670;19215041;17958891 False 3 100;0;0 21.569 True ENSG00000169554 ENSG00000169554 HGNC:14881 ZFHX3 gene ZFHX3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal {Epilepsy, idiopathic generalized, susceptibility to}, MIM#621500 38508705 False 3 100;0;0 21.569 True ENSG00000140836 ENSG00000140836 HGNC:777 ZFYVE26 gene ZFYVE26 Expert Review Green Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Disorders of autophagy;hereditary spastic paraplegia 15 MONDO:0010044 36029068;34130600;29884839 False 3 0;0;0 21.569 False ENSG00000072121 ENSG00000072121 HGNC:20761 ZFYVE26 gene ZFYVE26 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 15, autosomal recessive, MIM# 270700" False 3 100;0;0 21.569 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZFYVE26 gene ZFYVE26 Expert Review Green;Royal Melbourne Hospital Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 15 MIM#270700 17661097;19438933 False 3 100;0;0 21.569 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZFYVE26 gene ZFYVE26 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 15, autosomal recessive, MIM# 270700;Spastic paraplegia and retinal degeneration;Kjellin syndrome;Parkinsonism" PMID: 33033739;21462267 False 3 100;0;0 21.569 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZFYVE26 gene ZFYVE26 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 15, autosomal recessive, MIM# 270700 19084844 False 3 100;0;0 21.569 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZMYND11 gene ZMYND11 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 30 MIM# 616083 32097528;34216016 False 3 100;0;0 21.569 True ENSG00000015171 ENSG00000015171 HGNC:16966 ZMYND8 gene ZMYND8 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, ZMYND8-related;Delayed speech and language development;Motor delay;Intellectual disability;Abnormality of cardiovascular system morphology;Hearing abnormality;Abnormality of vision;Abnormality of the face;Seizures 35916866;32530565 False 3 100;0;0 21.569 True ENSG00000101040 ENSG00000101040 HGNC:9397 ZNF142 gene ZNF142 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with impaired speech and hyperkinetic movements, MIM#618425 31036918 False 3 100;0;0 21.569 True ENSG00000115568 ENSG00000115568 HGNC:12927 ZNF335 gene ZNF335 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly 10, primary, autosomal recessive (MIM#615095) 23178126;27540107;29652087 False 3 100;0;0 21.569 True ENSG00000198026 ENSG00000198026 HGNC:15807 ZNF526 gene ZNF526 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dentici-Novelli neurodevelopmental syndrome, MIM# 619877 21937992;25558065;33397746 False 3 100;0;0 21.569 True ENSG00000167625 ENSG00000167625 HGNC:29415 ZNF526 gene ZNF526 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dentici-Novelli neurodevelopmental syndrome, MIM# 619877 21937992;25558065;33397746 False 3 100;0;0 21.569 True ENSG00000167625 ENSG00000167625 HGNC:29415 ZNHIT3 gene ZNHIT3 Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal PEHO syndrome, MIM# 260565 28335020;28335020;31048081 False 3 100;0;0 21.569 True ENSG00000108278 ENSG00000273611 HGNC:12309 ZSWIM6 gene ZSWIM6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Acromelic frontonasal dysostosis MIM#603671;Neurodevelopmental disorder with movement abnormalities, abnormal gait, and autistic features MIM#617865 PMID: 29198722;33958584 False 3 100;0;0 21.569 True ENSG00000130449 ENSG00000130449 HGNC:29316 ABCD3_OPDM_GCC str ABCD3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 5, MIM# 621446 39068203 False 3 100;0;0 21.569 True ENSG00000117528 ENSG00000117528 HGNC:67 1 94883977 94883998 94418421 94418442 GCC 50 118 AR_SBMA_CAG str AR Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal and bulbar muscular atrophy of Kennedy MIM#313200 20301508;29325606 False 3 100;0;0 21.569 True ENSG00000169083 ENSG00000169083 HGNC:644 X 66765160 66765225 67545318 67545383 CAG 34 38 ARX_EIEE1_GCN1 str ARX Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 11889467;33811808 False 3 100;0;0 21.569 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031767 25031814 25013650 25013697 GCN 16 23 ARX_EIEE1_GCN1 str ARX Expert Review Green;Expert Review Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 11889467;33811808 False 3 100;0;0 21.569 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031767 25031814 25013650 25013697 GCN 16 23 ARX_EIEE1_GCN2 str ARX Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 11889467;33811808 False 3 100;0;0 21.569 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031647 25031682 25013530 25013565 GCN 12 20 ARX_EIEE1_GCN2 str ARX Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 11889467;33811808 False 3 100;0;0 21.569 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031647 25031682 25013530 25013565 GCN 12 20 ATN1_DRPLA_CAG str ATN1 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 8136840;8136826;29325606;20301664 False 3 100;0;0 21.569 False ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 ATN1_DRPLA_CAG str ATN1 Expert Review Green;Expert List Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 29325606;20301664 False 3 100;0;0 21.569 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 ATN1_DRPLA_CAG str ATN1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 29325606;20301664 False 3 100;0;0 21.569 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 ATN1_DRPLA_CAG str ATN1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 8136840;8136826;29325606;20301664 False 3 100;0;0 21.569 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 32 48 ATXN10_SCA10_ATTCT str ATXN10 Expert Review Green;Expert List Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 10 MIM#603516 20301354 False 3 100;0;0 21.569 True ENSG00000130638 ENSG00000130638 HGNC:10549 22 46191235 46191304 45795355 45795424 ATTCT 32 800 ATXN1_SCA1_CAG str ATXN1 Expert Review Green;Expert List Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 1 MIM#164400 29325606;20301363 False 3 100;0;0 21.569 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327918 16327953 16327687 16327722 CAG 35 39 ATXN1_SCA1_CAG str ATXN1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar Ataxia type 1;Parkinsonism;OMIM 164400 " PMID: 24602359" False 3 100;0;0 21.569 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327867 16327953 16327636 16327722 CAG 36 45 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 20301452 False 3 100;0;0 21.569 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599016 CAG 31 35 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 11761482;17923635;8896555;29325606;20301452 False 3 100;0;0 21.569 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 2 MONDO:0008458 40741828 False 3 100;0;0 21.569 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 ATXN3_SCA3_CAG str ATXN3 Expert Review Green;Expert List Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 20301375;29325606 False 3 100;0;0 21.569 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 ATXN3_SCA3_CAG str ATXN3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 11176969;7574470;7874163;20301375;29325606 False 3 100;0;0 21.569 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 ATXN7_SCA7_CAG str ATXN7 Expert Review Green;Expert List Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 7 MIM#164500 29325606;20301433 False 3 100;0;0 21.569 True ENSG00000163635 ENSG00000163635 HGNC:10560 3 63898362 63898391 63912686 63912715 CAG 27 37 ATXN8OS_SCA8_CTG str ATXN8OS Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 24285970;20301445;10192387 False 3 100;0;0 21.569 True ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139428 CTG 50 80 ATXN8OS_SCA8_CTG str ATXN8OS Expert Review Green;Expert List Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 20301445 False 3 100;0;0 21.569 True ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139422 CTG 50 80 BEAN1_SCA31_TGGAA str BEAN1 Expert Review Green;Expert List Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 31 MIM#117210 19878914;31755042 False 3 100;0;0 21.569 True ENSG00000166546 ENSG00000166546 HGNC:24160 16 66524300 66524369 66490397 66490466 TGGAA 22 80 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 25577942;21944779;21944778;31779815 False 3 100;0;0 21.569 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 26166205;24363131;26187722;25577942;21944779;21944778 False 3 100;0;0 21.569 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 25577942;21944779;21944778 False 3 100;0;0 21.569 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 C9orf72_FTDALS_GGGGCC str C9orf72 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MONDO:0007105 36970046;36632182 False 3 100;0;0 21.569 False ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 25577942;21944779;21944778 False 3 100;0;0 21.569 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 CACNA1A_SCA6_CAG str CACNA1A Expert Review Green;Expert List Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500 20301319;29325606 False 3 100;0;0 21.569 True ENSG00000141837 ENSG00000141837 HGNC:1388 19 13318673 13318691 13207859 13207897 CAG 18 20 CNBP_DM2_CCTG str CNBP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 2 MIM#602668 20301639;11486088 False 3 100;0;0 21.569 True ENSG00000169714 ENSG00000169714 HGNC:13164 3 128891420 128891499 129172577 129172656 CCTG 26 75 CSTB_EPM1_CCCCGCCCCGCG str CSTB Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 29325606;20301321 False 3 100;0;0 21.569 False ENSG00000160213 ENSG00000160213 HGNC:2482 21 45196325 45196360 43776444 43776479 CCCCGCCCCGCG 3 30 CSTB_EPM1_CCCCGCCCCGCG str CSTB Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 29325606;20301321;9126745 False 3 100;0;0 21.569 True ENSG00000160213 ENSG00000160213 HGNC:2482 21 45196325 45196360 43776444 43776479 CCCCGCCCCGCG 3 30 DAB1_SCA37_ATTTC str DAB1 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 37 MIM#615945 28686858;31145571 False 3 100;0;0 21.569 False ENSG00000173406 ENSG00000173406 HGNC:2661 1 57832716 57832797 57367044 57367121 ATTTC 0 31 DMPK_DM1_CTG str DMPK Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 1 MIM#160900 20301344;29325606 False 3 100;0;0 21.569 True ENSG00000104936 ENSG00000104936 HGNC:2933 19 46273463 46273522 45770205 45770264 CTG 34 50 FGF14_SCA27B_GAA str FGF14 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs) 37165652;36516086;36493768 False 3 100;0;0 21.569 False ENSG00000102466 ENSG00000102466 HGNC:3671 13 102813926 102814076 102161576 102161726 GAA 249 300 FMR1_FXTAS_CGG str FMR1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 27340021;28176767;20301558;23765048;25227148;11445641 False 3 100;0;0 21.569 True ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FMR1_FXTAS_CGG str FMR1 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 23765048;25227148 False 3 100;0;0 21.569 False ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FXN_FRDA_GAA str FXN Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 20301458 False 3 100;0;0 21.569 False ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 FXN_FRDA_GAA str FXN Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 20301458;8596916 False 3 100;0;0 21.569 True ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 FXN_FRDA_GAA str FXN Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 20301458;8596916 False 3 100;0;0 21.569 True ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 FXN_FRDA_GAA str FXN Expert Review Green;Expert List Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 20301458;8596916 False 3 100;0;0 21.569 True ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037301 GAA 33 66 GIPC1_OPDM2_CGG str GIPC1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 2 MIM#618940 32413282;33374016 False 3 100;0;0 21.569 True ENSG00000123159 ENSG00000123159 HGNC:1226 19 14606854 14606886 14496042 14496074 CGG 32 70 GLS_GDPAG_GCA str GLS Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 30970188 False 3 100;0;0 21.569 True ENSG00000115419 ENSG00000115419 HGNC:4331 2 191745599 191745646 190880873 190880920 GCA 16 400 GLS_GDPAG_GCA str GLS Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Global developmental delay, progressive ataxia, and elevated glutamine MIM#618412 30970188 False 3 100;0;0 21.569 True ENSG00000115419 ENSG00000115419 HGNC:4331 2 191745599 191745646 190880873 190880920 GCA 16 400 HTT_HD_CAG str HTT Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease MIM#143100 20301482;29325606 False 3 100;0;0 21.569 False ENSG00000197386 ENSG00000197386 HGNC:4851 4 3076604 3076666 3074877 3074939 CAG 26 40 HTT_HD_CAG str HTT Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease MIM#143100 8458085;20301482;29325606 False 3 100;0;0 21.569 False ENSG00000197386 ENSG00000197386 HGNC:4851 4 3076604 3076666 3074877 3074939 CAG 26 40 JPH3_HDL2_CTG str JPH3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 11558794;20301701 False 3 100;0;0 21.569 True ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 JPH3_HDL2_CTG str JPH3 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 11558794;20301701 False 3 100;0;0 21.569 False ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 JPH3_HDL2_CTG str JPH3 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 20301701 False 3 100;0;0 21.569 False ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 LRP12_ALS_CGG str LRP12 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyotrophic lateral sclerosis MONDO:0004976;Amyotrophic lateral sclerosis 28, MIM# 620452" 37339631 False 3 100;0;0 21.569 True ENSG00000147650 ENSG00000147650 HGNC:31708 8 105601201 105601227 104588973 104588999 CGG 50 61 LRP12_OPDM1_CGG str LRP12 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 1 MIM#164310 31332380;34047774 False 3 100;0;0 21.569 True ENSG00000147650 ENSG00000147650 HGNC:31708 8 105601201 105601227 104588973 104588999 CGG 45 85 MARCHF6_FAME3_TTTCA str MARCH6 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial adult myoclonic, 3 MIM#613608 31664039 False 3 100;0;0 21.569 True ENSG00000145495 ENSG00000145495 HGNC:30550 5 10356451 10356519 10356347 10356411 TTTCA 0 660 NOP56_SCA36_GGCCTG str NOP56 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 36 MIM#614153 21683323 False 3 100;0;0 21.569 False ENSG00000101361 ENSG00000101361 HGNC:15911 20 2633380 2633403 2652734 2652757 GGCCTG 14 650 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 21.569 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 21.569 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 21.569 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 21.569 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 NOTCH2NLC_NIID_GGC str NOTCH2NLC Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 21.569 False ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 NUTM2B-AS1_OPDM_CCG str NUTM2B-AS1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 31332380;37923380;39308795;38159879 False 3 100;0;0 21.569 True ENSG00000225484 ENSG00000225484 HGNC:51204 10 81586142 81586159 79826386 79826403 CCG 16 35 PABPN1_OPMD_GCN str PABPN1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Oculopharyngeal muscular dystrophy MIM#164300 9462747;20301305 False 3 100;0;0 21.569 True ENSG00000100836 ENSG00000100836 HGNC:8565 14 23790682 23790711 23321473 23321502 GCN 10 11 PLIN4_MRUPAV_33-mer str PLIN4 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted myopathy, distal, with rimmed vacuoles MONDO:0014945 32451610;37145156;36151849;35499779 False 3 100;0;0 21.569 True ENSG00000167676 ENSG00000167676 HGNC:29393 19 4510975 4511073 4510963 4511061 ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC 31 39 PPP2R2B_SCA12_CAG str PPP2R2B Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 27864267;33811808 False 3 100;0;0 21.569 False ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 PPP2R2B_SCA12_CAG str PPP2R2B Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 31286011;27864267;33811808;10581021 False 3 100;0;0 21.569 True ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 PRDM12_HSAN8_GCC str PRDM12 Literature;Expert Review Green;Expert Review Green;Literature;Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488 26005867 False 3 100;0;0 21.569 False ENSG00000130711 ENSG00000130711 HGNC:13997 9 133556993 133557026 130681606 130681639 GCC 14 18 PRDM12_HSAN8_GCC str PRDM12 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488 26005867 False 3 100;0;0 21.569 False ENSG00000130711 ENSG00000130711 HGNC:13997 9 133556993 133557026 130681606 130681639 GCC 14 18 PRNP_CJD_octapeptide str PRNP Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 2159587;20301407 False 3 100;0;0 21.569 False ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 PRNP_CJD_octapeptide str PRNP Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 2159587;20301407 False 3 100;0;0 21.569 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 PRNP_CJD_octapeptide str PRNP Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 2159587;20301407 False 3 100;0;0 21.569 False ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699424 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 PRNP_CJD_octapeptide str PRNP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 2159587;20301407 False 3 100;0;0 21.569 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 PRNP_CJD_octapeptide str PRNP Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 2159587;20301407 False 3 100;0;0 21.569 False ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 RFC1_CANVAS_ANNGN str RFC1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease MONDO:0005180 39833204;39152783;38789445;36705320;35013364 False 3 100;0;0 21.569 True ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 RFC1_CANVAS_ANNGN str RFC1 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972 False 3 100;0;0 21.569 False ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 RFC1_CANVAS_ANNGN str RFC1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972 False 3 100;0;0 21.569 True ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 RILPL1_OPDM4_CGG str RILPL1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 35148830 False 3 100;0;0 21.569 True ENSG00000188026 ENSG00000188026 HGNC:26814 12 124018270 124018296 123533723 123533749 CGG 16 139 SAMD12_FAME1_TTTCA str SAMD12 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Epilepsy, familial adult myoclonic, 1 MIM#601068 30194086;29507423 False 3 100;0;0 21.569 True ENSG00000177570 ENSG00000177570 HGNC:31750 8 119379055 119379157 118366816 118366918 TTTCA 0 100 STARD7_FAME2_ATTTC str STARD7 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epilepsy, familial adult myoclonic, 2 MIM#607876 11701600;24114805;31664034 False 3 100;0;0 21.569 True ENSG00000084090 ENSG00000084090 HGNC:18063 2 96862805 96862859 96197067 96197121 ATTTC 0 661 TAF1_XDP_CCCTCT str TAF1 Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Dystonia-Parkinsonism, X-linked MIM#314250 17273961;29229810 False 3 100;0;0 21.569 False ENSG00000147133 ENSG00000147133 HGNC:11535 X 70672905 70672979 71453055 71453129 CCCTCT 13 30 TAF1_XDP_CCCTCT str TAF1 Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia-Parkinsonism, X-linked MIM#314250 17273961;29229810 False 3 100;0;0 21.569 True ENSG00000147133 ENSG00000147133 HGNC:11535 X 70672905 70672979 71453055 71453129 CCCTCT 13 30 TBP_SCA17_CAG str TBP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 10484774;20301611;29325606;27172828;14638975;11313753;11914409 False 3 100;0;0 21.569 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 TBP_SCA17_CAG str TBP Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 20301611;29325606 False 3 100;0;0 21.569 False ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 TBP_SCA17_CAG str TBP Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 10484774;20301611 False 3 100;0;0 21.569 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 TBP_SCA17_CAG str TBP Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 10484774;20301611;29325606 False 3 100;0;0 21.569 False ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 VWA1_HMNMYO_GCGCGGAGCG str VWA1 Literature;Expert Review Green;Expert Review Green;Literature;Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neuropathy, hereditary motor, with myopathic features MIM#619216" 33559681;33459760 False 3 100;0;0 21.569 False ENSG00000179403 ENSG00000179403 HGNC:30910 1 1371179 1371198 1435799 1435818 GCGCGGAGCG 2 3 XYLT1_DBQD2_GGC str XYLT1 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Desbuquois dysplasia 2 MIM#615777 30554721 False 3 100;0;0 21.569 True ENSG00000103489 ENSG00000103489 HGNC:15516 16 17564765 17564779 17470908 17470922 GGC 20 120 ZFHX3_SCA4_GGC str ZFHX3 Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 38035881;38197134 False 3 100;0;0 21.569 True ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 ZFHX3_SCA4_GGC str ZFHX3 Literature;Expert Review Green;Expert Review Green;Literature Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 38035881;38197134 False 3 100;0;0 21.569 False ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 ISCA-37400-Loss region Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Chromosome 16p11.2 deletion syndrome, proximal, MIM# 611913;autism;intellectual disability;seizures" False 3 100;0;0 21.569 True 16 29638675 30188534 3 80 cnv_loss Chromosome 16p11.2 deletion syndrome, proximal ISCA-37404-Loss region Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Angelman syndrome, MIM# 105830;Prader-Willi syndrome, MIM# 176270" 20301323;20301505 False 3 100;0;0 21.569 True 15 22782170 28134729 3 80 cnv_loss Angelman and Prader-Willi syndromes ISCA-37404-Loss region Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Angelman syndrome, MIM# 105830;Prader-Willi syndrome, MIM# 176270" 20301323;20301505 False 3 100;0;0 21.569 False 15 22782170 28134729 3 80 cnv_loss Angelman and Prader-Willi syndromes ISCA-37405-Loss region NPHP1 Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Nephronophthisis 1, juvenile, MIM# 256100;Joubert syndrome 4, MIM# 609583;Senior-Loken syndrome 1, MIM# 266900" 29146700 False 3 100;0;0 21.569 True ENSG00000144061 ENSG00000144061 HGNC:7905 2 110122329 110205017 3 80 cnv_loss NPHP1 deletion ISCA-37411-Loss region Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Chromosome 15q13.3 microdeletion syndrome, MIM# 612001;intellectual disability;epilepsy" 19372089;20979196 False 3 100;0;0 21.569 True 15 30844901 32153207 3 80 cnv_loss Chromosome 15q13.3 microdeletion syndrome ISCA-37429-Loss region Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Wolf-Hirschhorn syndrome, MIM# 194190;intellectual disability;growth retardation;seizures;dysmorphic features" False 3 100;0;0 21.569 True 4 337779 2009235 3 80 cnv_loss Wolf-Hirschhorn syndrome, chromosome 4p16.3 terminal deletion ISCA-37431-Loss region Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chromosome 17q11.2 deletion syndrome, MIM#613675;NF1 deletion syndrome 12660952;14729829 False 3 100;0;0 21.569 False 17 30835804 31891648 3 80 cnv_loss Chromosome 17q11.2 deletion syndrome, NF1 deletion syndrome ISCA-37432-Gain region Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Chromosome 17q12 duplication syndrome 614526;intellectual disability;seizures;congenital anomalies" PMID: 19844256 False 3 100;0;0 21.569 False 17 36458167 37854617 3 80 cnv_gain Chromosome 17q12 duplication syndrome ISCA-37433-Loss region Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown DiGeorge syndrome MIM#188400 False 3 100;0;0 21.569 False 22 18924718 20299686 3 80 cnv_loss DiGeorge syndrome ISCA-37434-Loss region Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Chromosome 1p36 deletion syndrome MIM#607872;intellectual disability;hypotonia;congenital anomalies PMID: 12974736;18245432 False 3 100;0;0 21.569 False 1 898703 6229913 3 80 cnv_loss Chromosome 1p36 deletion syndrome ISCA-37436-Gain region Expert list;Expert Review Green;Expert list;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease type 1A, MIM#118220 PMID: 32648354 False 3 100;0;0 21.569 False 17 14194598 15567587 3 80 cnv_gain Charcot-Marie-Tooth disease type 1A ISCA-37436-Loss region Expert list;Expert Review Green;Expert Review Green;Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuropathy, recurrent, with pressure palsies, MIM# 162500 PMID: 32356557;31118906;24726093 False 3 100;0;0 21.569 False 17 14194598 15567587 3 80 cnv_loss Hereditary neuropathy with liability to pressure palsies ISCA-37440-Loss region Expert list;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "2p21 deletion syndrome;Hypotonia-cystinuria syndrome, MIM# 606407" PMID: 18234729;23794250 False 3 100;0;0 21.569 False 2 44183133 44362502 30 80 cnv_loss 2p21 deletion syndrome ISCA-37446-Loss region Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chromosome 22q11.2 deletion syndrome, distal MIM#611867;intellectual disability;autism;multiple congenital anomalies 18179902;23765049;21671380 False 3 100;0;0 21.569 False 22 18924718 21111384 3 80 cnv_loss Chromosome 22q11.2 deletion syndrome, distal ISCA-37478-Gain region Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chromosome 15q11q13 duplication syndrome, MIM#608636;autism;intellectual disability;ataxia False 3 100;0;0 21.569 False 15 23513243 28312040 3 80 cnv_gain Chromosome 15q11q13 duplication syndrome ISCA-37493-Loss region Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 1q43q44 microdeletion syndrome;intellectual disability;seizures;microcephaly;corpus callosum abnormalities 28283832;31929334;31830750;30853971 False 3 100;0;0 21.569 False 1 243124428 245154985 3 80 cnv_loss 1q43q44 microdeletion syndrome ISCA-46290-Gain region Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Chromosome Xp11.23-p11.22 duplication syndrome MIM#300801;intellectual disability;seizures 19716111;27605428;29707408;16900295 False 3 100;0;0 21.569 False X 48447780 52444265 3 80 cnv_gain Chromosome Xp11.23-p11.22 duplication syndrome ISCA-46295-Loss region Expert list;Expert Review Green;Expert Review Green;Expert list Progressive Neurological Conditions Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Chromosome 15q13.3 microdeletion syndrome MIM#612001;intellectual disability;seizures PMID: 19289393 False 3 100;0;0 21.569 False 15 31727418 32153205 3 80 cnv_loss Chromosome 15q13.3 microdeletion syndrome ISCA-46304-Gain region MECP2 Expert Review Green;ClinGen;ClinGen Progressive Neurological Conditions Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Syndromic X-linked intellectual disability Lubs type, MONDO:0010283 PMID: 29141583, 22679399 False 3 100;0;0 21.569 True ENSG00000169057 ENSG00000169057 HGNC:6990 X 154008529 154110279 0 3 80 cnv_gain Xq28 (includes MECP2) gain