Entity Name	Entity type	Gene Symbol	Sources(; separated)	Level4	Level3	Level2	Model_Of_Inheritance	Phenotypes	Omim	Orphanet	HPO	Publications	Description	Flagged	GEL_Status	UserRatings_Green_amber_red	version	ready	Mode of pathogenicity	EnsemblId(GRch37)	EnsemblId(GRch38)	HGNC	Position Chromosome	Position GRCh37 Start	Position GRCh37 End	Position GRCh38 Start	Position GRCh38 End	STR Repeated Sequence	STR Normal Repeats	STR Pathogenic Repeats	Region Haploinsufficiency Score	Region Triplosensitivity Score	Region Required Overlap Percentage	Region Variant Type	Region Verbose Name
AAAS	gene	AAAS	Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Achalasia-addisonianism-alacrimia syndrome MIM#231550						False	3	100;0;0	3.236	True		ENSG00000094914	ENSG00000094914	HGNC:13666													
ABCB7	gene	ABCB7	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Anaemia, sideroblastic, with ataxia, MIM# 301310				10196363;10196363;33157103;31772327;31511561;26242992		False	3	100;0;0	3.236	True		ENSG00000131269	ENSG00000131269	HGNC:48													
ABCD1	gene	ABCD1	Expert Review Green;Royal Melbourne Hospital;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Adrenoleukodystrophy MIM# 300100, XLR						False	3	100;0;0	3.236	True		ENSG00000101986	ENSG00000101986	HGNC:61													
ABHD12	gene	ABHD12	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674						False	3	100;0;0	3.236	True		ENSG00000100997	ENSG00000100997	HGNC:15868													
ACBD6	gene	ACBD6	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785				37951597		False	3	100;0;0	3.236	True		ENSG00000230124	ENSG00000230124	HGNC:23339													
ACBD6	gene	ACBD6	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785				37951597		False	3	100;0;0	3.236	True		ENSG00000230124	ENSG00000230124	HGNC:23339													
ACO2	gene	ACO2	Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile cerebellar-retinal degeneration, MIM#614559						False	3	100;0;0	3.236	True		ENSG00000100412	ENSG00000100412	HGNC:118													
ACTB	gene	ACTB	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Baraitser-Winter syndrome 1, 243310;Dystonia, juvenile-onset, 607371				29788902;28487785		False	3	100;0;0	3.236	True	Other	ENSG00000075624	ENSG00000075624	HGNC:132													
ADAR	gene	ADAR	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 6;neuroinflammatory disorder with cerebral calcification;progressive loss of cognition;spasticity;dystonia;parkinsonism;OMIM 615010				PMID: 32911246		False	3	100;0;0	3.236	True		ENSG00000160710	ENSG00000160710	HGNC:225													
ADAR	gene	ADAR	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	dystonia;Aicardi-Goutieres syndrome 6, 615010						False	3	100;0;0	3.236	False		ENSG00000160710	ENSG00000160710	HGNC:225													
ADCY5	gene	ADCY5	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651				22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617		False	3	100;0;0	3.236	True		ENSG00000173175	ENSG00000173175	HGNC:236													
ADCY5	gene	ADCY5	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651				22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617		False	3	100;0;0	3.236	False		ENSG00000173175	ENSG00000173175	HGNC:236													
ADCY5	gene	ADCY5	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651				22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617		False	3	100;0;0	3.236	True		ENSG00000173175	ENSG00000173175	HGNC:236													
ADGRG1	gene	ADGRG1	Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Polymicrogyria, Frontoparietal, 606854;Polymicrogyria, perisylvian type, 615752						False	3	100;0;0	3.236	True		ENSG00000205336	ENSG00000205336	HGNC:4512													
ADPRS	gene	ADPRS	Expert Review Green;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, stress-induced with variable ataxia and seizures, 618170				30100084;30401461		False	3	100;0;0	3.236	True		ENSG00000116863	ENSG00000116863	HGNC:21304													
AFG2B	gene	AFG2B	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616				34626583		False	3	100;0;0	3.236	True		ENSG00000171763	ENSG00000171763	HGNC:28762													
AFG3L2	gene	AFG3L2	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic ataxia 5, autosomal recessive MIM#614487;Spinocerebellar ataxia 28 MIM#610246				20725928		False	3	100;0;0	3.236	True		ENSG00000141385	ENSG00000141385	HGNC:315													
AGTPBP1	gene	AGTPBP1	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650				30420557, 28600779, 30976113, 38153683, 28325758		False	3	100;0;0	3.236	True		ENSG00000135049	ENSG00000135049	HGNC:17258													
AHI1	gene	AHI1	Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 3				25616960		False	3	100;0;0	3.236	True		ENSG00000135541	ENSG00000135541	HGNC:21575													
ALDH5A1	gene	ALDH5A1	Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinic semialdehyde dehydrogenase deficiency, MIM# 271980				14635103		False	3	100;0;0	3.236	True		ENSG00000112294	ENSG00000112294	HGNC:408													
ALDH5A1	gene	ALDH5A1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Succinic semialdehyde dehydrogenase deficiency, MIM# 271980				17438226;38499966		False	3	100;0;0	3.236	True		ENSG00000112294	ENSG00000112294	HGNC:408													
ANO10	gene	ANO10	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 10 MIM#613728						False	3	100;0;0	3.236	True		ENSG00000160746	ENSG00000160746	HGNC:25519													
ANO3	gene	ANO3	Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 24, 615034;familial form of cranio-cervical dystonia				33388357		False	3	100;0;0	3.236	False		ENSG00000134343	ENSG00000134343	HGNC:14004													
AOPEP	gene	AOPEP	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Dystonia 31, MIM#	619565"				34596301		False	3	100;0;0	3.236	False		ENSG00000148120	ENSG00000148120	HGNC:1361													
AOPEP	gene	AOPEP	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 31, MIM# 619565;Childhood/Adolescence onset generalised dystonia;Dystonia parkinsonism;Zech-Boesch Syndrome				PMID: 35306330		False	3	100;0;0	3.236	True		ENSG00000148120	ENSG00000148120	HGNC:1361													
AP1S2	gene	AP1S2	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Pettigrew syndrome, MIM# 304340						False	3	100;0;0	3.236	True		ENSG00000182287	ENSG00000182287	HGNC:560													
APTX	gene	APTX	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, early-onset, with oculomotor apraxia and hypoalbuminaemia MIM#208920				30986824;26256098;11586299		False	3	100;0;0	3.236	True		ENSG00000137074	ENSG00000137074	HGNC:15984													
APTX	gene	APTX	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-oculomotor apraxia type 1;Dystonia				15876520		False	3	100;0;0	3.236	True		ENSG00000137074	ENSG00000137074	HGNC:15984													
ARL13B	gene	ARL13B	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 8, MIM#	612291"						False	3	100;0;0	3.236	True		ENSG00000169379	ENSG00000169379	HGNC:25419													
ARSA	gene	ARSA	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic Leukodystrophy, 250100;Metachromatic leukodystrophy (#250100)						False	3	100;0;0	3.236	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARSA	gene	ARSA	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Metachromatic leukodystrophy, MIM#250100						False	3	100;0;0	3.236	True		ENSG00000100299	ENSG00000100299	HGNC:713													
ARX	gene	ARX	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Partington syndrome, MIM# 309510;Dystonia				11889467;15200506		False	3	100;0;0	3.236	True	Other	ENSG00000004848	ENSG00000004848	HGNC:18060													
ATAD1	gene	ATAD1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperekplexia 4, MIM#618011				28180185;29390050;29659736		False	3	100;0;0	3.236	True		ENSG00000138138	ENSG00000138138	HGNC:25903													
ATCAY	gene	ATCAY	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, cerebellar, Cayman type, MIM# 601238;MONDO:0011025				14556008;29449188;23226316;26343454		False	3	50;50;0	3.236	True		ENSG00000167654	ENSG00000167654	HGNC:779													
ATG7	gene	ATG7	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, SCAR31, MIM#619422				34161705		False	3	100;0;0	3.236	True		ENSG00000197548	ENSG00000197548	HGNC:16935													
ATM	gene	ATM	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia telangiectasia;Dystonia						False	3	100;0;0	3.236	False		ENSG00000149311	ENSG00000149311	HGNC:795													
ATM	gene	ATM	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-telangiectasia MIM#208900						False	3	100;0;0	3.236	True		ENSG00000149311	ENSG00000149311	HGNC:795													
ATP13A2	gene	ATP13A2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome MIM#606693				21094623;20853184;20310007		False	3	100;0;0	3.236	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kufor-Rakeb syndrome MIM#606693				21362476;21696388;31588715;32559632;33033738;33091395;34405108		False	3	100;0;0	3.236	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP13A2	gene	ATP13A2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	parkinsonism due to ATP13A2 deficiency MONDO:0017809				25900096;20301402		False	3	100;0;0	3.236	True		ENSG00000159363	ENSG00000159363	HGNC:30213													
ATP1A2	gene	ATP1A2	Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	3.236	False		ENSG00000018625	ENSG00000018625	HGNC:800													
ATP1A2	gene	ATP1A2	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alternating hemiplegia of childhood 1, MIM# 104290				15174025;15286158;33126486;31766058;24097848		False	3	100;0;0	3.236	True		ENSG00000018625	ENSG00000018625	HGNC:800													
ATP1A3	gene	ATP1A3	Expert list;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002				15260953, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	0;0;0	3.236	False		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP1A3	gene	ATP1A3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder MONDO:0700002				20301294;17282997;15260953;17595045;17516473;22534615		False	3	100;0;0	3.236	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP1A3	gene	ATP1A3	Expert list;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002				15260953, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	3.236	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP1A3	gene	ATP1A3	Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002				15260953, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	3.236	True		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP1A3	gene	ATP1A3	Expert Review Green;Expert list;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	ATP1A3-associated neurological disorder, MONDO:0700002				15260953;17282997;19351654, 22842232, 24468074, 33762331, 29861155, 31425744		False	3	100;0;0	3.236	False		ENSG00000105409	ENSG00000105409	HGNC:801													
ATP2B2	gene	ATP2B2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related				PMID: 37675773		False	3	100;0;0	3.236	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000157087	ENSG00000157087	HGNC:815													
ATP2B2	gene	ATP2B2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related				PMID: 37675773		False	3	100;0;0	3.236	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000157087	ENSG00000157087	HGNC:815													
ATP2B3	gene	ATP2B3	Expert Review Green;Expert list;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Spinocerebellar ataxia, X-linked 1				37821930;36207321;31680123;28807751;28720891;27653636;25953895		False	3	50;50;0	3.236	True		ENSG00000067842	ENSG00000067842	HGNC:816													
ATP5F1A	gene	ATP5F1A	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD				34483339;34954817;40859057		False	3	100;0;0	3.236	True		ENSG00000152234	ENSG00000152234	HGNC:823													
ATP5MC3	gene	ATP5MC3	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Dystonia, early-onset, and/or spastic paraplegia, MIM#	619681"				34636445;34954817		False	3	100;0;0	3.236	True		ENSG00000154518	ENSG00000154518	HGNC:843													
ATP6AP2	gene	ATP6AP2	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	"Parkinsonism with spasticity, X-linked, MIM#	300911"				30985297;23595882		False	3	100;0;0	3.236	True		ENSG00000182220	ENSG00000182220	HGNC:18305													
ATP6V0A1	gene	ATP6V0A1	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971				PMID:34909687		False	3	50;50;0	3.236	True		ENSG00000033627	ENSG00000033627	HGNC:865													
ATP7B	gene	ATP7B	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease, MIM# 277900						False	3	100;0;0	3.236	True		ENSG00000123191	ENSG00000123191	HGNC:870													
ATP7B	gene	ATP7B	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease MIM#277900				17435591		False	3	50;50;0	3.236	True		ENSG00000123191	ENSG00000123191	HGNC:870													
ATP7B	gene	ATP7B	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease, MIM# 277900;Dystonia				32662046		False	3	100;0;0	3.236	True		ENSG00000123191	ENSG00000123191	HGNC:870													
ATP8A2	gene	ATP8A2	Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268				22892528;31612321		False	3	100;0;0	3.236	True		ENSG00000132932	ENSG00000132932	HGNC:13533													
AUH	gene	AUH	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-Methylglutaconic aciduria type 1;Dystonia						False	3	100;0;0	3.236	True		ENSG00000148090	ENSG00000148090	HGNC:890													
BBS1	gene	BBS1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 1, 209900				15637713		False	3	100;0;0	3.236	True		ENSG00000174483	ENSG00000174483	HGNC:966													
BCAP31	gene	BCAP31	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Deafness, dystonia and cerebellar hypomyelination, MIM#300475				24011989;28332767;30713915;31330203;32652807		False	3	100;0;0	3.236	True		ENSG00000185825	ENSG00000185825	HGNC:16695													
BCKDHB	gene	BCKDHB	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Episodic ataxia during metabolic crises;paroxysmal nonkinesigenic dyskinesia				PMID 32151765		False	3	0;0;0	3.236	True		ENSG00000083123	ENSG00000083123	HGNC:987													
BRAT1	gene	BRAT1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056				26483087;26494257;27282546		False	3	100;0;0	3.236	True		ENSG00000106009	ENSG00000106009	HGNC:21701													
C19orf12	gene	C19orf12	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	neurodegeneration with brain iron accumulation 4 MONDO:0013674				21981780;23278385;23447832		False	3	100;0;0	3.236	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
C19orf12	gene	C19orf12	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	neurodegeneration with brain iron accumulation 4 MONDO:0013674				21981780;22508347		False	3	100;0;0	3.236	True		ENSG00000131943	ENSG00000131943	HGNC:25443													
CA8	gene	CA8	Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3;Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3, 613227				21937992;19461874		False	3	100;0;0	3.236	True		ENSG00000178538	ENSG00000178538	HGNC:1382													
CACNA1A	gene	CACNA1A	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 2 MIM#108500						False	3	50;50;0	3.236	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1A	gene	CACNA1A	Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	3.236	False		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1A	gene	CACNA1A	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 2 MIM#108500;Spinocerebellar ataxia 6 MIM#183086				25468264;23441182;19232643;18758887;11344116		False	3	100;0;0	3.236	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1A	gene	CACNA1A	Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 2 MIM#108500						False	3	100;0;0	3.236	True		ENSG00000141837	ENSG00000141837	HGNC:1388													
CACNA1G	gene	CACNA1G	Expert Review Green;Expert list;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits MIM#618087						False	3	100;0;0	3.236	True		ENSG00000006283	ENSG00000006283	HGNC:1394													
CACNA1G	gene	CACNA1G	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM#	618087"				29878067		False	3	100;0;0	3.236	True		ENSG00000006283	ENSG00000006283	HGNC:1394													
CACNA1S	gene	CACNA1S	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypokalemic periodic paralysis, type 1, MIM# 170400				11591859		False	3	100;0;0	3.236	True		ENSG00000081248	ENSG00000081248	HGNC:1397													
CACNA2D2	gene	CACNA2D2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar atrophy with seizures and variable developmental delay MIM#618501				23339110;24358150;30410802;29997391;31402629		False	3	100;0;0	3.236	True		ENSG00000007402	ENSG00000007402	HGNC:1400													
CAD	gene	CAD	Expert Review Green;Literature;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epileptic encephalopathy, early infantile, 50;OMIM # 616457				PMID: 32820246		False	3	100;0;0	3.236	True		ENSG00000084774	ENSG00000084774	HGNC:1424													
CAMK4	gene	CAMK4	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;Autism;Behavioral abnormality;Abnormality of movement;Dystonia;Ataxia;Chorea;Myoclonus				30262571;33098801;33211350		False	3	100;0;0	3.236	True		ENSG00000152495	ENSG00000152495	HGNC:1464													
CAMTA1	gene	CAMTA1	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cerebellarataxia, nonprogressive, with mental retardation, 614756;Cerebellar ataxia with mental retardation, 614756				32157189;22693284		False	3	100;0;0	3.236	True		ENSG00000171735	ENSG00000171735	HGNC:18806													
CAPRIN1	gene	CAPRIN1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy				39878554		False	3	100;0;0	3.236	True		ENSG00000135387	ENSG00000135387	HGNC:6743													
CASK	gene	CASK	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	FG syndrome 4, 300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749						False	3	100;0;0	3.236	True		ENSG00000147044	ENSG00000147044	HGNC:1497													
CASR	gene	CASR	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Hypocalciuric hypercalcemia, type I, MIM#	145980;Hypocalciuric Hypercalcemic;Hyperparathyroidism;paroxysmal dyskinesia;brain calcification"				34913197		False	3	100;0;0	3.236	True		ENSG00000036828	ENSG00000036828	HGNC:1514													
CBY1	gene	CBY1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	intellectual disability;cerebellar ataxia;molar tooth sign;polydactyly;Joubert syndrome				33131181;25103236;25220153		False	3	100;0;0	3.236	True		ENSG00000100211	ENSG00000100211	HGNC:1307													
CC2D2A	gene	CC2D2A	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 9, MIM#612285				18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408		False	3	100;0;0	3.236	True		ENSG00000048342	ENSG00000048342	HGNC:29253													
CD99L2	gene	CD99L2	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodevelopmental disorder, MONDO:0700092;CD99L2-related				41690933		False	3	100;0;0	3.236	True		ENSG00000102181	ENSG00000102181	HGNC:18237													
CEP290	gene	CEP290	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 5, MIM# 610188				18327255;20690115;16682973;16682970;17564967;16909394;17564974		False	3	100;0;0	3.236	True		ENSG00000198707	ENSG00000198707	HGNC:29021													
CEP41	gene	CEP41	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 15, MIM# 614464				22246503		False	3	100;0;0	3.236	True		ENSG00000106477	ENSG00000106477	HGNC:12370													
CHCHD2	gene	CHCHD2	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 22, autosomal dominant MIM#616710				32068847;25662902;31600778;26705026		False	3	100;0;0	3.236	False		ENSG00000106153	ENSG00000106153	HGNC:21645													
CLCN1	gene	CLCN1	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Myotonia congenita, dominant, MIM#	160800;Myotonia congenita, recessive, MIM#	255700"						False	3	100;0;0	3.236	True		ENSG00000188037	ENSG00000188037	HGNC:2019													
CLCN2	gene	CLCN2	Expert Review Green;Victorian Clinical Genetics Services;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with ataxia, MIM# 615651				29403011;29403012;23707145		False	3	100;0;0	3.236	True		ENSG00000114859	ENSG00000114859	HGNC:2020													
CLDN5	gene	CLDN5	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Syndromic disorder, MONDO:0002254, CLDN5-related;familial migraine;alternating hemiplegia;hemiplegic migraine;brain calcification;acquired microcephaly;epilepsy				35714222;36825455		False	3	100;0;0	3.236	True		ENSG00000184113	ENSG00000184113	HGNC:2047													
CLN3	gene	CLN3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 3 MIM#204200				19489875;11342698		False	3	100;0;0	3.236	True		ENSG00000188603	ENSG00000188603	HGNC:2074													
CLN3	gene	CLN3	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ceroid lipofuscinosis, neuronal, 3	204200"				19353721		False	3	100;0;0	3.236	True		ENSG00000188603	ENSG00000188603	HGNC:2074													
CLN5	gene	CLN5	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis neuronal 5, MIM# 256731						False	3	100;0;0	3.236	True		ENSG00000102805	ENSG00000102805	HGNC:2076													
CLN6	gene	CLN6	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300				11791207;11727201;21549341;30561534		False	3	100;0;0	3.236	True		ENSG00000128973	ENSG00000128973	HGNC:2077													
CLPP	gene	CLPP	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 3, MIM# 614129				25254289		False	3	100;0;0	3.236	True		ENSG00000125656	ENSG00000125656	HGNC:2084													
COA7	gene	COA7	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3, MONDO:0020770				37750949;37264311		False	3	100;0;0	3.236	False		ENSG00000162377	ENSG00000162377	HGNC:25716													
COA7	gene	COA7	Expert Review Green;Expert list;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387						False	3	100;0;0	3.236	True		ENSG00000162377	ENSG00000162377	HGNC:25716													
COA7	gene	COA7	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3, MONDO:0020770				37750949;37264311		False	3	100;0;0	3.236	False		ENSG00000162377	ENSG00000162377	HGNC:25716													
COASY	gene	COASY	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodegeneration with brain iron accumulation 6, MONDO:0014290;Neurodegeneration with brain iron accumulation 6 615643				23447832;24360804;27021474		False	3	100;0;0	3.236	True		ENSG00000068120	ENSG00000068120	HGNC:29932													
COQ4	gene	COQ4	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Childhood-onset ataxia				30225196;33704555;30847826		False	3	100;0;0	3.236	True		ENSG00000167113	ENSG00000167113	HGNC:19693													
COQ5	gene	COQ5	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 9 MIM#619028				29044765;37599337;21937992;41199775;36266294		False	3	33;0;67	3.236	True		ENSG00000110871	ENSG00000110871	HGNC:28722													
COQ8A	gene	COQ8A	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Coenzyme Q10 deficiency, primary, 4, MIM#	612016"				32337771		False	3	100;0;0	3.236	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
COQ8A	gene	COQ8A	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Coenzyme Q10 deficiency, primary, 4 MIM#612016				32337771		False	3	100;0;0	3.236	True		ENSG00000163050	ENSG00000163050	HGNC:16812													
COX20	gene	COX20	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex IV deficiency, 220110;Mitochondrial complex IV deficiency						False	3	100;0;0	3.236	False		ENSG00000203667	ENSG00000203667	HGNC:26970													
CP	gene	CP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminaemia, MIM#604290						False	3	100;0;0	3.236	True		ENSG00000047457	ENSG00000047457	HGNC:2295													
CP	gene	CP	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminaemia, MIM#604290						False	3	100;0;0	3.236	True		ENSG00000047457	ENSG00000047457	HGNC:2295													
CP	gene	CP	Victorian Clinical Genetics Services;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290				20301666		False	3	100;0;0	3.236	False		ENSG00000047457	ENSG00000047457	HGNC:2295													
CPLANE1	gene	CPLANE1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 17, MIM#	614615"						False	3	100;0;0	3.236	True		ENSG00000197603	ENSG00000197603	HGNC:25801													
CSF1R	gene	CSF1R	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia				24198292;25563800;25935893		False	3	100;0;0	3.236	False		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSF1R	gene	CSF1R	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	leukoencephalopathy, diffuse hereditary, with spheroids 1 MONDO:0800027				25935893;22934315;22934315		False	3	100;0;0	3.236	True		ENSG00000182578	ENSG00000182578	HGNC:2433													
CSNK2B	gene	CSNK2B	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732				PMID: 34041744		False	3	100;0;0	3.236	True		ENSG00000204435	ENSG00000204435	HGNC:2460													
CSTB	gene	CSTB	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM#254800				9012407;9054946		False	3	50;50;0	3.236	True		ENSG00000160213	ENSG00000160213	HGNC:2482													
CTBP1	gene	CTBP1	Expert Review Green;Expert list;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, MIM#617915				27094857;28955726;31041561		False	3	100;0;0	3.236	True		ENSG00000159692	ENSG00000159692	HGNC:2494													
CWF19L1	gene	CWF19L1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 17, 616127;Autosomal recessive spinocerebellar ataxia type 17, 616127						False	3	100;0;0	3.236	False		ENSG00000095485	ENSG00000095485	HGNC:25613													
CYP27A1	gene	CYP27A1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebrotendinous xanthomatosis, MIM#	213700;Cerebrotendinous xanthomatosis,  infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas;Epilepsy;Parkinsonism;Ataxia;Peripheral neuropathy"				PMID: 30054180		False	3	100;0;0	3.236	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, MIM# 213700;Cholestanol storage disease;Dystonia				19373932;21531161;25424010		False	3	100;0;0	3.236	True		ENSG00000135929	ENSG00000135929	HGNC:2605													
CYP27A1	gene	CYP27A1	NHS GMS;Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebrotendinous xanthomatosis, 213700						False	3	100;0;0	3.236	False		ENSG00000135929	ENSG00000135929	HGNC:2605													
DAGLA	gene	DAGLA	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuroocular syndrome 2, paroxysmal type, MIM# 168885				35737950		False	3	100;0;0	3.236	True		ENSG00000134780	ENSG00000134780	HGNC:1165													
DAGLB	gene	DAGLB	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease, MONDO:0005180, DALGB-related				35715418;40244389		False	3	100;0;0	3.236	True		ENSG00000164535	ENSG00000164535	HGNC:28923													
DARS2	gene	DARS2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation;Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105						False	3	100;0;0	3.236	False		ENSG00000117593	ENSG00000117593	HGNC:25538													
DCAF17	gene	DCAF17	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Woodhouse-Sakati syndrome MONDO:0009419;Dystonia				18175354;36185913;17167799		False	3	100;0;0	3.236	True		ENSG00000115827	ENSG00000115827	HGNC:25784													
DCTN1	gene	DCTN1	Expert list;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Perry syndrome, MONDO:0008201				20945553, 19136952, 24343258		False	3	100;0;0	3.236	True		ENSG00000204843	ENSG00000204843	HGNC:2711													
DDC	gene	DDC	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aromatic L-amino acid decarboxylase deficiency, MIM# 608643;Infantile-onset parkinsonism & dystonia;Bulbar dysfunction;Oculogyric crisis;Autonomic dysfunction;Intellectual disability				33983693;36928758;36054588;35829818;35593933;30260058		False	3	67;33;0	3.236	True		ENSG00000132437	ENSG00000132437	HGNC:2719													
DDC	gene	DDC	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aromatic L-amino acid decarboxylase deficiency, 608643;Dystonia				20505134		False	3	100;0;0	3.236	True		ENSG00000132437	ENSG00000132437	HGNC:2719													
DDHD2	gene	DDHD2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive paraplegia 54 (#615033). Complex form of disease ataxia reported amongst the phenotypic features in Citterio et al. (2014), Journal of Neurology, 261, pp.373-381 and Doi et al. (2014), Scientific Reports, 4, 7132.;Spastic paraplegia 54						False	3	100;0;0	3.236	False		ENSG00000085788	ENSG00000085788	HGNC:29106													
DHDDS	gene	DHDDS	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental delay and seizures with or without movement abnormalities, OMIM:617836				29100083;33798445;34182312;34382076		False	3	100;0;0	3.236	True		ENSG00000117682	ENSG00000117682	HGNC:20603													
DLAT	gene	DLAT	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase E2 deficiency 245348;Dystonia				39007626;20022530;16049940		False	3	100;0;0	3.236	True		ENSG00000150768	ENSG00000150768	HGNC:2896													
DLAT	gene	DLAT	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pyruvate dehydrogenase E2 deficiency, MIM# 245348;Episodic dystonia (Exercise induced or without clear trigger)				20022530;29093066		False	3	100;0;0	3.236	True		ENSG00000150768	ENSG00000150768	HGNC:2896													
DNAJC12	gene	DNAJC12	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384						False	3	100;0;0	3.236	True		ENSG00000108176	ENSG00000108176	HGNC:28908													
DNAJC12	gene	DNAJC12	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, mild, non-BH4-deficient, 617384						False	3	100;0;0	3.236	True		ENSG00000108176	ENSG00000108176	HGNC:28908													
DNAJC19	gene	DNAJC19	Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type V 610198;dilated cardiomyopathy with ataxia (DCMA) syndrome;3-methylglutaconic aciduria type V, 610198						False	3	100;0;0	3.236	False		ENSG00000205981	ENSG00000205981	HGNC:30528													
DNAJC3	gene	DNAJC3	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile-onset diabetes mellitus-central and peripheral neurodegeneration syndrome, MONDO:0014523				34654017;34630333;33486469;32738013;28940199		False	3	100;0;0	3.236	True		ENSG00000102580	ENSG00000102580	HGNC:9439													
DNAJC5	gene	DNAJC5	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083						False	3	100;0;0	3.236	False		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNAJC5	gene	DNAJC5	Expert list;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083				22978711;21820099;22235333		False	3	100;0;0	3.236	True		ENSG00000101152	ENSG00000101152	HGNC:16235													
DNAJC6	gene	DNAJC6	Expert list;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 19a, juvenile-onset - MIM#615528;Parkinson disease 19b, early-onset - MIM#615528				22563501, 23211418, 26528954, 33983693		False	3	100;0;0	3.236	True		ENSG00000116675	ENSG00000116675	HGNC:15469													
DNMT1	gene	DNMT1	Expert Review Green;ClinGen;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584				22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424		False	3	100;0;0	3.236	False		ENSG00000130816	ENSG00000130816	HGNC:2976													
DOCK3	gene	DOCK3	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292						False	3	100;0;0	3.236	True		ENSG00000088538	ENSG00000088538	HGNC:2989													
DRD1	gene	DRD1	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DRD1-related				41966088;37048120		False	3	100;0;0	3.236	True		ENSG00000184845	ENSG00000184845	HGNC:3020													
DRD2	gene	DRD2	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Combined dystonia, MONDO:0020065, DRD2-related;dystonia;chorea;anxiety;ataxia;orofacial dyskinesia;tremor;memory problems				33200438		False	3	100;0;0	3.236	True	Other	ENSG00000149295	ENSG00000149295	HGNC:3023													
EBF3	gene	EBF3	Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypotonia, ataxia and delayed development syndrome, 617330						False	3	100;0;0	3.236	False		ENSG00000108001	ENSG00000108001	HGNC:19087													
ECHS1	gene	ECHS1	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM#	616277"				32677093;32858208		False	3	100;0;0	3.236	True		ENSG00000127884	ENSG00000127884	HGNC:3151													
ECHS1	gene	ECHS1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277;paroxysmal dyskinesia (isolated or with other features of a mitochondrial disease)				27090768;28039521		False	3	100;0;0	3.236	True		ENSG00000127884	ENSG00000127884	HGNC:3151													
EEFSEC	gene	EEFSEC	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102				39753114		False	3	100;0;0	3.236	True		ENSG00000132394	ENSG00000132394	HGNC:24614													
EIF2AK2	gene	EIF2AK2	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness;early onset dystonia				33236446;33866603		False	3	100;0;0	3.236	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
EIF2AK2	gene	EIF2AK2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877;Neurodevelopmental Syndrome;Developmental delays;Ataxia;Parkinsonism;White matter alterations				PMID: 32197074		False	3	100;0;0	3.236	True		ENSG00000055332	ENSG00000055332	HGNC:9437													
EIF2B1	gene	EIF2B1	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	3.236	True		ENSG00000111361	ENSG00000111361	HGNC:3257													
EIF2B2	gene	EIF2B2	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	3.236	True		ENSG00000119718	ENSG00000119718	HGNC:3258													
EIF2B3	gene	EIF2B3	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	3.236	True		ENSG00000070785	ENSG00000070785	HGNC:3259													
EIF2B4	gene	EIF2B4	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	3.236	True		ENSG00000115211	ENSG00000115211	HGNC:3260													
EIF2B5	gene	EIF2B5	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy with vanishing white matter MIM#603896						False	3	100;0;0	3.236	True		ENSG00000145191	ENSG00000145191	HGNC:3261													
EIF4A2	gene	EIF4A2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455				37485550		False	3	100;0;0	3.236	True		ENSG00000156976	ENSG00000156976	HGNC:3284													
ELFN1	gene	ELFN1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dursun-Ozgul neurodevelopmental syndrome, MIM# 621344				PMID:40576023		False	3	100;0;0	3.236	True		ENSG00000225968	ENSG00000225968	HGNC:33154													
ELOVL4	gene	ELOVL4	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190						False	3	100;0;0	3.236	False		ENSG00000118402	ENSG00000118402	HGNC:14415													
ELOVL5	gene	ELOVL5	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 38, MIM#615957				25065913		False	3	100;0;0	3.236	False		ENSG00000012660	ENSG00000012660	HGNC:21308													
EPG5	gene	EPG5	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	neurodevelopmental disorder with parkinsonism or other movement abnormalities MONDO:0980990				41159719;41053928;40192014		False	3	100;0;0	3.236	True		ENSG00000152223	ENSG00000152223	HGNC:29331													
EPG5	gene	EPG5	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506				41053928;36410285;40192014		False	3	100;0;0	3.236	True		ENSG00000152223	ENSG00000152223	HGNC:29331													
EPM2A	gene	EPM2A	Expert Review Green;Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive myoclonic epilepsy 2A, Lafora, 254780;Epilepsy, progressive myoclonic 2A (Lafora) 254780						False	3	100;0;0	3.236	False		ENSG00000112425	ENSG00000112425	HGNC:3413													
ERCC4	gene	ERCC4	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM#	278760"				29403087;28431612;29892709		False	3	100;0;0	3.236	False		ENSG00000175595	ENSG00000175595	HGNC:3436													
ESRRG	gene	ESRRG	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Movement disorder, MONDO:0005395, ESRRG-related				41265451		False	3	100;0;0	3.236	True		ENSG00000196482	ENSG00000196482	HGNC:3474													
EXOSC5	gene	EXOSC5	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, brain abnormalities, and cardiac conduction defects, MIM# 619576;Short stature;Motor developmental delays;Cerebellar hypoplasia;Ataxia				32504085;29302074		False	3	100;0;0	3.236	True		ENSG00000077348	ENSG00000077348	HGNC:24662													
FA2H	gene	FA2H	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 35, autosomal recessive	MIM#612319"				31135052		False	3	100;0;0	3.236	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FA2H	gene	FA2H	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia;Spastic paraplegia 35, autosomal recessive 612319;fatty acid hydroxylase-associated neurodegeneration				19068277;20104589;20853438;31135052		False	3	100;0;0	3.236	True		ENSG00000103089	ENSG00000103089	HGNC:21197													
FAT2	gene	FAT2	GeneReviews;Royal Melbourne Hospital;Expert list;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 45, MIM#617769				29053796;33884300		False	3	50;50;0	3.236	False		ENSG00000086570	ENSG00000086570	HGNC:3596													
FBXL4	gene	FBXL4	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type), MIM# 615471				28383868		False	3	100;0;0	3.236	True		ENSG00000112234	ENSG00000112234	HGNC:13601													
FBXO28	gene	FBXO28	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 100, MIM# 619777				33280099		False	3	100;0;0	3.236	True		ENSG00000143756	ENSG00000143756	HGNC:29046													
FBXO7	gene	FBXO7	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile parkinsonism;Dystonia						False	3	0;0;0	3.236	False		ENSG00000100225	ENSG00000100225	HGNC:13586													
FBXO7	gene	FBXO7	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	parkinsonian-pyramidal syndrome MONDO:0009830				20301402		False	3	100;0;0	3.236	True		ENSG00000100225	ENSG00000100225	HGNC:13586													
FDXR	gene	FDXR	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887				30250212;28965846;29040572;33348459;37046037;37481223		False	3	100;0;0	3.236	True		ENSG00000161513	ENSG00000161513	HGNC:3642													
FGF14	gene	FGF14	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 27 MIM#609307						False	3	100;0;0	3.236	True		ENSG00000102466	ENSG00000102466	HGNC:3671													
FIG4	gene	FIG4	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Charcot-Marie-Tooth disease type 4J, MONDO:0012640				41177402;40884084;40118803;40062820;37950760;37868919		False	3	100;0;0	3.236	True		ENSG00000112367	ENSG00000112367	HGNC:16873													
FITM2	gene	FITM2	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Siddiqi syndrome MIM#618635;dystonia;deafness				28067622;30214770;30288795		False	3	100;0;0	3.236	True		ENSG00000197296	ENSG00000197296	HGNC:16135													
FLVCR1	gene	FLVCR1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia, posterior column, with retinitis pigmentosa MIM#609033						False	3	100;0;0	3.236	True		ENSG00000162769	ENSG00000162769	HGNC:24682													
FOLR1	gene	FOLR1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration due to cerebral folate transport deficiency, 613068;Neurodegeneration due to cerebral folate transport deficiency						False	3	100;0;0	3.236	False		ENSG00000110195	ENSG00000110195	HGNC:3791													
FOXG1	gene	FOXG1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Rett syndrome, congenital variant;Dystonia				27029630		False	3	100;0;0	3.236	True		ENSG00000176165	ENSG00000176165	HGNC:3811													
FOXG1	gene	FOXG1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Rett syndrome, congenital variant, MIM#	613454;Developmental and Epileptic Encephalopathy;Dystonia,;Athetosis;Parkinsonism;Stereotypies"				PMID: 21953941		False	3	100;0;0	3.236	True		ENSG00000176165	ENSG00000176165	HGNC:3811													
FRMD5	gene	FRMD5	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094				36206744		False	3	100;0;0	3.236	True		ENSG00000171877	ENSG00000171877	HGNC:28214													
FRRS1L	gene	FRRS1L	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 37, MIM# 616981;Seizures;Chorea;Parkinsonism;Developmental delay				PMID: 29086067		False	3	100;0;0	3.236	True		ENSG00000260230	ENSG00000260230	HGNC:1362													
FTL	gene	FTL	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodegeneration with brain iron accumulation 3, MIM# 606159				11438811;15099026;12746423;18413574		False	3	100;0;0	3.236	True		ENSG00000087086	ENSG00000087086	HGNC:3999													
FTL	gene	FTL	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted					23447832;20301320		False	3	100;0;0	3.236	False		ENSG00000087086	ENSG00000087086	HGNC:3999													
FUCA1	gene	FUCA1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Fucosidosis, MIM#230000				31064022		False	3	100;0;0	3.236	True		ENSG00000179163	ENSG00000179163	HGNC:4006													
FXN	gene	FXN	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300						False	3	100;0;0	3.236	True		ENSG00000165060	ENSG00000165060	HGNC:3951													
GABRB2	gene	GABRB2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631				38996765		False	3	100;0;0	3.236	True	Other	ENSG00000145864	ENSG00000145864	HGNC:4082													
GABRB3	gene	GABRB3	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 43 MIM#617113				37647766		False	3	100;0;0	3.236	True	Other	ENSG00000166206	ENSG00000166206	HGNC:4083													
GABRB3	gene	GABRB3	Literature;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 43 MIM#617113				37647766		False	3	100;0;0	3.236	False	Other	ENSG00000166206	ENSG00000166206	HGNC:4083													
GALT	gene	GALT	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Galactosemia,	MIM#230400"				30718057		False	3	100;0;0	3.236	True		ENSG00000213930	ENSG00000213930	HGNC:4135													
GAMT	gene	GAMT	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebral creatine deficiency syndrome 2 MIM#612736				19027335;33996490;12557293;19288536;16855203		False	3	50;0;50	3.236	True		ENSG00000130005	ENSG00000130005	HGNC:4136													
GBA1	gene	GBA1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson's disease, MONDO:0005180, GBA-related				PMID: 12809640;35639160		False	3	100;0;0	3.236	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GBA1	gene	GBA1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Gaucher disease, type III, MIM#	231000"				27789132		False	3	100;0;0	3.236	True		ENSG00000177628	ENSG00000177628	HGNC:4177													
GBA2	gene	GBA2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 46, autosomal recessive, MIM# 614409;MONDO:0013737				23332916;23332917;29524657		False	3	100;0;0	3.236	True		ENSG00000070610	ENSG00000070610	HGNC:18986													
GCDH	gene	GCDH	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	glutaryl-CoA dehydrogenase deficiency MONDO:0009281				32777384;21912879;31536184		False	3	100;0;0	3.236	True		ENSG00000105607	ENSG00000105607	HGNC:4189													
GCH1	gene	GCH1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230				7874165;11113234;15753436		False	3	100;0;0	3.236	False		ENSG00000131979	ENSG00000131979	HGNC:4193													
GCH1	gene	GCH1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230				32170445;32278297;32746945;30314816		False	3	100;0;0	3.236	True		ENSG00000131979	ENSG00000131979	HGNC:4193													
GCH1	gene	GCH1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	"Dopa-responsive dystonia;exercise-induced dystonia;Dystonia, DOPA-responsive, with or without hyperphenylalaninemia	128230"						False	3	100;0;0	3.236	True		ENSG00000131979	ENSG00000131979	HGNC:4193													
GDAP2	gene	GDAP2	Expert Review Green;Royal Melbourne Hospital;Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia						False	3	100;0;0	3.236	False		ENSG00000196505	ENSG00000196505	HGNC:18010													
GEMIN5	gene	GEMIN5	Expert Review Green;Literature;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, OMIM # 619333				34569062;33963192		False	3	100;0;0	3.236	True		ENSG00000082516	ENSG00000082516	HGNC:20043													
GFAP	gene	GFAP	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease						False	3	100;0;0	3.236	False		ENSG00000131095	ENSG00000131095	HGNC:4235													
GJC2	gene	GJC2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypomyelinating leukodystrophy 2, 608804;Leukodystrophy, hypomyelinating, 2;Autosomal Recessive Ataxia;Spastic paraplegia 44, 613206						False	3	100;0;0	3.236	False		ENSG00000198835	ENSG00000198835	HGNC:17494													
GJC2	gene	GJC2	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leukodystrophy, hypomyelinating, 2, MIM#	608804"				15192806;18094336		False	3	100;0;0	3.236	True		ENSG00000198835	ENSG00000198835	HGNC:17494													
GLB1	gene	GLB1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1 gangliosidosis type 3 MONDO:0009262				24156116;35937492;34514040;1353343		False	3	100;0;0	3.236	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GLB1	gene	GLB1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM1-gangliosidosis, type III , MIM#230650;Parkinsonism				PMID: 34514040		False	3	100;0;0	3.236	True		ENSG00000170266	ENSG00000170266	HGNC:4298													
GLRA1	gene	GLRA1	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperekplexia 1, MIM# 149400				8298642;16832093		False	3	100;0;0	3.236	True		ENSG00000145888	ENSG00000145888	HGNC:4326													
GLRA1	gene	GLRA1	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperekplexia 1, MIM# 149400				8298642;16832093		False	3	100;0;0	3.236	True		ENSG00000145888	ENSG00000145888	HGNC:4326													
GLRB	gene	GLRB	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperekplexia 2, MIM# 614619				21391991;11929858;27843043		False	3	100;0;0	3.236	True		ENSG00000109738	ENSG00000109738	HGNC:4329													
GLRB	gene	GLRB	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperekplexia 2, MIM# 614619				21391991;11929858;27843043		False	3	100;0;0	3.236	True		ENSG00000109738	ENSG00000109738	HGNC:4329													
GM2A	gene	GM2A	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, AB variant, MIM#272750						False	3	100;0;0	3.236	True		ENSG00000196743	ENSG00000196743	HGNC:4367													
GNAL	gene	GNAL	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 25, MIM# 615073;MONDO:0014033				23222958;33175450;32180288		False	3	100;0;0	3.236	False		ENSG00000141404	ENSG00000141404	HGNC:4388													
GNAO1	gene	GNAO1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	movement disorder, MONDO:0005395				38358016;35722775		False	3	100;0;0	3.236	True		ENSG00000087258	ENSG00000087258	HGNC:4389													
GNAO1	gene	GNAO1	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 17;Neurodevelopmental disorder with involuntary movements				28747448;30682224		False	3	100;0;0	3.236	True	Other	ENSG00000087258	ENSG00000087258	HGNC:4389													
GNAO1	gene	GNAO1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with involuntary movements, 617493				28747448;30682224		False	3	100;0;0	3.236	True	Other	ENSG00000087258	ENSG00000087258	HGNC:4389													
GNB1	gene	GNB1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Mental retardation, autosomal dominant 42, MIM# 616973;Myoclonus dystonia				30194818;27108799;27668284;31034681		False	3	100;0;0	3.236	True		ENSG00000078369	ENSG00000078369	HGNC:4396													
GOSR2	gene	GOSR2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 6, 614018;Progressive myoclonic epilepsy 6, 614018						False	3	100;0;0	3.236	False		ENSG00000108433	ENSG00000108433	HGNC:4431													
GPAA1	gene	GPAA1	Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Glycosylphosphatidylinositol biosynthesis defect 15, 617810						False	3	100;0;0	3.236	True		ENSG00000197858	ENSG00000197858	HGNC:4446													
GRID2	gene	GRID2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 18, 616204						False	3	100;0;0	3.236	False		ENSG00000152208	ENSG00000152208	HGNC:4576													
GRIN1	gene	GRIN1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820				29365063;27164704;27164704;28051072		False	3	100;0;0	3.236	True		ENSG00000176884	ENSG00000176884	HGNC:4584													
GRM1	gene	GRM1	Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 13;Spinocerebellar ataxia 44, 617691, autosomal recessive spinocerebellar ataxia type 13, 614831						False	3	100;0;0	3.236	False		ENSG00000152822	ENSG00000152822	HGNC:4593													
GRN	gene	GRN	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Frontotemporal lobar degeneration with ubiquitin-positive inclusions,	MIM#607485"						False	3	100;0;0	3.236	True		ENSG00000030582	ENSG00000030582	HGNC:4601													
GRN	gene	GRN	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM# 607485				17923627;20301545		False	3	100;0;0	3.236	False		ENSG00000030582	ENSG00000030582	HGNC:4601													
GSS	gene	GSS	NHS GMS;Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Gluthathione synthetase deficiency, MIM# 266130				15717202		False	3	100;0;0	3.236	True		ENSG00000100983	ENSG00000100983	HGNC:4624													
GSX2	gene	GSX2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Diencephalic-mesencephalic junction dysplasia syndrome 2	618646;Intellectual disability;Dystonia;Spastic tetra paresis"				31412107;39119454		False	3	100;0;0	3.236	True		ENSG00000180613	ENSG00000180613	HGNC:24959													
GTPBP2	gene	GTPBP2	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Jaberi-Elahi syndrome, MIM#617988				26675814;29449720;30790272		False	3	100;0;0	3.236	True		ENSG00000172432	ENSG00000172432	HGNC:4670													
HEXA	gene	HEXA	Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2-gangliosidosis, several forms, 272800;Tay-Sachs disease, 272800						False	3	100;0;0	3.236	False		ENSG00000213614	ENSG00000213614	HGNC:4878													
HEXB	gene	HEXB	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sandhoff disease, infantile, juvenile, and adult forms, 268800;Sandhoff disease, 268800						False	3	100;0;0	3.236	False		ENSG00000049860	ENSG00000049860	HGNC:4879													
HIBCH	gene	HIBCH	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620;Paroxysmal dyskinesia (exercise induced or without clear trigger;isolated or with additional features;mitochondrial disorder (Leigh syndrome);neurodevelopmental disability;epilepsy.				PMID 31679561		False	3	100;0;0	3.236	True		ENSG00000198130	ENSG00000198130	HGNC:4908													
HIBCH	gene	HIBCH	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"3-hydroxyisobutryl-CoA hydrolase deficiency, MIM#	250620"				26026795;25251209;24299452;32677093		False	3	100;0;0	3.236	True		ENSG00000198130	ENSG00000198130	HGNC:4908													
HPCA	gene	HPCA	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 2, torsion, autosomal recessive, 224500;MONDO:0009141;childhood-onset generalized dystonia;adolescence-onset segmental dystonia;generalized dystonia with additional neurological features				25799108;30991467;30145809		False	3	100;0;0	3.236	False		ENSG00000121905	ENSG00000121905	HGNC:5144													
HPRT1	gene	HPRT1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Lesch-Nyhan syndrome;Dystonia				20301328		False	3	100;0;0	3.236	True		ENSG00000165704	ENSG00000165704	HGNC:5157													
HTRA2	gene	HTRA2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria type 8 MONDO:0044723				27208207;27696117;30114719		False	3	50;50;0	3.236	True		ENSG00000115317	ENSG00000115317	HGNC:14348													
IMPDH2	gene	IMPDH2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with dystonia				PMID: 33098801		False	3	100;0;0	3.236	True		ENSG00000178035	ENSG00000178035	HGNC:6053													
INPP5E	gene	INPP5E	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 1						False	3	100;0;0	3.236	False		ENSG00000148384	ENSG00000148384	HGNC:21474													
IRF2BPL	gene	IRF2BPL	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures 618088				PMID: 30057031;30166628		False	3	100;0;0	3.236	True		ENSG00000119669	ENSG00000119669	HGNC:14282													
IRF2BPL	gene	IRF2BPL	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with regression, abnormal movement, loss of speech and seizures, 618088				30057031		False	3	100;0;0	3.236	True		ENSG00000119669	ENSG00000119669	HGNC:14282													
ITM2B	gene	ITM2B	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia				10391242;10781099;33814452		False	3	100;0;0	3.236	False		ENSG00000136156	ENSG00000136156	HGNC:6174													
ITPR1	gene	ITPR1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 15 MIM#606658;Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360						False	3	100;0;0	3.236	True		ENSG00000150995	ENSG00000150995	HGNC:6180													
KCNA1	gene	KCNA1	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia/myokymia syndrome, MIM# 160120				11026449		False	3	100;0;0	3.236	True	Other	ENSG00000111262	ENSG00000111262	HGNC:6218													
KCNA1	gene	KCNA1	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	EPISODIC ATAXIA, TYPE 1;myokymia with periodic ataxia;Episodic ataxia/myokymia syndrome, 160120;Episodic ataxia/myokymia syndrome				11026449		False	3	100;0;0	3.236	True	Other	ENSG00000111262	ENSG00000111262	HGNC:6218													
KCNA1	gene	KCNA1	Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	3.236	False		ENSG00000111262	ENSG00000111262	HGNC:6218													
KCNA2	gene	KCNA2	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia;Epileptic encephalopathy, early infantile, 32, MIM# 616366				27733563;27543892;25477152		False	3	100;0;0	3.236	True		ENSG00000177301	ENSG00000177301	HGNC:6220													
KCNA2	gene	KCNA2	Expert Review Green;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early infantile encephalopathy 32, 616366				29050392		False	3	100;0;0	3.236	True		ENSG00000177301	ENSG00000177301	HGNC:6220													
KCNC3	gene	KCNC3	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 13 MIM#605259						False	3	100;0;0	3.236	True		ENSG00000131398	ENSG00000131398	HGNC:6235													
KCND3	gene	KCND3	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 19, MIM#	607346"				32823520		False	3	100;0;0	3.236	True		ENSG00000171385	ENSG00000171385	HGNC:6239													
KCNJ10	gene	KCNJ10	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Paroxysmal dyskinesia, MONDO:0015427, KCNJ10-related				38979912;38436103		False	3	100;0;0	3.236	True		ENSG00000177807	ENSG00000177807	HGNC:6256													
KCNJ10	gene	KCNJ10	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Seizures, Sensorineural Deafness, Ataxia, Mental Retardation, and Electrolyte Imbalance Syndrome;SESAME syndrome, 612780						False	3	100;0;0	3.236	False		ENSG00000177807	ENSG00000177807	HGNC:6256													
KCNJ2	gene	KCNJ2	Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	3.236	False		ENSG00000123700	ENSG00000123700	HGNC:6263													
KCNJ2	gene	KCNJ2	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Andersen syndrome, MIM# 170390				16217063;16571646;16419128;17324964		False	3	100;0;0	3.236	True		ENSG00000123700	ENSG00000123700	HGNC:6263													
KCNMA1	gene	KCNMA1	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy MIM#609446				26195193;15937479;29356177		False	3	100;0;0	3.236	False	Other	ENSG00000156113	ENSG00000156113	HGNC:6284													
KCNMA1	gene	KCNMA1	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM# 609446				15937479;26195193		False	3	100;0;0	3.236	True		ENSG00000156113	ENSG00000156113	HGNC:6284													
KCNMA1	gene	KCNMA1	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM# 609446				15937479;26195193		False	3	100;0;0	3.236	True		ENSG00000156113	ENSG00000156113	HGNC:6284													
KCNN2	gene	KCNN2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725				33242881		False	3	100;0;0	3.236	True		ENSG00000080709	ENSG00000080709	HGNC:6291													
KCNN2	gene	KCNN2	Literature;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 34, myoclonic, MIM#619724;Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725				32212350;33242881		False	3	100;0;0	3.236	False		ENSG00000080709	ENSG00000080709	HGNC:6291													
KCNQ2	gene	KCNQ2	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myokymia, MIM# 121200;Seizures, benign neonatal, 1, MIM# 121200;Developmental and epileptic encephalopathy 7, MIM# 613720						False	3	100;0;0	3.236	True		ENSG00000075043	ENSG00000075043	HGNC:6296													
KCNQ2	gene	KCNQ2	Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	3.236	False		ENSG00000075043	ENSG00000075043	HGNC:6296													
KCNQ3	gene	KCNQ3	Victorian Clinical Genetics Services;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Seizures, benign neonatal, 2, MIM# 121201				33337327		False	3	100;0;0	3.236	False		ENSG00000184156	ENSG00000184156	HGNC:6297													
KCNQ3	gene	KCNQ3	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Seizures, benign neonatal, 2, MIM# 121201				33337327;25524373;24851285		False	3	100;0;0	3.236	True		ENSG00000184156	ENSG00000184156	HGNC:6297													
KCTD17	gene	KCTD17	Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Dystonia 26, myoclonic MIM#616398				25983243;30642807;30579817		False	3	100;0;0	3.236	False		ENSG00000100379	ENSG00000100379	HGNC:25705													
KIF1A	gene	KIF1A	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia;spastic paraplegia;intellectual disability				32096284;32935419		False	3	100;0;0	3.236	False		ENSG00000130294	ENSG00000130294	HGNC:888													
KIF1C	gene	KIF1C	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 2, autosomal recessive MIM#611302				24482476;24319291;31413903;29544888		False	3	100;0;0	3.236	True		ENSG00000129250	ENSG00000129250	HGNC:6317													
KIF7	gene	KIF7	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Koubert syndrome 12;Acrocallosal syndrome, Schinzel type						False	3	100;0;0	3.236	False		ENSG00000166813	ENSG00000166813	HGNC:30497													
KMT2B	gene	KMT2B	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 28, childhood-onset , MIM#617284				PMID: 33816656		False	3	100;0;0	3.236	True		ENSG00000272333	ENSG00000272333	HGNC:15840													
KMT2B	gene	KMT2B	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early-onset dystonia;Dystonia 28, childhood-onset 617284;MONDO:0015004				27839873;27992417		False	3	100;0;0	3.236	False		ENSG00000272333	ENSG00000272333	HGNC:15840													
L2HGDH	gene	L2HGDH	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	L-2-hydroxyglutaric aciduria MIM#236792				24753671;18780161;15824270;10399870		False	3	100;0;0	3.236	True		ENSG00000087299	ENSG00000087299	HGNC:20499													
LAMA1	gene	LAMA1	Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Poretti-Boltshauser syndrome;Cerebellar ataxia, intellectual disability, oculomotor apraxia, cerebellar cysts syndrome				26932191;25105227		False	3	100;0;0	3.236	True		ENSG00000101680	ENSG00000101680	HGNC:6481													
LARS2	gene	LARS2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021;Leukodystrophy				29205794;32423379;30737337		False	3	100;0;0	3.236	True		ENSG00000011376	ENSG00000011376	HGNC:17095													
LETM1	gene	LETM1	Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089				36055214		False	3	100;0;0	3.236	True		ENSG00000168924	ENSG00000168924	HGNC:6556													
LMNB1	gene	LMNB1	Victorian Clinical Genetics Services;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Leukodystrophy, adult-onset, autosomal dominant MIM#169500				31695592		False	3	100;0;0	3.236	False		ENSG00000113368	ENSG00000113368	HGNC:6637													
LRP10	gene	LRP10	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease MONDO:0005180				36434476;33913039;32613234;32597809;30964957;30597596;29887161		False	3	100;0;0	3.236	True		ENSG00000197324	ENSG00000197324	HGNC:14553													
LRRK2	gene	LRRK2	Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted							False	3	100;0;0	3.236	False		ENSG00000188906	ENSG00000188906	HGNC:18618													
LYST	gene	LYST	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chediak-Higashi syndrome MONDO:0008963				23436631;23521865;20301751		False	3	100;0;0	3.236	True		ENSG00000143669	ENSG00000143669	HGNC:1968													
MAG	gene	MAG	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 75, autosomal recessive, MIM#	616680;Cerebellar ataxia;Oculomotor apraxia"				32629324;32340215;32629324		False	3	100;0;0	3.236	True		ENSG00000105695	ENSG00000105695	HGNC:6783													
MAPT	gene	MAPT	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	late-onset Parkinson disease MONDO:0008199				20301678		False	3	100;0;0	3.236	True		ENSG00000186868	ENSG00000186868	HGNC:6893													
MARS2	gene	MARS2	Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 3, autosomal recessive MIM#611390						False	3	100;0;0	3.236	True		ENSG00000247626	ENSG00000247626	HGNC:25133													
MARS2	gene	MARS2	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 3, autosomal recessive MIM#611390				16672289;22448145		False	3	100;0;0	3.236	True		ENSG00000247626	ENSG00000247626	HGNC:25133													
MECP2	gene	MECP2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	MECP2-related disorders;Rett syndrome, MIM# 312750;Mental retardation, X-linked, syndromic 13, MIM# 300055				31970230;27050783		False	3	100;0;0	3.236	True		ENSG00000169057	ENSG00000169057	HGNC:6990													
MECR	gene	MECR	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities, MIM# 617282;MONDO:0015003				27817865;33401012;31137067;31070877		False	3	100;0;0	3.236	True		ENSG00000116353	ENSG00000116353	HGNC:19691													
MED27	gene	MED27	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual disability;cerebellar hypoplasia;dystonia				33443317		False	3	100;0;0	3.236	False		ENSG00000160563	ENSG00000160563	HGNC:2377													
MICU1	gene	MICU1	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Myopathy with extrapyramidal signs, MIM# 615673				24336167;29721912;32395406;38219528;36115200;36054588		False	3	100;0;0	3.236	True		ENSG00000107745	ENSG00000107745	HGNC:1530													
MKS1	gene	MKS1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 28						False	3	100;0;0	3.236	False		ENSG00000011143	ENSG00000011143	HGNC:7121													
MMACHC	gene	MMACHC	NHS GMS;Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methylmalonic aciduria and homocystinuria cblC type, 277400;Methylmalonic aciduria and homocystinuria, cblC type, 277400;Ataxia and hypogonadism						False	3	100;0;0	3.236	False		ENSG00000132763	ENSG00000132763	HGNC:24525													
MORC2	gene	MORC2	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Axonal type CMT disease type 2Z, 616688;Cerebellar ataxia				28402445		False	3	50;0;50	3.236	True		ENSG00000133422	ENSG00000133422	HGNC:23573													
MRE11	gene	MRE11	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-Telangiectasia-Like Disorder;Ataxia-telangiectasia-like disorder 1, 604391						False	3	100;0;0	3.236	False		ENSG00000020922	ENSG00000020922	HGNC:7230													
MSTO1	gene	MSTO1	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Myopathy, mitochondrial, and ataxia MIM#617675						False	3	100;0;0	3.236	True		ENSG00000125459	ENSG00000125459	HGNC:29678													
MT-ATP6	gene	MT-ATP6	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related				40112238		False	3	100;0;0	3.236	True		ENSG00000198899	ENSG00000198899	HGNC:7414													
MTCL1	gene	MTCL1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	slowly progressive cerebellar ataxia, mild intellectual disability, seizures in childhood and episodic pain in the lower limbs				30548255;28283581		False	3	100;0;0	3.236	True		ENSG00000168502	ENSG00000168502	HGNC:29121													
MT-CO1	gene	MT-CO1	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related				30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519		False	3	100;0;0	3.236	True		ENSG00000198804	ENSG00000198804	HGNC:7419													
MT-CO2	gene	MT-CO2	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related				34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519		False	3	100;0;0	3.236	True		ENSG00000198712	ENSG00000198712	HGNC:7421													
MT-CYB	gene	MT-CYB	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related				39858655;34804306;26937408		False	3	100;0;0	3.236	True		ENSG00000198727	ENSG00000198727	HGNC:7427													
MTFMT	gene	MTFMT	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 15 MIM#614947;Mitochondrial complex I deficiency, nuclear type 27 MIM#618248				26060307;24461907		False	3	100;0;0	3.236	True		ENSG00000103707	ENSG00000103707	HGNC:29666													
MT-ND3	gene	MT-ND3	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND3-related				1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403		False	3	100;0;0	3.236	False		ENSG00000198840	ENSG00000198840	HGNC:7458													
MT-ND4	gene	MT-ND4	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-ND4-related				12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231		False	3	100;0;0	3.236	True		ENSG00000198886	ENSG00000198886	HGNC:7459													
MT-TE	gene	MT-TE	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TE-related				8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256		False	3	100;0;0	3.236	True		ENSG00000210194	ENSG00000210194	HGNC:7479													
MT-TG	gene	MT-TG	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TG-related				8079988;9199564;11971101;16120360;32337339;35432167;10090480		False	3	100;0;0	3.236	True		ENSG00000210164	ENSG00000210164	HGNC:7486													
MT-TH	gene	MT-TH	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TH-related				12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194		False	3	100;0;0	3.236	True		ENSG00000210176	ENSG00000210176	HGNC:7487													
MTTP	gene	MTTP	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Abetalipoproteinemia, 200100;Abetalipoproteinemia						False	3	100;0;0	3.236	False		ENSG00000138823	ENSG00000138823	HGNC:7467													
MT-TS2	gene	MT-TS2	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TS2-related				9792552;10090882;16950817;21257182;22369973;22378285		False	3	100;0;0	3.236	True		ENSG00000210184	ENSG00000210184	HGNC:7498													
MT-TV	gene	MT-TV	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related				9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	3.236	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TV	gene	MT-TV	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TV-related				9450773;12056939;19252805;15320572;18314141;24691472;39468830		False	3	100;0;0	3.236	True		ENSG00000210077	ENSG00000210077	HGNC:7500													
MT-TW	gene	MT-TW	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related				7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	3.236	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
MT-TW	gene	MT-TW	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TW-related				7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556		False	3	100;0;0	3.236	True		ENSG00000210117	ENSG00000210117	HGNC:7501													
MT-TY	gene	MT-TY	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TY-related				11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411		False	3	100;0;0	3.236	True		ENSG00000210144	ENSG00000210144	HGNC:7502													
MVK	gene	MVK	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mevalonic aciduria 610377				12563048;10401001;28095071		False	3	100;0;0	3.236	True		ENSG00000110921	ENSG00000110921	HGNC:7530													
MYORG	gene	MYORG	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317;Primary familial brain calcification;Atypical parkinsonism;Supranuclear gaze palsy				32211515;30656188;30649222;30460687;29910000;31951047		False	3	100;0;0	3.236	True		ENSG00000164976	ENSG00000164976	HGNC:19918													
MYORG	gene	MYORG	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317;paroxysmal dyskinesia;brain calcification;episodic hemiparesis				34346093;34783389;32303062		False	3	100;0;0	3.236	True		ENSG00000164976	ENSG00000164976	HGNC:19918													
NAA15	gene	NAA15	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787				38380600;36221186;35730864		False	3	100;0;0	3.236	True		ENSG00000164134	ENSG00000164134	HGNC:30782													
NACC1	gene	NACC1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	chorea;dystonia;epilepsy;microcephaly;cataracts;dysautonomia;iron deficiency anemia;stereotypies				38698576		False	3	100;0;0	3.236	True		ENSG00000160877	ENSG00000160877	HGNC:20967													
NHLRC1	gene	NHLRC1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive myoclonic epilepsy 2B, Lafora, 254780;Epilepsy, progressive myoclonic 2B (Lafora) 254780						False	3	100;0;0	3.236	False		ENSG00000187566	ENSG00000187566	HGNC:21576													
NIT1	gene	NIT1	Literature;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Brain small vessel disease 4, MIM# 621313				38430071		False	3	100;0;0	3.236	False		ENSG00000158793	ENSG00000158793	HGNC:7828													
NKX2-1	gene	NKX2-1	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Choreoathetosis, hypothyroidism, and neonatal respiratory distress 610978;Choreoathetosis, hypothyroidism and neonatal respiratory distress, 610978;Chorea, hereditary benign 118700;Hereditary bening chorea, 118700				10931427;27066577;26839702;26103969		False	3	100;0;0	3.236	True		ENSG00000136352	ENSG00000136352	HGNC:11825													
NKX2-1	gene	NKX2-1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Chorea, hereditary benign MIM#118700;Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978				24714694;30186310		False	3	100;0;0	3.236	True		ENSG00000136352	ENSG00000136352	HGNC:11825													
NKX6-2	gene	NKX6-2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy MIM#617560				30285346;28575651;28969374		False	3	100;0;0	3.236	True		ENSG00000148826	ENSG00000148826	HGNC:19321													
NKX6-2	gene	NKX6-2	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spastic ataxia 8 with hypomyelinating leukodystrophy, 617560;Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560						False	3	100;0;0	3.236	False		ENSG00000148826	ENSG00000148826	HGNC:19321													
NOVA2	gene	NOVA2	Expert Review Green;Literature;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, OMIM #618859				PMID: 32197073		False	3	100;0;0	3.236	True		ENSG00000104967	ENSG00000104967	HGNC:7887													
NPC1	gene	NPC1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Niemann-Pick disease, MIM# 257220;Parkinsonism				24035292;30369906		False	3	100;0;0	3.236	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC1	gene	NPC1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C1 MONDO:0009757				12555942;20301473		False	3	100;0;0	3.236	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC1	gene	NPC1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease type C1, 257220;Niemann-Pick disease types C1 and D (#257220)				10480349;17003072;25497598;33228797		False	3	100;0;0	3.236	True		ENSG00000141458	ENSG00000141458	HGNC:7897													
NPC2	gene	NPC2	Expert Review Green;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease type C2, 607625;Niemann-Pick disease type C2 (#607625)						False	3	100;0;0	3.236	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPC2	gene	NPC2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann Pick C2, OMIM 607625;Parkinsonism				PMID: 35695805		False	3	100;0;0	3.236	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPC2	gene	NPC2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Niemann-Pick disease, type C2 MONDO:0011873;Dystonia				34993563;17470133		False	3	100;0;0	3.236	True		ENSG00000119655	ENSG00000119655	HGNC:14537													
NPHP1	gene	NPHP1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 4						False	3	100;0;0	3.236	False		ENSG00000144061	ENSG00000144061	HGNC:7905													
NPTX1	gene	NPTX1	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	cerebellar ataxia MONDO#0000437, NPTX1-related				34788392;35288776;35285082;35560436		False	3	100;0;0	3.236	False		ENSG00000171246	ENSG00000171246	HGNC:7952													
NR4A2	gene	NR4A2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911				31922365		False	3	100;0;0	3.236	True		ENSG00000153234	ENSG00000153234	HGNC:7981													
NR4A2	gene	NR4A2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911				31922365		False	3	100;0;0	3.236	True		ENSG00000153234	ENSG00000153234	HGNC:7981													
NUBPL	gene	NUBPL	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex I deficiency, nuclear type 21, OMIM # 618242				23553477;32518176		False	3	100;0;0	3.236	True		ENSG00000151413	ENSG00000151413	HGNC:20278													
NUS1	gene	NUS1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Epilepsy, myoclonus, ataxia and scoliosis;Mental retardation, autosomal dominant 55, with seizures, 617831				PMID: 31656175;29100083		False	3	100;0;0	3.236	True		ENSG00000153989	ENSG00000153989	HGNC:21042													
NUS1	gene	NUS1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder, autosomal dominant 55, with seizures, MIM#	617831;Parkinsonism;Developmental delay;Intellectual disability;Ataxia;Myoclonus"				PMID: 32485575;30348779		False	3	100;0;0	3.236	True		ENSG00000153989	ENSG00000153989	HGNC:21042													
OFD1	gene	OFD1	Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 10						False	3	100;0;0	3.236	False		ENSG00000046651	ENSG00000046651	HGNC:2567													
OPA1	gene	OPA1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	OPA1-related optic atrophy with or without extraocular features, MONDO:0800181				30165240;28494813		False	3	100;0;0	3.236	True		ENSG00000198836	ENSG00000198836	HGNC:8140													
OPA3	gene	OPA3	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type III, MIM# 258501;developmental delay, hypotonia;dystonia and chorea;ataxia, optic atrophy;spastic paraplegia				20301646;7510656;2494568;11668429		False	3	100;0;0	3.236	True		ENSG00000125741	ENSG00000125741	HGNC:8142													
OPA3	gene	OPA3	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria, type III, 258501;Optic atrophy 3 with cataract, 165300;3-methylglutaconic aciduria type III, 258501;Costeff syndrome						False	3	100;0;0	3.236	False		ENSG00000125741	ENSG00000125741	HGNC:8142													
OPHN1	gene	OPHN1	Expert Review Green;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	X-linked mental retardation with cerebellar hypoplasia and distinctive facial appearance, 300486;Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486						False	3	100;0;0	3.236	True		ENSG00000079482	ENSG00000079482	HGNC:8148													
PAH	gene	PAH	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Phenylketonuria MIM#261600				PMID: 25614310, PMID: 15390012, PMID: 30369906		False	3	100;0;0	3.236	True		ENSG00000171759	ENSG00000171759	HGNC:8582													
PANK2	gene	PANK2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	pantothenate kinase-associated neurodegeneration MONDO:0009319				23447832;20301663		False	3	0;0;0	3.236	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PANK2	gene	PANK2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	pantothenate kinase-associated neurodegeneration MONDO:0009319;Dystonia				15911822		False	3	100;0;0	3.236	True		ENSG00000125779	ENSG00000125779	HGNC:15894													
PARK7	gene	PARK7	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive early-onset Parkinson disease 7 MONDO:0011658				20301402		False	3	100;0;0	3.236	True		ENSG00000116288	ENSG00000116288	HGNC:16369													
PARK7	gene	PARK7	Expert list;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Parkinson disease 7, autosomal recessive early-onset	MIM#606324"				29644727		False	3	100;0;0	3.236	False		ENSG00000116288	ENSG00000116288	HGNC:16369													
PCCA	gene	PCCA	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Propionicacidemia, MIM#	606054"				30879957		False	3	100;0;0	3.236	True		ENSG00000175198	ENSG00000175198	HGNC:8653													
PCCB	gene	PCCB	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Propionicacidemia, MIM#	606054"				30879957		False	3	100;0;0	3.236	True		ENSG00000114054	ENSG00000114054	HGNC:8654													
PDE10A	gene	PDE10A	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Early onset chorea without epilepsy;infantile onset limb and orofacial dyskinesia (OMIM 616921)				PMID 27058447		False	3	100;0;0	3.236	False		ENSG00000112541	ENSG00000112541	HGNC:8772													
PDE1B	gene	PDE1B	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related				40492975		False	3	100;0;0	3.236	True		ENSG00000123360	ENSG00000123360	HGNC:8775													
PDE1B	gene	PDE1B	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related				40492975		False	3	100;0;0	3.236	True		ENSG00000123360	ENSG00000123360	HGNC:8775													
PDE2A	gene	PDE2A	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Paroxysmal dyskinesia;Intellectual developmental disorder with paroxysmal dyskinesia or seizures, MIM# 619150				32467598;32196122;29392776;37317634		False	3	100;0;0	3.236	True		ENSG00000186642	ENSG00000186642	HGNC:8777													
PDE8B	gene	PDE8B	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Striatal degeneration, autosomal dominant, MIM#609161				20085714;26769607;26475694		False	3	100;0;0	3.236	True		ENSG00000113231	ENSG00000113231	HGNC:8794													
PDGFB	gene	PDGFB	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 5 615483						False	3	100;0;0	3.236	False		ENSG00000100311	ENSG00000100311	HGNC:8800													
PDGFB	gene	PDGFB	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 5, MIM# 615483				23913003		False	3	100;0;0	3.236	True		ENSG00000100311	ENSG00000100311	HGNC:8800													
PDGFB	gene	PDGFB	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 5, MIM# 615483;Paroxysmal nonkinesigenic dyskinesia;paroxysmal kinesigenic dyskinesia;Brain calcification				28556368;32443735;23913003		False	3	100;0;0	3.236	True		ENSG00000100311	ENSG00000100311	HGNC:8800													
PDGFRB	gene	PDGFRB	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 4, MIM# 615007				23255827;30979360		False	3	100;0;0	3.236	True		ENSG00000113721	ENSG00000113721	HGNC:8804													
PDHA1	gene	PDHA1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Pyruvate dehydrogenase E1-alpha deficiency MIM#312170				20002125		False	3	100;0;0	3.236	True		ENSG00000131828	ENSG00000131828	HGNC:8806													
PDHA1	gene	PDHA1	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Pyruvate dehydrogenase E1-alpha deficiency, MIM# 312170;Paroxysmal dyskinesia (exercise induced or without clear trigger				20002125;22079328		False	3	100;0;0	3.236	True		ENSG00000131828	ENSG00000131828	HGNC:8806													
PDHX	gene	PDHX	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lactic acidemia due to PDX1 deficiency, MIM# 245349;episodic dystonia;Paroxysmal dyskinesia (exercise induced or without clear trigger;isolated or with additional features)				16566017;20002125		False	3	100;0;0	3.236	True		ENSG00000110435	ENSG00000110435	HGNC:21350													
PDHX	gene	PDHX	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lacticacidemia due to PDX1 deficiency	MIM#245349"				20002125;16566017;17152059		False	3	100;0;0	3.236	True		ENSG00000110435	ENSG00000110435	HGNC:21350													
PDYN	gene	PDYN	Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245						False	3	100;0;0	3.236	False		ENSG00000101327	ENSG00000101327	HGNC:8820													
PEX16	gene	PEX16	Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Zellweger syndrome (614876);Peroxisome biogenesis disorder 8B (#614877)  infantile progressive ataxia and spastic paresis;Peroxisome biogenesis disorder 8A, 614876;Peroxisome biogenesis disorder 8B, 614877						False	3	100;0;0	3.236	False		ENSG00000121680	ENSG00000121680	HGNC:8857													
PEX7	gene	PEX7	Expert Review Green;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Refsum disease;Peroxisome biogenesis disorder 9B, MIM#614879						False	3	100;0;0	3.236	True		ENSG00000112357	ENSG00000112357	HGNC:8860													
PGK1	gene	PGK1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Phosphoglycerate kinase 1 deficiency, MIM# 300653;Haemolytic anaemia;Rhabdomyolysis;Myopathy;Juvenile Parkinsonism;OMIM 300653				PMID: 30975619		False	3	100;0;0	3.236	True		ENSG00000102144	ENSG00000102144	HGNC:8896													
PHYH	gene	PHYH	Expert Review Green;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Refsum disease, MIM#	266500"						False	3	100;0;0	3.236	True		ENSG00000107537	ENSG00000107537	HGNC:8940													
PIGS	gene	PIGS	Expert Review Green;Literature;Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 95, OMIM # 618143				30269814;33410539		False	3	100;0;0	3.236	True		ENSG00000087111	ENSG00000087111	HGNC:14937													
PINK1	gene	PINK1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 6, early onset MIM#605909				28980524		False	3	100;0;0	3.236	True		ENSG00000158828	ENSG00000158828	HGNC:14581													
PINK1	gene	PINK1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 6, early onset;Dystonia						False	3	0;0;0	3.236	False		ENSG00000158828	ENSG00000158828	HGNC:14581													
PITRM1	gene	PITRM1	Expert Review Green;Literature;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis				26697887;29764912		False	3	100;0;0	3.236	True		ENSG00000107959	ENSG00000107959	HGNC:17663													
PLA2G6	gene	PLA2G6	Expert Review Green;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive Parkinson disease 14, 612953;Parkinson disease 14 (#612953);Infantile neuroaxonal dystrophy 1 (#256600);Infantile neuroaxonal dystrophy 1, 256600;Neurodegeneration with brain iron accumulation 2B (#610217);Neurodegeneration with brain iron accumulation 2B, 610217						False	3	100;0;0	3.236	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLA2G6	gene	PLA2G6	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive Parkinson disease 14 MONDO:0013060				20301718		False	3	100;0;0	3.236	True		ENSG00000184381	ENSG00000184381	HGNC:9039													
PLA2G6	gene	PLA2G6	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 14, autosomal recessive 612953;PLA2G6-associated neurodegeneration;Neurodegeneration with brain iron accumulation 2B 610217;Infantile neuroaxonal dystrophy 1 256600						False	3	0;0;0	3.236	False		ENSG00000184381	ENSG00000184381	HGNC:9039													
PMPCA	gene	PMPCA	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200				25808372;26657514;33272776;30617178		False	3	100;0;0	3.236	True		ENSG00000165688	ENSG00000165688	HGNC:18667													
PMPCB	gene	PMPCB	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Multiple mitochondrial dysfunctions syndrome 6, 617954				29576218		False	3	100;0;0	3.236	True		ENSG00000105819	ENSG00000105819	HGNC:9119													
PNKD	gene	PNKD	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800;MONDO:0007326				15262732;15496428;15824259;19124534;21487022		False	3	100;0;0	3.236	False		ENSG00000127838	ENSG00000127838	HGNC:9153													
PNKD	gene	PNKD	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800				15496428		False	3	100;0;0	3.236	True		ENSG00000127838	ENSG00000127838	HGNC:9153													
PNKD	gene	PNKD	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Paroxysmal nonkinesigenic dyskinesia 1, 118800						False	3	100;0;0	3.236	True		ENSG00000127838	ENSG00000127838	HGNC:9153													
PNKD	gene	PNKD	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800						False	3	100;0;0	3.236	True		ENSG00000127838	ENSG00000127838	HGNC:9153													
PNKP	gene	PNKP	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Microcephaly, seizures and developmental delay, 613402;Ataxia-oculomotor apraxia 4, 616267;Ataxia with oculomotor apraxia 4 (#616267)				31436889;31707899		False	3	100;0;0	3.236	True		ENSG00000039650	ENSG00000039650	HGNC:9154													
PNKP	gene	PNKP	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ataxia-oculomotor apraxia 4, MIM#	616267"				28552035;25728773		False	3	100;0;0	3.236	True		ENSG00000039650	ENSG00000039650	HGNC:9154													
PNPLA6	gene	PNPLA6	Expert Review Green;Expert list;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Boucher-Neuhauser syndrome MIM#215470;Laurence-Moon syndrome MIM#245800;Oliver-McFarlane syndrome MIM#275400;Spastic paraplegia 39, autosomal recessive MIM#612020						False	3	100;0;0	3.236	True		ENSG00000032444	ENSG00000032444	HGNC:16268													
PNPLA8	gene	PNPLA8	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related				PMID: 39082157		False	3	100;0;0	3.236	True		ENSG00000135241	ENSG00000135241	HGNC:28900													
PNPT1	gene	PNPT1	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 25, MIM#	608703"				35411967;37935417;39729134;39899068;39924761;40757543		False	3	60;40;0	3.236	False		ENSG00000138035	ENSG00000138035	HGNC:23166													
POLG	gene	POLG	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450						False	3	100;0;0	3.236	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLG	gene	POLG	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	autosomal dominant progressive external ophthalmoplegia MONDO:0008003				20301791;15351195		False	3	100;0;0	3.236	True		ENSG00000140521	ENSG00000140521	HGNC:9179													
POLR3A	gene	POLR3A	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276				32600288;32373668;31940116;31932101;29618326		False	3	100;0;0	3.236	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3A	gene	POLR3A	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276				PMID: 33652360		False	3	100;0;0	3.236	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3A	gene	POLR3A	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	POLR3A-related disorder MONDO:0700276						False	3	100;0;0	3.236	True		ENSG00000148606	ENSG00000148606	HGNC:30074													
POLR3B	gene	POLR3B	Expert Review Green;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#614381				22036171;22036172		False	3	100;0;0	3.236	True		ENSG00000013503	ENSG00000013503	HGNC:30348													
POU4F1	gene	POU4F1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ataxia;intention tremor;hypotonia				33783914;8876243		False	3	100;0;0	3.236	True		ENSG00000152192	ENSG00000152192	HGNC:9218													
PPP2R5D	gene	PPP2R5D	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early onset Parkinsonism;Houge-Janssens syndrome 1, MIM#616355				33338668;32743835		False	3	100;0;0	3.236	True		ENSG00000112640	ENSG00000112640	HGNC:9312													
PRDX3	gene	PRDX3	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia MONDO:0000437, PRDX3-related				33889951		False	3	100;0;0	3.236	True		ENSG00000165672	ENSG00000165672	HGNC:9354													
PRKCG	gene	PRKCG	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 14, MIM# 605361;Myoclonus;Parkinsonism				PMID: 29603387		False	3	100;0;0	3.236	True		ENSG00000126583	ENSG00000126583	HGNC:9402													
PRKN	gene	PRKN	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile parkinsonism/dystonia;Parkinson disease, juvenile, type 2;Dystonia						False	3	0;0;0	3.236	False		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRKN	gene	PRKN	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	autosomal recessive juvenile Parkinson disease 2 MONDO:0010820						False	3	100;0;0	3.236	True		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRKRA	gene	PRKRA	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 16, MIM# 612067;MONDO:0012789				18243799;25142429;29279192		False	3	100;0;0	3.236	False		ENSG00000180228	ENSG00000180228	HGNC:9438													
PRKRA	gene	PRKRA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	dystonia 16 MONDO:0012789				33502045		False	3	100;0;0	3.236	True		ENSG00000180228	ENSG00000180228	HGNC:9438													
PRMT1	gene	PRMT1	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Neurodevelopmental disorder, MONDO:0700092, PRMT1-related				39937650		False	3	100;0;0	3.236	True		ENSG00000126457	ENSG00000126457	HGNC:5187													
PRNP	gene	PRNP	Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease				2564168;34324063;20301407		False	3	100;0;0	3.236	False		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRNP	gene	PRNP	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 1 MONDO:0011299				30713928;27400454		False	3	100;0;0	3.236	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRNP	gene	PRNP	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	inherited Creutzfeldt-Jakob disease MONDO:0007403;Gerstmann-Straussler-Scheinker syndrome MONDO:0007656				20301407		False	3	100;0;0	3.236	True		ENSG00000171867	ENSG00000171867	HGNC:9449													
PRRT2	gene	PRRT2	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic kinesigenic dyskinesia 1, MIM# 128200;MONDO:0007494				22101681;22120146;22744660;22399141		False	3	100;0;0	3.236	False		ENSG00000167371	ENSG00000167371	HGNC:30500													
PRRT2	gene	PRRT2	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	PRRT2-associated paroxysmal movement disorder MONDO:0100556				26598494;31193310;30501978;30713971		False	3	100;0;0	3.236	True		ENSG00000167371	ENSG00000167371	HGNC:30500													
PRRT2	gene	PRRT2	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	PRRT2-associated paroxysmal movement disorder MONDO:0100556				33126500		False	3	100;0;0	3.236	True		ENSG00000167371	ENSG00000167371	HGNC:30500													
PRRT2	gene	PRRT2	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	PRRT2-associated paroxysmal movement disorder MONDO:0100556				33126500		False	3	100;0;0	3.236	True		ENSG00000167371	ENSG00000167371	HGNC:30500													
PSAP	gene	PSAP	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491				32201884		False	3	100;0;0	3.236	True		ENSG00000197746	ENSG00000197746	HGNC:9498													
PSEN1	gene	PSEN1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease 3 MONDO:0011913				3548932;34843019;36825052		False	3	100;0;0	3.236	True		ENSG00000080815	ENSG00000080815	HGNC:9508													
PSEN1	gene	PSEN1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Frontotemporal dementia, MIM# 600274;Dystonia				28664294;12810495;15159497;29316780		False	3	100;0;0	3.236	True		ENSG00000080815	ENSG00000080815	HGNC:9508													
PSMF1	gene	PSMF1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related				https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1		False	3	100;0;0	3.236	True		ENSG00000125818	ENSG00000125818	HGNC:9571													
PTRH2	gene	PTRH2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Infantile multi-system neurologic, endocrine, and pancreatic disease, 616263				25558065;25574476;31057140;27129381		False	3	100;0;0	3.236	True		ENSG00000141378	ENSG00000141378	HGNC:24265													
PTRHD1	gene	PTRHD1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747				27753167;27134041;30398675;29143421		False	3	100;0;0	3.236	True		ENSG00000184924	ENSG00000184924	HGNC:33782													
PTS	gene	PTS	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal							False	3	100;0;0	3.236	True		ENSG00000150787	ENSG00000150787	HGNC:9689													
PTS	gene	PTS	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, A, 261640;6-Pyruvoyltetrahydropterin Synthase Deficiency;Dystonia						False	3	0;0;0	3.236	False		ENSG00000150787	ENSG00000150787	HGNC:9689													
PUM1	gene	PUM1	Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 47, 617931						False	3	100;0;0	3.236	False		ENSG00000134644	ENSG00000134644	HGNC:14957													
QDPR	gene	QDPR	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, C, MIM#261630;Dehydropteridin reductase deficiency, Infantile-onset dystonia;Parkinsonism;Epilepsy;Autonomic dysfunction;Hyperphenylalaninemia				PMID: 28413401		False	3	100;0;0	3.236	True		ENSG00000151552	ENSG00000151552	HGNC:9752													
QDPR	gene	QDPR	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hyperphenylalaninemia, BH4-deficient, C, 261630;Dihydropteridine reductase deficiency;Dystonia						False	3	0;0;0	3.236	False		ENSG00000151552	ENSG00000151552	HGNC:9752													
RAB32	gene	RAB32	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Parkinson disease 26, autosomal dominant, susceptibility to}, MIM# 620923				38858457;38614108;38293014;40118982;40568674;41103171		False	3	33;33;33	3.236	True	Other	ENSG00000118508	ENSG00000118508	HGNC:9772													
RAB39B	gene	RAB39B	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Early-onset parkinsonism-intellectual disability syndrome MONDO:0010709				25434005;26399558;26739247		False	3	100;0;0	3.236	True		ENSG00000155961	ENSG00000155961	HGNC:16499													
RAB3A	gene	RAB3A	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 52, MIM# 621535				40166812		False	3	100;0;0	3.236	True		ENSG00000105649	ENSG00000105649	HGNC:9777													
RFC1	gene	RFC1	Literature;Expert list;Expert Review Green;Expert Review Green;Expert list;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575				30926972;33103729;35883251;36478048;36289003		False	3	67;33;0	3.236	False		ENSG00000035928	ENSG00000035928	HGNC:9969													
RHOBTB2	gene	RHOBTB2	Expert Review Green;Other	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 64, MIM#	618004;Paroxysmal movement disorder"				PMID 29276004		False	3	100;0;0	3.236	True		ENSG00000008853	ENSG00000008853	HGNC:18756													
RHOBTB2	gene	RHOBTB2	Expert Review Green;Other	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Epileptic encephalopathy, early infantile, 64, MIM#	618004;Dystonia, hypertonia, movement disorder;truncal hypotonia;hemiparesis;developmental and epileptic encephalopathy"				PMID: 29276004		False	3	0;0;0	3.236	True		ENSG00000008853	ENSG00000008853	HGNC:18756													
RNASEH2B	gene	RNASEH2B	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 2 MIM#610181				20131292;26860721		False	3	100;0;0	3.236	True		ENSG00000136104	ENSG00000136104	HGNC:25671													
RNASEH2C	gene	RNASEH2C	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 3 MIM#610329				20131292;23322642		False	3	100;0;0	3.236	True		ENSG00000172922	ENSG00000172922	HGNC:24116													
RNF170	gene	RNF170	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Ataxia, sensory, 1, autosomal dominant, MIM# 608984				32943585;21115467		False	3	100;0;0	3.236	False		ENSG00000120925	ENSG00000120925	HGNC:25358													
RNF216	gene	RNF216	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840						False	3	100;0;0	3.236	True		ENSG00000011275	ENSG00000011275	HGNC:21698													
RNF220	gene	RNF220	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum				33964137;10881263		False	3	100;0;0	3.236	True		ENSG00000187147	ENSG00000187147	HGNC:25552													
RNU7-1	gene	RNU7-1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 9, MIM# 619487				33230297		False	3	100;0;0	3.236	True		ENSG00000238923	ENSG00000238923	HGNC:34033													
RORA	gene	RORA	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, 618060				29656859		False	3	100;0;0	3.236	True		ENSG00000069667	ENSG00000069667	HGNC:10258													
RPGRIP1L	gene	RPGRIP1L	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 7, MIM#	611560"						False	3	100;0;0	3.236	True		ENSG00000103494	ENSG00000103494	HGNC:29168													
RUBCN	gene	RUBCN	Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Royal Melbourne Hospital Clinical Genetics Department	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 15, MIM#615705				20826435;23728897		False	3	100;0;0	3.236	True		ENSG00000145016	ENSG00000145016	HGNC:28991													
SACS	gene	SACS	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia, Charlevoix-Saguenay type MIM#270550						False	3	100;0;0	3.236	True		ENSG00000151835	ENSG00000151835	HGNC:10519													
SAMD9L	gene	SAMD9L	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550				35310830;33884299;28570036		False	3	100;0;0	3.236	False		ENSG00000177409	ENSG00000177409	HGNC:1349													
SCN1A	gene	SCN1A	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dravet syndrome, MIM# 607208;Epilepsy, Paekinsonism				PMID: 28186331;24850485		False	3	100;0;0	3.236	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN1A	gene	SCN1A	Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	3.236	False		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN1A	gene	SCN1A	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 6 (Dravet syndrome), MIM# 607208				27264139;27817982;28732259		False	3	67;33;0	3.236	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN1A	gene	SCN1A	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dravet syndrome 607208;Epilepsy, generalized, with febrile seizures plus, type 2 604403;Febrile seizures, familial, 3A 604403;Migraine, familial hemiplegic, 3 609634						False	3	100;0;0	3.236	True		ENSG00000144285	ENSG00000144285	HGNC:10585													
SCN2A	gene	SCN2A	Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	3.236	False		ENSG00000136531	ENSG00000136531	HGNC:10588													
SCN2A	gene	SCN2A	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Early infantile epileptic encephalopathy 11, MIM# 613721						False	3	100;0;0	3.236	True		ENSG00000136531	ENSG00000136531	HGNC:10588													
SCN4A	gene	SCN4A	Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	3	0;0;0	3.236	False		ENSG00000007314	ENSG00000007314	HGNC:10591													
SCN8A	gene	SCN8A	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Complex neurodevelopmental disorder MONDO:0100038				26677014;29356177;25799905		False	3	100;0;0	3.236	True		ENSG00000196876	ENSG00000196876	HGNC:10596													
SCN8A	gene	SCN8A	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myoclonus, familial, 2, MIM# 618364;epilepsy;paroxysmal kinesigenic dyskinesias				29726066;27098556		False	3	100;0;0	3.236	True		ENSG00000196876	ENSG00000196876	HGNC:10596													
SCN8A	gene	SCN8A	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy 13, 614558;Cognitive impairment with or without cerebellar ataxia, 614306				31904124;31887642;31675620		False	3	100;0;0	3.236	True		ENSG00000196876	ENSG00000196876	HGNC:10596													
SCYL1	gene	SCYL1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 21, 616719;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy				29419818;17571074;26581903;30531813		False	3	100;0;0	3.236	True		ENSG00000142186	ENSG00000142186	HGNC:14372													
SERAC1	gene	SERAC1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739;Parkinsonism				PMID: 29332177;16527507		False	3	100;0;0	3.236	True		ENSG00000122335	ENSG00000122335	HGNC:21061													
SERAC1	gene	SERAC1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	3-MEthylGlutaconic aciduria, Dystonia-Deafness, Hepatopathy, Encephalopathy, Leigh-like syndrome;3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, 614739;Lesions in the basal ganglia						False	3	0;0;0	3.236	False		ENSG00000122335	ENSG00000122335	HGNC:21061													
SETX	gene	SETX	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002						False	3	100;0;0	3.236	True		ENSG00000107290	ENSG00000107290	HGNC:445													
SETX	gene	SETX	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2, MIM#	606002"				19696032		False	3	100;0;0	3.236	True		ENSG00000107290	ENSG00000107290	HGNC:445													
SGCE	gene	SGCE	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed)	Dystonia-11, myoclonic, MIM# 159900;MONDO:0008044				11528394;12821748;16227522		False	3	100;0;0	3.236	False		ENSG00000127990	ENSG00000127990	HGNC:10808													
SHQ1	gene	SHQ1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 35, childhood-onset , MIM# 619921;Neurodevelopmental disorder with dystonia and seizures, MIM# 619922				34542157;29178645;36847845;37475611		False	3	100;0;0	3.236	True		ENSG00000144736	ENSG00000144736	HGNC:25543													
SIL1	gene	SIL1	Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Marinesco-Sjogren syndrome, 248800						False	3	100;0;0	3.236	False		ENSG00000120725	ENSG00000120725	HGNC:24624													
SKOR2	gene	SKOR2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Valence-Farazi cerebellar ataxia syndrome, MIM# 621386				40890458;29997391;21937600		False	3	100;0;0	3.236	True		ENSG00000215474	ENSG00000215474	HGNC:32695													
SLC13A3	gene	SLC13A3	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384)				https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID)		False	3	100;0;0	3.236	True		ENSG00000158296	ENSG00000158296	HGNC:14430													
SLC16A2	gene	SLC16A2	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Allan-Herndon-Dudley syndrome, MIM# 300523				15980113;31410843;20301789		False	3	100;0;0	3.236	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC16A2	gene	SLC16A2	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Allan-Herndon-Dudley syndrome, MIM# 300523;paroxysmal dyskinesia (passive movement trigger);neurodevelopmental disability, hypotonia				15980113;31410843;20301789		False	3	100;0;0	3.236	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC16A2	gene	SLC16A2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Allan-Herndon-Dudley syndrome, MONDO:0010354				41144879;40088079		False	3	100;0;0	3.236	True		ENSG00000147100	ENSG00000147100	HGNC:10923													
SLC17A5	gene	SLC17A5	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Salla disease;Sialic acid storage disease, severe infantile type, MIM# 269920				26171070		False	3	100;0;0	3.236	True		ENSG00000119899	ENSG00000119899	HGNC:10933													
SLC18A2	gene	SLC18A2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia, infantile, 2 , MIM# 618049;Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism				33983693;23363473;31240161;26497564		False	3	100;0;0	3.236	True		ENSG00000165646	ENSG00000165646	HGNC:10935													
SLC18A2	gene	SLC18A2	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Parkinsonism-dystonia, infantile, 2, MIM#	618049"				23363473;31240161;26497564		False	3	100;0;0	3.236	True		ENSG00000165646	ENSG00000165646	HGNC:10935													
SLC19A3	gene	SLC19A3	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483;Childhood onset Dystonia and Parkinsonism				PMID: 24260777		False	3	100;0;0	3.236	True		ENSG00000135917	ENSG00000135917	HGNC:16266													
SLC19A3	gene	SLC19A3	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2) 607483;Dystonia						False	3	0;0;0	3.236	False		ENSG00000135917	ENSG00000135917	HGNC:16266													
SLC1A3	gene	SLC1A3	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Episodic ataxia, type 6;Episodic ataxia type 6, 612656						False	3	100;0;0	3.236	False		ENSG00000079215	ENSG00000079215	HGNC:10941													
SLC1A3	gene	SLC1A3	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 6, MIM# 612656				19139306;16116111;29208948;27829685		False	3	100;0;0	3.236	True		ENSG00000079215	ENSG00000079215	HGNC:10941													
SLC1A3	gene	SLC1A3	Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 6 MIM#612656				16116111;23107647;19139306;29741614;25497598;29208948;29062094		False	3	100;0;0	3.236	True		ENSG00000079215	ENSG00000079215	HGNC:10941													
SLC20A2	gene	SLC20A2	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 1, MIM# 213600				22327515;23334463		False	3	100;0;0	3.236	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC20A2	gene	SLC20A2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 1 213600;Dystonia				22327515;23334463;24411498		False	3	100;0;0	3.236	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC25A46	gene	SLC25A46	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hereditary motor and sensory neuropathy type VIB, MIM#616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303				30178502;26168012;27543974;27430653;27390132;28934388;28558379		False	3	100;0;0	3.236	True		ENSG00000164209	ENSG00000164209	HGNC:25198													
SLC2A1	gene	SLC2A1	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	GLUT1 deficiency syndrome MONDO:0000188				18451999;34279792;18577546;34305802;27098784		False	3	100;0;0	3.236	True		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC2A1	gene	SLC2A1	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	GLUT1-deficiency syndrome, MONDO:0000188;Dystonia 9 601042;GLUT1 deficiency syndrome 1, infantile onset, severe 606777;GLUT1 deficiency syndrome 2, childhood onset 612126;Stomatin-deficient cryohydrocytosis with neurologic defects 608885				32913944		False	3	100;0;0	3.236	True		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC2A1	gene	SLC2A1	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 9, MIM# 601042;MONDO:0010983						False	3	100;0;0	3.236	False		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC2A1	gene	SLC2A1	Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	dystonia 9;GLUT1 deficiency syndrome 2, 612126;GLUT1 DEFICIENCY SYNDROME 1;paroxysmal exertion-induced dyskinesia with or without epilepsy and/or hemolytic anemia;GLUT1 deficiency syndrome 1, 606777;Dystonia 9, 601042;EPILEPSY, IDIOPATHIC GENERALIZED						False	3	100;0;0	3.236	False		ENSG00000117394	ENSG00000117394	HGNC:11005													
SLC30A10	gene	SLC30A10	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome MONDO:0013208				22341971;22341972		False	3	100;0;0	3.236	True		ENSG00000196660	ENSG00000196660	HGNC:25355													
SLC30A10	gene	SLC30A10	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia/Parkinsonism, Hypermanganesemia, Polycythemia, and Chronic Liver Disease;Hypermanganesemia with dystonia, polycythemia, and cirrhosis, 613280						False	3	0;0;0	3.236	False		ENSG00000196660	ENSG00000196660	HGNC:25355													
SLC30A9	gene	SLC30A9	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Birk-Landau-Perez syndrome	(MIM#617595)"				37041080		False	3	100;0;0	3.236	True		ENSG00000014824	ENSG00000014824	HGNC:1329													
SLC39A14	gene	SLC39A14	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermanganesemia with dystonia 2 (MIM# 617013)				27231142;32626807;29685658;30232769		False	3	100;0;0	3.236	True		ENSG00000104635	ENSG00000104635	HGNC:20858													
SLC39A14	gene	SLC39A14	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypermanganesemia with dystonia 2 617013						False	3	0;0;0	3.236	False		ENSG00000104635	ENSG00000104635	HGNC:20858													
SLC44A1	gene	SLC44A1	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Childhood-onset neurodegeneration;progressive ataxia tremor cognitive decline dysphagia optic atrophy dysarthria				31855247		False	3	100;0;0	3.236	True		ENSG00000070214	ENSG00000070214	HGNC:18798													
SLC52A2	gene	SLC52A2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bwon-Vialetto-Van Laere syndrome 2, 614707						False	3	100;0;0	3.236	True		ENSG00000185803	ENSG00000185803	HGNC:30224													
SLC6A3	gene	SLC6A3	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia, infantile, 1, MIM# 613135				21112253		False	3	100;0;0	3.236	True		ENSG00000142319	ENSG00000142319	HGNC:11049													
SLC6A3	gene	SLC6A3	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dopamine transporter deficiency;Parkinsonism-dystonia, infantile, 613135						False	3	0;0;0	3.236	False		ENSG00000142319	ENSG00000142319	HGNC:11049													
SLC6A5	gene	SLC6A5	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperekplexia 3, MIM# 614618				31604777;30847549;29859229;16751771		False	3	100;0;0	3.236	True		ENSG00000165970	ENSG00000165970	HGNC:11051													
SLC6A5	gene	SLC6A5	Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Hyperekplexia 3, MIM# 614618				31604777;30847549;29859229;16751771		False	3	100;0;0	3.236	True		ENSG00000165970	ENSG00000165970	HGNC:11051													
SLC9A1	gene	SLC9A1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Lichtenstein-Knorr Syndrome, MIM#	616291"				25205112;30018422;25760855		False	3	50;50;0	3.236	True		ENSG00000090020	ENSG00000090020	HGNC:11071													
SLC9A6	gene	SLC9A6	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Mental retardation, X-linked syndromic, Christianson type, 300243						False	3	100;0;0	3.236	False		ENSG00000198689	ENSG00000198689	HGNC:11079													
SLC9A6	gene	SLC9A6	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142				35198730;39810750;35198730;31192222		False	3	100;0;0	3.236	True		ENSG00000198689	ENSG00000198689	HGNC:11079													
SNAP25	gene	SNAP25	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Myasthenic syndrome, congenital, 18, 616330;cerebellar ataxia and seizures				29491473;25381298;17283335		False	3	100;0;0	3.236	True		ENSG00000132639	ENSG00000132639	HGNC:11132													
SNCA	gene	SNCA	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543)				32849182;26858591;32740728		False	3	100;0;0	3.236	True		ENSG00000145335	ENSG00000145335	HGNC:11138													
SNORD118	gene	SNORD118	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukoencephalopathy, brain calcifications, and cysts MIM#614561				27571260		False	3	100;0;0	3.236	True		ENSG00000200463	ENSG00000200463	HGNC:32952													
SNX14	gene	SNX14	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia 20, 616354;Autosomal recessive spinocerebellar ataxia (#616354)						False	3	100;0;0	3.236	False		ENSG00000135317	ENSG00000135317	HGNC:14977													
SOX6	gene	SOX6	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Tolchin-Le Caignec syndrome, MIM#	618971;Developmental delay;ID;ASD;ADHD;Parkinsonism;Syringomyelia"				24453155;25127144		False	3	100;0;0	3.236	True		ENSG00000110693	ENSG00000110693	HGNC:16421													
SPG11	gene	SPG11	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary spastic paraplegia 11 MONDO:0011445				35036589;23121729;21381113;27217339		False	3	100;0;0	3.236	True		ENSG00000104133	ENSG00000104133	HGNC:11226													
SPG7	gene	SPG7	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 7, autosomal recessive, MIM#	607259;Ataxia;Progressive external opthalmoplegia;Parkinsonism"				PMID: 31433872		False	3	100;0;0	3.236	True		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPG7	gene	SPG7	Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259						False	3	100;0;0	3.236	False		ENSG00000197912	ENSG00000197912	HGNC:11237													
SPR	gene	SPR	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716;MONDO:0012994				11443547;18502672;22522443;16532389;31777525;29147684;28189489		False	3	100;0;0	3.236	False		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPR	gene	SPR	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994				22522443;11920285;14663042;16443856;21782285;32813147		False	3	0;100;0	3.236	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPR	gene	SPR	Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716				22522443;16650784;21431957;28189489		False	3	100;0;0	3.236	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPR	gene	SPR	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Dopa-responsive dystonia due to sepiaterin reductase deficiency, 612716;Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716						False	3	100;0;0	3.236	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SPTAN1	gene	SPTAN1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia MONDO:0957813				36331550		False	3	100;0;0	3.236	True	Other	ENSG00000197694	ENSG00000197694	HGNC:11273													
SPTBN2	gene	SPTBN2	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 14, MIM#	615386;Spinocerebellar ataxia 5, MIM#	600224"				23236289;23838597;22781464;31617442;31066025		False	3	100;0;0	3.236	True		ENSG00000173898	ENSG00000173898	HGNC:11276													
SQSTM1	gene	SQSTM1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145				PMID: 27545679		False	3	100;0;0	3.236	True		ENSG00000161011	ENSG00000161011	HGNC:11280													
SQSTM1	gene	SQSTM1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145				27545679		False	3	100;0;0	3.236	True		ENSG00000161011	ENSG00000161011	HGNC:11280													
SRD5A3	gene	SRD5A3	Expert Review Green;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kahrizi syndrome, 612713;Congenital disorder of glycosylation, type Iq, 612379;Congenital disorder of glycosylation type Iq, 612379						False	3	100;0;0	3.236	True		ENSG00000128039	ENSG00000128039	HGNC:25812													
SRRM4	gene	SRRM4	Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, MONDO:0700092, SRRM4-related				41958152		False	3	100;0;0	3.236	True	Other	ENSG00000139767	ENSG00000139767	HGNC:29389													
STUB1	gene	STUB1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar Ataxia 48, OMIM 618093;Parkinsonism				30381368;32285148;32337344		False	3	100;0;0	3.236	True		ENSG00000103266	ENSG00000103266	HGNC:11427													
STUB1	gene	STUB1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 16, MIM#	615768"				25258038;24742043		False	3	100;0;0	3.236	True		ENSG00000103266	ENSG00000103266	HGNC:11427													
STXBP1	gene	STXBP1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Developmental and epileptic encephalopathy 4, MIM# 612164;Juvenile onset Parkinsonism				25418441;32643187;29929108		False	3	100;0;0	3.236	True		ENSG00000136854	ENSG00000136854	HGNC:11444													
SUCLA2	gene	SUCLA2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria);Dystonia						False	3	0;0;0	3.236	False		ENSG00000136143	ENSG00000136143	HGNC:11448													
SUFU	gene	SUFU	Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Joubert syndrome 32, MIM#617757;Neurodevelopmental disorder, MONDO:0700092, SUFU-related				33024317		False	3	100;0;0	3.236	True		ENSG00000107882	ENSG00000107882	HGNC:16466													
SUOX	gene	SUOX	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Sulfite oxidase deficiency MIM#272300				9600976;28933809;16140720		False	3	100;0;0	3.236	True		ENSG00000139531	ENSG00000139531	HGNC:11460													
SURF1	gene	SURF1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Leigh syndrome, due to COX IV deficiency, MIM#	256000"				19780766		False	3	100;0;0	3.236	True		ENSG00000148290	ENSG00000148290	HGNC:11474													
SVBP	gene	SVBP	Expert Review Green;Expert list;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, 618569				31363758;30607023		False	3	100;0;0	3.236	True		ENSG00000177868	ENSG00000177868	HGNC:29204													
SYNE1	gene	SYNE1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 8, MIM#	610743"				23325900;27086870		False	3	100;0;0	3.236	True		ENSG00000131018	ENSG00000131018	HGNC:17089													
SYNJ1	gene	SYNJ1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile Parkinsonism;Parkinson disease 20, early-onset						False	3	0;0;0	3.236	False		ENSG00000159082	ENSG00000159082	HGNC:11503													
SYNJ1	gene	SYNJ1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 20, early-onset, MIM# 615530				23804563;23804577;27496670;33841314		False	3	100;0;0	3.236	True		ENSG00000159082	ENSG00000159082	HGNC:11503													
SYT1	gene	SYT1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Baker-Gordon syndrome MIM#618218				30107533		False	3	100;0;0	3.236	True		ENSG00000067715	ENSG00000067715	HGNC:11509													
TARDBP	gene	TARDBP	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	frontotemporal dementia with motor neuron disease MONDO:0017161				36247987		False	3	100;0;0	3.236	True		ENSG00000120948	ENSG00000120948	HGNC:11571													
TBC1D23	gene	TBC1D23	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 11, 617695				28823707;28823706		False	3	100;0;0	3.236	True		ENSG00000036054	ENSG00000036054	HGNC:25622													
TBC1D24	gene	TBC1D24	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer's cramp, MIM# 608105;Episodic dystonia (Exercise induced or without clear trigger);epilepsy;myoclonus;hearing loss				PMID 31257402;PMID 31226716;PMID 25719194		False	3	100;0;0	3.236	True		ENSG00000162065	ENSG00000162065	HGNC:29203													
TBC1D24	gene	TBC1D24	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Developmental and epileptic encephalopathy 16, MIM# 615338;Intellectual disability;Parkinsonism;Seizures;Psychosis				PMID: 28663785;21087195		False	3	100;0;0	3.236	True		ENSG00000162065	ENSG00000162065	HGNC:29203													
TBCE	gene	TBCE	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Encephalopathy, progressive, with amyotrophy and optic atrophy, OMIM #617207				PubMed: 27666369		False	3	100;0;0	3.236	True		-	ENSG00000284770	HGNC:11582													
TCTN1	gene	TCTN1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 13, MIM#	614173"				31302911;28631893;21725307;26477546;26489806		False	3	100;0;0	3.236	True		ENSG00000204852	ENSG00000204852	HGNC:26113													
TCTN2	gene	TCTN2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 24, MIM#	616654"				25118024;21565611		False	3	100;0;0	3.236	True		ENSG00000168778	ENSG00000168778	HGNC:25774													
TCTN3	gene	TCTN3	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 18, MIM# 614815;Orofaciodigital syndrome IV, MIM# 258860				22883145;25118024		False	3	100;0;0	3.236	True		ENSG00000119977	ENSG00000119977	HGNC:24519													
TDP2	gene	TDP2	Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 23				31410782;30109272;24658003		False	3	100;0;0	3.236	True		ENSG00000111802	ENSG00000111802	HGNC:17768													
TH	gene	TH	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Tyrosine hydroxylase deficiency MONDO:0100064				20301334;20301610		False	3	100;0;0	3.236	True		ENSG00000180176	ENSG00000180176	HGNC:11782													
TH	gene	TH	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Segawa syndrome, recessive, MIM# 605407;MONDO:0011551						False	3	100;0;0	3.236	False		ENSG00000180176	ENSG00000180176	HGNC:11782													
THAP1	gene	THAP1	Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Dystonia 6, torsion, 602629;Dystonia;MONDO:0011264				21793105;22377579;36205328;21425335;20211909		False	3	100;0;0	3.236	False		ENSG00000131931	ENSG00000131931	HGNC:20856													
TIMM8A	gene	TIMM8A	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Deafness-Dystonia-Optic Neuronopathy Syndrome;Mohr-Tranebjaerg syndrome, MIM# 304700				11803487;11405816;32820032		False	3	100;0;0	3.236	True		ENSG00000126953	ENSG00000126953	HGNC:11817													
TINF2	gene	TINF2	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant dyskeratosis congenita 3, 613990;Revesz syndrome, 268130				18252230;21477109;18979121		False	3	100;0;0	3.236	True		ENSG00000092330	ENSG00000092330	HGNC:11824													
TMEM106B	gene	TMEM106B	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypomyelinating leukodystrophy 16, 617964				29186371;29444210		False	3	100;0;0	3.236	True		ENSG00000106460	ENSG00000106460	HGNC:22407													
TMEM151A	gene	TMEM151A	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Paroxysmal Kinesigenic Dyskinesia;episodic kinesigenic dyskinesia MONDO:0044202				34820915;34518509		False	3	100;0;0	3.236	False		ENSG00000179292	ENSG00000179292	HGNC:28497													
TMEM216	gene	TMEM216	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 2, MIM#	608091"				20036350;20512146		False	3	100;0;0	3.236	True		ENSG00000187049	ENSG00000187049	HGNC:25018													
TMEM237	gene	TMEM237	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 14, MIM#	614424"						False	3	100;0;0	3.236	True		ENSG00000155755	ENSG00000155755	HGNC:14432													
TMEM240	gene	TMEM240	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spinocerebellar ataxia 21, MIM#	607454"				25070513		False	3	100;0;0	3.236	True		ENSG00000205090	ENSG00000205090	HGNC:25186													
TMEM67	gene	TMEM67	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 6, MIM#	610688"						False	3	100;0;0	3.236	True		ENSG00000164953	ENSG00000164953	HGNC:28396													
TNPO2	gene	TNPO2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM#	619556"				34314705		False	3	100;0;0	3.236	True		ENSG00000105576	ENSG00000105576	HGNC:19998													
TOR1A	gene	TOR1A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant or sporadic dystonia (DYT1);Early-Onset Primary Dystonia;Dystonia-1, torsion, 128100				9288096;19955557;18477710;32243914;31583275;31347572		False	3	100;0;0	3.236	False		ENSG00000136827	ENSG00000136827	HGNC:3098													
TPK1	gene	TPK1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type);Dystonia						False	3	0;0;0	3.236	False		ENSG00000196511	ENSG00000196511	HGNC:17358													
TPP1	gene	TPP1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;Parkinsonism				PMID: 21940688		False	3	100;0;0	3.236	True		ENSG00000166340	ENSG00000166340	HGNC:2073													
TPP1	gene	TPP1	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia 7, 609270;Neuronal ceroid lipofuscinosis, 204500;Spinocerebellar ataxia, autosomal recessive 7, 609270;Ceroid lipofuscinosis, neuronal, 2, 204500						False	3	100;0;0	3.236	False		ENSG00000166340	ENSG00000166340	HGNC:2073													
TREX1	gene	TREX1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 1, dominant and recessive MIM#225750				20131292		False	3	100;0;0	3.236	True		ENSG00000213689	ENSG00000213689	HGNC:12269													
TRPM3	gene	TRPM3	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224				31278393;35146895		False	3	100;0;0	3.236	True		ENSG00000083067	ENSG00000083067	HGNC:17992													
TSFM	gene	TSFM	Expert Review Green;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 3						False	3	100;0;0	3.236	True		ENSG00000123297	ENSG00000123297	HGNC:12367													
TSPOAP1	gene	TSPOAP1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 22, MIM# 620453				33539324		False	3	100;0;0	3.236	True		ENSG00000005379	ENSG00000005379	HGNC:16831													
TTBK2	gene	TTBK2	Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11						False	3	50;50;0	3.236	False		ENSG00000128881	ENSG00000128881	HGNC:19141													
TTC19	gene	TTC19	Expert Review Green;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial complex III deficiency nuclear type II, 615157;Mitochondrial complex III deficiency, nuclear type 2, 615157						False	3	100;0;0	3.236	True		ENSG00000011295	ENSG00000011295	HGNC:26006													
TTI1	gene	TTI1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445				26539891;30315573;36724785		False	3	50;25;25	3.236	True		ENSG00000101407	ENSG00000101407	HGNC:29029													
TTPA	gene	TTPA	NHS GMS;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Ataxia with isolated vitamin E deficiency, MIM#	277460"						False	3	100;0;0	3.236	True		ENSG00000137561	ENSG00000137561	HGNC:12404													
TUBA4A	gene	TUBA4A	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic ataxia 11, autosomal dominant, MIM# 621226				38884572;37418012		False	3	100;0;0	3.236	True	Other	ENSG00000127824	ENSG00000127824	HGNC:12407													
TUBB4A	gene	TUBB4A	Royal Melbourne Hospital;Expert Review Green;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	hereditary whispering dysphonia;Dystonia 4, torsion, autosomal dominant, 128101;Dystonia				23424103;23595291;33084096;32943487		False	3	100;0;0	3.236	False		ENSG00000104833	ENSG00000104833	HGNC:20774													
TUBB4A	gene	TUBB4A	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Leukodystrophy, hypomyelinating, 6, 612438;Dystonia 4, 128101, Hypomyelinating leukodystrophy 6, 612438;Dystonia 4, torsion, autosomal dominant, 128101						False	3	100;0;0	3.236	False		ENSG00000104833	ENSG00000104833	HGNC:20774													
TWNK	gene	TWNK	Royal Melbourne Hospital;Expert Review Green	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 7, 271245;Ataxia Neuropathy Spectrum Disorders, Dominant;Progressive external ophthalmoplegia with mitochondrial DNA deletions, 609286;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, 609286;Perrault syndrome 5, 616138;Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), 271245;Spinocerebellar Ataxia, Recessive						False	3	100;0;0	3.236	False		ENSG00000107815	ENSG00000107815	HGNC:1160													
TWNK	gene	TWNK	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286				24076137;22949510;22580846;19353676		False	3	100;0;0	3.236	True		ENSG00000107815	ENSG00000107815	HGNC:1160													
UBTF	gene	UBTF	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;Parkinsonism;Dystonia;Chorea;Brain atrophy				PubMed: 28777933;29300972		False	3	100;0;0	3.236	True		ENSG00000108312	ENSG00000108312	HGNC:12511													
UBTF	gene	UBTF	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701				28777933;29300972		False	3	100;0;0	3.236	True	Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments	ENSG00000108312	ENSG00000108312	HGNC:12511													
UBTF	gene	UBTF	Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701				29300972		False	3	100;0;0	3.236	True		ENSG00000108312	ENSG00000108312	HGNC:12511													
UCHL1	gene	UCHL1	Expert Review Green;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic paraplegia 79, autosomal recessive, MIM#615491;Neurodegenerative disease, MONDO:0005559, UCHL1-related				28007905;23359680;11555633;35986737		False	3	100;0;0	3.236	True		ENSG00000154277	ENSG00000154277	HGNC:12513													
UNC13A	gene	UNC13A	Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456				27648472;28192369;41125872		False	3	100;0;0	3.236	True	Other	ENSG00000130477	ENSG00000130477	HGNC:23150													
VAC14	gene	VAC14	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Striatonigral degeneration, childhood-onset, MIM# 617054;Dystonia;Parkinsonism				PMID: 31392254;28502045		False	3	100;0;0	3.236	True		ENSG00000103043	ENSG00000103043	HGNC:25507													
VAC14	gene	VAC14	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Striatonigral degeneration, childhood-onset 617054						False	3	0;0;0	3.236	False		ENSG00000103043	ENSG00000103043	HGNC:25507													
VAMP2	gene	VAMP2	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760;Dystonia;Cortical visual impairment;Seizures;Stereotypic behaviour;Generalized hypotonia;Intellectual disability				30929742		False	3	100;0;0	3.236	True		ENSG00000220205	ENSG00000220205	HGNC:12643													
VCP	gene	VCP	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507				38283104;38145206		False	3	100;0;0	3.236	True	Other	ENSG00000165280	ENSG00000165280	HGNC:12666													
VLDLR	gene	VLDLR	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, mental retardation and dysequilibirum syndrome 1, 224050;Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, 224050						False	3	100;0;0	3.236	False		ENSG00000147852	ENSG00000147852	HGNC:12698													
VPS13A	gene	VPS13A	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	complex parkinsonism;Choreoacanthocytosis 200150						False	3	0;0;0	3.236	False		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13A	gene	VPS13A	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	chorea-acanthocytosis MONDO:0008695				20301561;37636221		False	3	100;0;0	3.236	True		ENSG00000197969	ENSG00000197969	HGNC:1908													
VPS13C	gene	VPS13C	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease 23, autosomal recessive, early onset MIM#616840				26942284;30452786;28862745		False	3	100;0;0	3.236	True		ENSG00000129003	ENSG00000129003	HGNC:23594													
VPS13D	gene	VPS13D	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 4, MIM#	607317"				29604224;29518281		False	3	100;0;0	3.236	True		ENSG00000048707	ENSG00000048707	HGNC:23595													
VPS13D	gene	VPS13D	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spinocerebellar ataxia, autosomal recessive 4, MIM#	607317"				29604224;29518281		False	3	100;0;0	3.236	True		ENSG00000048707	ENSG00000048707	HGNC:23595													
VPS16	gene	VPS16	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia 30, MIM#619291				32808683		False	3	100;0;0	3.236	True		ENSG00000215305	ENSG00000215305	HGNC:14584													
VPS35	gene	VPS35	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 17, MIM# 614203				21763482;21763483;22801713;34704029		False	3	100;0;0	3.236	True		ENSG00000069329	ENSG00000069329	HGNC:13487													
VPS41	gene	VPS41	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay				32808683;33764426		False	3	100;0;0	3.236	True		ENSG00000006715	ENSG00000006715	HGNC:12713													
VPS41	gene	VPS41	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay				32808683;33764426		False	3	100;0;0	3.236	True		ENSG00000006715	ENSG00000006715	HGNC:12713													
VPS4A	gene	VPS4A	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	CIMDAG syndrome MIM# 619273				33186543;33186545		False	3	100;0;0	3.236	True	Other	ENSG00000132612	ENSG00000132612	HGNC:13488													
VWA3B	gene	VWA3B	Expert Review Green;GeneReviews;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 22 MIM#616948				26157035		False	3	50;0;50	3.236	True		ENSG00000168658	ENSG00000168658	HGNC:28385													
WARS2	gene	WARS2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738				PMID: 29120065;34890876;31970218		False	3	100;0;0	3.236	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WARS2	gene	WARS2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710				29120065;31970218;34890876;28236339;28650581;28905505;30920170		False	3	100;0;0	3.236	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WARS2	gene	WARS2	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710				29120065;31970218;34890876;28236339;28650581;28905505;30920170		False	3	100;0;0	3.236	True		ENSG00000116874	ENSG00000116874	HGNC:12730													
WDR45	gene	WDR45	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Neurodegeneration with brain iron accumulation 5 300894;beta-propeller protein-associated neurodegeneration;Dystonia						False	3	0;0;0	3.236	False		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR45	gene	WDR45	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	X-linked complex neurodevelopmental disorder MONDO:0100148				28211668		False	3	100;0;0	3.236	True		ENSG00000196998	ENSG00000196998	HGNC:28912													
WDR73	gene	WDR73	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway Mowat syndrome, when patients are ambulant ataxia is a recognisednfeature;Galloway-Mowat Syndrome 1, 251300						False	3	100;0;0	3.236	False		ENSG00000177082	ENSG00000177082	HGNC:25928													
WDR73	gene	WDR73	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Galloway-Mowat syndrome 1, 251300						False	3	0;0;0	3.236	False		ENSG00000177082	ENSG00000177082	HGNC:25928													
WDR81	gene	WDR81	Expert Review Red;Expert Review Red;Expert list;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital hydrocephalus 3 with brain anomalies, 617967;Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Cerebellar ataxia, mental retardation and dysequilibrium syndrome 2, 610185				21885617;28556411;28969387		False	3	33;0;67	3.236	True		ENSG00000167716	ENSG00000167716	HGNC:26600													
WFS1	gene	WFS1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wolfram syndrome 1, 222300				25211237		False	3	100;0;0	3.236	True		ENSG00000109501	ENSG00000109501	HGNC:12762													
WWOX	gene	WWOX	Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spinocerebellar ataxia 12, 6143232;Early infantile epileptic encephalopathy 28, 616211;Autosomal recessive spinocerebellar ataxia 12, 614322						False	3	100;0;0	3.236	False		ENSG00000186153	ENSG00000186153	HGNC:12799													
XK	gene	XK	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	McLeod syndrome with or without chronic granulomatous disease MIM#300842				11761473		False	3	100;0;0	3.236	True		ENSG00000047597	ENSG00000047597	HGNC:12811													
XPR1	gene	XPR1	Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 6, MIM# 616413				25938945		False	3	100;0;0	3.236	True		ENSG00000143324	ENSG00000143324	HGNC:12827													
XRCC1	gene	XRCC1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 26 MIM#617633				28002403;29472272		False	3	100;0;0	3.236	True		ENSG00000073050	ENSG00000073050	HGNC:12828													
YIF1B	gene	YIF1B	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement				32006098;26077767		False	3	100;0;0	3.236	True		ENSG00000167645	ENSG00000167645	HGNC:30511													
YY1	gene	YY1	Expert Review Green;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Gabriele-de Vries syndrome 617557						False	3	0;0;0	3.236	False		ENSG00000100811	ENSG00000100811	HGNC:12856													
ZFYVE26	gene	ZFYVE26	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic paraplegia 15, autosomal recessive, MIM#	270700;Spastic paraplegia and retinal degeneration;Kjellin syndrome;Parkinsonism"				PMID: 33033739;21462267		False	3	100;0;0	3.236	True		ENSG00000072121	ENSG00000072121	HGNC:20761													
ZNF526	gene	ZNF526	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dentici-Novelli neurodevelopmental syndrome, MIM# 619877				21937992;25558065;33397746		False	3	100;0;0	3.236	True		ENSG00000167625	ENSG00000167625	HGNC:29415													
ABAT	gene	ABAT	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GABA-transaminase deficiency, MIM# 613163;intellectual disability;autism;DEE;epilepsy;paroxysmal dyskinesia				30617166		False	2	0;100;0	3.236	True		ENSG00000183044	ENSG00000183044	HGNC:23													
ACBD5	gene	ACBD5	Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leukodystrophy;syndromic cleft palate;ataxia;retinal dystrophy				27799409;23105016		False	2	50;50;0	3.236	True		ENSG00000107897	ENSG00000107897	HGNC:23338													
AFG3L2	gene	AFG3L2	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 28, MIM# 610246;optic atrophy;spastic ataxia;L-dopa-responsive parkinsonism				30252181;36110148		False	2	33;33;33	3.236	True		ENSG00000141385	ENSG00000141385	HGNC:315													
AFG3L2	gene	AFG3L2	Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Spastic ataxia 5, autosomal recessive MIM#614487;Early-onset dystonia				22964162;16541453;32219868;36110148		False	2	33;0;67	3.236	True		ENSG00000141385	ENSG00000141385	HGNC:315													
ALK	gene	ALK	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic-dystonic diplegia				PMID: 32989326		False	2	0;100;0	3.236	True		ENSG00000171094	ENSG00000171094	HGNC:427													
APP	gene	APP	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alzheimer disease 1, familial, MIM# 104300						False	2	0;100;0	3.236	True		ENSG00000142192	ENSG00000142192	HGNC:620													
ARFGEF3	gene	ARFGEF3	Literature;Expert Review Amber;Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia, MONDO:0044807, ARFGEF3-related				PMID: 33098801		False	2	50;50;0	3.236	False		ENSG00000112379	ENSG00000112379	HGNC:21213													
ATG5	gene	ATG5	Expert Review Amber;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Spinocerebellar ataxia, autosomal recessive 25				16625204;26812546		False	2	0;100;0	3.236	True		ENSG00000057663	ENSG00000057663	HGNC:589													
ATP5F1B	gene	ATP5F1B	Expert Review Amber;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Dystonia 38, susceptibility to, MIM# 621502				36860166;40276935		False	2	50;50;0	3.236	True		ENSG00000110955	ENSG00000110955	HGNC:830													
ATP7B	gene	ATP7B	Expert Review Amber;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease, MIM# 277900				32662046		False	2	0;100;0	3.236	True		ENSG00000123191	ENSG00000123191	HGNC:870													
CACNB4	gene	CACNB4	Expert Review Amber;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 5, MIM#613855				10762541;9628818;27003325		False	2	0;100;0	3.236	True		ENSG00000182389	ENSG00000182389	HGNC:1404													
CACNB4	gene	CACNB4	Expert Review Red;Expert list;Expert Review Amber;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia, type 5, MIM#613855				10762541;9628818;27003325		False	2	0;50;50	3.236	True		ENSG00000182389	ENSG00000182389	HGNC:1404													
CAPN1	gene	CAPN1	Expert list;Expert Review Amber;Expert list;Expert Review Green;Expert Review Green;Expert list;Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 76, autosomal recessive, 616907;MONDO:0014827				27320912;29678961;30572172;31023339;31104286		False	2	50;50;0	3.236	False		ENSG00000014216	ENSG00000014216	HGNC:1476													
CCDC88C	gene	CCDC88C	Victorian Clinical Genetics Services;GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	autosomal dominant spinocerebellar ataxia;?Spinocerebellar ataxia 40, 616053				25062847;30398676		False	2	33;67;0	3.236	False		ENSG00000015133	ENSG00000015133	HGNC:19967													
CHD8	gene	CHD8	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder, CHD8-related, MIM#615032;Dystonia				34415117		False	2	0;100;0	3.236	True		ENSG00000100888	ENSG00000100888	HGNC:20153													
CHP1	gene	CHP1	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic ataxia 9, autosomal recessive, OMIM #618438				29379881;32787936		False	2	50;50;0	3.236	True		ENSG00000187446	ENSG00000187446	HGNC:17433													
CIZ1	gene	CIZ1	Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Dystonia 23, 614860				27163549;29154038;22447717		False	2	0;100;0	3.236	False		ENSG00000148337	ENSG00000148337	HGNC:16744													
COASY	gene	COASY	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodegeneration with brain iron accumulation 6, MIM# 615643				28489334;24360804		False	2	0;100;0	3.236	True		ENSG00000068120	ENSG00000068120	HGNC:29932													
COL6A3	gene	COL6A3	Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Amber;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 27, MIM#616411				26004199;32037012;26872670;32037012		False	2	50;50;0	3.236	False		ENSG00000163359	ENSG00000163359	HGNC:2213													
COQ2	gene	COQ2	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	multiple system atrophy, MONDO:0007803				39152783;30242188;25672683;23758206		False	2	0;100;0	3.236	True		ENSG00000173085	ENSG00000173085	HGNC:25223													
DHDDS	gene	DHDDS	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Developmental delay and seizures with or without movement abnormalities, MIM# 617836;Myoclonic Epilepsy;Parkinsonism;Ataxia;Intellectual disability				PMID: 34837344;29100083		False	2	50;50;0	3.236	True		ENSG00000117682	ENSG00000117682	HGNC:20603													
EPM2A	gene	EPM2A	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780;Progressive Myoclonic Epilepsy;Parkinsonism				27574708;28818698		False	2	50;50;0	3.236	True		ENSG00000112425	ENSG00000112425	HGNC:3413													
FBXL4	gene	FBXL4	Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) MIM#615471						False	2	0;100;0	3.236	True		ENSG00000112234	ENSG00000112234	HGNC:13601													
H6PD	gene	H6PD	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease MONDO:0005180				40959972		False	2	0;100;0	3.236	True		ENSG00000049239	ENSG00000049239	HGNC:4795													
HACE1	gene	HACE1	Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia and psychomotor retardation with or without seizures MIM#616756				26424145;26437029		False	2	0;100;0	3.236	True		ENSG00000085382	ENSG00000085382	HGNC:21033													
HARS1	gene	HARS1	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	multisystem ataxic syndrome				32333447		False	2	33;67;0	3.236	True		ENSG00000170445	ENSG00000170445	HGNC:4816													
JPH3	gene	JPH3	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	paroxysmal dystonia, intellectual disability				PMID: 36273396		False	2	50;50;0	3.236	True		ENSG00000154118	ENSG00000154118	HGNC:14203													
KCNQ2	gene	KCNQ2	Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Epileptic encephalopathy, early infantile, 7 MIM#613720				12742592;32585800		False	2	0;100;0	3.236	True		ENSG00000075043	ENSG00000075043	HGNC:6296													
KCNQ2	gene	KCNQ2	Expert Review Amber;Expert list;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Early infantile encephalopathy 7, 613720;Myokymia, 121200				22169383;20962009;10575255		False	2	33;67;0	3.236	True		ENSG00000075043	ENSG00000075043	HGNC:6296													
KGD4	gene	KGD4	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related				PMID: 41018056;38685873		False	2	0;100;0	3.236	True		ENSG00000134056	ENSG00000134056	HGNC:16631													
KIF1C	gene	KIF1C	Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Spastic ataxia 2, autosomal recessive, MIM#	611302"				31413903		False	2	0;100;0	3.236	True		ENSG00000129250	ENSG00000129250	HGNC:6317													
KIF5A	gene	KIF5A	Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spastic paraplegia 10, autosomal dominant MIM#604187				18853458		False	2	0;100;0	3.236	True		ENSG00000155980	ENSG00000155980	HGNC:6323													
MAPK8IP3	gene	MAPK8IP3	Expert Review Amber;Literature;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431				30612693;30945334		False	2	0;100;0	3.236	True		ENSG00000138834	ENSG00000138834	HGNC:6884													
MAPT	gene	MAPT	Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dementia, frontotemporal, with or without parkinsonism MIM#600274				17319286;15883319		False	2	0;100;0	3.236	True		ENSG00000186868	ENSG00000186868	HGNC:6893													
MKKS	gene	MKKS	Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 6, 605231				15637713		False	2	67;33;0	3.236	True		ENSG00000125863	ENSG00000125863	HGNC:7108													
MTNAP1	gene	MTNAP1	Expert Review Amber;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial disease, MONDO:0044970				41720819		False	2	0;100;0	3.236	True		ENSG00000141219	ENSG00000141219	HGNC:29601													
MTPAP	gene	MTPAP	Expert Review Green;Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Ataxia, spastic, 4,;Autosomal recessive spastic ataxia 4, 613672				20970105;26319014;25008111		False	2	50;50;0	3.236	True		ENSG00000107951	ENSG00000107951	HGNC:25532													
MT-TC	gene	MT-TC	Expert Review Amber;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TC-related				8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363		False	2	0;100;0	3.236	True		ENSG00000210140	ENSG00000210140	HGNC:7477													
MT-TC	gene	MT-TC	Expert Review Amber;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Mitochondrial disease (MONDO:0044970), MT-TC-related				8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363		False	2	0;100;0	3.236	True		ENSG00000210140	ENSG00000210140	HGNC:7477													
NBEA	gene	NBEA	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM# 619157;Paroxysmal Kinesigenic Dyskinesia;DEE;autism;intellectual disability				33692494		False	2	0;100;0	3.236	True		ENSG00000172915	ENSG00000172915	HGNC:7648													
NHLRC1	gene	NHLRC1	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 2B (Lafora), MIM# 254780;Lafora disease;Progressive Myoclonic Epilepsy;Parkinsonism				22425593;32301727		False	2	50;50;0	3.236	True		ENSG00000187566	ENSG00000187566	HGNC:21576													
NUP54	gene	NUP54	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 37, early-onset, with striatal lesions, MIM# 620427;Early onset dystonia;progressive neurological deterioration;ataxia;dysarthria;dysphagia;hypotonia				36333996		False	2	0;100;0	3.236	True		ENSG00000138750	ENSG00000138750	HGNC:17359													
PCNA	gene	PCNA	Expert Review Amber;ClinGen	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	hereditary ataxia MONDO:0100309				24911150, 33426167, 36990216		False	2	0;100;0	3.236	True		ENSG00000132646	ENSG00000132646	HGNC:8729													
PLD3	gene	PLD3	GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Spinocerebellar ataxia 46				29053796;30312375;30312384;38059248		False	2	0;100;0	3.236	False		ENSG00000105223	ENSG00000105223	HGNC:17158													
PNPLA6	gene	PNPLA6	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	PNPLA6-related spastic paraplegia with or without ataxia MONDO:0100149				32623594;36825042		False	2	0;100;0	3.236	True		ENSG00000032444	ENSG00000032444	HGNC:16268													
PRKCG	gene	PRKCG	Expert Review Amber;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 14, MIM# 605361				34292398		False	2	0;100;0	3.236	True		ENSG00000126583	ENSG00000126583	HGNC:9402													
PRKN	gene	PRKN	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease, juvenile, type 2 MIM#600116;paroxysmal exercise induced dyskinesia;fasting induced dyskinesia;early onset parkinsonism				37205242		False	2	0;100;0	3.236	True		ENSG00000185345	ENSG00000185345	HGNC:8607													
PRPS1	gene	PRPS1	Literature;Expert Review Amber;Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy				33898739;28967191		False	2	0;100;0	3.236	False		ENSG00000147224	ENSG00000147224	HGNC:9462													
PTPA	gene	PTPA	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic, autosomal or pseudoautosomal	Intellectual disability, MONDO: 36073231, PTPA-related;Parkinson disease MONDO:0005180, PTPA-related				36073231;37448355;37046398		False	2	0;100;0	3.236	True		ENSG00000119383	ENSG00000119383	HGNC:9308													
RFXANK	gene	RFXANK	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive Ataxia and Neurologic Regression;MHC class II deficiency, complementation group B MIM#209920				PMID: 33855173;23314770;28676232		False	2	50;50;0	3.236	True		ENSG00000064490	ENSG00000064490	HGNC:9987													
SAMHD1	gene	SAMHD1	Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 5 MIM#612952				20131292		False	2	0;100;0	3.236	True		ENSG00000101347	ENSG00000101347	HGNC:15925													
SDHA	gene	SDHA	Expert list;Expert Review Amber;Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259				10976639;27683074		False	2	0;100;0	3.236	False		ENSG00000073578	ENSG00000073578	HGNC:10680													
SHQ1	gene	SHQ1	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder with dystonia and seizures, MIM# 619922				36847845		False	2	50;50;0	3.236	True		ENSG00000144736	ENSG00000144736	HGNC:25543													
SIDT2	gene	SIDT2	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Lysosomal storage disease, MONDO:0002561, SIDT2-related				PMID: 40541391		False	2	0;100;0	3.236	True		ENSG00000149577	ENSG00000149577	HGNC:24272													
SPR	gene	SPR	Expert Review Amber;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994				32591469		False	2	0;100;0	3.236	True		ENSG00000116096	ENSG00000116096	HGNC:11257													
SYNGAP1	gene	SYNGAP1	Expert Review Amber;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Autosomal dominant mental retardation 5, 612621				26989088		False	2	0;100;0	3.236	True		ENSG00000197283	ENSG00000197283	HGNC:11497													
TDP1	gene	TDP1	Expert Review Amber;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250				31182267;12244316;39576382		False	2	0;100;0	3.236	True		ENSG00000042088	ENSG00000042088	HGNC:18884													
TENM4	gene	TENM4	Literature;Expert Review Amber;Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	tremor, hereditary essential, 5 MONDO:0014756				41449293;36689009;26188006;29249217;34589676;22915103		False	2	0;100;0	3.236	False		ENSG00000149256	ENSG00000149256	HGNC:29945													
THG1L	gene	THG1L	Expert Review Amber;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 28, MIM# 618800				27307223;30214071;31168944		False	2	0;100;0	3.236	True		ENSG00000113272	ENSG00000113272	HGNC:26053													
TMEM138	gene	TMEM138	Expert Review Amber;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Joubert syndrome 16, MIM#	614465"						False	2	0;100;0	3.236	True		ENSG00000149483	ENSG00000149483	HGNC:26944													
TMEM231	gene	TMEM231	Expert Review Amber;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 20, MIM# 614970;Meckel syndrome 11 615397						False	2	0;100;0	3.236	True		ENSG00000205084	ENSG00000205084	HGNC:37234													
TRPC3	gene	TRPC3	GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown					25477146;26112884		False	2	0;100;0	3.236	False		ENSG00000138741	ENSG00000138741	HGNC:12335													
UBA5	gene	UBA5	Expert Review Amber;Royal Melbourne Hospital;GeneReviews	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Autosomal recessive spinocerebellar ataxia 24, 617133;Early infantile epileptic encephalopathy 44, 617132				26872069;29902590		False	2	0;100;0	3.236	True		ENSG00000081307	ENSG00000081307	HGNC:23230													
UBR4	gene	UBR4	Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Episodic ataxia;Episodic ataxia type 8, 616055				29062094;23982692;28600779		False	2	0;100;0	3.236	True		ENSG00000127481	ENSG00000127481	HGNC:30313													
UQCRC1	gene	UQCRC1	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinsonism with polyneuropathy, MIM# 619279				33141179;33248804		False	2	50;50;0	3.236	True		ENSG00000010256	ENSG00000010256	HGNC:12585													
VAMP1	gene	VAMP1	Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"Spastic ataxia 1, autosomal dominant, MIM#	108600"				22958904		False	2	0;100;0	3.236	True		ENSG00000139190	ENSG00000139190	HGNC:12642													
VAMP1	gene	VAMP1	Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Autosomal dominant spastic ataxia 1, 108600;Spastic ataxia 1, autosomal dominant, 108600				22958904		False	2	0;100;0	3.236	False		ENSG00000139190	ENSG00000139190	HGNC:12642													
VRK1	gene	VRK1	Expert Review Amber;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 1A, 607596				19646678;21937992;25609612;24126608;27281532		False	2	0;100;0	3.236	True		ENSG00000100749	ENSG00000100749	HGNC:12718													
XPR1	gene	XPR1	Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Basal ganglia calcification, idiopathic, 6, MIM# 616413;brain calcification;basal ganglia calcification;paroxysmal dyskinesia;epilepsy;DEE				33433330		False	2	0;100;0	3.236	True		ENSG00000143324	ENSG00000143324	HGNC:12827													
ZFYVE26	gene	ZFYVE26	Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Autosomal recessive spastic paraplegia 15, 270700				24367272;18394578		False	2	0;100;0	3.236	False		ENSG00000072121	ENSG00000072121	HGNC:20761													
ALPL	gene	ALPL	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal	Hypophosphatasia, adult, MIM# 146300;Osteomalacia;Parkinsonism				PMID: 32956941		False	1	50;0;50	3.236	True		ENSG00000162551	ENSG00000162551	HGNC:438													
AMPD2	gene	AMPD2	Expert Review Red;Other;Expert Review Red;Victorian Clinical Genetics Services;Expert Review Green;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 9, 615809						False	1	0;0;100	3.236	True		ENSG00000116337	ENSG00000116337	HGNC:469													
ANG	gene	ANG	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown	Parkinson disease MONDO:0005180				33875291;25386690		False	1	0;0;100	3.236	True		ENSG00000214274	ENSG00000214274	HGNC:483													
ARL6	gene	ARL6	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 3, 600151						False	1	50;0;50	3.236	True		ENSG00000113966	ENSG00000113966	HGNC:13210													
ARMC9	gene	ARMC9	Expert list;Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Joubert syndrome 30, MIM#617622						False	1	50;0;50	3.236	True		ENSG00000135931	ENSG00000135931	HGNC:20730													
ATP1A2	gene	ATP1A2	Royal Melbourne Hospital;Expert Review Red;Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Alternating hemiplegia of childhood 1, 104290;Familial hemiplegic migraine 2, 602481						False	1	0;0;100	3.236	False		ENSG00000018625	ENSG00000018625	HGNC:800													
ATP7B	gene	ATP7B	Royal Melbourne Hospital;Expert Review Red	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Wilson disease 277900;Wilson disease, 277900						False	1	0;0;100	3.236	False		ENSG00000123191	ENSG00000123191	HGNC:870													
ATXN10	gene	ATXN10	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar Ataxia 10;Parkinsonism;OMIM 603516				PMID: 28890930		False	1	100;0;0	3.236	True		ENSG00000130638	ENSG00000130638	HGNC:10549													
BBS10	gene	BBS10	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 10, 615987						False	1	50;0;50	3.236	True		ENSG00000179941	ENSG00000179941	HGNC:26291													
BBS12	gene	BBS12	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 12, 615989						False	1	100;0;0	3.236	True		ENSG00000181004	ENSG00000181004	HGNC:26648													
BBS2	gene	BBS2	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 2, 615981				15637713		False	1	50;0;50	3.236	True		ENSG00000125124	ENSG00000125124	HGNC:967													
BBS4	gene	BBS4	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 4, 615982						False	1	50;0;50	3.236	True		ENSG00000140463	ENSG00000140463	HGNC:969													
BBS5	gene	BBS5	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 5, 615983				15637713		False	1	50;0;50	3.236	True		ENSG00000163093	ENSG00000163093	HGNC:970													
BBS7	gene	BBS7	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 7, 615984						False	1	50;0;50	3.236	True		ENSG00000138686	ENSG00000138686	HGNC:18758													
BBS9	gene	BBS9	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 9, 615986						False	1	50;0;50	3.236	True		ENSG00000122507	ENSG00000122507	HGNC:30000													
BRD9	gene	BRD9	Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Early onset Parkinson Disease MONDO:0017279				40959972		False	1	0;0;100	3.236	False		ENSG00000028310	ENSG00000028310	HGNC:25818													
CACNA1B	gene	CACNA1B	Expert Review Red;Other;Other	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myoclonus-dystonia syndrome MONDO:0000903				25296916;26157024;35698023;33051750;35041927		False	1	0;0;100	3.236	True		ENSG00000148408	ENSG00000148408	HGNC:1389													
CACNA1S	gene	CACNA1S	Expert Review Red;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Hypokalemic periodic paralysis, type 1, MIM# 170400				11591859		False	1	0;0;100	3.236	True		ENSG00000081248	ENSG00000081248	HGNC:1397													
CACNB4	gene	CACNB4	Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert list;Expert Review Red;Expert Review Red;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Episodic ataxia type 5, 613855				10762541;27003325;9628818		False	1	0;50;50	3.236	False		ENSG00000182389	ENSG00000182389	HGNC:1404													
CCDC28B	gene	CCDC28B	Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Other	{Bardet-Biedl syndrome 1, modifier of}, 209900						False	1	0;33;67	3.236	True		ENSG00000160050	ENSG00000160050	HGNC:28163													
CHCHD10	gene	CHCHD10	Literature;Expert Review Red;Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532				24934289		False	1	0;0;100	3.236	False		ENSG00000250479	ENSG00000250479	HGNC:15559													
CHMP1A	gene	CHMP1A	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 8, 614961						False	1	50;0;50	3.236	True		ENSG00000131165	ENSG00000131165	HGNC:8740													
CHMP2B	gene	CHMP2B	Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	familial frontotemporal lobar degeneration (ALS17);Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Dystonia				20301378		False	1	0;0;100	3.236	True		ENSG00000083937	ENSG00000083937	HGNC:24537													
CYP2U1	gene	CYP2U1	Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 56, autosomal recessive, 615030						False	1	0;0;100	3.236	True		ENSG00000155016	ENSG00000155016	HGNC:20582													
DAB1	gene	DAB1	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Neurodevelopmental disorder, MONDO:0700092, DAB1-related				PMID: 33928188		False	1	33;33;33	3.236	True		ENSG00000173406	ENSG00000173406	HGNC:2661													
DCAF17	gene	DCAF17	Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	1	0;0;100	3.236	True		ENSG00000115827	ENSG00000115827	HGNC:25784													
DCTN1	gene	DCTN1	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Perry syndrome MIM#168605				24343258		False	1	0;0;100	3.236	True		ENSG00000204843	ENSG00000204843	HGNC:2711													
DNAJC13	gene	DNAJC13	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted					30788857;24218364;29309590;31082451;29887357;27270108		False	1	0;100;0	3.236	True		ENSG00000138246	ENSG00000138246	HGNC:30343													
EARS2	gene	EARS2	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Combined oxidative phosphorylation deficiency 12 MIM#614924				22492562		False	1	0;0;100	3.236	True		ENSG00000103356	ENSG00000103356	HGNC:29419													
EEF2	gene	EEF2	Victorian Clinical Genetics Services;GeneReviews;Royal Melbourne Hospital;Expert Review Red;Expert Review Red;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	?Spinocerebellar ataxia 26				15732118;23001565		False	1	0;0;0	3.236	False		ENSG00000167658	ENSG00000167658	HGNC:3214													
ELOVL1	gene	ELOVL1	Expert Review Red;Expert list;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, 618527						False	1	0;33;67	3.236	True		ENSG00000066322	ENSG00000066322	HGNC:14418													
EXOSC3	gene	EXOSC3	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 1B, 614678						False	1	100;0;0	3.236	True		ENSG00000107371	ENSG00000107371	HGNC:17944													
FUS	gene	FUS	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	"tremor, hereditary essential, 4	MONDO:0013888"				22863194;23834483;23825177;38626532		False	1	0;0;100	3.236	True		ENSG00000089280	ENSG00000089280	HGNC:4010													
GIGYF2	gene	GIGYF2	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	{Parkinson disease 11} , OMIM # 607688				18358451;33239198;25279164;20060621;19250854;26152800;19449032		False	1	0;50;50	3.236	True		ENSG00000204120	ENSG00000204120	HGNC:11960													
GPR88	gene	GPR88	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	chorea, childhood-onset, with psychomotor retardation MONDO:0014839				27123486		False	1	0;0;100	3.236	True		ENSG00000181656	ENSG00000181656	HGNC:4539													
HARS2	gene	HARS2	Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Perrault syndrome 2, MIM#	614926"				31827252		False	1	0;0;100	3.236	True		ENSG00000112855	ENSG00000112855	HGNC:4817													
HEXA	gene	HEXA	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	GM2 Gangliosidosis;Tay-Sachs disease;Parkinsonism;OMIM 272800				PMID: 33069254		False	1	50;0;50	3.236	True		ENSG00000213614	ENSG00000213614	HGNC:4878													
IFRD1	gene	IFRD1	Literature;Expert Review Red;Expert Review;Expert Review Red;Expert Review Red;Expert Review;Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Hereditary spastic paraplegia MONDO:0019064, IFRD1-related				29362493;28601596;19409521		False	1	0;0;100	3.236	False		ENSG00000006652	ENSG00000006652	HGNC:5456													
KCNJ15	gene	KCNJ15	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease, MONDO:0005180, KCNJ15-related				40566643		False	1	0;0;100	3.236	True		ENSG00000157551	ENSG00000157551	HGNC:6261													
MAT1A	gene	MAT1A	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Methionine adenosyltransferase deficiency, autosomal recessive MIM#250850				8770875		False	1	0;0;100	3.236	True		ENSG00000151224	ENSG00000151224	HGNC:6903													
MMADHC	gene	MMADHC	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Homocystinuria, cblD type, variant 1 MIM#277410				15292234;18385497		False	1	0;0;100	3.236	True		ENSG00000168288	ENSG00000168288	HGNC:25221													
MME	gene	MME	Victorian Clinical Genetics Services;Expert Review Red;GeneReviews;Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital;GeneReviews;Expert Review Red	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	?Spinocerebellar ataxia type 43, 617018				27583304		False	1	0;0;100	3.236	False		ENSG00000196549	ENSG00000196549	HGNC:7154													
MOGS	gene	MOGS	Expert Review Red;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Congenital disorder of glycosylation, type IIb, MIM# 606056				33058492		False	1	0;0;100	3.236	True		ENSG00000115275	ENSG00000115275	HGNC:24862													
MPV17	gene	MPV17	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) MIM#256810				29282788		False	1	0;0;100	3.236	True		ENSG00000115204	ENSG00000115204	HGNC:7224													
MT-ND6	gene	MT-ND6	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MITOCHONDRIAL	Leber Optic Atrophy;Parkinsonism;OMIM 516006				PMID: 33109474		False	1	50;0;50	3.236	True		ENSG00000198695	ENSG00000198695	HGNC:7462													
NEFM	gene	NEFM	Expert Review Red;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, MONDO:0000437				41913087		False	1	0;0;100	3.236	True		ENSG00000104722	ENSG00000104722	HGNC:7734													
NOL3	gene	NOL3	Royal Melbourne Hospital;Expert Review Red;Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Myoclonus, familial cortical				22926851		False	1	0;0;100	3.236	False		ENSG00000140939	ENSG00000140939	HGNC:7869													
OPA3	gene	OPA3	Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown							False	1	0;0;100	3.236	True		ENSG00000125741	ENSG00000125741	HGNC:8142													
PAX6	gene	PAX6	Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aniridia, 106210;Aniridia, Cerebellar Ataxia, And Mental Retardation						False	1	50;0;50	3.236	False		ENSG00000007372	ENSG00000007372	HGNC:8620													
PCDH12	gene	PCDH12	Expert Review Green;Expert Review Red;Royal Melbourne Hospital;GeneReviews;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	cerebellar ataxia, dystonia, retinopathy, and dysmorphism				30459466		False	1	50;0;50	3.236	True		ENSG00000113555	ENSG00000113555	HGNC:8657													
PCYT2	gene	PCYT2	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy				31637422		False	1	50;0;50	3.236	True		ENSG00000185813	ENSG00000185813	HGNC:8756													
PDGFRB	gene	PDGFRB	Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Basal ganglia calcification, idiopathic, 4, MIM# 615007				24518837		False	1	0;0;100	3.236	True		ENSG00000113721	ENSG00000113721	HGNC:8804													
PIK3R5	gene	PIK3R5	Expert Review Red;Expert Review Red;Literature;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Ataxia-oculomotor apraxia 3, OMIM #615217				PubMed: 22065524		False	1	0;0;100	3.236	True		ENSG00000141506	ENSG00000141506	HGNC:30035													
PLP1	gene	PLP1	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Pelizaeus-Merzbacher disease MIM#312080				30046645;19396823		False	1	0;0;100	3.236	True		ENSG00000123560	ENSG00000123560	HGNC:9086													
PODXL	gene	PODXL	Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	Unknown	juvenile-onset Parkinson disease				26864383;20706633		False	1	0;100;0	3.236	False		ENSG00000128567	ENSG00000128567	HGNC:9171													
PODXL	gene	PODXL	Expert list;Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	juvenile-onset Parkinson disease				26864383		False	1	0;0;100	3.236	False		ENSG00000128567	ENSG00000128567	HGNC:9171													
PRICKLE1	gene	PRICKLE1	Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Progressive myoclonic epilepsy 1B, 612437;Progressive Myoclonus Epilepsy with Ataxia				20301774		False	1	0;0;100	3.236	True		ENSG00000139174	ENSG00000139174	HGNC:17019													
PSEN2	gene	PSEN2	Expert Review Red;Other	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinsonism;Alzheimer disease-4 MIM#606889				22118943;26422362;18427071;29692703		False	1	0;0;100	3.236	True		ENSG00000143801	ENSG00000143801	HGNC:9509													
RARS2	gene	RARS2	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia, type 6, 611523;early onset cerebellar ataxia				31429931;17847012;25809939;20635367		False	1	0;0;100	3.236	True		ENSG00000146282	ENSG00000146282	HGNC:21406													
RELN	gene	RELN	Other;Expert Review Red;Expert Review Red;Other	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Myoclonus-dystonia syndrome MONDO:0000903				32334381;25648840		False	1	0;0;100	3.236	False		ENSG00000189056	ENSG00000189056	HGNC:9957													
RIC3	gene	RIC3	Expert Review Red;Other	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease				27055476;28153381;28606768;32794657		False	1	0;0;100	3.236	True		ENSG00000166405	ENSG00000166405	HGNC:30338													
RNASEH2A	gene	RNASEH2A	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Aicardi-Goutieres syndrome 4 MIM#610333				20131292		False	1	0;0;100	3.236	True		ENSG00000104889	ENSG00000104889	HGNC:18518													
SAR1B	gene	SAR1B	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Chylomicron retention disease, 246700						False	1	50;0;50	3.236	True		ENSG00000152700	ENSG00000152700	HGNC:10535													
SEPSECS	gene	SEPSECS	Victorian Clinical Genetics Services;Expert list;Expert Review Red;Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2D, 613811;cerebellar ataxia and cognitive impairment				29464431		False	1	0;0;100	3.236	False		ENSG00000109618	ENSG00000109618	HGNC:30605													
SLC20A2	gene	SLC20A2	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Basal ganglia calcification, idiopathic, 1, MIM# 213600;Paroxysmal kinesigenic dyskinesia				22327515;23334463;24411498		False	1	0;0;100	3.236	True		ENSG00000168575	ENSG00000168575	HGNC:10947													
SLC27A3	gene	SLC27A3	Expert Review Red;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Inherited neurodegenerative disorder, MONDO:0024237, SLC27A3-related				PMID: 41054338		False	1	0;0;100	3.236	True		ENSG00000143554	ENSG00000143554	HGNC:10997													
SYT14	gene	SYT14	Victorian Clinical Genetics Services;Expert Review Red;GeneReviews;Royal Melbourne Hospital;Expert Review Red;Expert Review Red;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Spinocerebellarataxia,autosomalrecessive11,614229				21835308		False	1	0;0;100	3.236	False		ENSG00000143469	ENSG00000143469	HGNC:23143													
TGM6	gene	TGM6	Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Red;Expert Review Red;Expert Review Red;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	Spinocerebellar ataxia 35, 613908;Spinocerebellar ataxia 35				25253745;21106500;28934387;22554020;30670339;29053796;23206699		False	1	0;0;100	3.236	False		ENSG00000166948	ENSG00000166948	HGNC:16255													
TMEM230	gene	TMEM230	Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Parkinson disease 21, MIM#616361				30804554;27270108;28115417;28017548;30804555;30804556;31323517		False	1	0;100;0	3.236	False		ENSG00000089063	ENSG00000089063	HGNC:15876													
TOR1AIP1	gene	TOR1AIP1	Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia, cerebellar atrophy, and cardiomyopathy				25425325		False	1	0;0;100	3.236	True		ENSG00000143337	ENSG00000143337	HGNC:29456													
TPR	gene	TPR	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Intellectual developmental disorder, autosomal recessive 79, MIM# 620393				34494102		False	1	0;0;100	3.236	True		ENSG00000047410	ENSG00000047410	HGNC:12017													
TRIM32	gene	TRIM32	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Muscular dystrophy, limb-girdle, autosomal recessive 8, 254110;?Bardet-Biedl syndrome 11, 615988						False	1	50;0;50	3.236	True		ENSG00000119401	ENSG00000119401	HGNC:16380													
TSEN2	gene	TSEN2	Expert Review Red;Expert list;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Pontocerebellar hypoplasia type 2B, 612389						False	1	0;0;100	3.236	True		ENSG00000154743	ENSG00000154743	HGNC:28422													
TSEN34	gene	TSEN34	Expert Review Red;Expert list;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Pontocerebellar hypoplasia type 2C, 612390						False	1	0;0;100	3.236	True		ENSG00000170892	ENSG00000170892	HGNC:15506													
TSEN54	gene	TSEN54	Expert list;Expert Review Red;Expert list;Expert list;Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	adult-onset cerebellar ataxia				24938831		False	1	0;0;100	3.236	False		ENSG00000182173	ENSG00000182173	HGNC:27561													
TTC8	gene	TTC8	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Bardet-Biedl syndrome 8, 615985						False	1	50;0;50	3.236	True		ENSG00000165533	ENSG00000165533	HGNC:20087													
TUBA1A	gene	TUBA1A	Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Lissencephaly 3, 611603				21403111		False	1	67;0;33	3.236	True		ENSG00000167552	ENSG00000167552	HGNC:20766													
TUBB2A	gene	TUBB2A	Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	?progressive spastic ataxia syndrome resembling sacsinopathy;Complex cortical dysplasia with other brain malformations 5, 615763				29547997;32203252		False	1	50;0;50	3.236	True		ENSG00000137267	ENSG00000137267	HGNC:12412													
TUBB4A	gene	TUBB4A	Expert Review Red;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted							False	1	0;0;100	3.236	True		ENSG00000104833	ENSG00000104833	HGNC:20774													
UBR4	gene	UBR4	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	early onset episodic ataxia;nystagmus;myokymia;tremor				23982692;29062094		False	1	0;0;100	3.236	True		ENSG00000127481	ENSG00000127481	HGNC:30313													
UNC80	gene	UNC80	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Hypotonia, infantile, with psychomotor retardation and characteristic facies 2, MIM# 616801;MONDO:0014777				26545877		False	1	0;0;100	3.236	True		ENSG00000144406	ENSG00000144406	HGNC:26582													
VPS11	gene	VPS11	Literature;Expert Review Red;Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Dystonia 32, MIM# 619637;Dystonia, adult-onset				33452836		False	1	0;0;100	3.236	False		ENSG00000160695	ENSG00000160695	HGNC:14583													
VPS37A	gene	VPS37A	Expert Review Red;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spastic paraplegia 53, autosomal recessive MIM#614898				22717650		False	1	0;0;100	3.236	True		ENSG00000155975	ENSG00000155975	HGNC:24928													
WASL	gene	WASL	Expert Review Red;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson's disease, MONDO:0005180, WASL-related				PMID: 33571872		False	1	50;0;50	3.236	True		ENSG00000106299	ENSG00000106299	HGNC:12735													
WDPCP	gene	WDPCP	Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	?Bardet-Biedl syndrome 15, 615992;?Congenital heart defects, hamartomas of tongue, and polysyndactyly, 217085						False	1	50;0;50	3.236	True		ENSG00000143951	ENSG00000143951	HGNC:28027													
ZNF423	gene	ZNF423	Expert Review Red;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Nephronophthisis 14						False	1	0;33;67	3.236	True		ENSG00000102935	ENSG00000102935	HGNC:16762													
ZNF592	gene	ZNF592	Expert Review Red;Royal Melbourne Hospital	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Spinocerebellar ataxia, autosomal recessive 5;Galloway-Mowat Syndrome 1, 251300				20531441;26123727		False	1	0;0;100	3.236	True		ENSG00000166716	ENSG00000166716	HGNC:28986													
ARX_EIEE1_GCN1	str	ARX	Expert Review Green;Expert Review	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510				11889467;33811808		False	3	100;0;0	3.236	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031767	25031814	25013650	25013697	GCN	16	23					
ARX_EIEE1_GCN2	str	ARX	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510				11889467;33811808		False	3	100;0;0	3.236	True		ENSG00000004848	ENSG00000004848	HGNC:18060	X	25031647	25031682	25013530	25013565	GCN	12	20					
ATN1_DRPLA_CAG	str	ATN1	Expert Review Green;Expert List	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370				29325606;20301664		False	3	100;0;0	3.236	True		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
ATN1_DRPLA_CAG	str	ATN1	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dentatorubral-pallidoluysian atrophy MIM#125370				8136840;8136826;29325606;20301664		False	3	100;0;0	3.236	False		ENSG00000111676	ENSG00000111676	HGNC:3033	12	7045892	7045936	6936729	6936773	CAG	35	48					
ATXN10_SCA10_ATTCT	str	ATXN10	Expert Review Green;Expert List	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 10 MIM#603516				20301354		False	3	100;0;0	3.236	True		ENSG00000130638	ENSG00000130638	HGNC:10549	22	46191235	46191304	45795355	45795424	ATTCT	32	800					
ATXN1_SCA1_CAG	str	ATXN1	Expert Review Green;Expert List	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 1 MIM#164400				29325606;20301363		False	3	100;0;0	3.236	True		ENSG00000124788	ENSG00000124788	HGNC:10548	6	16327918	16327953	16327687	16327722	CAG	35	39					
ATXN1_SCA1_CAG	str	ATXN1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar Ataxia type 1;Parkinsonism;OMIM 164400				" 	PMID: 24602359"		False	3	100;0;0	3.236	True		ENSG00000124788	ENSG00000124788	HGNC:10548	6	16327867	16327953	16327636	16327722	CAG	36	45					
ATXN2_SCA2_CAG	str	ATXN2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 2 MIM#183090				11761482;17923635;8896555;29325606;20301452		False	3	100;0;0	3.236	True		ENSG00000204842	ENSG00000204842	HGNC:10555	12	112036755	112036823	111598951	111599019	CAG	31	35					
ATXN2_SCA2_CAG	str	ATXN2	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia type 2 MONDO:0008458				40741828		False	3	100;0;0	3.236	True		ENSG00000204842	ENSG00000204842	HGNC:10555	12	112036755	112036823	111598951	111599019	CAG	31	35					
ATXN3_SCA3_CAG	str	ATXN3	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3				11176969;7574470;7874163;20301375;29325606		False	3	100;0;0	3.236	True		ENSG00000066427	ENSG00000066427	HGNC:7106	14	92537355	92537396	92071011	92071052	CAG	44	60					
ATXN3_SCA3_CAG	str	ATXN3	Expert Review Green;Expert List	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3				20301375;29325606		False	3	100;0;0	3.236	True		ENSG00000066427	ENSG00000066427	HGNC:7106	14	92537355	92537396	92071011	92071052	CAG	44	60					
ATXN7_SCA7_CAG	str	ATXN7	Expert Review Green;Expert List	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 7 MIM#164500				29325606;20301433		False	3	100;0;0	3.236	True		ENSG00000163635	ENSG00000163635	HGNC:10560	3	63898362	63898391	63912686	63912715	CAG	27	37					
ATXN8OS_SCA8_CTG	str	ATXN8OS	Expert Review Green;Expert List	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 8 MIM#608768				20301445		False	3	100;0;0	3.236	True		ENSG00000230223	ENSG00000230223	HGNC:10561	13	70713486	70713560	70139354	70139422	CTG	50	80					
ATXN8OS_SCA8_CTG	str	ATXN8OS	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 8 MIM#608768				24285970;20301445;10192387		False	3	100;0;0	3.236	True		ENSG00000230223	ENSG00000230223	HGNC:10561	13	70713486	70713560	70139354	70139428	CTG	50	80					
BEAN1_SCA31_TGGAA	str	BEAN1	Expert Review Green;Expert List	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 31 MIM#117210				19878914;31755042		False	3	100;0;0	3.236	True		ENSG00000166546	ENSG00000166546	HGNC:24160	16	66524300	66524369	66490397	66490466	TGGAA	22	80					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550				25577942;21944779;21944778;31779815		False	3	100;0;0	3.236	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
C9orf72_FTDALS_GGGGCC	str	C9orf72	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550				26166205;24363131;26187722;25577942;21944779;21944778		False	3	100;0;0	3.236	True		ENSG00000147894	ENSG00000147894	HGNC:28337	9	27573427	27573544	27573529	27573546	GGGGCC	25	60					
CACNA1A_SCA6_CAG	str	CACNA1A	Expert Review Green;Expert List	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500				20301319;29325606		False	3	100;0;0	3.236	True		ENSG00000141837	ENSG00000141837	HGNC:1388	19	13318673	13318691	13207859	13207897	CAG	18	20					
CSTB_EPM1_CCCCGCCCCGCG	str	CSTB	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800				29325606;20301321		False	3	100;0;0	3.236	False		ENSG00000160213	ENSG00000160213	HGNC:2482	21	45196325	45196360	43776444	43776479	CCCCGCCCCGCG	3	30					
DAB1_SCA37_ATTTC	str	DAB1	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 37 MIM#615945				28686858;31145571		False	3	100;0;0	3.236	False		ENSG00000173406	ENSG00000173406	HGNC:2661	1	57832716	57832797	57367044	57367121	ATTTC	0	31					
FGF14_SCA27B_GAA	str	FGF14	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs)				37165652;36516086;36493768		False	3	100;0;0	3.236	False		ENSG00000102466	ENSG00000102466	HGNC:3671	13	102813926	102814076	102161576	102161726	GAA	249	300					
FMR1_FXTAS_CGG	str	FMR1	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Fragile X tremor/ataxia syndrome MIM#300623				23765048;25227148		False	3	100;0;0	3.236	False		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	55					
FMR1_FXTAS_CGG	str	FMR1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males)	Fragile X tremor/ataxia syndrome MIM#300623				27340021;28176767;20301558;23765048;25227148;11445641		False	3	100;0;0	3.236	True		ENSG00000102081	ENSG00000102081	HGNC:3775	X	146993569	146993628	147912051	147912110	CGG	44	55					
FXN_FRDA_GAA	str	FXN	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Friedreich ataxia MIM#229300				20301458		False	3	100;0;0	3.236	False		ENSG00000165060	ENSG00000165060	HGNC:3951	9	71652203	71652220	69037287	69037304	GAA	33	66					
HTT_HD_CAG	str	HTT	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease MIM#143100				8458085;20301482;29325606		False	3	100;0;0	3.236	False		ENSG00000197386	ENSG00000197386	HGNC:4851	4	3076604	3076666	3074877	3074939	CAG	26	40					
HTT_HD_CAG	str	HTT	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease MIM#143100				20301482;29325606		False	3	100;0;0	3.236	False		ENSG00000197386	ENSG00000197386	HGNC:4851	4	3076604	3076666	3074877	3074939	CAG	26	40					
JPH3_HDL2_CTG	str	JPH3	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438				11558794;20301701		False	3	100;0;0	3.236	True		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
JPH3_HDL2_CTG	str	JPH3	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Huntington disease-like 2 MIM#606438				11558794;20301701		False	3	100;0;0	3.236	False		ENSG00000154118	ENSG00000154118	HGNC:14203	16	87637894	87637935	87604288	87604329	CTG	28	40					
NOP56_SCA36_GGCCTG	str	NOP56	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 36 MIM#614153				21683323		False	3	100;0;0	3.236	False		ENSG00000101361	ENSG00000101361	HGNC:15911	20	2633380	2633403	2652734	2652757	GGCCTG	14	650					
NOTCH2NLC_NIID_GGC	str	NOTCH2NLC	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866				31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668		False	3	100;0;0	3.236	True		-	ENSG00000286219	HGNC:53924	1	145209324	145209344	149390803	149390829	GGC	40	60					
PPP2R2B_SCA12_CAG	str	PPP2R2B	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 12 MIM#604326				31286011;27864267;33811808;10581021		False	3	100;0;0	3.236	True		ENSG00000156475	ENSG00000156475	HGNC:9305	5	146258292	146258321	146878729	146878758	CAG	32	51					
PPP2R2B_SCA12_CAG	str	PPP2R2B	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 12 MIM#604326				27864267;33811808		False	3	100;0;0	3.236	False		ENSG00000156475	ENSG00000156475	HGNC:9305	5	146258292	146258321	146878729	146878758	CAG	32	51					
PRNP_CJD_octapeptide	str	PRNP	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	3.236	True		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
PRNP_CJD_octapeptide	str	PRNP	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	3.236	False		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699424	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
PRNP_CJD_octapeptide	str	PRNP	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440				2159587;20301407		False	3	100;0;0	3.236	False		ENSG00000171867	ENSG00000171867	HGNC:9449	20	4680026	4680073	4699380	4699427	GGTGGTGGCTGGGGGCAGCCTCAT	4	5					
RFC1_CANVAS_ANNGN	str	RFC1	Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Parkinson disease MONDO:0005180				39833204;39152783;38789445;36705320;35013364		False	3	100;0;0	3.236	True		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	ANNGN	0	400					
RFC1_CANVAS_ANNGN	str	RFC1	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575				30926972		False	3	100;0;0	3.236	False		ENSG00000035928	ENSG00000035928	HGNC:9969	4	39350045	39350103	39348425	39348483	ANNGN	0	400					
TAF1_XDP_CCCTCT	str	TAF1	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	X-LINKED: hemizygous mutation in males, biallelic mutations in females	Dystonia-Parkinsonism, X-linked MIM#314250				17273961;29229810		False	3	100;0;0	3.236	False		ENSG00000147133	ENSG00000147133	HGNC:11535	X	70672905	70672979	71453055	71453129	CCCTCT	13	30					
TAF1_XDP_CCCTCT	str	TAF1	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Dystonia-Parkinsonism, X-linked MIM#314250				17273961;29229810		False	3	100;0;0	3.236	True		ENSG00000147133	ENSG00000147133	HGNC:11535	X	70672905	70672979	71453055	71453129	CCCTCT	13	30					
TBP_SCA17_CAG	str	TBP	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136				20301611;29325606		False	3	100;0;0	3.236	False		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
TBP_SCA17_CAG	str	TBP	Expert list;Expert Review Green;Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136				10484774;20301611;29325606		False	3	100;0;0	3.236	False		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
TBP_SCA17_CAG	str	TBP	Expert Review Green;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 17 MIM#607136				10484774;20301611;29325606;27172828;14638975;11313753;11914409		False	3	100;0;0	3.236	True		ENSG00000112592	ENSG00000112592	HGNC:11588	6	170870996	170871109	170561908	170562021	CAG	40	49					
ZFHX3_SCA4_GGC	str	ZFHX3	Literature;Expert Review Green;Expert Review Green;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	spinocerebellar ataxia type 4 MONDO:0010847				38035881;38197134		False	3	100;0;0	3.236	False		ENSG00000140836	ENSG00000140836	HGNC:777	16	72821594	72821657	72787695	72787758	GGC	30	48					
THAP11_SCA51_CAG	str	THAP11	Literature;Expert Review Amber;Expert Review Amber;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Spinocerebellar ataxia 51 MONDO:0975800				15368101;24677642;34165550;38113319;40459937;39651830;37148549		False	2	0;100;0	3.236	False		ENSG00000168286	ENSG00000168286	HGNC:23194	16	67876766	67876853	67842863	67842950	CAG	39	47					
ISCA-37404-Loss	region		Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown	"Angelman syndrome, MIM#	105830;Prader-Willi syndrome, MIM#	176270"				20301323;20301505		False	3	100;0;0	3.236	True					15			22782170	28134729				3		80	cnv_loss	Angelman and Prader-Willi syndromes
ISCA-37405-Loss	region	NPHP1	Expert Review Green;Expert list;Expert list	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	BIALLELIC, autosomal or pseudoautosomal	"Nephronophthisis 1, juvenile, MIM#	256100;Joubert syndrome 4, MIM#	609583;Senior-Loken syndrome 1, MIM#	266900"				29146700		False	3	100;0;0	3.236	True		ENSG00000144061	ENSG00000144061	HGNC:7905	2			110122329	110205017				3		80	cnv_loss	NPHP1 deletion
LMNB1 upstream region	region		Expert Review Green;Literature;Literature	Movement Disorders Superpanel		Neurology and neurodevelopmental disorders	MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted	Adult-onset autosomal dominant demyelinating leukodystrophy, MONDO:0008215				PMID: 30842973;30697589;25701871		False	3	100;0;0	3.236	False					5			126522203	126689287						80	cnv_loss	LMNB1 upstream region
