Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name AAAS gene AAAS Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Achalasia-addisonianism-alacrimia syndrome MIM#231550 False 3 100;0;0 3.208 True ENSG00000094914 ENSG00000094914 HGNC:13666 ABCB7 gene ABCB7 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Anaemia, sideroblastic, with ataxia, MIM# 301310 10196363;10196363;33157103;31772327;31511561;26242992 False 3 100;0;0 3.208 True ENSG00000131269 ENSG00000131269 HGNC:48 ABCD1 gene ABCD1 Expert Review Green;Royal Melbourne Hospital;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenoleukodystrophy MIM# 300100, XLR False 3 100;0;0 3.208 True ENSG00000101986 ENSG00000101986 HGNC:61 ABHD12 gene ABHD12 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract MIM#612674 False 3 100;0;0 3.208 True ENSG00000100997 ENSG00000100997 HGNC:15868 ACBD6 gene ACBD6 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 37951597 False 3 100;0;0 3.208 True ENSG00000230124 ENSG00000230124 HGNC:23339 ACBD6 gene ACBD6 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive movement abnormalities, MIM# 620785 37951597 False 3 100;0;0 3.208 True ENSG00000230124 ENSG00000230124 HGNC:23339 ACO2 gene ACO2 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile cerebellar-retinal degeneration, MIM#614559 False 3 100;0;0 3.208 True ENSG00000100412 ENSG00000100412 HGNC:118 ACTB gene ACTB Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Baraitser-Winter syndrome 1, 243310;Dystonia, juvenile-onset, 607371 29788902;28487785 False 3 100;0;0 3.208 True Other ENSG00000075624 ENSG00000075624 HGNC:132 ADAR gene ADAR Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dystonia;Aicardi-Goutieres syndrome 6, 615010 False 3 100;0;0 3.208 False ENSG00000160710 ENSG00000160710 HGNC:225 ADAR gene ADAR Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6;neuroinflammatory disorder with cerebral calcification;progressive loss of cognition;spasticity;dystonia;parkinsonism;OMIM 615010 PMID: 32911246 False 3 100;0;0 3.208 True ENSG00000160710 ENSG00000160710 HGNC:225 ADCY5 gene ADCY5 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651 22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617 False 3 100;0;0 3.208 True ENSG00000173175 ENSG00000173175 HGNC:236 ADCY5 gene ADCY5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651 22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617 False 3 100;0;0 3.208 False ENSG00000173175 ENSG00000173175 HGNC:236 ADCY5 gene ADCY5 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dyskinesia, familial, with facial myokymia, MIM# 606703;MONDO:0011707;Hyperkinetic movement disorder with dyskinesia, myoclonus, chorea, and dystonia-2 (HYDMCD2), MIM#619647;Neurodevelopmental disorder with hyperkinetic movements and dyskinesia (NEDHYD), MIM#619651 22782511;24700542;33051786;32647899;33704598;34631954;28971144;30975617 False 3 100;0;0 3.208 True ENSG00000173175 ENSG00000173175 HGNC:236 ADGRG1 gene ADGRG1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polymicrogyria, Frontoparietal, 606854;Polymicrogyria, perisylvian type, 615752 False 3 100;0;0 3.208 True ENSG00000205336 ENSG00000205336 HGNC:4512 ADPRHL2 gene ADPRHL2 Expert Review Green;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced with variable ataxia and seizures, 618170 30100084;30401461 False 3 100;0;0 3.208 True ENSG00000116863 ENSG00000116863 HGNC:21304 AFG3L2 gene AFG3L2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive MIM#614487;Spinocerebellar ataxia 28 MIM#610246 20725928 False 3 100;0;0 3.208 True ENSG00000141385 ENSG00000141385 HGNC:315 AGTPBP1 gene AGTPBP1 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650 30420557, 28600779, 30976113, 38153683, 28325758 False 3 100;0;0 3.208 True ENSG00000135049 ENSG00000135049 HGNC:17258 AHI1 gene AHI1 Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 3 25616960 False 3 100;0;0 3.208 True ENSG00000135541 ENSG00000135541 HGNC:21575 ALDH5A1 gene ALDH5A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 14635103 False 3 100;0;0 3.208 True ENSG00000112294 ENSG00000112294 HGNC:408 ALDH5A1 gene ALDH5A1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Succinic semialdehyde dehydrogenase deficiency, MIM# 271980 17438226;38499966 False 3 100;0;0 3.208 True ENSG00000112294 ENSG00000112294 HGNC:408 ANO10 gene ANO10 Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 10 MIM#613728 False 3 100;0;0 3.208 True ENSG00000160746 ENSG00000160746 HGNC:25519 ANO3 gene ANO3 Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 24, 615034;familial form of cranio-cervical dystonia 33388357 False 3 100;0;0 3.208 False ENSG00000134343 ENSG00000134343 HGNC:14004 AP1S2 gene AP1S2 Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Pettigrew syndrome, MIM# 304340 False 3 100;0;0 3.208 True ENSG00000182287 ENSG00000182287 HGNC:560 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminaemia MIM#208920 30986824;26256098;11586299 False 3 100;0;0 3.208 True ENSG00000137074 ENSG00000137074 HGNC:15984 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-oculomotor apraxia type 1;Dystonia 15876520 False 3 100;0;0 3.208 True ENSG00000137074 ENSG00000137074 HGNC:15984 ARL13B gene ARL13B Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 8, MIM# 612291" False 3 100;0;0 3.208 True ENSG00000169379 ENSG00000169379 HGNC:25419 ARSA gene ARSA Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM#250100 False 3 100;0;0 3.208 True ENSG00000100299 ENSG00000100299 HGNC:713 ARSA gene ARSA Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic Leukodystrophy, 250100;Metachromatic leukodystrophy (#250100) False 3 100;0;0 3.208 True ENSG00000100299 ENSG00000100299 HGNC:713 ARX gene ARX Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Partington syndrome, MIM# 309510;Dystonia 11889467;15200506 False 3 100;0;0 3.208 True Other ENSG00000004848 ENSG00000004848 HGNC:18060 ATAD1 gene ATAD1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperekplexia 4, MIM#618011 28180185;29390050;29659736 False 3 100;0;0 3.208 True ENSG00000138138 ENSG00000138138 HGNC:25903 ATCAY gene ATCAY Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, cerebellar, Cayman type, MIM# 601238;MONDO:0011025 14556008;29449188;23226316;26343454 False 3 50;50;0 3.208 True ENSG00000167654 ENSG00000167654 HGNC:779 ATG7 gene ATG7 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, SCAR31, MIM#619422 34161705 False 3 100;0;0 3.208 True ENSG00000197548 ENSG00000197548 HGNC:16935 ATM gene ATM Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia telangiectasia;Dystonia False 3 100;0;0 3.208 False ENSG00000149311 ENSG00000149311 HGNC:795 ATM gene ATM Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia MIM#208900 False 3 100;0;0 3.208 True ENSG00000149311 ENSG00000149311 HGNC:795 ATP13A2 gene ATP13A2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 21094623;20853184;20310007 False 3 100;0;0 3.208 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal parkinsonism due to ATP13A2 deficiency MONDO:0017809 25900096;20301402 False 3 100;0;0 3.208 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP13A2 gene ATP13A2 Expert Review Green;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kufor-Rakeb syndrome MIM#606693 21362476;21696388;31588715;32559632;33033738;33091395;34405108 False 3 100;0;0 3.208 True ENSG00000159363 ENSG00000159363 HGNC:30213 ATP1A2 gene ATP1A2 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alternating hemiplegia of childhood 1, MIM# 104290 15174025;15286158;33126486;31766058;24097848 False 3 100;0;0 3.208 True ENSG00000018625 ENSG00000018625 HGNC:800 ATP1A2 gene ATP1A2 Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 3.208 False ENSG00000018625 ENSG00000018625 HGNC:800 ATP1A3 gene ATP1A3 Expert Review Green;Expert list;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 15260953;17282997;19351654, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 3.208 False ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder MONDO:0700002 20301294;17282997;15260953;17595045;17516473;22534615 False 3 100;0;0 3.208 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 3.208 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert list;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 100;0;0 3.208 True ENSG00000105409 ENSG00000105409 HGNC:801 ATP1A3 gene ATP1A3 Expert list;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ATP1A3-associated neurological disorder, MONDO:0700002 15260953, 22842232, 24468074, 33762331, 29861155, 31425744 False 3 0;0;0 3.208 False ENSG00000105409 ENSG00000105409 HGNC:801 ATP2B2 gene ATP2B2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related PMID: 37675773 False 3 100;0;0 3.208 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157087 ENSG00000157087 HGNC:815 ATP2B2 gene ATP2B2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental Disorder, MONDO:0700092, ATP2B2-related PMID: 37675773 False 3 100;0;0 3.208 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000157087 ENSG00000157087 HGNC:815 ATP2B3 gene ATP2B3 Expert Review Green;Expert list;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Spinocerebellar ataxia, X-linked 1 37821930;36207321;31680123;28807751;28720891;27653636;25953895 False 3 50;50;0 3.208 True ENSG00000067842 ENSG00000067842 HGNC:816 ATP5A1 gene ATP5A1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mitochondrial complex V (ATP synthase) deficiency, nuclear type 4A (MIM#620358), AD 34483339;34954817;40859057 False 3 100;0;0 3.208 True ENSG00000152234 ENSG00000152234 HGNC:823 ATP5G3 gene ATP5G3 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Dystonia, early-onset, and/or spastic paraplegia, MIM# 619681" 34636445;34954817 False 3 100;0;0 3.208 True ENSG00000154518 ENSG00000154518 HGNC:843 ATP6AP2 gene ATP6AP2 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Parkinsonism with spasticity, X-linked, MIM# 300911" 30985297;23595882 False 3 100;0;0 3.208 True ENSG00000182220 ENSG00000182220 HGNC:18305 ATP6V0A1 gene ATP6V0A1 Expert Review Green;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 104 MIM#619970;Neurodevelopmental disorder with epilepsy and brain atrophy MIM#619971 PMID:34909687 False 3 50;50;0 3.208 True ENSG00000033627 ENSG00000033627 HGNC:865 ATP7B gene ATP7B Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease MIM#277900 17435591 False 3 50;50;0 3.208 True ENSG00000123191 ENSG00000123191 HGNC:870 ATP7B gene ATP7B Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease, MIM# 277900;Dystonia 32662046 False 3 100;0;0 3.208 True ENSG00000123191 ENSG00000123191 HGNC:870 ATP7B gene ATP7B Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease, MIM# 277900 False 3 100;0;0 3.208 True ENSG00000123191 ENSG00000123191 HGNC:870 ATP8A2 gene ATP8A2 Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 4, MIM#615268 22892528;31612321 False 3 100;0;0 3.208 True ENSG00000132932 ENSG00000132932 HGNC:13533 AUH gene AUH Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-Methylglutaconic aciduria type 1;Dystonia False 3 100;0;0 3.208 True ENSG00000148090 ENSG00000148090 HGNC:890 BBS1 gene BBS1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 1, 209900 15637713 False 3 100;0;0 3.208 True ENSG00000174483 ENSG00000174483 HGNC:966 BCAP31 gene BCAP31 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Deafness, dystonia and cerebellar hypomyelination, MIM#300475 24011989;28332767;30713915;31330203;32652807 False 3 100;0;0 3.208 True ENSG00000185825 ENSG00000185825 HGNC:16695 BCKDHB gene BCKDHB Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Episodic ataxia during metabolic crises;paroxysmal nonkinesigenic dyskinesia PMID 32151765 False 3 0;0;0 3.208 True ENSG00000083123 ENSG00000083123 HGNC:987 BRAT1 gene BRAT1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and with or without seizures, MIM#618056 26483087;26494257;27282546 False 3 100;0;0 3.208 True ENSG00000106009 ENSG00000106009 HGNC:21701 C19orf12 gene C19orf12 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodegeneration with brain iron accumulation 4 MONDO:0013674 21981780;23278385;23447832 False 3 100;0;0 3.208 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal neurodegeneration with brain iron accumulation 4 MONDO:0013674 21981780;22508347 False 3 100;0;0 3.208 True ENSG00000131943 ENSG00000131943 HGNC:25443 C5orf42 gene C5orf42 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 17, MIM# 614615" False 3 100;0;0 3.208 True ENSG00000197603 ENSG00000197603 HGNC:25801 C9orf3 gene C9orf3 Literature;Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Dystonia 31, MIM# 619565" 34596301 False 3 100;0;0 3.208 False ENSG00000148120 ENSG00000148120 HGNC:1361 C9orf3 gene C9orf3 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 31, MIM# 619565;Childhood/Adolescence onset generalised dystonia;Dystonia parkinsonism;Zech-Boesch Syndrome PMID: 35306330 False 3 100;0;0 3.208 True ENSG00000148120 ENSG00000148120 HGNC:1361 CA8 gene CA8 Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3;Cerebellar ataxia and mental retardation with or without quadrupedal locomotion 3, 613227 21937992;19461874 False 3 100;0;0 3.208 True ENSG00000178538 ENSG00000178538 HGNC:1382 CACNA1A gene CACNA1A Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 3.208 False ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1A gene CACNA1A Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500;Spinocerebellar ataxia 6 MIM#183086 25468264;23441182;19232643;18758887;11344116 False 3 100;0;0 3.208 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1A gene CACNA1A Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500 False 3 100;0;0 3.208 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1A gene CACNA1A Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 2 MIM#108500 False 3 50;50;0 3.208 True ENSG00000141837 ENSG00000141837 HGNC:1388 CACNA1G gene CACNA1G Expert Review Green;Expert list;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits MIM#618087 False 3 100;0;0 3.208 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA1G gene CACNA1G Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 42, early-onset, severe, with neurodevelopmental deficits, MIM# 618087" 29878067 False 3 100;0;0 3.208 True ENSG00000006283 ENSG00000006283 HGNC:1394 CACNA1S gene CACNA1S Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypokalemic periodic paralysis, type 1, MIM# 170400 11591859 False 3 100;0;0 3.208 True ENSG00000081248 ENSG00000081248 HGNC:1397 CACNA2D2 gene CACNA2D2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar atrophy with seizures and variable developmental delay MIM#618501 23339110;24358150;30410802;29997391;31402629 False 3 100;0;0 3.208 True ENSG00000007402 ENSG00000007402 HGNC:1400 CAD gene CAD Expert Review Green;Literature;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epileptic encephalopathy, early infantile, 50;OMIM # 616457 PMID: 32820246 False 3 100;0;0 3.208 True ENSG00000084774 ENSG00000084774 HGNC:1424 CAMK4 gene CAMK4 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;Autism;Behavioral abnormality;Abnormality of movement;Dystonia;Ataxia;Chorea;Myoclonus 30262571;33098801;33211350 False 3 100;0;0 3.208 True ENSG00000152495 ENSG00000152495 HGNC:1464 CAMTA1 gene CAMTA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellarataxia, nonprogressive, with mental retardation, 614756;Cerebellar ataxia with mental retardation, 614756 32157189;22693284 False 3 100;0;0 3.208 True ENSG00000171735 ENSG00000171735 HGNC:18806 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy 39878554 False 3 100;0;0 3.208 True ENSG00000135387 ENSG00000135387 HGNC:6743 CASK gene CASK Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) FG syndrome 4, 300422;Intellectual developmental disorder and microcephaly with pontine and cerebellar hypoplasia MIM#300749 False 3 100;0;0 3.208 True ENSG00000147044 ENSG00000147044 HGNC:1497 CASR gene CASR Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Hypocalciuric hypercalcemia, type I, MIM# 145980;Hypocalciuric Hypercalcemic;Hyperparathyroidism;paroxysmal dyskinesia;brain calcification" 34913197 False 3 100;0;0 3.208 True ENSG00000036828 ENSG00000036828 HGNC:1514 CBY1 gene CBY1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal intellectual disability;cerebellar ataxia;molar tooth sign;polydactyly;Joubert syndrome 33131181;25103236;25220153 False 3 100;0;0 3.208 True ENSG00000100211 ENSG00000100211 HGNC:1307 CC2D2A gene CC2D2A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 9, MIM#612285 18387594;18950740;18513680;18950740;19574260;21725307;33486889;30267408 False 3 100;0;0 3.208 True ENSG00000048342 ENSG00000048342 HGNC:29253 CD99L2 gene CD99L2 Expert Review Green;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodevelopmental disorder, MONDO:0700092;CD99L2-related 41690933 False 3 100;0;0 3.208 True ENSG00000102181 ENSG00000102181 HGNC:18237 CEP290 gene CEP290 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 5, MIM# 610188 18327255;20690115;16682973;16682970;17564967;16909394;17564974 False 3 100;0;0 3.208 True ENSG00000198707 ENSG00000198707 HGNC:29021 CEP41 gene CEP41 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 15, MIM# 614464 22246503 False 3 100;0;0 3.208 True ENSG00000106477 ENSG00000106477 HGNC:12370 CHCHD2 gene CHCHD2 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 22, autosomal dominant MIM#616710 32068847;25662902;31600778;26705026 False 3 100;0;0 3.208 False ENSG00000106153 ENSG00000106153 HGNC:21645 CLCN1 gene CLCN1 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Myotonia congenita, dominant, MIM# 160800;Myotonia congenita, recessive, MIM# 255700" False 3 100;0;0 3.208 True ENSG00000188037 ENSG00000188037 HGNC:2019 CLCN2 gene CLCN2 Expert Review Green;Victorian Clinical Genetics Services;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with ataxia, MIM# 615651 29403011;29403012;23707145 False 3 100;0;0 3.208 True ENSG00000114859 ENSG00000114859 HGNC:2020 CLDN5 gene CLDN5 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Syndromic disorder, MONDO:0002254, CLDN5-related;familial migraine;alternating hemiplegia;hemiplegic migraine;brain calcification;acquired microcephaly;epilepsy 35714222;36825455 False 3 100;0;0 3.208 True ENSG00000184113 ENSG00000184113 HGNC:2047 CLN3 gene CLN3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 3 MIM#204200 19489875;11342698 False 3 100;0;0 3.208 True ENSG00000188603 ENSG00000188603 HGNC:2074 CLN3 gene CLN3 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ceroid lipofuscinosis, neuronal, 3 204200" 19353721 False 3 100;0;0 3.208 True ENSG00000188603 ENSG00000188603 HGNC:2074 CLN5 gene CLN5 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis neuronal 5, MIM# 256731 False 3 100;0;0 3.208 True ENSG00000102805 ENSG00000102805 HGNC:2076 CLN6 gene CLN6 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 6, MIM# 601780;Ceroid lipofuscinosis, neuronal, Kufs type, adult onset, MIM# 204300 11791207;11727201;21549341;30561534 False 3 100;0;0 3.208 True ENSG00000128973 ENSG00000128973 HGNC:2077 CLPP gene CLPP Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 3, MIM# 614129 25254289 False 3 100;0;0 3.208 True ENSG00000125656 ENSG00000125656 HGNC:2084 COA7 gene COA7 Expert Review Green;Expert list;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3 MIM#618387 False 3 100;0;0 3.208 True ENSG00000162377 ENSG00000162377 HGNC:25716 COASY gene COASY Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal neurodegeneration with brain iron accumulation 6, MONDO:0014290;Neurodegeneration with brain iron accumulation 6 615643 23447832;24360804;27021474 False 3 100;0;0 3.208 True ENSG00000068120 ENSG00000068120 HGNC:29932 COQ4 gene COQ4 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 7, MIM# 616276;Childhood-onset ataxia 30225196;33704555;30847826 False 3 100;0;0 3.208 True ENSG00000167113 ENSG00000167113 HGNC:19693 COQ5 gene COQ5 Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 9 MIM#619028 29044765;37599337;21937992;41199775;36266294 False 3 33;0;67 3.208 True ENSG00000110871 ENSG00000110871 HGNC:28722 COQ8A gene COQ8A Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Coenzyme Q10 deficiency, primary, 4, MIM# 612016" 32337771 False 3 100;0;0 3.208 True ENSG00000163050 ENSG00000163050 HGNC:16812 COQ8A gene COQ8A Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 32337771 False 3 100;0;0 3.208 True ENSG00000163050 ENSG00000163050 HGNC:16812 COX20 gene COX20 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, 220110;Mitochondrial complex IV deficiency False 3 100;0;0 3.208 False ENSG00000203667 ENSG00000203667 HGNC:26970 CP gene CP Victorian Clinical Genetics Services;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminemia, 604290;Cerebellar ataxia, 604290;Hemosiderosis, systemic, due to aceruloplasminemia, 604290 20301666 False 3 100;0;0 3.208 False ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminaemia, MIM#604290 False 3 100;0;0 3.208 True ENSG00000047457 ENSG00000047457 HGNC:2295 CP gene CP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aceruloplasminaemia, MIM#604290 False 3 100;0;0 3.208 True ENSG00000047457 ENSG00000047457 HGNC:2295 CSF1R gene CSF1R Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted leukoencephalopathy, diffuse hereditary, with spheroids 1 MONDO:0800027 25935893;22934315;22934315 False 3 100;0;0 3.208 True ENSG00000182578 ENSG00000182578 HGNC:2433 CSF1R gene CSF1R Literature;Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukoencephalopathy, diffuse hereditary, with spheroids MIM#221820;ataxia 24198292;25563800;25935893 False 3 100;0;0 3.208 False ENSG00000182578 ENSG00000182578 HGNC:2433 CSNK2B gene CSNK2B Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Poirier-Bienvenu neurodevelopmental syndrome , MIM#618732 PMID: 34041744 False 3 100;0;0 3.208 True ENSG00000204435 ENSG00000204435 HGNC:2460 CSTB gene CSTB Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg), MIM#254800 9012407;9054946 False 3 50;50;0 3.208 True ENSG00000160213 ENSG00000160213 HGNC:2482 CTBP1 gene CTBP1 Expert Review Green;Expert list;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome, MIM#617915 27094857;28955726;31041561 False 3 100;0;0 3.208 True ENSG00000159692 ENSG00000159692 HGNC:2494 CWF19L1 gene CWF19L1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 17, 616127;Autosomal recessive spinocerebellar ataxia type 17, 616127 False 3 100;0;0 3.208 False ENSG00000095485 ENSG00000095485 HGNC:25613 CYP27A1 gene CYP27A1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebrotendinous xanthomatosis, MIM# 213700;Cerebrotendinous xanthomatosis, infantile-onset diarrhoea, juvenile-onset cataract, young adult-onset tendon xanthomas;Epilepsy;Parkinsonism;Ataxia;Peripheral neuropathy" PMID: 30054180 False 3 100;0;0 3.208 True ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 NHS GMS;Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700 False 3 100;0;0 3.208 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, MIM# 213700;Cholestanol storage disease;Dystonia 19373932;21531161;25424010 False 3 100;0;0 3.208 True ENSG00000135929 ENSG00000135929 HGNC:2605 DAGLA gene DAGLA Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuroocular syndrome 2, paroxysmal type, MIM# 168885 35737950 False 3 100;0;0 3.208 True ENSG00000134780 ENSG00000134780 HGNC:1165 DAGLB gene DAGLB Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease, MONDO:0005180, DALGB-related 35715418;40244389 False 3 100;0;0 3.208 True ENSG00000164535 ENSG00000164535 HGNC:28923 DARS2 gene DARS2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation;Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation, 611105 False 3 100;0;0 3.208 False ENSG00000117593 ENSG00000117593 HGNC:25538 DCAF17 gene DCAF17 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Woodhouse-Sakati syndrome MONDO:0009419;Dystonia 18175354;36185913;17167799 False 3 100;0;0 3.208 True ENSG00000115827 ENSG00000115827 HGNC:25784 DCTN1 gene DCTN1 Expert list;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MONDO:0008201 20945553, 19136952, 24343258 False 3 100;0;0 3.208 True ENSG00000204843 ENSG00000204843 HGNC:2711 DDC gene DDC Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aromatic L-amino acid decarboxylase deficiency, 608643;Dystonia 20505134 False 3 100;0;0 3.208 True ENSG00000132437 ENSG00000132437 HGNC:2719 DDHD2 gene DDHD2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive paraplegia 54 (#615033). Complex form of disease ataxia reported amongst the phenotypic features in Citterio et al. (2014), Journal of Neurology, 261, pp.373-381 and Doi et al. (2014), Scientific Reports, 4, 7132.;Spastic paraplegia 54 False 3 100;0;0 3.208 False ENSG00000085788 ENSG00000085788 HGNC:29106 DHDDS gene DHDDS Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay and seizures with or without movement abnormalities, OMIM:617836 29100083;33798445;34182312;34382076 False 3 100;0;0 3.208 True ENSG00000117682 ENSG00000117682 HGNC:20603 DLAT gene DLAT Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase E2 deficiency, MIM# 245348;Episodic dystonia (Exercise induced or without clear trigger) 20022530;29093066 False 3 100;0;0 3.208 True ENSG00000150768 ENSG00000150768 HGNC:2896 DLAT gene DLAT Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pyruvate dehydrogenase E2 deficiency 245348;Dystonia 39007626;20022530;16049940 False 3 100;0;0 3.208 True ENSG00000150768 ENSG00000150768 HGNC:2896 DNAJC12 gene DNAJC12 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, mild, non-BH4-deficient, MIM#617384 False 3 100;0;0 3.208 True ENSG00000108176 ENSG00000108176 HGNC:28908 DNAJC12 gene DNAJC12 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, mild, non-BH4-deficient, 617384 False 3 100;0;0 3.208 True ENSG00000108176 ENSG00000108176 HGNC:28908 DNAJC19 gene DNAJC19 Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type V 610198;dilated cardiomyopathy with ataxia (DCMA) syndrome;3-methylglutaconic aciduria type V, 610198 False 3 100;0;0 3.208 False ENSG00000205981 ENSG00000205981 HGNC:30528 DNAJC3 gene DNAJC3 Expert Review Green;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile-onset diabetes mellitus-central and peripheral neurodegeneration syndrome, MONDO:0014523 34654017;34630333;33486469;32738013;28940199 False 3 100;0;0 3.208 True ENSG00000102580 ENSG00000102580 HGNC:9439 DNAJC5 gene DNAJC5 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 False 3 100;0;0 3.208 False ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC5 gene DNAJC5 Expert list;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ceroid lipofuscinosis, neuronal, 4 (Kufs type), MONDO:0008083 22978711;21820099;22235333 False 3 100;0;0 3.208 True ENSG00000101152 ENSG00000101152 HGNC:16235 DNAJC6 gene DNAJC6 Expert list;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 19a, juvenile-onset - MIM#615528;Parkinson disease 19b, early-onset - MIM#615528 22563501, 23211418, 26528954, 33983693 False 3 100;0;0 3.208 True ENSG00000116675 ENSG00000116675 HGNC:15469 DNMT1 gene DNMT1 Expert Review Green;ClinGen;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 False 3 100;0;0 3.208 False ENSG00000130816 ENSG00000130816 HGNC:2976 DOCK3 gene DOCK3 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with impaired intellectual development, hypotonia, and ataxia, MIM#618292 False 3 100;0;0 3.208 True ENSG00000088538 ENSG00000088538 HGNC:2989 DRD2 gene DRD2 Expert Review Green;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Combined dystonia, MONDO:0020065, DRD2-related;dystonia;chorea;anxiety;ataxia;orofacial dyskinesia;tremor;memory problems 33200438 False 3 100;0;0 3.208 True Other ENSG00000149295 ENSG00000149295 HGNC:3023 EBF3 gene EBF3 Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypotonia, ataxia and delayed development syndrome, 617330 False 3 100;0;0 3.208 False ENSG00000108001 ENSG00000108001 HGNC:19087 ECHS1 gene ECHS1 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277" 32677093;32858208 False 3 100;0;0 3.208 True ENSG00000127884 ENSG00000127884 HGNC:3151 ECHS1 gene ECHS1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial short-chain enoyl-CoA hydratase 1 deficiency, MIM# 616277;paroxysmal dyskinesia (isolated or with other features of a mitochondrial disease) 27090768;28039521 False 3 100;0;0 3.208 True ENSG00000127884 ENSG00000127884 HGNC:3151 EEFSEC gene EEFSEC Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain abnormalities, MIM#621102 39753114 False 3 100;0;0 3.208 True ENSG00000132394 ENSG00000132394 HGNC:24614 EIF2AK2 gene EIF2AK2 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual disability;white matter abnormalities;ataxia;regression with febrile illness;early onset dystonia 33236446;33866603 False 3 100;0;0 3.208 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2AK2 gene EIF2AK2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukoencephalopathy, developmental delay, and episodic neurologic regression syndrome, MIM# 618877;Neurodevelopmental Syndrome;Developmental delays;Ataxia;Parkinsonism;White matter alterations PMID: 32197074 False 3 100;0;0 3.208 True ENSG00000055332 ENSG00000055332 HGNC:9437 EIF2B1 gene EIF2B1 Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.208 True ENSG00000111361 ENSG00000111361 HGNC:3257 EIF2B2 gene EIF2B2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.208 True ENSG00000119718 ENSG00000119718 HGNC:3258 EIF2B3 gene EIF2B3 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.208 True ENSG00000070785 ENSG00000070785 HGNC:3259 EIF2B4 gene EIF2B4 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.208 True ENSG00000115211 ENSG00000115211 HGNC:3260 EIF2B5 gene EIF2B5 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy with vanishing white matter MIM#603896 False 3 100;0;0 3.208 True ENSG00000145191 ENSG00000145191 HGNC:3261 EIF4A2 gene EIF4A2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia and speech delay, with or without seizures, MIM# 620455 37485550 False 3 100;0;0 3.208 True ENSG00000156976 ENSG00000156976 HGNC:3284 ELFN1 gene ELFN1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dursun-Ozgul neurodevelopmental syndrome, MIM# 621344 PMID:40576023 False 3 100;0;0 3.208 True ENSG00000225968 ENSG00000225968 HGNC:33154 ELOVL4 gene ELOVL4 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 34 133190;Spinocerebellar ataxia 34, 133190 False 3 100;0;0 3.208 False ENSG00000118402 ENSG00000118402 HGNC:14415 ELOVL5 gene ELOVL5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 38, MIM#615957 25065913 False 3 100;0;0 3.208 False ENSG00000012660 ENSG00000012660 HGNC:21308 EPG5 gene EPG5 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with parkinsonism or other movement abnormalities, MIM# 621506 41053928;36410285;40192014 False 3 100;0;0 3.208 True ENSG00000152223 ENSG00000152223 HGNC:29331 EPM2A gene EPM2A Expert Review Green;Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2A, Lafora, 254780;Epilepsy, progressive myoclonic 2A (Lafora) 254780 False 3 100;0;0 3.208 False ENSG00000112425 ENSG00000112425 HGNC:3413 ERCC4 gene ERCC4 Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebellar ataxia;Xeroderma pigmentosum, group F, MIM# 278760" 29403087;28431612;29892709 False 3 100;0;0 3.208 False ENSG00000175595 ENSG00000175595 HGNC:3436 ESRRG gene ESRRG Expert Review Green;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Movement disorder, MONDO:0005395, ESRRG-related 41265451 False 3 100;0;0 3.208 True ENSG00000196482 ENSG00000196482 HGNC:3474 EXOSC5 gene EXOSC5 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, brain abnormalities, and cardiac conduction defects, MIM# 619576;Short stature;Motor developmental delays;Cerebellar hypoplasia;Ataxia 32504085;29302074 False 3 100;0;0 3.208 True ENSG00000077348 ENSG00000077348 HGNC:24662 FA2H gene FA2H Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 35, autosomal recessive MIM#612319" 31135052 False 3 100;0;0 3.208 True ENSG00000103089 ENSG00000103089 HGNC:21197 FA2H gene FA2H Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia;Spastic paraplegia 35, autosomal recessive 612319;fatty acid hydroxylase-associated neurodegeneration 19068277;20104589;20853438;31135052 False 3 100;0;0 3.208 True ENSG00000103089 ENSG00000103089 HGNC:21197 FAT2 gene FAT2 GeneReviews;Royal Melbourne Hospital;Expert list;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 45, MIM#617769 29053796;33884300 False 3 50;50;0 3.208 False ENSG00000086570 ENSG00000086570 HGNC:3596 FBXL4 gene FBXL4 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type), MIM# 615471 28383868 False 3 100;0;0 3.208 True ENSG00000112234 ENSG00000112234 HGNC:13601 FBXO28 gene FBXO28 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 100, MIM# 619777 33280099 False 3 100;0;0 3.208 True ENSG00000143756 ENSG00000143756 HGNC:29046 FBXO7 gene FBXO7 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal parkinsonian-pyramidal syndrome MONDO:0009830 20301402 False 3 100;0;0 3.208 True ENSG00000100225 ENSG00000100225 HGNC:13586 FBXO7 gene FBXO7 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile parkinsonism;Dystonia False 3 0;0;0 3.208 False ENSG00000100225 ENSG00000100225 HGNC:13586 FDXR gene FDXR Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with mitochondrial abnormalities, optic atrophy, and developmental regression, MIM# 620887 30250212;28965846;29040572;33348459;37046037;37481223 False 3 100;0;0 3.208 True ENSG00000161513 ENSG00000161513 HGNC:3642 FGF14 gene FGF14 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 27 MIM#609307 False 3 100;0;0 3.208 True ENSG00000102466 ENSG00000102466 HGNC:3671 FITM2 gene FITM2 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Siddiqi syndrome MIM#618635;dystonia;deafness 28067622;30214770;30288795 False 3 100;0;0 3.208 True ENSG00000197296 ENSG00000197296 HGNC:16135 FLVCR1 gene FLVCR1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, posterior column, with retinitis pigmentosa MIM#609033 False 3 100;0;0 3.208 True ENSG00000162769 ENSG00000162769 HGNC:24682 FOLR1 gene FOLR1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration due to cerebral folate transport deficiency, 613068;Neurodegeneration due to cerebral folate transport deficiency False 3 100;0;0 3.208 False ENSG00000110195 ENSG00000110195 HGNC:3791 FOXG1 gene FOXG1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Rett syndrome, congenital variant;Dystonia 27029630 False 3 100;0;0 3.208 True ENSG00000176165 ENSG00000176165 HGNC:3811 FOXG1 gene FOXG1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Rett syndrome, congenital variant, MIM# 613454;Developmental and Epileptic Encephalopathy;Dystonia,;Athetosis;Parkinsonism;Stereotypies" PMID: 21953941 False 3 100;0;0 3.208 True ENSG00000176165 ENSG00000176165 HGNC:3811 FRMD5 gene FRMD5 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with eye movement abnormalities and ataxia, MIM# 620094 36206744 False 3 100;0;0 3.208 True ENSG00000171877 ENSG00000171877 HGNC:28214 FRRS1L gene FRRS1L Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 37, MIM# 616981;Seizures;Chorea;Parkinsonism;Developmental delay PMID: 29086067 False 3 100;0;0 3.208 True ENSG00000260230 ENSG00000260230 HGNC:1362 FTL gene FTL Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 23447832;20301320 False 3 100;0;0 3.208 False ENSG00000087086 ENSG00000087086 HGNC:3999 FTL gene FTL Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodegeneration with brain iron accumulation 3, MIM# 606159 11438811;15099026;12746423;18413574 False 3 100;0;0 3.208 True ENSG00000087086 ENSG00000087086 HGNC:3999 FUCA1 gene FUCA1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fucosidosis, MIM#230000 31064022 False 3 100;0;0 3.208 True ENSG00000179163 ENSG00000179163 HGNC:4006 FXN gene FXN Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 False 3 100;0;0 3.208 True ENSG00000165060 ENSG00000165060 HGNC:3951 GABRB2 gene GABRB2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted epileptic encephalopathy, infantile or early childhood, 2 MONDO:0020631 38996765 False 3 100;0;0 3.208 True Other ENSG00000145864 ENSG00000145864 HGNC:4082 GABRB3 gene GABRB3 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 43 MIM#617113 37647766 False 3 100;0;0 3.208 True Other ENSG00000166206 ENSG00000166206 HGNC:4083 GABRB3 gene GABRB3 Literature;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 43 MIM#617113 37647766 False 3 100;0;0 3.208 False Other ENSG00000166206 ENSG00000166206 HGNC:4083 GALT gene GALT Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Galactosemia, MIM#230400" 30718057 False 3 100;0;0 3.208 True ENSG00000213930 ENSG00000213930 HGNC:4135 GAMT gene GAMT Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral creatine deficiency syndrome 2 MIM#612736 19027335;33996490;12557293;19288536;16855203 False 3 50;0;50 3.208 True ENSG00000130005 ENSG00000130005 HGNC:4136 GBA gene GBA Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Gaucher disease, type III, MIM# 231000" 27789132 False 3 100;0;0 3.208 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA gene GBA Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson's disease, MONDO:0005180, GBA-related PMID: 12809640;35639160 False 3 100;0;0 3.208 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA2 gene GBA2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, MIM# 614409;MONDO:0013737 23332916;23332917;29524657 False 3 100;0;0 3.208 True ENSG00000070610 ENSG00000070610 HGNC:18986 GCDH gene GCDH Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal glutaryl-CoA dehydrogenase deficiency MONDO:0009281 32777384;21912879;31536184 False 3 100;0;0 3.208 True ENSG00000105607 ENSG00000105607 HGNC:4189 GCH1 gene GCH1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230 7874165;11113234;15753436 False 3 100;0;0 3.208 False ENSG00000131979 ENSG00000131979 HGNC:4193 GCH1 gene GCH1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, DOPA-responsive, with or without hyperphenylalaninemia, MIM# 128230 32170445;32278297;32746945;30314816 False 3 100;0;0 3.208 True ENSG00000131979 ENSG00000131979 HGNC:4193 GCH1 gene GCH1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Dopa-responsive dystonia;exercise-induced dystonia;Dystonia, DOPA-responsive, with or without hyperphenylalaninemia 128230" False 3 100;0;0 3.208 True ENSG00000131979 ENSG00000131979 HGNC:4193 GDAP2 gene GDAP2 Expert Review Green;Royal Melbourne Hospital;Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia False 3 100;0;0 3.208 False ENSG00000196505 ENSG00000196505 HGNC:18010 GEMIN5 gene GEMIN5 Expert Review Green;Literature;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cerebellar atrophy and motor dysfunction, OMIM # 619333 34569062;33963192 False 3 100;0;0 3.208 True ENSG00000082516 ENSG00000082516 HGNC:20043 GFAP gene GFAP Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Alexander disease, 203450;Autosomal Dominant Ataxia;Alexander disease False 3 100;0;0 3.208 False ENSG00000131095 ENSG00000131095 HGNC:4235 GJC2 gene GJC2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating leukodystrophy 2, 608804;Leukodystrophy, hypomyelinating, 2;Autosomal Recessive Ataxia;Spastic paraplegia 44, 613206 False 3 100;0;0 3.208 False ENSG00000198835 ENSG00000198835 HGNC:17494 GJC2 gene GJC2 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 2, MIM# 608804" 15192806;18094336 False 3 100;0;0 3.208 True ENSG00000198835 ENSG00000198835 HGNC:17494 GLB1 gene GLB1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1-gangliosidosis, type III , MIM#230650;Parkinsonism PMID: 34514040 False 3 100;0;0 3.208 True ENSG00000170266 ENSG00000170266 HGNC:4298 GLB1 gene GLB1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM1 gangliosidosis type 3 MONDO:0009262 24156116;35937492;34514040;1353343 False 3 100;0;0 3.208 True ENSG00000170266 ENSG00000170266 HGNC:4298 GLRA1 gene GLRA1 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 1, MIM# 149400 8298642;16832093 False 3 100;0;0 3.208 True ENSG00000145888 ENSG00000145888 HGNC:4326 GLRA1 gene GLRA1 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 1, MIM# 149400 8298642;16832093 False 3 100;0;0 3.208 True ENSG00000145888 ENSG00000145888 HGNC:4326 GLRB gene GLRB Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperekplexia 2, MIM# 614619 21391991;11929858;27843043 False 3 100;0;0 3.208 True ENSG00000109738 ENSG00000109738 HGNC:4329 GLRB gene GLRB Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperekplexia 2, MIM# 614619 21391991;11929858;27843043 False 3 100;0;0 3.208 True ENSG00000109738 ENSG00000109738 HGNC:4329 GM2A gene GM2A Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, AB variant, MIM#272750 False 3 100;0;0 3.208 True ENSG00000196743 ENSG00000196743 HGNC:4367 GNAL gene GNAL Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 25, MIM# 615073;MONDO:0014033 23222958;33175450;32180288 False 3 100;0;0 3.208 False ENSG00000141404 ENSG00000141404 HGNC:4388 GNAO1 gene GNAO1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with involuntary movements, 617493 28747448;30682224 False 3 100;0;0 3.208 True Other ENSG00000087258 ENSG00000087258 HGNC:4389 GNAO1 gene GNAO1 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 17;Neurodevelopmental disorder with involuntary movements 28747448;30682224 False 3 100;0;0 3.208 True Other ENSG00000087258 ENSG00000087258 HGNC:4389 GNB1 gene GNB1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mental retardation, autosomal dominant 42, MIM# 616973;Myoclonus dystonia 30194818;27108799;27668284;31034681 False 3 100;0;0 3.208 True ENSG00000078369 ENSG00000078369 HGNC:4396 GOSR2 gene GOSR2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 6, 614018;Progressive myoclonic epilepsy 6, 614018 False 3 100;0;0 3.208 False ENSG00000108433 ENSG00000108433 HGNC:4431 GPAA1 gene GPAA1 Expert Review Green;Expert list;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 15, 617810 False 3 100;0;0 3.208 True ENSG00000197858 ENSG00000197858 HGNC:4446 GRID2 gene GRID2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 18, 616204 False 3 100;0;0 3.208 False ENSG00000152208 ENSG00000152208 HGNC:4576 GRIN1 gene GRIN1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant, MIM# 614254;Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal recessive, MIM# 617820 29365063;27164704;27164704;28051072 False 3 100;0;0 3.208 True ENSG00000176884 ENSG00000176884 HGNC:4584 GRM1 gene GRM1 Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 13;Spinocerebellar ataxia 44, 617691, autosomal recessive spinocerebellar ataxia type 13, 614831 False 3 100;0;0 3.208 False ENSG00000152822 ENSG00000152822 HGNC:4593 GRN gene GRN Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM# 607485 17923627;20301545 False 3 100;0;0 3.208 False ENSG00000030582 ENSG00000030582 HGNC:4601 GRN gene GRN Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Frontotemporal lobar degeneration with ubiquitin-positive inclusions, MIM#607485" False 3 100;0;0 3.208 True ENSG00000030582 ENSG00000030582 HGNC:4601 GSS gene GSS NHS GMS;Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gluthathione synthetase deficiency, MIM# 266130 15717202 False 3 100;0;0 3.208 True ENSG00000100983 ENSG00000100983 HGNC:4624 GSX2 gene GSX2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Diencephalic-mesencephalic junction dysplasia syndrome 2 618646;Intellectual disability;Dystonia;Spastic tetra paresis" 31412107;39119454 False 3 100;0;0 3.208 True ENSG00000180613 ENSG00000180613 HGNC:24959 GTPBP2 gene GTPBP2 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Jaberi-Elahi syndrome, MIM#617988 26675814;29449720;30790272 False 3 100;0;0 3.208 True ENSG00000172432 ENSG00000172432 HGNC:4670 HEXA gene HEXA Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms, 272800;Tay-Sachs disease, 272800 False 3 100;0;0 3.208 False ENSG00000213614 ENSG00000213614 HGNC:4878 HEXB gene HEXB Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms, 268800;Sandhoff disease, 268800 False 3 100;0;0 3.208 False ENSG00000049860 ENSG00000049860 HGNC:4879 HIBCH gene HIBCH Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620" 26026795;25251209;24299452;32677093 False 3 100;0;0 3.208 True ENSG00000198130 ENSG00000198130 HGNC:4908 HIBCH gene HIBCH Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-hydroxyisobutryl-CoA hydrolase deficiency, MIM# 250620;Paroxysmal dyskinesia (exercise induced or without clear trigger;isolated or with additional features;mitochondrial disorder (Leigh syndrome);neurodevelopmental disability;epilepsy. PMID 31679561 False 3 100;0;0 3.208 True ENSG00000198130 ENSG00000198130 HGNC:4908 HPCA gene HPCA Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 2, torsion, autosomal recessive, 224500;MONDO:0009141;childhood-onset generalized dystonia;adolescence-onset segmental dystonia;generalized dystonia with additional neurological features 25799108;30991467;30145809 False 3 100;0;0 3.208 False ENSG00000121905 ENSG00000121905 HGNC:5144 HPRT1 gene HPRT1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Lesch-Nyhan syndrome;Dystonia 20301328 False 3 100;0;0 3.208 True ENSG00000165704 ENSG00000165704 HGNC:5157 HTRA2 gene HTRA2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria type 8 MONDO:0044723 27208207;27696117;30114719 False 3 50;50;0 3.208 True ENSG00000115317 ENSG00000115317 HGNC:14348 IMPDH2 gene IMPDH2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with dystonia PMID: 33098801 False 3 100;0;0 3.208 True ENSG00000178035 ENSG00000178035 HGNC:6053 INPP5E gene INPP5E Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 1 False 3 100;0;0 3.208 False ENSG00000148384 ENSG00000148384 HGNC:21474 IRF2BPL gene IRF2BPL Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with regression, abnormal movement, loss of speech and seizures, 618088 30057031 False 3 100;0;0 3.208 True ENSG00000119669 ENSG00000119669 HGNC:14282 IRF2BPL gene IRF2BPL Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures 618088 PMID: 30057031;30166628 False 3 100;0;0 3.208 True ENSG00000119669 ENSG00000119669 HGNC:14282 ITM2B gene ITM2B Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Cerebellar ataxia, cataract, deafness, and dementia or psychosis;Danish familial dementia 10391242;10781099;33814452 False 3 100;0;0 3.208 False ENSG00000136156 ENSG00000136156 HGNC:6174 ITPR1 gene ITPR1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 15 MIM#606658;Spinocerebellar ataxia 29, congenital nonprogressive MIM#117360 False 3 100;0;0 3.208 True ENSG00000150995 ENSG00000150995 HGNC:6180 KCNA1 gene KCNA1 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia/myokymia syndrome, MIM# 160120 11026449 False 3 100;0;0 3.208 True Other ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA1 gene KCNA1 Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 3.208 False ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA1 gene KCNA1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown EPISODIC ATAXIA, TYPE 1;myokymia with periodic ataxia;Episodic ataxia/myokymia syndrome, 160120;Episodic ataxia/myokymia syndrome 11026449 False 3 100;0;0 3.208 True Other ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA2 gene KCNA2 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia;Epileptic encephalopathy, early infantile, 32, MIM# 616366 27733563;27543892;25477152 False 3 100;0;0 3.208 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNA2 gene KCNA2 Expert Review Green;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 32, 616366 29050392 False 3 100;0;0 3.208 True ENSG00000177301 ENSG00000177301 HGNC:6220 KCNC3 gene KCNC3 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 13 MIM#605259 False 3 100;0;0 3.208 True ENSG00000131398 ENSG00000131398 HGNC:6235 KCND3 gene KCND3 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 19, MIM# 607346" 32823520 False 3 100;0;0 3.208 True ENSG00000171385 ENSG00000171385 HGNC:6239 KCNJ10 gene KCNJ10 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Paroxysmal dyskinesia, MONDO:0015427, KCNJ10-related 38979912;38436103 False 3 100;0;0 3.208 True ENSG00000177807 ENSG00000177807 HGNC:6256 KCNJ10 gene KCNJ10 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Seizures, Sensorineural Deafness, Ataxia, Mental Retardation, and Electrolyte Imbalance Syndrome;SESAME syndrome, 612780 False 3 100;0;0 3.208 False ENSG00000177807 ENSG00000177807 HGNC:6256 KCNJ2 gene KCNJ2 Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 3.208 False ENSG00000123700 ENSG00000123700 HGNC:6263 KCNJ2 gene KCNJ2 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Andersen syndrome, MIM# 170390 16217063;16571646;16419128;17324964 False 3 100;0;0 3.208 True ENSG00000123700 ENSG00000123700 HGNC:6263 KCNMA1 gene KCNMA1 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM# 609446 15937479;26195193 False 3 100;0;0 3.208 True ENSG00000156113 ENSG00000156113 HGNC:6284 KCNMA1 gene KCNMA1 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy, MIM# 609446 15937479;26195193 False 3 100;0;0 3.208 True ENSG00000156113 ENSG00000156113 HGNC:6284 KCNMA1 gene KCNMA1 Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia, 3, with or without generalized epilepsy MIM#609446 26195193;15937479;29356177 False 3 100;0;0 3.208 False Other ENSG00000156113 ENSG00000156113 HGNC:6284 KCNN2 gene KCNN2 Literature;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 34, myoclonic, MIM#619724;Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 32212350;33242881 False 3 100;0;0 3.208 False ENSG00000080709 ENSG00000080709 HGNC:6291 KCNN2 gene KCNN2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder with or without variable movement or behavioural abnormalities, MIM#619725 33242881 False 3 100;0;0 3.208 True ENSG00000080709 ENSG00000080709 HGNC:6291 KCNQ2 gene KCNQ2 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myokymia, MIM# 121200;Seizures, benign neonatal, 1, MIM# 121200;Developmental and epileptic encephalopathy 7, MIM# 613720 False 3 100;0;0 3.208 True ENSG00000075043 ENSG00000075043 HGNC:6296 KCNQ2 gene KCNQ2 Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 3.208 False ENSG00000075043 ENSG00000075043 HGNC:6296 KCNQ3 gene KCNQ3 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Seizures, benign neonatal, 2, MIM# 121201 33337327;25524373;24851285 False 3 100;0;0 3.208 True ENSG00000184156 ENSG00000184156 HGNC:6297 KCNQ3 gene KCNQ3 Victorian Clinical Genetics Services;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Seizures, benign neonatal, 2, MIM# 121201 33337327 False 3 100;0;0 3.208 False ENSG00000184156 ENSG00000184156 HGNC:6297 KCTD17 gene KCTD17 Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Dystonia 26, myoclonic MIM#616398 25983243;30642807;30579817 False 3 100;0;0 3.208 False ENSG00000100379 ENSG00000100379 HGNC:25705 KIAA1161 gene KIAA1161 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317;Primary familial brain calcification;Atypical parkinsonism;Supranuclear gaze palsy 32211515;30656188;30649222;30460687;29910000;31951047 False 3 100;0;0 3.208 True ENSG00000164976 ENSG00000164976 HGNC:19918 KIAA1161 gene KIAA1161 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 7, autosomal recessive, OMIM #618317;paroxysmal dyskinesia;brain calcification;episodic hemiparesis 34346093;34783389;32303062 False 3 100;0;0 3.208 True ENSG00000164976 ENSG00000164976 HGNC:19918 KIF1A gene KIF1A Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia;spastic paraplegia;intellectual disability 32096284;32935419 False 3 100;0;0 3.208 False ENSG00000130294 ENSG00000130294 HGNC:888 KIF1C gene KIF1C Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive MIM#611302 24482476;24319291;31413903;29544888 False 3 100;0;0 3.208 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF7 gene KIF7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Koubert syndrome 12;Acrocallosal syndrome, Schinzel type False 3 100;0;0 3.208 False ENSG00000166813 ENSG00000166813 HGNC:30497 KMT2B gene KMT2B Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 28, childhood-onset , MIM#617284 PMID: 33816656 False 3 100;0;0 3.208 True ENSG00000272333 ENSG00000272333 HGNC:15840 KMT2B gene KMT2B Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted early-onset dystonia;Dystonia 28, childhood-onset 617284;MONDO:0015004 27839873;27992417 False 3 100;0;0 3.208 False ENSG00000272333 ENSG00000272333 HGNC:15840 L2HGDH gene L2HGDH Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal L-2-hydroxyglutaric aciduria MIM#236792 24753671;18780161;15824270;10399870 False 3 100;0;0 3.208 True ENSG00000087299 ENSG00000087299 HGNC:20499 LAMA1 gene LAMA1 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Poretti-Boltshauser syndrome;Cerebellar ataxia, intellectual disability, oculomotor apraxia, cerebellar cysts syndrome 26932191;25105227 False 3 100;0;0 3.208 True ENSG00000101680 ENSG00000101680 HGNC:6481 LARS2 gene LARS2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 4;Hydrops, lactic acidosis, and sideroblastic anemia, MIM# 617021;Leukodystrophy 29205794;32423379;30737337 False 3 100;0;0 3.208 True ENSG00000011376 ENSG00000011376 HGNC:17095 LETM1 gene LETM1 Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration with multisystem involvement due to mitochondrial dysfunction (CONDMIM), MIM#620089 36055214 False 3 100;0;0 3.208 True ENSG00000168924 ENSG00000168924 HGNC:6556 LMNB1 gene LMNB1 Victorian Clinical Genetics Services;Expert list;Expert Review Green;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Leukodystrophy, adult-onset, autosomal dominant MIM#169500 31695592 False 3 100;0;0 3.208 False ENSG00000113368 ENSG00000113368 HGNC:6637 LRRK2 gene LRRK2 Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted False 3 100;0;0 3.208 False ENSG00000188906 ENSG00000188906 HGNC:18618 LYST gene LYST Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chediak-Higashi syndrome MONDO:0008963 23436631;23521865;20301751 False 3 100;0;0 3.208 True ENSG00000143669 ENSG00000143669 HGNC:1968 MAG gene MAG Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 75, autosomal recessive, MIM# 616680;Cerebellar ataxia;Oculomotor apraxia" 32629324;32340215;32629324 False 3 100;0;0 3.208 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAPT gene MAPT Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted late-onset Parkinson disease MONDO:0008199 20301678 False 3 100;0;0 3.208 True ENSG00000186868 ENSG00000186868 HGNC:6893 MARS2 gene MARS2 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 16672289;22448145 False 3 100;0;0 3.208 True ENSG00000247626 ENSG00000247626 HGNC:25133 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 False 3 100;0;0 3.208 True ENSG00000247626 ENSG00000247626 HGNC:25133 MECP2 gene MECP2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females MECP2-related disorders;Rett syndrome, MIM# 312750;Mental retardation, X-linked, syndromic 13, MIM# 300055 31970230;27050783 False 3 100;0;0 3.208 True ENSG00000169057 ENSG00000169057 HGNC:6990 MECR gene MECR Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, childhood-onset, with optic atrophy and basal ganglia abnormalities, MIM# 617282;MONDO:0015003 27817865;33401012;31137067;31070877 False 3 100;0;0 3.208 True ENSG00000116353 ENSG00000116353 HGNC:19691 MED27 gene MED27 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual disability;cerebellar hypoplasia;dystonia 33443317 False 3 100;0;0 3.208 False ENSG00000160563 ENSG00000160563 HGNC:2377 MKS1 gene MKS1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 28 False 3 100;0;0 3.208 False ENSG00000011143 ENSG00000011143 HGNC:7121 MMACHC gene MMACHC NHS GMS;Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Methylmalonic aciduria and homocystinuria cblC type, 277400;Methylmalonic aciduria and homocystinuria, cblC type, 277400;Ataxia and hypogonadism False 3 100;0;0 3.208 False ENSG00000132763 ENSG00000132763 HGNC:24525 MORC2 gene MORC2 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Axonal type CMT disease type 2Z, 616688;Cerebellar ataxia 28402445 False 3 50;0;50 3.208 True ENSG00000133422 ENSG00000133422 HGNC:23573 MRE11 gene MRE11 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-Telangiectasia-Like Disorder;Ataxia-telangiectasia-like disorder 1, 604391 False 3 100;0;0 3.208 False ENSG00000020922 ENSG00000020922 HGNC:7230 MSTO1 gene MSTO1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy, mitochondrial, and ataxia MIM#617675 False 3 100;0;0 3.208 True ENSG00000125459 ENSG00000125459 HGNC:29678 MT-ATP6 gene MT-ATP6 Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial complex V (ATP synthase) deficiency, MONDO:0014471, MT-ATP6-related 40112238 False 3 100;0;0 3.208 True ENSG00000198899 ENSG00000198899 HGNC:7414 MTCL1 gene MTCL1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal slowly progressive cerebellar ataxia, mild intellectual disability, seizures in childhood and episodic pain in the lower limbs 30548255;28283581 False 3 100;0;0 3.208 True ENSG00000168502 ENSG00000168502 HGNC:29121 MT-CO1 gene MT-CO1 Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO1-related 30743023;39460813;24956508;10441567;10980727;15751226;16284789;18977334;22832341;18276892;30030519 False 3 100;0;0 3.208 True ENSG00000198804 ENSG00000198804 HGNC:7419 MT-CO2 gene MT-CO2 Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related 34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519 False 3 100;0;0 3.208 True ENSG00000198712 ENSG00000198712 HGNC:7421 MT-CYB gene MT-CYB Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CYB-related 39858655;34804306;26937408 False 3 100;0;0 3.208 True ENSG00000198727 ENSG00000198727 HGNC:7427 MTFMT gene MTFMT Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 15 MIM#614947;Mitochondrial complex I deficiency, nuclear type 27 MIM#618248 26060307;24461907 False 3 100;0;0 3.208 True ENSG00000103707 ENSG00000103707 HGNC:29666 MT-ND3 gene MT-ND3 Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND3-related 1928099;14705112;14764913;17152068;20202874;25118196;25384404;11456298;19458970;30199507;29237403 False 3 100;0;0 3.208 False ENSG00000198840 ENSG00000198840 HGNC:7458 MT-ND4 gene MT-ND4 Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND4-related 12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231 False 3 100;0;0 3.208 True ENSG00000198886 ENSG00000198886 HGNC:7459 MT-TE gene MT-TE Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TE-related 8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256 False 3 100;0;0 3.208 True ENSG00000210194 ENSG00000210194 HGNC:7479 MT-TG gene MT-TG Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 3.208 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TH gene MT-TH Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TH-related 12682337;14967777;15111688;21704194;21931169;23696415;35092007;24920829;21704194 False 3 100;0;0 3.208 True ENSG00000210176 ENSG00000210176 HGNC:7487 MTTP gene MTTP Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Abetalipoproteinemia, 200100;Abetalipoproteinemia False 3 100;0;0 3.208 False ENSG00000138823 ENSG00000138823 HGNC:7467 MT-TS2 gene MT-TS2 Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS2-related 9792552;10090882;16950817;21257182;22369973;22378285 False 3 100;0;0 3.208 True ENSG00000210184 ENSG00000210184 HGNC:7498 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 3.208 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 3.208 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TW gene MT-TW Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 3.208 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TW gene MT-TW Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 3.208 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TY gene MT-TY Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 3.208 True ENSG00000210144 ENSG00000210144 HGNC:7502 MVK gene MVK Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mevalonic aciduria 610377 12563048;10401001;28095071 False 3 100;0;0 3.208 True ENSG00000110921 ENSG00000110921 HGNC:7530 NAA15 gene NAA15 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder, autosomal dominant 50, with behavioral abnormalities - MIM#617787 38380600;36221186;35730864 False 3 100;0;0 3.208 True ENSG00000164134 ENSG00000164134 HGNC:30782 NACC1 gene NACC1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted chorea;dystonia;epilepsy;microcephaly;cataracts;dysautonomia;iron deficiency anemia;stereotypies 38698576 False 3 100;0;0 3.208 True ENSG00000160877 ENSG00000160877 HGNC:20967 NHLRC1 gene NHLRC1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive myoclonic epilepsy 2B, Lafora, 254780;Epilepsy, progressive myoclonic 2B (Lafora) 254780 False 3 100;0;0 3.208 False ENSG00000187566 ENSG00000187566 HGNC:21576 NIT1 gene NIT1 Literature;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brain small vessel disease 4, MIM# 621313 38430071 False 3 100;0;0 3.208 False ENSG00000158793 ENSG00000158793 HGNC:7828 NKX2-1 gene NKX2-1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Choreoathetosis, hypothyroidism, and neonatal respiratory distress 610978;Choreoathetosis, hypothyroidism and neonatal respiratory distress, 610978;Chorea, hereditary benign 118700;Hereditary bening chorea, 118700 10931427;27066577;26839702;26103969 False 3 100;0;0 3.208 True ENSG00000136352 ENSG00000136352 HGNC:11825 NKX2-1 gene NKX2-1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Chorea, hereditary benign MIM#118700;Choreoathetosis, hypothyroidism, and neonatal respiratory distress MIM#610978 24714694;30186310 False 3 100;0;0 3.208 True ENSG00000136352 ENSG00000136352 HGNC:11825 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic ataxia 8 with hypomyelinating leukodystrophy, 617560;Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy 617560 False 3 100;0;0 3.208 False ENSG00000148826 ENSG00000148826 HGNC:19321 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy MIM#617560 30285346;28575651;28969374 False 3 100;0;0 3.208 True ENSG00000148826 ENSG00000148826 HGNC:19321 NOVA2 gene NOVA2 Expert Review Green;Literature;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities, OMIM #618859 PMID: 32197073 False 3 100;0;0 3.208 True ENSG00000104967 ENSG00000104967 HGNC:7887 NPC1 gene NPC1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C1 MONDO:0009757 12555942;20301473 False 3 100;0;0 3.208 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C1, 257220;Niemann-Pick disease types C1 and D (#257220) 10480349;17003072;25497598;33228797 False 3 100;0;0 3.208 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC1 gene NPC1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Niemann-Pick disease, MIM# 257220;Parkinsonism 24035292;30369906 False 3 100;0;0 3.208 True ENSG00000141458 ENSG00000141458 HGNC:7897 NPC2 gene NPC2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann Pick C2, OMIM 607625;Parkinsonism PMID: 35695805 False 3 100;0;0 3.208 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPC2 gene NPC2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease, type C2 MONDO:0011873;Dystonia 34993563;17470133 False 3 100;0;0 3.208 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPC2 gene NPC2 Expert Review Green;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Niemann-Pick disease type C2, 607625;Niemann-Pick disease type C2 (#607625) False 3 100;0;0 3.208 True ENSG00000119655 ENSG00000119655 HGNC:14537 NPHP1 gene NPHP1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 4 False 3 100;0;0 3.208 False ENSG00000144061 ENSG00000144061 HGNC:7905 NPTX1 gene NPTX1 Literature;Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted cerebellar ataxia MONDO#0000437, NPTX1-related 34788392;35288776;35285082;35560436 False 3 100;0;0 3.208 False ENSG00000171246 ENSG00000171246 HGNC:7952 NR4A2 gene NR4A2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 31922365 False 3 100;0;0 3.208 True ENSG00000153234 ENSG00000153234 HGNC:7981 NR4A2 gene NR4A2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Intellectual developmental disorder with language impairment and early-onset DOPA-responsive dystonia-parkinsonism, MIM# 619911 31922365 False 3 100;0;0 3.208 True ENSG00000153234 ENSG00000153234 HGNC:7981 NUBPL gene NUBPL Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency, nuclear type 21, OMIM # 618242 23553477;32518176 False 3 100;0;0 3.208 True ENSG00000151413 ENSG00000151413 HGNC:20278 NUS1 gene NUS1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Epilepsy, myoclonus, ataxia and scoliosis;Mental retardation, autosomal dominant 55, with seizures, 617831 PMID: 31656175;29100083 False 3 100;0;0 3.208 True ENSG00000153989 ENSG00000153989 HGNC:21042 NUS1 gene NUS1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder, autosomal dominant 55, with seizures, MIM# 617831;Parkinsonism;Developmental delay;Intellectual disability;Ataxia;Myoclonus" PMID: 32485575;30348779 False 3 100;0;0 3.208 True ENSG00000153989 ENSG00000153989 HGNC:21042 OFD1 gene OFD1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 10 False 3 100;0;0 3.208 False ENSG00000046651 ENSG00000046651 HGNC:2567 OPA1 gene OPA1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal OPA1-related optic atrophy with or without extraocular features, MONDO:0800181 30165240;28494813 False 3 100;0;0 3.208 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA3 gene OPA3 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, 258501;Optic atrophy 3 with cataract, 165300;3-methylglutaconic aciduria type III, 258501;Costeff syndrome False 3 100;0;0 3.208 False ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria, type III, MIM# 258501;developmental delay, hypotonia;dystonia and chorea;ataxia, optic atrophy;spastic paraplegia 20301646;7510656;2494568;11668429 False 3 100;0;0 3.208 True ENSG00000125741 ENSG00000125741 HGNC:8142 OPHN1 gene OPHN1 Expert Review Green;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked mental retardation with cerebellar hypoplasia and distinctive facial appearance, 300486;Mental retardation, X-linked, with cerebellar hypoplasia and distinctive facial appearance, 300486 False 3 100;0;0 3.208 True ENSG00000079482 ENSG00000079482 HGNC:8148 PAH gene PAH Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phenylketonuria MIM#261600 PMID: 25614310, PMID: 15390012, PMID: 30369906 False 3 100;0;0 3.208 True ENSG00000171759 ENSG00000171759 HGNC:8582 PANK2 gene PANK2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pantothenate kinase-associated neurodegeneration MONDO:0009319;Dystonia 15911822 False 3 100;0;0 3.208 True ENSG00000125779 ENSG00000125779 HGNC:15894 PANK2 gene PANK2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal pantothenate kinase-associated neurodegeneration MONDO:0009319 23447832;20301663 False 3 0;0;0 3.208 True ENSG00000125779 ENSG00000125779 HGNC:15894 PARK7 gene PARK7 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive early-onset Parkinson disease 7 MONDO:0011658 20301402 False 3 100;0;0 3.208 True ENSG00000116288 ENSG00000116288 HGNC:16369 PARK7 gene PARK7 Expert list;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Parkinson disease 7, autosomal recessive early-onset MIM#606324" 29644727 False 3 100;0;0 3.208 False ENSG00000116288 ENSG00000116288 HGNC:16369 PCCA gene PCCA Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Propionicacidemia, MIM# 606054" 30879957 False 3 100;0;0 3.208 True ENSG00000175198 ENSG00000175198 HGNC:8653 PCCB gene PCCB Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Propionicacidemia, MIM# 606054" 30879957 False 3 100;0;0 3.208 True ENSG00000114054 ENSG00000114054 HGNC:8654 PDE10A gene PDE10A Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Early onset chorea without epilepsy;infantile onset limb and orofacial dyskinesia (OMIM 616921) PMID 27058447 False 3 100;0;0 3.208 False ENSG00000112541 ENSG00000112541 HGNC:8772 PDE1B gene PDE1B Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related 40492975 False 3 100;0;0 3.208 True ENSG00000123360 ENSG00000123360 HGNC:8775 PDE1B gene PDE1B Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PDE1B-related 40492975 False 3 100;0;0 3.208 True ENSG00000123360 ENSG00000123360 HGNC:8775 PDE2A gene PDE2A Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Paroxysmal dyskinesia;Intellectual developmental disorder with paroxysmal dyskinesia or seizures, MIM# 619150 32467598;32196122;29392776;37317634 False 3 100;0;0 3.208 True ENSG00000186642 ENSG00000186642 HGNC:8777 PDE8B gene PDE8B Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Striatal degeneration, autosomal dominant, MIM#609161 20085714;26769607;26475694 False 3 100;0;0 3.208 True ENSG00000113231 ENSG00000113231 HGNC:8794 PDGFB gene PDGFB Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5, MIM# 615483;Paroxysmal nonkinesigenic dyskinesia;paroxysmal kinesigenic dyskinesia;Brain calcification 28556368;32443735;23913003 False 3 100;0;0 3.208 True ENSG00000100311 ENSG00000100311 HGNC:8800 PDGFB gene PDGFB Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5 615483 False 3 100;0;0 3.208 False ENSG00000100311 ENSG00000100311 HGNC:8800 PDGFB gene PDGFB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 5, MIM# 615483 23913003 False 3 100;0;0 3.208 True ENSG00000100311 ENSG00000100311 HGNC:8800 PDGFRB gene PDGFRB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 4, MIM# 615007 23255827;30979360 False 3 100;0;0 3.208 True ENSG00000113721 ENSG00000113721 HGNC:8804 PDHA1 gene PDHA1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Pyruvate dehydrogenase E1-alpha deficiency MIM#312170 20002125 False 3 100;0;0 3.208 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDHA1 gene PDHA1 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Pyruvate dehydrogenase E1-alpha deficiency, MIM# 312170;Paroxysmal dyskinesia (exercise induced or without clear trigger 20002125;22079328 False 3 100;0;0 3.208 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDHX gene PDHX Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lacticacidemia due to PDX1 deficiency MIM#245349" 20002125;16566017;17152059 False 3 100;0;0 3.208 True ENSG00000110435 ENSG00000110435 HGNC:21350 PDHX gene PDHX Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lactic acidemia due to PDX1 deficiency, MIM# 245349;episodic dystonia;Paroxysmal dyskinesia (exercise induced or without clear trigger;isolated or with additional features) 16566017;20002125 False 3 100;0;0 3.208 True ENSG00000110435 ENSG00000110435 HGNC:21350 PDYN gene PDYN Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23;Spinocerebellar ataxia 23, 610245 False 3 100;0;0 3.208 False ENSG00000101327 ENSG00000101327 HGNC:8820 PEX16 gene PEX16 Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Zellweger syndrome (614876);Peroxisome biogenesis disorder 8B (#614877) infantile progressive ataxia and spastic paresis;Peroxisome biogenesis disorder 8A, 614876;Peroxisome biogenesis disorder 8B, 614877 False 3 100;0;0 3.208 False ENSG00000121680 ENSG00000121680 HGNC:8857 PEX7 gene PEX7 Expert Review Green;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum disease;Peroxisome biogenesis disorder 9B, MIM#614879 False 3 100;0;0 3.208 True ENSG00000112357 ENSG00000112357 HGNC:8860 PGK1 gene PGK1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Phosphoglycerate kinase 1 deficiency, MIM# 300653;Haemolytic anaemia;Rhabdomyolysis;Myopathy;Juvenile Parkinsonism;OMIM 300653 PMID: 30975619 False 3 100;0;0 3.208 True ENSG00000102144 ENSG00000102144 HGNC:8896 PHYH gene PHYH Expert Review Green;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Refsum disease, MIM# 266500" False 3 100;0;0 3.208 True ENSG00000107537 ENSG00000107537 HGNC:8940 PIGS gene PIGS Expert Review Green;Literature;Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 95, OMIM # 618143 30269814;33410539 False 3 100;0;0 3.208 True ENSG00000087111 ENSG00000087111 HGNC:14937 PINK1 gene PINK1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 6, early onset;Dystonia False 3 0;0;0 3.208 False ENSG00000158828 ENSG00000158828 HGNC:14581 PINK1 gene PINK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 6, early onset MIM#605909 28980524 False 3 100;0;0 3.208 True ENSG00000158828 ENSG00000158828 HGNC:14581 PITRM1 gene PITRM1 Expert Review Green;Literature;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-30 (SCAR30), MIM#619405;intellectual disability;cognitive decline;psychosis 26697887;29764912 False 3 100;0;0 3.208 True ENSG00000107959 ENSG00000107959 HGNC:17663 PLA2G6 gene PLA2G6 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 14, autosomal recessive 612953;PLA2G6-associated neurodegeneration;Neurodegeneration with brain iron accumulation 2B 610217;Infantile neuroaxonal dystrophy 1 256600 False 3 0;0;0 3.208 False ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive Parkinson disease 14 MONDO:0013060 20301718 False 3 100;0;0 3.208 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLA2G6 gene PLA2G6 Expert Review Green;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive Parkinson disease 14, 612953;Parkinson disease 14 (#612953);Infantile neuroaxonal dystrophy 1 (#256600);Infantile neuroaxonal dystrophy 1, 256600;Neurodegeneration with brain iron accumulation 2B (#610217);Neurodegeneration with brain iron accumulation 2B, 610217 False 3 100;0;0 3.208 True ENSG00000184381 ENSG00000184381 HGNC:9039 PMPCA gene PMPCA Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 2, MIM# 213200 25808372;26657514;33272776;30617178 False 3 100;0;0 3.208 True ENSG00000165688 ENSG00000165688 HGNC:18667 PMPCB gene PMPCB Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 6, 617954 29576218 False 3 100;0;0 3.208 True ENSG00000105819 ENSG00000105819 HGNC:9119 PNKD gene PNKD Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800;MONDO:0007326 15262732;15496428;15824259;19124534;21487022 False 3 100;0;0 3.208 False ENSG00000127838 ENSG00000127838 HGNC:9153 PNKD gene PNKD Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800 15496428 False 3 100;0;0 3.208 True ENSG00000127838 ENSG00000127838 HGNC:9153 PNKD gene PNKD Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal nonkinesigenic dyskinesia 1, MIM# 118800 False 3 100;0;0 3.208 True ENSG00000127838 ENSG00000127838 HGNC:9153 PNKD gene PNKD Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Paroxysmal nonkinesigenic dyskinesia 1, 118800 False 3 100;0;0 3.208 True ENSG00000127838 ENSG00000127838 HGNC:9153 PNKP gene PNKP Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia-oculomotor apraxia 4, MIM# 616267" 28552035;25728773 False 3 100;0;0 3.208 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNKP gene PNKP Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly, seizures and developmental delay, 613402;Ataxia-oculomotor apraxia 4, 616267;Ataxia with oculomotor apraxia 4 (#616267) 31436889;31707899 False 3 100;0;0 3.208 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNPLA6 gene PNPLA6 Expert Review Green;Expert list;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Boucher-Neuhauser syndrome MIM#215470;Laurence-Moon syndrome MIM#245800;Oliver-McFarlane syndrome MIM#275400;Spastic paraplegia 39, autosomal recessive MIM#612020 False 3 100;0;0 3.208 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA8 gene PNPLA8 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related PMID: 39082157 False 3 100;0;0 3.208 True ENSG00000135241 ENSG00000135241 HGNC:28900 PNPT1 gene PNPT1 Literature;Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 25, MIM# 608703" 35411967;37935417;39729134;39899068;39924761;40757543 False 3 60;40;0 3.208 False ENSG00000138035 ENSG00000138035 HGNC:23166 POLG gene POLG Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant progressive external ophthalmoplegia MONDO:0008003 20301791;15351195 False 3 100;0;0 3.208 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type) MIM#203700;Mitochondrial DNA depletion syndrome 4B (MNGIE type) MIM#613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) MIM#607459;Progressive external ophthalmoplegia, autosomal recessive 1 MIM#258450 False 3 100;0;0 3.208 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLR3A gene POLR3A Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 32600288;32373668;31940116;31932101;29618326 False 3 100;0;0 3.208 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 PMID: 33652360 False 3 100;0;0 3.208 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3A gene POLR3A Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal POLR3A-related disorder MONDO:0700276 False 3 100;0;0 3.208 True ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3B gene POLR3B Expert Review Green;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 8, with or without oligodontia and/or hypogonadotropic hypogonadism, MIM#614381 22036171;22036172 False 3 100;0;0 3.208 True ENSG00000013503 ENSG00000013503 HGNC:30348 POU4F1 gene POU4F1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia;intention tremor;hypotonia 33783914;8876243 False 3 100;0;0 3.208 True ENSG00000152192 ENSG00000152192 HGNC:9218 PPP2R5D gene PPP2R5D Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early onset Parkinsonism;Houge-Janssens syndrome 1, MIM#616355 33338668;32743835 False 3 100;0;0 3.208 True ENSG00000112640 ENSG00000112640 HGNC:9312 PRDX3 gene PRDX3 Expert Review Green;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia MONDO:0000437, PRDX3-related 33889951 False 3 100;0;0 3.208 True ENSG00000165672 ENSG00000165672 HGNC:9354 PRKCG gene PRKCG Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14, MIM# 605361;Myoclonus;Parkinsonism PMID: 29603387 False 3 100;0;0 3.208 True ENSG00000126583 ENSG00000126583 HGNC:9402 PRKN gene PRKN Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile parkinsonism/dystonia;Parkinson disease, juvenile, type 2;Dystonia False 3 0;0;0 3.208 False ENSG00000185345 ENSG00000185345 HGNC:8607 PRKN gene PRKN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive juvenile Parkinson disease 2 MONDO:0010820 False 3 100;0;0 3.208 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRKRA gene PRKRA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dystonia 16 MONDO:0012789 33502045 False 3 100;0;0 3.208 True ENSG00000180228 ENSG00000180228 HGNC:9438 PRKRA gene PRKRA Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 16, MIM# 612067;MONDO:0012789 18243799;25142429;29279192 False 3 100;0;0 3.208 False ENSG00000180228 ENSG00000180228 HGNC:9438 PRMT1 gene PRMT1 Expert Review Green;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neurodevelopmental disorder, MONDO:0700092, PRMT1-related 39937650 False 3 100;0;0 3.208 True ENSG00000126457 ENSG00000126457 HGNC:5187 PRNP gene PRNP Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 1 MONDO:0011299 30713928;27400454 False 3 100;0;0 3.208 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted inherited Creutzfeldt-Jakob disease MONDO:0007403;Gerstmann-Straussler-Scheinker syndrome MONDO:0007656 20301407 False 3 100;0;0 3.208 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRNP gene PRNP Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Multiple allelic disorders reported;Huntington disease-like 1;Autosomal Dominant Ataxia;Gerstmann-Straussler disease;Insomnia, fatal familial;Creutzfeldt-Jakob disease 2564168;34324063;20301407 False 3 100;0;0 3.208 False ENSG00000171867 ENSG00000171867 HGNC:9449 PRRT2 gene PRRT2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic kinesigenic dyskinesia 1, MIM# 128200;MONDO:0007494 22101681;22120146;22744660;22399141 False 3 100;0;0 3.208 False ENSG00000167371 ENSG00000167371 HGNC:30500 PRRT2 gene PRRT2 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal PRRT2-associated paroxysmal movement disorder MONDO:0100556 33126500 False 3 100;0;0 3.208 True ENSG00000167371 ENSG00000167371 HGNC:30500 PRRT2 gene PRRT2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal PRRT2-associated paroxysmal movement disorder MONDO:0100556 26598494;31193310;30501978;30713971 False 3 100;0;0 3.208 True ENSG00000167371 ENSG00000167371 HGNC:30500 PRRT2 gene PRRT2 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal PRRT2-associated paroxysmal movement disorder MONDO:0100556 33126500 False 3 100;0;0 3.208 True ENSG00000167371 ENSG00000167371 HGNC:30500 PSAP gene PSAP Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Parkinson disease 24, autosomal dominant, susceptibility to, MIM# 619491 32201884 False 3 100;0;0 3.208 True ENSG00000197746 ENSG00000197746 HGNC:9498 PSEN1 gene PSEN1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 3 MONDO:0011913 3548932;34843019;36825052 False 3 100;0;0 3.208 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSEN1 gene PSEN1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Frontotemporal dementia, MIM# 600274;Dystonia 28664294;12810495;15159497;29316780 False 3 100;0;0 3.208 True ENSG00000080815 ENSG00000080815 HGNC:9508 PSMF1 gene PSMF1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 False 3 100;0;0 3.208 True ENSG00000125818 ENSG00000125818 HGNC:9571 PTRH2 gene PTRH2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile multi-system neurologic, endocrine, and pancreatic disease, 616263 25558065;25574476;31057140;27129381 False 3 100;0;0 3.208 True ENSG00000141378 ENSG00000141378 HGNC:24265 PTRHD1 gene PTRHD1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with early-onset parkinsonism and behavioral abnormalities, MIM# 620747 27753167;27134041;30398675;29143421 False 3 100;0;0 3.208 True ENSG00000184924 ENSG00000184924 HGNC:33782 PTS gene PTS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 3.208 True ENSG00000150787 ENSG00000150787 HGNC:9689 PTS gene PTS Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, A, 261640;6-Pyruvoyltetrahydropterin Synthase Deficiency;Dystonia False 3 0;0;0 3.208 False ENSG00000150787 ENSG00000150787 HGNC:9689 PUM1 gene PUM1 Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 47, 617931 False 3 100;0;0 3.208 False ENSG00000134644 ENSG00000134644 HGNC:14957 QDPR gene QDPR Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, MIM#261630;Dehydropteridin reductase deficiency, Infantile-onset dystonia;Parkinsonism;Epilepsy;Autonomic dysfunction;Hyperphenylalaninemia PMID: 28413401 False 3 100;0;0 3.208 True ENSG00000151552 ENSG00000151552 HGNC:9752 QDPR gene QDPR Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperphenylalaninemia, BH4-deficient, C, 261630;Dihydropteridine reductase deficiency;Dystonia False 3 0;0;0 3.208 False ENSG00000151552 ENSG00000151552 HGNC:9752 RAB32 gene RAB32 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Parkinson disease 26, autosomal dominant, susceptibility to}, MIM# 620923 38858457;38614108;38293014;40118982;40568674;41103171 False 3 33;33;33 3.208 True Other ENSG00000118508 ENSG00000118508 HGNC:9772 RAB39B gene RAB39B Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Early-onset parkinsonism-intellectual disability syndrome MONDO:0010709 25434005;26399558;26739247 False 3 100;0;0 3.208 True ENSG00000155961 ENSG00000155961 HGNC:16499 RAB3A gene RAB3A Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 52, MIM# 621535 40166812 False 3 100;0;0 3.208 True ENSG00000105649 ENSG00000105649 HGNC:9777 RFC1 gene RFC1 Literature;Expert list;Expert Review Green;Expert Review Green;Expert list;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 3.208 False ENSG00000035928 ENSG00000035928 HGNC:9969 RHOBTB2 gene RHOBTB2 Expert Review Green;Other Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 64, MIM# 618004;Paroxysmal movement disorder" PMID 29276004 False 3 100;0;0 3.208 True ENSG00000008853 ENSG00000008853 HGNC:18756 RHOBTB2 gene RHOBTB2 Expert Review Green;Other Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epileptic encephalopathy, early infantile, 64, MIM# 618004;Dystonia, hypertonia, movement disorder;truncal hypotonia;hemiparesis;developmental and epileptic encephalopathy" PMID: 29276004 False 3 0;0;0 3.208 True ENSG00000008853 ENSG00000008853 HGNC:18756 RNASEH2B gene RNASEH2B Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 2 MIM#610181 20131292;26860721 False 3 100;0;0 3.208 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNASEH2C gene RNASEH2C Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 3 MIM#610329 20131292;23322642 False 3 100;0;0 3.208 True ENSG00000172922 ENSG00000172922 HGNC:24116 RNF170 gene RNF170 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Ataxia, sensory, 1, autosomal dominant, MIM# 608984 32943585;21115467 False 3 100;0;0 3.208 False ENSG00000120925 ENSG00000120925 HGNC:25358 RNF216 gene RNF216 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia and hypogonadotropic hypogonadism MIM#212840 False 3 100;0;0 3.208 True ENSG00000011275 ENSG00000011275 HGNC:21698 RNF220 gene RNF220 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 23, with ataxia, deafness, liver dysfunction, and dilated cardiomyopathy, MIM# 619688;Leukodystrophy;CNS hypomyelination;Ataxia;Intellectual disability;Sensorineural hearing impairment;Elevated hepatic transaminases;Hepatic fibrosis;Dilated cardiomyopathy;Spastic paraplegia;Dysarthria;Abnormality of the corpus callosum 33964137;10881263 False 3 100;0;0 3.208 True ENSG00000187147 ENSG00000187147 HGNC:25552 RNU7-1 gene RNU7-1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 9, MIM# 619487 33230297 False 3 100;0;0 3.208 True ENSG00000238923 ENSG00000238923 HGNC:34033 RORA gene RORA Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Intellectual developmental disorder with or without epilepsy or cerebellar ataxia, 618060 29656859 False 3 100;0;0 3.208 True ENSG00000069667 ENSG00000069667 HGNC:10258 RPGRIP1L gene RPGRIP1L Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 7, MIM# 611560" False 3 100;0;0 3.208 True ENSG00000103494 ENSG00000103494 HGNC:29168 RUBCN gene RUBCN Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Royal Melbourne Hospital Clinical Genetics Department Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 15, MIM#615705 20826435;23728897 False 3 100;0;0 3.208 True ENSG00000145016 ENSG00000145016 HGNC:28991 SACS gene SACS Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia, Charlevoix-Saguenay type MIM#270550 False 3 100;0;0 3.208 True ENSG00000151835 ENSG00000151835 HGNC:10519 SAMD9L gene SAMD9L Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 49, MIM# 619806;Ataxia-pancytopaenia syndrome, MIM# 159550 35310830;33884299;28570036 False 3 100;0;0 3.208 False ENSG00000177409 ENSG00000177409 HGNC:1349 SCN1A gene SCN1A Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dravet syndrome 607208;Epilepsy, generalized, with febrile seizures plus, type 2 604403;Febrile seizures, familial, 3A 604403;Migraine, familial hemiplegic, 3 609634 False 3 100;0;0 3.208 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN1A gene SCN1A Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 6 (Dravet syndrome), MIM# 607208 27264139;27817982;28732259 False 3 67;33;0 3.208 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN1A gene SCN1A Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dravet syndrome, MIM# 607208;Epilepsy, Paekinsonism PMID: 28186331;24850485 False 3 100;0;0 3.208 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN1A gene SCN1A Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 3.208 False ENSG00000144285 ENSG00000144285 HGNC:10585 SCN2A gene SCN2A Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Early infantile epileptic encephalopathy 11, MIM# 613721 False 3 100;0;0 3.208 True ENSG00000136531 ENSG00000136531 HGNC:10588 SCN2A gene SCN2A Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 3.208 False ENSG00000136531 ENSG00000136531 HGNC:10588 SCN4A gene SCN4A Royal Children's Hospital Neurology Department;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders Unknown False 3 0;0;0 3.208 False ENSG00000007314 ENSG00000007314 HGNC:10591 SCN8A gene SCN8A Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myoclonus, familial, 2, MIM# 618364;epilepsy;paroxysmal kinesigenic dyskinesias 29726066;27098556 False 3 100;0;0 3.208 True ENSG00000196876 ENSG00000196876 HGNC:10596 SCN8A gene SCN8A Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Complex neurodevelopmental disorder MONDO:0100038 26677014;29356177;25799905 False 3 100;0;0 3.208 True ENSG00000196876 ENSG00000196876 HGNC:10596 SCN8A gene SCN8A Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy 13, 614558;Cognitive impairment with or without cerebellar ataxia, 614306 31904124;31887642;31675620 False 3 100;0;0 3.208 True ENSG00000196876 ENSG00000196876 HGNC:10596 SCYL1 gene SCYL1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 21, 616719;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy 29419818;17571074;26581903;30531813 False 3 100;0;0 3.208 True ENSG00000142186 ENSG00000142186 HGNC:14372 SERAC1 gene SERAC1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739;Parkinsonism PMID: 29332177;16527507 False 3 100;0;0 3.208 True ENSG00000122335 ENSG00000122335 HGNC:21061 SERAC1 gene SERAC1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-MEthylGlutaconic aciduria, Dystonia-Deafness, Hepatopathy, Encephalopathy, Leigh-like syndrome;3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, 614739;Lesions in the basal ganglia False 3 0;0;0 3.208 False ENSG00000122335 ENSG00000122335 HGNC:21061 SETX gene SETX Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2, MIM# 606002" 19696032 False 3 100;0;0 3.208 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 MIM#606002 False 3 100;0;0 3.208 True ENSG00000107290 ENSG00000107290 HGNC:445 SGCE gene SGCE Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Dystonia-11, myoclonic, MIM# 159900;MONDO:0008044 11528394;12821748;16227522 False 3 100;0;0 3.208 False ENSG00000127990 ENSG00000127990 HGNC:10808 SHQ1 gene SHQ1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 35, childhood-onset , MIM# 619921;Neurodevelopmental disorder with dystonia and seizures, MIM# 619922 34542157;29178645;36847845;37475611 False 3 100;0;0 3.208 True ENSG00000144736 ENSG00000144736 HGNC:25543 SIL1 gene SIL1 Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Marinesco-Sjogren syndrome, 248800 False 3 100;0;0 3.208 False ENSG00000120725 ENSG00000120725 HGNC:24624 SKOR2 gene SKOR2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Valence-Farazi cerebellar ataxia syndrome, MIM# 621386 40890458;29997391;21937600 False 3 100;0;0 3.208 True ENSG00000215474 ENSG00000215474 HGNC:32695 SLC13A3 gene SLC13A3 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, acute reversible, with increased urinary alpha-ketoglutarate (MIM# 618384) https://www.neurology.org/doi/full/10.1212/NXG.0000000000200101 (No PMID) False 3 100;0;0 3.208 True ENSG00000158296 ENSG00000158296 HGNC:14430 SLC16A2 gene SLC16A2 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, MIM# 300523;paroxysmal dyskinesia (passive movement trigger);neurodevelopmental disability, hypotonia 15980113;31410843;20301789 False 3 100;0;0 3.208 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC16A2 gene SLC16A2 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, MIM# 300523 15980113;31410843;20301789 False 3 100;0;0 3.208 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC17A5 gene SLC17A5 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Salla disease;Sialic acid storage disease, severe infantile type, MIM# 269920 26171070 False 3 100;0;0 3.208 True ENSG00000119899 ENSG00000119899 HGNC:10933 SLC18A2 gene SLC18A2 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Parkinsonism-dystonia, infantile, 2, MIM# 618049" 23363473;31240161;26497564 False 3 100;0;0 3.208 True ENSG00000165646 ENSG00000165646 HGNC:10935 SLC18A2 gene SLC18A2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 2 , MIM# 618049;Brain dopamine-serotonin transport disease, Childhood-onset parkinsonism 33983693;23363473;31240161;26497564 False 3 100;0;0 3.208 True ENSG00000165646 ENSG00000165646 HGNC:10935 SLC19A3 gene SLC19A3 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2) 607483;Dystonia False 3 0;0;0 3.208 False ENSG00000135917 ENSG00000135917 HGNC:16266 SLC19A3 gene SLC19A3 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 2 (biotin- or thiamine-responsive encephalopathy type 2), MIM# 607483;Childhood onset Dystonia and Parkinsonism PMID: 24260777 False 3 100;0;0 3.208 True ENSG00000135917 ENSG00000135917 HGNC:16266 SLC1A3 gene SLC1A3 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 6, MIM# 612656 19139306;16116111;29208948;27829685 False 3 100;0;0 3.208 True ENSG00000079215 ENSG00000079215 HGNC:10941 SLC1A3 gene SLC1A3 Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 6 MIM#612656 16116111;23107647;19139306;29741614;25497598;29208948;29062094 False 3 100;0;0 3.208 True ENSG00000079215 ENSG00000079215 HGNC:10941 SLC1A3 gene SLC1A3 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Episodic ataxia, type 6;Episodic ataxia type 6, 612656 False 3 100;0;0 3.208 False ENSG00000079215 ENSG00000079215 HGNC:10941 SLC20A2 gene SLC20A2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 1 213600;Dystonia 22327515;23334463;24411498 False 3 100;0;0 3.208 True ENSG00000168575 ENSG00000168575 HGNC:10947 SLC20A2 gene SLC20A2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 1, MIM# 213600 22327515;23334463 False 3 100;0;0 3.208 True ENSG00000168575 ENSG00000168575 HGNC:10947 SLC25A46 gene SLC25A46 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary motor and sensory neuropathy type VIB, MIM#616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303 30178502;26168012;27543974;27430653;27390132;28934388;28558379 False 3 100;0;0 3.208 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC2A1 gene SLC2A1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 9, MIM# 601042;MONDO:0010983 False 3 100;0;0 3.208 False ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted GLUT1 deficiency syndrome MONDO:0000188 18451999;34279792;18577546;34305802;27098784 False 3 100;0;0 3.208 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal dystonia 9;GLUT1 deficiency syndrome 2, 612126;GLUT1 DEFICIENCY SYNDROME 1;paroxysmal exertion-induced dyskinesia with or without epilepsy and/or hemolytic anemia;GLUT1 deficiency syndrome 1, 606777;Dystonia 9, 601042;EPILEPSY, IDIOPATHIC GENERALIZED False 3 100;0;0 3.208 False ENSG00000117394 ENSG00000117394 HGNC:11005 SLC2A1 gene SLC2A1 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted GLUT1-deficiency syndrome, MONDO:0000188;Dystonia 9 601042;GLUT1 deficiency syndrome 1, infantile onset, severe 606777;GLUT1 deficiency syndrome 2, childhood onset 612126;Stomatin-deficient cryohydrocytosis with neurologic defects 608885 32913944 False 3 100;0;0 3.208 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC30A10 gene SLC30A10 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal cirrhosis - dystonia - polycythemia - hypermanganesemia syndrome MONDO:0013208 22341971;22341972 False 3 100;0;0 3.208 True ENSG00000196660 ENSG00000196660 HGNC:25355 SLC30A10 gene SLC30A10 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia/Parkinsonism, Hypermanganesemia, Polycythemia, and Chronic Liver Disease;Hypermanganesemia with dystonia, polycythemia, and cirrhosis, 613280 False 3 0;0;0 3.208 False ENSG00000196660 ENSG00000196660 HGNC:25355 SLC30A9 gene SLC30A9 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Birk-Landau-Perez syndrome (MIM#617595)" 37041080 False 3 100;0;0 3.208 True ENSG00000014824 ENSG00000014824 HGNC:1329 SLC39A14 gene SLC39A14 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermanganesemia with dystonia 2 (MIM# 617013) 27231142;32626807;29685658;30232769 False 3 100;0;0 3.208 True ENSG00000104635 ENSG00000104635 HGNC:20858 SLC39A14 gene SLC39A14 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermanganesemia with dystonia 2 617013 False 3 0;0;0 3.208 False ENSG00000104635 ENSG00000104635 HGNC:20858 SLC44A1 gene SLC44A1 Expert Review Green;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset neurodegeneration;progressive ataxia tremor cognitive decline dysphagia optic atrophy dysarthria 31855247 False 3 100;0;0 3.208 True ENSG00000070214 ENSG00000070214 HGNC:18798 SLC52A2 gene SLC52A2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bwon-Vialetto-Van Laere syndrome 2, 614707 False 3 100;0;0 3.208 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC6A3 gene SLC6A3 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia, infantile, 1, MIM# 613135 21112253 False 3 100;0;0 3.208 True ENSG00000142319 ENSG00000142319 HGNC:11049 SLC6A3 gene SLC6A3 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dopamine transporter deficiency;Parkinsonism-dystonia, infantile, 613135 False 3 0;0;0 3.208 False ENSG00000142319 ENSG00000142319 HGNC:11049 SLC6A5 gene SLC6A5 Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 3, MIM# 614618 31604777;30847549;29859229;16751771 False 3 100;0;0 3.208 True ENSG00000165970 ENSG00000165970 HGNC:11051 SLC6A5 gene SLC6A5 Expert Review Green;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hyperekplexia 3, MIM# 614618 31604777;30847549;29859229;16751771 False 3 100;0;0 3.208 True ENSG00000165970 ENSG00000165970 HGNC:11051 SLC9A1 gene SLC9A1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Lichtenstein-Knorr Syndrome, MIM# 616291" 25205112;30018422;25760855 False 3 50;50;0 3.208 True ENSG00000090020 ENSG00000090020 HGNC:11071 SLC9A6 gene SLC9A6 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegenerative disorder, X-linked, female-restricted, with parkinsonism and cognitive impairement, MIM# 301142 35198730;39810750;35198730;31192222 False 3 100;0;0 3.208 True ENSG00000198689 ENSG00000198689 HGNC:11079 SLC9A6 gene SLC9A6 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Mental retardation, X-linked syndromic, Christianson type, 300243 False 3 100;0;0 3.208 False ENSG00000198689 ENSG00000198689 HGNC:11079 SNAP25 gene SNAP25 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Myasthenic syndrome, congenital, 18, 616330;cerebellar ataxia and seizures 29491473;25381298;17283335 False 3 100;0;0 3.208 True ENSG00000132639 ENSG00000132639 HGNC:11132 SNCA gene SNCA Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dementia, Lewy body (MIM#127750);Parkinson disease 1 (MIM#168601);Parkinson disease 4 (MIM#605543) 32849182;26858591;32740728 False 3 100;0;0 3.208 True ENSG00000145335 ENSG00000145335 HGNC:11138 SNORD118 gene SNORD118 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukoencephalopathy, brain calcifications, and cysts MIM#614561 27571260 False 3 100;0;0 3.208 True ENSG00000200463 ENSG00000200463 HGNC:32952 SNX14 gene SNX14 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 20, 616354;Autosomal recessive spinocerebellar ataxia (#616354) False 3 100;0;0 3.208 False ENSG00000135317 ENSG00000135317 HGNC:14977 SOX6 gene SOX6 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Tolchin-Le Caignec syndrome, MIM# 618971;Developmental delay;ID;ASD;ADHD;Parkinsonism;Syringomyelia" 24453155;25127144 False 3 100;0;0 3.208 True ENSG00000110693 ENSG00000110693 HGNC:16421 SPATA5L1 gene SPATA5L1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hearing loss and spasticity, MIM# 619616 34626583 False 3 100;0;0 3.208 True ENSG00000171763 ENSG00000171763 HGNC:28762 SPG11 gene SPG11 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary spastic paraplegia 11 MONDO:0011445 35036589;23121729;21381113;27217339 False 3 100;0;0 3.208 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG7 gene SPG7 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 7, autosomal recessive, MIM# 607259;Ataxia;Progressive external opthalmoplegia;Parkinsonism" PMID: 31433872 False 3 100;0;0 3.208 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7 (#607259) complex forms of the disease. Actually associated with a range of phenotypes including adult-onset ataxia;Autosomal recessive spastic paraplegia 7, 607259 False 3 100;0;0 3.208 False ENSG00000197912 ENSG00000197912 HGNC:11237 SPR gene SPR Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994 22522443;11920285;14663042;16443856;21782285;32813147 False 3 0;100;0 3.208 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPR gene SPR Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716 22522443;16650784;21431957;28189489 False 3 100;0;0 3.208 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPR gene SPR Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dystonia, dopa-responsive, due to sepiapterin reductase deficiency, MIM# 612716;MONDO:0012994 11443547;18502672;22522443;16532389;31777525;29147684;28189489 False 3 100;0;0 3.208 False ENSG00000116096 ENSG00000116096 HGNC:11257 SPR gene SPR Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiaterin reductase deficiency, 612716;Dystonia, dopa-responsive, due to sepiapterin reductase deficiency 612716 False 3 100;0;0 3.208 True ENSG00000116096 ENSG00000116096 HGNC:11257 SPTAN1 gene SPTAN1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 91, autosomal dominant, with or without cerebellar ataxia MONDO:0957813 36331550 False 3 100;0;0 3.208 True Other ENSG00000197694 ENSG00000197694 HGNC:11273 SPTBN2 gene SPTBN2 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 14, MIM# 615386;Spinocerebellar ataxia 5, MIM# 600224" 23236289;23838597;22781464;31617442;31066025 False 3 100;0;0 3.208 True ENSG00000173898 ENSG00000173898 HGNC:11276 SQSTM1 gene SQSTM1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 PMID: 27545679 False 3 100;0;0 3.208 True ENSG00000161011 ENSG00000161011 HGNC:11280 SQSTM1 gene SQSTM1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset, MIM# 617145 27545679 False 3 100;0;0 3.208 True ENSG00000161011 ENSG00000161011 HGNC:11280 SRD5A3 gene SRD5A3 Expert Review Green;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kahrizi syndrome, 612713;Congenital disorder of glycosylation, type Iq, 612379;Congenital disorder of glycosylation type Iq, 612379 False 3 100;0;0 3.208 True ENSG00000128039 ENSG00000128039 HGNC:25812 STUB1 gene STUB1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar Ataxia 48, OMIM 618093;Parkinsonism 30381368;32285148;32337344 False 3 100;0;0 3.208 True ENSG00000103266 ENSG00000103266 HGNC:11427 STUB1 gene STUB1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768" 25258038;24742043 False 3 100;0;0 3.208 True ENSG00000103266 ENSG00000103266 HGNC:11427 STXBP1 gene STXBP1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental and epileptic encephalopathy 4, MIM# 612164;Juvenile onset Parkinsonism 25418441;32643187;29929108 False 3 100;0;0 3.208 True ENSG00000136854 ENSG00000136854 HGNC:11444 SUCLA2 gene SUCLA2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria);Dystonia False 3 0;0;0 3.208 False ENSG00000136143 ENSG00000136143 HGNC:11448 SUFU gene SUFU Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Joubert syndrome 32, MIM#617757;Neurodevelopmental disorder, MONDO:0700092, SUFU-related 33024317 False 3 100;0;0 3.208 True ENSG00000107882 ENSG00000107882 HGNC:16466 SUOX gene SUOX Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sulfite oxidase deficiency MIM#272300 9600976;28933809;16140720 False 3 100;0;0 3.208 True ENSG00000139531 ENSG00000139531 HGNC:11460 SURF1 gene SURF1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leigh syndrome, due to COX IV deficiency, MIM# 256000" 19780766 False 3 100;0;0 3.208 True ENSG00000148290 ENSG00000148290 HGNC:11474 SVBP gene SVBP Expert Review Green;Expert list;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with ataxia, hypotonia, and microcephaly, 618569 31363758;30607023 False 3 100;0;0 3.208 True ENSG00000177868 ENSG00000177868 HGNC:29204 SYNE1 gene SYNE1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 8, MIM# 610743" 23325900;27086870 False 3 100;0;0 3.208 True ENSG00000131018 ENSG00000131018 HGNC:17089 SYNJ1 gene SYNJ1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 20, early-onset, MIM# 615530 23804563;23804577;27496670;33841314 False 3 100;0;0 3.208 True ENSG00000159082 ENSG00000159082 HGNC:11503 SYNJ1 gene SYNJ1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal juvenile Parkinsonism;Parkinson disease 20, early-onset False 3 0;0;0 3.208 False ENSG00000159082 ENSG00000159082 HGNC:11503 SYT1 gene SYT1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Baker-Gordon syndrome MIM#618218 30107533 False 3 100;0;0 3.208 True ENSG00000067715 ENSG00000067715 HGNC:11509 TBC1D23 gene TBC1D23 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 11, 617695 28823707;28823706 False 3 100;0;0 3.208 True ENSG00000036054 ENSG00000036054 HGNC:25622 TBC1D24 gene TBC1D24 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental and epileptic encephalopathy 16, MIM# 615338;Intellectual disability;Parkinsonism;Seizures;Psychosis PMID: 28663785;21087195 False 3 100;0;0 3.208 True ENSG00000162065 ENSG00000162065 HGNC:29203 TBC1D24 gene TBC1D24 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, rolandic, with proxysmal exercise-induce dystonia and writer's cramp, MIM# 608105;Episodic dystonia (Exercise induced or without clear trigger);epilepsy;myoclonus;hearing loss PMID 31257402;PMID 31226716;PMID 25719194 False 3 100;0;0 3.208 True ENSG00000162065 ENSG00000162065 HGNC:29203 TBCE gene TBCE Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, with amyotrophy and optic atrophy, OMIM #617207 PubMed: 27666369 False 3 100;0;0 3.208 True ENSG00000116957 ENSG00000116957 HGNC:11582 TCTN1 gene TCTN1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 13, MIM# 614173" 31302911;28631893;21725307;26477546;26489806 False 3 100;0;0 3.208 True ENSG00000204852 ENSG00000204852 HGNC:26113 TCTN2 gene TCTN2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 24, MIM# 616654" 25118024;21565611 False 3 100;0;0 3.208 True ENSG00000168778 ENSG00000168778 HGNC:25774 TCTN3 gene TCTN3 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 18, MIM# 614815;Orofaciodigital syndrome IV, MIM# 258860 22883145;25118024 False 3 100;0;0 3.208 True ENSG00000119977 ENSG00000119977 HGNC:24519 TDP2 gene TDP2 Expert Review Green;Expert list;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 23 31410782;30109272;24658003 False 3 100;0;0 3.208 True ENSG00000111802 ENSG00000111802 HGNC:17768 TH gene TH Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Segawa syndrome, recessive, MIM# 605407;MONDO:0011551 False 3 100;0;0 3.208 False ENSG00000180176 ENSG00000180176 HGNC:11782 TH gene TH Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Tyrosine hydroxylase deficiency MONDO:0100064 20301334;20301610 False 3 100;0;0 3.208 True ENSG00000180176 ENSG00000180176 HGNC:11782 THAP1 gene THAP1 Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Dystonia 6, torsion, 602629;Dystonia;MONDO:0011264 21793105;22377579;36205328;21425335;20211909 False 3 100;0;0 3.208 False ENSG00000131931 ENSG00000131931 HGNC:20856 TIMM8A gene TIMM8A Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Deafness-Dystonia-Optic Neuronopathy Syndrome;Mohr-Tranebjaerg syndrome, MIM# 304700 11803487;11405816;32820032 False 3 100;0;0 3.208 True ENSG00000126953 ENSG00000126953 HGNC:11817 TINF2 gene TINF2 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant dyskeratosis congenita 3, 613990;Revesz syndrome, 268130 18252230;21477109;18979121 False 3 100;0;0 3.208 True ENSG00000092330 ENSG00000092330 HGNC:11824 TMEM106B gene TMEM106B Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypomyelinating leukodystrophy 16, 617964 29186371;29444210 False 3 100;0;0 3.208 True ENSG00000106460 ENSG00000106460 HGNC:22407 TMEM151A gene TMEM151A Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Paroxysmal Kinesigenic Dyskinesia;episodic kinesigenic dyskinesia MONDO:0044202 34820915;34518509 False 3 100;0;0 3.208 False ENSG00000179292 ENSG00000179292 HGNC:28497 TMEM216 gene TMEM216 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 2, MIM# 608091" 20036350;20512146 False 3 100;0;0 3.208 True ENSG00000187049 ENSG00000187049 HGNC:25018 TMEM237 gene TMEM237 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 14, MIM# 614424" False 3 100;0;0 3.208 True ENSG00000155755 ENSG00000155755 HGNC:14432 TMEM240 gene TMEM240 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spinocerebellar ataxia 21, MIM# 607454" 25070513 False 3 100;0;0 3.208 True ENSG00000205090 ENSG00000205090 HGNC:25186 TMEM67 gene TMEM67 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 6, MIM# 610688" False 3 100;0;0 3.208 True ENSG00000164953 ENSG00000164953 HGNC:28396 TNPO2 gene TNPO2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Intellectual developmental disorder with hypotonia, impaired speech, and dysmorphic facies, MIM# 619556" 34314705 False 3 100;0;0 3.208 True ENSG00000105576 ENSG00000105576 HGNC:19998 TOR1A gene TOR1A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant or sporadic dystonia (DYT1);Early-Onset Primary Dystonia;Dystonia-1, torsion, 128100 9288096;19955557;18477710;32243914;31583275;31347572 False 3 100;0;0 3.208 False ENSG00000136827 ENSG00000136827 HGNC:3098 TPK1 gene TPK1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Thiamine metabolism dysfunction syndrome 5 (episodic encephalopathy type);Dystonia False 3 0;0;0 3.208 False ENSG00000196511 ENSG00000196511 HGNC:17358 TPP1 gene TPP1 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 7, 609270;Neuronal ceroid lipofuscinosis, 204500;Spinocerebellar ataxia, autosomal recessive 7, 609270;Ceroid lipofuscinosis, neuronal, 2, 204500 False 3 100;0;0 3.208 False ENSG00000166340 ENSG00000166340 HGNC:2073 TPP1 gene TPP1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis, neuronal, 2, MIM# 204500;Parkinsonism PMID: 21940688 False 3 100;0;0 3.208 True ENSG00000166340 ENSG00000166340 HGNC:2073 TREX1 gene TREX1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 1, dominant and recessive MIM#225750 20131292 False 3 100;0;0 3.208 True ENSG00000213689 ENSG00000213689 HGNC:12269 TRPM3 gene TRPM3 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia, dysmorphic facies, and skeletal anomalies, with or without seizures, MIM# 620224 31278393;35146895 False 3 100;0;0 3.208 True ENSG00000083067 ENSG00000083067 HGNC:17992 TSFM gene TSFM Expert Review Green;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3 False 3 100;0;0 3.208 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSPOAP1 gene TSPOAP1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 22, MIM# 620453 33539324 False 3 100;0;0 3.208 True ENSG00000005379 ENSG00000005379 HGNC:16831 TTBK2 gene TTBK2 Victorian Clinical Genetics Services;Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 11, 604432;Spinocerebellar ataxia 11 False 3 50;50;0 3.208 False ENSG00000128881 ENSG00000128881 HGNC:19141 TTC19 gene TTC19 Expert Review Green;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency nuclear type II, 615157;Mitochondrial complex III deficiency, nuclear type 2, 615157 False 3 100;0;0 3.208 True ENSG00000011295 ENSG00000011295 HGNC:26006 TTI1 gene TTI1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and movement abnormalities, MIM# 620445 26539891;30315573;36724785 False 3 50;25;25 3.208 True ENSG00000101407 ENSG00000101407 HGNC:29029 TTPA gene TTPA NHS GMS;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia with isolated vitamin E deficiency, MIM# 277460" False 3 100;0;0 3.208 True ENSG00000137561 ENSG00000137561 HGNC:12404 TUBA4A gene TUBA4A Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic ataxia 11, autosomal dominant, MIM# 621226 38884572;37418012 False 3 100;0;0 3.208 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBB4A gene TUBB4A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted hereditary whispering dysphonia;Dystonia 4, torsion, autosomal dominant, 128101;Dystonia 23424103;23595291;33084096;32943487 False 3 100;0;0 3.208 False ENSG00000104833 ENSG00000104833 HGNC:20774 TUBB4A gene TUBB4A Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Leukodystrophy, hypomyelinating, 6, 612438;Dystonia 4, 128101, Hypomyelinating leukodystrophy 6, 612438;Dystonia 4, torsion, autosomal dominant, 128101 False 3 100;0;0 3.208 False ENSG00000104833 ENSG00000104833 HGNC:20774 TWNK gene TWNK Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286 24076137;22949510;22580846;19353676 False 3 100;0;0 3.208 True ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Royal Melbourne Hospital;Expert Review Green Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 7, 271245;Ataxia Neuropathy Spectrum Disorders, Dominant;Progressive external ophthalmoplegia with mitochondrial DNA deletions, 609286;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, 609286;Perrault syndrome 5, 616138;Mitochondrial DNA depletion syndrome 7 (hepatocerebral type), 271245;Spinocerebellar Ataxia, Recessive False 3 100;0;0 3.208 False ENSG00000107815 ENSG00000107815 HGNC:1160 UBTF gene UBTF Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;Parkinsonism;Dystonia;Chorea;Brain atrophy PubMed: 28777933;29300972 False 3 100;0;0 3.208 True ENSG00000108312 ENSG00000108312 HGNC:12511 UBTF gene UBTF Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701 29300972 False 3 100;0;0 3.208 True ENSG00000108312 ENSG00000108312 HGNC:12511 UBTF gene UBTF Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration, childhood-onset, with brain atrophy, MIM# 617672;MONDO:0044701 28777933;29300972 False 3 100;0;0 3.208 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000108312 ENSG00000108312 HGNC:12511 UCHL1 gene UCHL1 Expert Review Green;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 79, autosomal recessive, MIM#615491;Neurodegenerative disease, MONDO:0005559, UCHL1-related 28007905;23359680;11555633;35986737 False 3 100;0;0 3.208 True ENSG00000154277 ENSG00000154277 HGNC:12513 UNC13A gene UNC13A Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with speech delay, movement abnormalities, and seizures, MIM# 621456 27648472;28192369;41125872 False 3 100;0;0 3.208 True Other ENSG00000130477 ENSG00000130477 HGNC:23150 VAC14 gene VAC14 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Striatonigral degeneration, childhood-onset, MIM# 617054;Dystonia;Parkinsonism PMID: 31392254;28502045 False 3 100;0;0 3.208 True ENSG00000103043 ENSG00000103043 HGNC:25507 VAC14 gene VAC14 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Striatonigral degeneration, childhood-onset 617054 False 3 0;0;0 3.208 False ENSG00000103043 ENSG00000103043 HGNC:25507 VAMP2 gene VAMP2 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with hypotonia and autistic features with or without hyperkinetic movements 618760;Dystonia;Cortical visual impairment;Seizures;Stereotypic behaviour;Generalized hypotonia;Intellectual disability 30929742 False 3 100;0;0 3.208 True ENSG00000220205 ENSG00000220205 HGNC:12643 VCP gene VCP Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with Paget disease of bone and frontotemporal dementia MONDO:0000507 38283104;38145206 False 3 100;0;0 3.208 True Other ENSG00000165280 ENSG00000165280 HGNC:12666 VLDLR gene VLDLR Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, mental retardation and dysequilibirum syndrome 1, 224050;Cerebellar hypoplasia and mental retardation with or without quadrupedal locomotion 1, 224050 False 3 100;0;0 3.208 False ENSG00000147852 ENSG00000147852 HGNC:12698 VPS13A gene VPS13A Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex parkinsonism;Choreoacanthocytosis 200150 False 3 0;0;0 3.208 False ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13A gene VPS13A Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal chorea-acanthocytosis MONDO:0008695 20301561;37636221 False 3 100;0;0 3.208 True ENSG00000197969 ENSG00000197969 HGNC:1908 VPS13C gene VPS13C Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 23, autosomal recessive, early onset MIM#616840 26942284;30452786;28862745 False 3 100;0;0 3.208 True ENSG00000129003 ENSG00000129003 HGNC:23594 VPS13D gene VPS13D Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317" 29604224;29518281 False 3 100;0;0 3.208 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS13D gene VPS13D Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 4, MIM# 607317" 29604224;29518281 False 3 100;0;0 3.208 True ENSG00000048707 ENSG00000048707 HGNC:23595 VPS16 gene VPS16 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia 30, MIM#619291 32808683 False 3 100;0;0 3.208 True ENSG00000215305 ENSG00000215305 HGNC:14584 VPS35 gene VPS35 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinson disease 17, MIM# 614203 21763482;21763483;22801713;34704029 False 3 100;0;0 3.208 True ENSG00000069329 ENSG00000069329 HGNC:13487 VPS41 gene VPS41 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay 32808683;33764426 False 3 100;0;0 3.208 True ENSG00000006715 ENSG00000006715 HGNC:12713 VPS41 gene VPS41 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia-29 (SCAR29), MIM#619389;Progressive neurodevelopmental disorder with ataxia, hypotonia, dystonia, intellectual disability and speech delay 32808683;33764426 False 3 100;0;0 3.208 True ENSG00000006715 ENSG00000006715 HGNC:12713 VPS4A gene VPS4A Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted CIMDAG syndrome MIM# 619273 33186543;33186545 False 3 100;0;0 3.208 True Other ENSG00000132612 ENSG00000132612 HGNC:13488 VWA3B gene VWA3B Expert Review Green;GeneReviews;Royal Melbourne Hospital;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 22 MIM#616948 26157035 False 3 50;0;50 3.208 True ENSG00000168658 ENSG00000168658 HGNC:28385 WARS2 gene WARS2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 3.208 True ENSG00000116874 ENSG00000116874 HGNC:12730 WARS2 gene WARS2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738 PMID: 29120065;34890876;31970218 False 3 100;0;0 3.208 True ENSG00000116874 ENSG00000116874 HGNC:12730 WARS2 gene WARS2 Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinsonism-dystonia 3, childhood-onset, MIM# 619738;Neurodevelopmental disorder, mitochondrial, with abnormal movements and lactic acidosis, with or without seizures, MIM# 617710 29120065;31970218;34890876;28236339;28650581;28905505;30920170 False 3 100;0;0 3.208 True ENSG00000116874 ENSG00000116874 HGNC:12730 WDR45 gene WDR45 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodegeneration with brain iron accumulation 5 300894;beta-propeller protein-associated neurodegeneration;Dystonia False 3 0;0;0 3.208 False ENSG00000196998 ENSG00000196998 HGNC:28912 WDR45 gene WDR45 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked complex neurodevelopmental disorder MONDO:0100148 28211668 False 3 100;0;0 3.208 True ENSG00000196998 ENSG00000196998 HGNC:28912 WDR73 gene WDR73 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway Mowat syndrome, when patients are ambulant ataxia is a recognisednfeature;Galloway-Mowat Syndrome 1, 251300 False 3 100;0;0 3.208 False ENSG00000177082 ENSG00000177082 HGNC:25928 WDR73 gene WDR73 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Galloway-Mowat syndrome 1, 251300 False 3 0;0;0 3.208 False ENSG00000177082 ENSG00000177082 HGNC:25928 WDR81 gene WDR81 Expert Review Red;Expert Review Red;Expert list;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital hydrocephalus 3 with brain anomalies, 617967;Cerebellar ataxia, mental retardation, and dysequilibrium syndrome 2, 610185;Cerebellar ataxia, mental retardation and dysequilibrium syndrome 2, 610185 21885617;28556411;28969387 False 3 33;0;67 3.208 True ENSG00000167716 ENSG00000167716 HGNC:26600 WFS1 gene WFS1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wolfram syndrome 1, 222300 25211237 False 3 100;0;0 3.208 True ENSG00000109501 ENSG00000109501 HGNC:12762 WWOX gene WWOX Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spinocerebellar ataxia 12, 6143232;Early infantile epileptic encephalopathy 28, 616211;Autosomal recessive spinocerebellar ataxia 12, 614322 False 3 100;0;0 3.208 False ENSG00000186153 ENSG00000186153 HGNC:12799 XK gene XK Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) McLeod syndrome with or without chronic granulomatous disease MIM#300842 11761473 False 3 100;0;0 3.208 True ENSG00000047597 ENSG00000047597 HGNC:12811 XPR1 gene XPR1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Basal ganglia calcification, idiopathic, 6, MIM# 616413 25938945 False 3 100;0;0 3.208 True ENSG00000143324 ENSG00000143324 HGNC:12827 XRCC1 gene XRCC1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 26 MIM#617633 28002403;29472272 False 3 100;0;0 3.208 True ENSG00000073050 ENSG00000073050 HGNC:12828 YIF1B gene YIF1B Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kaya-Barakat-Masson syndrome, MIM# 619125;Central hypotonia;Failure to thrive;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Spasticity;Abnormality of movement 32006098;26077767 False 3 100;0;0 3.208 True ENSG00000167645 ENSG00000167645 HGNC:30511 YY1 gene YY1 Expert Review Green;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Gabriele-de Vries syndrome 617557 False 3 0;0;0 3.208 False ENSG00000100811 ENSG00000100811 HGNC:12856 ZFYVE26 gene ZFYVE26 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 15, autosomal recessive, MIM# 270700;Spastic paraplegia and retinal degeneration;Kjellin syndrome;Parkinsonism" PMID: 33033739;21462267 False 3 100;0;0 3.208 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZNF526 gene ZNF526 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dentici-Novelli neurodevelopmental syndrome, MIM# 619877 21937992;25558065;33397746 False 3 100;0;0 3.208 True ENSG00000167625 ENSG00000167625 HGNC:29415 ABAT gene ABAT Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GABA-transaminase deficiency, MIM# 613163;intellectual disability;autism;DEE;epilepsy;paroxysmal dyskinesia 30617166 False 2 0;100;0 3.208 True ENSG00000183044 ENSG00000183044 HGNC:23 ACBD5 gene ACBD5 Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy;syndromic cleft palate;ataxia;retinal dystrophy 27799409;23105016 False 2 50;50;0 3.208 True ENSG00000107897 ENSG00000107897 HGNC:23338 AFG3L2 gene AFG3L2 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 28, MIM# 610246;optic atrophy;spastic ataxia;L-dopa-responsive parkinsonism 30252181;36110148 False 2 33;33;33 3.208 True ENSG00000141385 ENSG00000141385 HGNC:315 AFG3L2 gene AFG3L2 Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive MIM#614487;Early-onset dystonia 22964162;16541453;32219868;36110148 False 2 33;0;67 3.208 True ENSG00000141385 ENSG00000141385 HGNC:315 ALK gene ALK Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic-dystonic diplegia PMID: 32989326 False 2 0;100;0 3.208 True ENSG00000171094 ENSG00000171094 HGNC:427 APP gene APP Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease 1, familial, MIM# 104300 False 2 0;100;0 3.208 True ENSG00000142192 ENSG00000142192 HGNC:620 ARFGEF3 gene ARFGEF3 Literature;Expert Review Amber;Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, MONDO:0044807, ARFGEF3-related PMID: 33098801 False 2 50;50;0 3.208 False ENSG00000112379 ENSG00000112379 HGNC:21213 ATG5 gene ATG5 Expert Review Amber;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Spinocerebellar ataxia, autosomal recessive 25 16625204;26812546 False 2 0;100;0 3.208 True ENSG00000057663 ENSG00000057663 HGNC:589 ATP5B gene ATP5B Expert Review Amber;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Dystonia 38, susceptibility to, MIM# 621502 36860166;40276935 False 2 50;50;0 3.208 True ENSG00000110955 ENSG00000110955 HGNC:830 ATP7B gene ATP7B Expert Review Amber;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Wilson disease, MIM# 277900 32662046 False 2 0;100;0 3.208 True ENSG00000123191 ENSG00000123191 HGNC:870 C17orf80 gene C17orf80 Expert Review Amber;Literature;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970 41720819 False 2 0;100;0 3.208 True ENSG00000141219 ENSG00000141219 HGNC:29601 CACNB4 gene CACNB4 Expert Review Amber;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 5, MIM#613855 10762541;9628818;27003325 False 2 0;100;0 3.208 True ENSG00000182389 ENSG00000182389 HGNC:1404 CACNB4 gene CACNB4 Expert Review Red;Expert list;Expert Review Amber;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Episodic ataxia, type 5, MIM#613855 10762541;9628818;27003325 False 2 0;50;50 3.208 True ENSG00000182389 ENSG00000182389 HGNC:1404 CAPN1 gene CAPN1 Expert list;Expert Review Amber;Expert list;Expert Review Green;Expert Review Green;Expert list;Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76, autosomal recessive, 616907;MONDO:0014827 27320912;29678961;30572172;31023339;31104286 False 2 50;50;0 3.208 False ENSG00000014216 ENSG00000014216 HGNC:1476 CCDC88C gene CCDC88C Victorian Clinical Genetics Services;GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown autosomal dominant spinocerebellar ataxia;?Spinocerebellar ataxia 40, 616053 25062847;30398676 False 2 33;67;0 3.208 False ENSG00000015133 ENSG00000015133 HGNC:19967 CHD8 gene CHD8 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, CHD8-related, MIM#615032;Dystonia 34415117 False 2 0;100;0 3.208 True ENSG00000100888 ENSG00000100888 HGNC:20153 CHP1 gene CHP1 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 9, autosomal recessive, OMIM #618438 29379881;32787936 False 2 50;50;0 3.208 True ENSG00000187446 ENSG00000187446 HGNC:17433 CIZ1 gene CIZ1 Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Dystonia 23, 614860 27163549;29154038;22447717 False 2 0;100;0 3.208 False ENSG00000148337 ENSG00000148337 HGNC:16744 COASY gene COASY Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 6, MIM# 615643 28489334;24360804 False 2 0;100;0 3.208 True ENSG00000068120 ENSG00000068120 HGNC:29932 COL6A3 gene COL6A3 Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Amber;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 27, MIM#616411 26004199;32037012;26872670;32037012 False 2 50;50;0 3.208 False ENSG00000163359 ENSG00000163359 HGNC:2213 DDC gene DDC Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aromatic L-amino acid decarboxylase deficiency, MIM# 608643;Infantile-onset parkinsonism & dystonia;Bulbar dysfunction;Oculogyric crisis;Autonomic dysfunction;Intellectual disability PMID: 33983693 False 2 50;50;0 3.208 True ENSG00000132437 ENSG00000132437 HGNC:2719 DHDDS gene DHDDS Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Developmental delay and seizures with or without movement abnormalities, MIM# 617836;Myoclonic Epilepsy;Parkinsonism;Ataxia;Intellectual disability PMID: 34837344;29100083 False 2 50;50;0 3.208 True ENSG00000117682 ENSG00000117682 HGNC:20603 EPM2A gene EPM2A Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2A (Lafora), MIM# 254780;Progressive Myoclonic Epilepsy;Parkinsonism 27574708;28818698 False 2 50;50;0 3.208 True ENSG00000112425 ENSG00000112425 HGNC:3413 FBXL4 gene FBXL4 Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 13 (encephalomyopathic type) MIM#615471 False 2 0;100;0 3.208 True ENSG00000112234 ENSG00000112234 HGNC:13601 HACE1 gene HACE1 Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia and psychomotor retardation with or without seizures MIM#616756 26424145;26437029 False 2 0;100;0 3.208 True ENSG00000085382 ENSG00000085382 HGNC:21033 HARS gene HARS Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal multisystem ataxic syndrome 32333447 False 2 33;67;0 3.208 True ENSG00000170445 ENSG00000170445 HGNC:4816 JPH3 gene JPH3 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal paroxysmal dystonia, intellectual disability PMID: 36273396 False 2 50;50;0 3.208 True ENSG00000154118 ENSG00000154118 HGNC:14203 KCNQ2 gene KCNQ2 Expert Review Amber;Expert list;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early infantile encephalopathy 7, 613720;Myokymia, 121200 22169383;20962009;10575255 False 2 33;67;0 3.208 True ENSG00000075043 ENSG00000075043 HGNC:6296 KCNQ2 gene KCNQ2 Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Epileptic encephalopathy, early infantile, 7 MIM#613720 12742592;32585800 False 2 0;100;0 3.208 True ENSG00000075043 ENSG00000075043 HGNC:6296 KIF1C gene KIF1C Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic ataxia 2, autosomal recessive, MIM# 611302" 31413903 False 2 0;100;0 3.208 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF5A gene KIF5A Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 10, autosomal dominant MIM#604187 18853458 False 2 0;100;0 3.208 True ENSG00000155980 ENSG00000155980 HGNC:6323 MAPK8IP3 gene MAPK8IP3 Expert Review Amber;Literature;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without variable brain abnormalities OMIM# 605431 30612693;30945334 False 2 0;100;0 3.208 True ENSG00000138834 ENSG00000138834 HGNC:6884 MAPT gene MAPT Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dementia, frontotemporal, with or without parkinsonism MIM#600274 17319286;15883319 False 2 0;100;0 3.208 True ENSG00000186868 ENSG00000186868 HGNC:6893 MKKS gene MKKS Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bardet-Biedl syndrome 6, 605231 15637713 False 2 67;33;0 3.208 True ENSG00000125863 ENSG00000125863 HGNC:7108 MRPS36 gene MRPS36 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome - MONDO:0009723, MRPS36/KGD4-related PMID: 41018056;38685873 False 2 0;100;0 3.208 True ENSG00000134056 ENSG00000134056 HGNC:16631 MTPAP gene MTPAP Expert Review Green;Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Ataxia, spastic, 4,;Autosomal recessive spastic ataxia 4, 613672 20970105;26319014;25008111 False 2 50;50;0 3.208 True ENSG00000107951 ENSG00000107951 HGNC:25532 MT-TC gene MT-TC Expert Review Amber;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TC-related 8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363 False 2 0;100;0 3.208 True ENSG00000210140 ENSG00000210140 HGNC:7477 MT-TC gene MT-TC Expert Review Amber;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TC-related 8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363 False 2 0;100;0 3.208 True ENSG00000210140 ENSG00000210140 HGNC:7477 NBEA gene NBEA Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with or without early-onset generalized epilepsy, MIM# 619157;Paroxysmal Kinesigenic Dyskinesia;DEE;autism;intellectual disability 33692494 False 2 0;100;0 3.208 True ENSG00000172915 ENSG00000172915 HGNC:7648 NHLRC1 gene NHLRC1 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 2B (Lafora), MIM# 254780;Lafora disease;Progressive Myoclonic Epilepsy;Parkinsonism 22425593;32301727 False 2 50;50;0 3.208 True ENSG00000187566 ENSG00000187566 HGNC:21576 NUP54 gene NUP54 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia 37, early-onset, with striatal lesions, MIM# 620427;Early onset dystonia;progressive neurological deterioration;ataxia;dysarthria;dysphagia;hypotonia 36333996 False 2 0;100;0 3.208 True ENSG00000138750 ENSG00000138750 HGNC:17359 PCNA gene PCNA Expert Review Amber;ClinGen Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary ataxia MONDO:0100309 24911150, 33426167, 36990216 False 2 0;100;0 3.208 True ENSG00000132646 ENSG00000132646 HGNC:8729 PLD3 gene PLD3 GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Spinocerebellar ataxia 46 29053796;30312375;30312384;38059248 False 2 0;100;0 3.208 False ENSG00000105223 ENSG00000105223 HGNC:17158 PNPLA6 gene PNPLA6 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal PNPLA6-related spastic paraplegia with or without ataxia MONDO:0100149 32623594;36825042 False 2 0;100;0 3.208 True ENSG00000032444 ENSG00000032444 HGNC:16268 PRKCG gene PRKCG Expert Review Amber;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 14, MIM# 605361 34292398 False 2 0;100;0 3.208 True ENSG00000126583 ENSG00000126583 HGNC:9402 PRKN gene PRKN Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease, juvenile, type 2 MIM#600116;paroxysmal exercise induced dyskinesia;fasting induced dyskinesia;early onset parkinsonism 37205242 False 2 0;100;0 3.208 True ENSG00000185345 ENSG00000185345 HGNC:8607 PRPS1 gene PRPS1 Literature;Expert Review Amber;Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adult-onset progressive ataxia, congenital strabismus, infantile-onset hearing loss, retinal dystrophy 33898739;28967191 False 2 0;100;0 3.208 False ENSG00000147224 ENSG00000147224 HGNC:9462 PTPA gene PTPA Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Intellectual disability, MONDO: 36073231, PTPA-related;Parkinson disease MONDO:0005180, PTPA-related 36073231;37448355;37046398 False 2 0;100;0 3.208 True ENSG00000119383 ENSG00000119383 HGNC:9308 RFXANK gene RFXANK Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive Ataxia and Neurologic Regression;MHC class II deficiency, complementation group B MIM#209920 PMID: 33855173;23314770;28676232 False 2 50;50;0 3.208 True ENSG00000064490 ENSG00000064490 HGNC:9987 SAMHD1 gene SAMHD1 Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 5 MIM#612952 20131292 False 2 0;100;0 3.208 True ENSG00000101347 ENSG00000101347 HGNC:15925 SDHA gene SDHA Expert list;Expert Review Amber;Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegeneration with ataxia and late-onset optic atrophy, MIM# 619259 10976639;27683074 False 2 0;100;0 3.208 False ENSG00000073578 ENSG00000073578 HGNC:10680 SHQ1 gene SHQ1 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with dystonia and seizures, MIM# 619922 36847845 False 2 50;50;0 3.208 True ENSG00000144736 ENSG00000144736 HGNC:25543 SIDT2 gene SIDT2 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lysosomal storage disease, MONDO:0002561, SIDT2-related PMID: 40541391 False 2 0;100;0 3.208 True ENSG00000149577 ENSG00000149577 HGNC:24272 SPR gene SPR Expert Review Amber;Royal Children's Hospital Neurology Department;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dopa-responsive dystonia due to sepiapterin reductase deficiency MONDO:0012994 32591469 False 2 0;100;0 3.208 True ENSG00000116096 ENSG00000116096 HGNC:11257 SYNGAP1 gene SYNGAP1 Expert Review Amber;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Autosomal dominant mental retardation 5, 612621 26989088 False 2 0;100;0 3.208 True ENSG00000197283 ENSG00000197283 HGNC:11497 TDP1 gene TDP1 Expert Review Amber;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250 31182267;12244316;39576382 False 2 0;100;0 3.208 True ENSG00000042088 ENSG00000042088 HGNC:18884 TENM4 gene TENM4 Literature;Expert Review Amber;Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted tremor, hereditary essential, 5 MONDO:0014756 41449293;36689009;26188006;29249217;34589676;22915103 False 2 0;100;0 3.208 False ENSG00000149256 ENSG00000149256 HGNC:29945 THG1L gene THG1L Expert Review Amber;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 28, MIM# 618800 27307223;30214071;31168944 False 2 0;100;0 3.208 True ENSG00000113272 ENSG00000113272 HGNC:26053 TMEM138 gene TMEM138 Expert Review Amber;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Joubert syndrome 16, MIM# 614465" False 2 0;100;0 3.208 True ENSG00000149483 ENSG00000149483 HGNC:26944 TMEM231 gene TMEM231 Expert Review Amber;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Joubert syndrome 20, MIM# 614970;Meckel syndrome 11 615397 False 2 0;100;0 3.208 True ENSG00000205084 ENSG00000205084 HGNC:37234 TRPC3 gene TRPC3 GeneReviews;Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown 25477146;26112884 False 2 0;100;0 3.208 False ENSG00000138741 ENSG00000138741 HGNC:12335 UBA5 gene UBA5 Expert Review Amber;Royal Melbourne Hospital;GeneReviews Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Autosomal recessive spinocerebellar ataxia 24, 617133;Early infantile epileptic encephalopathy 44, 617132 26872069;29902590 False 2 0;100;0 3.208 True ENSG00000081307 ENSG00000081307 HGNC:23230 UBR4 gene UBR4 Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Episodic ataxia;Episodic ataxia type 8, 616055 29062094;23982692;28600779 False 2 0;100;0 3.208 True ENSG00000127481 ENSG00000127481 HGNC:30313 UQCRC1 gene UQCRC1 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Parkinsonism with polyneuropathy, MIM# 619279 33141179;33248804 False 2 50;50;0 3.208 True ENSG00000010256 ENSG00000010256 HGNC:12585 VAMP1 gene VAMP1 Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Autosomal dominant spastic ataxia 1, 108600;Spastic ataxia 1, autosomal dominant, 108600 22958904 False 2 0;100;0 3.208 False ENSG00000139190 ENSG00000139190 HGNC:12642 VAMP1 gene VAMP1 Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic ataxia 1, autosomal dominant, MIM# 108600" 22958904 False 2 0;100;0 3.208 True ENSG00000139190 ENSG00000139190 HGNC:12642 VRK1 gene VRK1 Expert Review Amber;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 1A, 607596 19646678;21937992;25609612;24126608;27281532 False 2 0;100;0 3.208 True ENSG00000100749 ENSG00000100749 HGNC:12718 XPR1 gene XPR1 Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Basal ganglia calcification, idiopathic, 6, MIM# 616413;brain calcification;basal ganglia calcification;paroxysmal dyskinesia;epilepsy;DEE 33433330 False 2 0;100;0 3.208 True ENSG00000143324 ENSG00000143324 HGNC:12827 ZFYVE26 gene ZFYVE26 Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autosomal recessive spastic paraplegia 15, 270700 24367272;18394578 False 2 0;100;0 3.208 False ENSG00000072121 ENSG00000072121 HGNC:20761 ARX_EIEE1_GCN1 str ARX Expert Review Green;Expert Review Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 11889467;33811808 False 3 100;0;0 3.208 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031767 25031814 25013650 25013697 GCN 16 23 ARX_EIEE1_GCN2 str ARX Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Developmental and epileptic encephalopathy 1 MIM#308350;Intellectual disability, X-linked 29 and others MIM#300419;Partington syndrome MIM#309510 11889467;33811808 False 3 100;0;0 3.208 True ENSG00000004848 ENSG00000004848 HGNC:18060 X 25031647 25031682 25013530 25013565 GCN 12 20 ATN1_DRPLA_CAG str ATN1 Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 8136840;8136826;29325606;20301664 False 3 100;0;0 3.208 False ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 ATN1_DRPLA_CAG str ATN1 Expert Review Green;Expert List Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dentatorubral-pallidoluysian atrophy MIM#125370 29325606;20301664 False 3 100;0;0 3.208 True ENSG00000111676 ENSG00000111676 HGNC:3033 12 7045892 7045936 6936729 6936773 CAG 35 48 ATXN10_SCA10_ATTCT str ATXN10 Expert Review Green;Expert List Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 10 MIM#603516 20301354 False 3 100;0;0 3.208 True ENSG00000130638 ENSG00000130638 HGNC:10549 22 46191235 46191304 45795355 45795424 ATTCT 32 800 ATXN1_SCA1_CAG str ATXN1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar Ataxia type 1;Parkinsonism;OMIM 164400 " PMID: 24602359" False 3 100;0;0 3.208 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327867 16327953 16327636 16327722 CAG 36 45 ATXN1_SCA1_CAG str ATXN1 Expert Review Green;Expert List Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 1 MIM#164400 29325606;20301363 False 3 100;0;0 3.208 True ENSG00000124788 ENSG00000124788 HGNC:10548 6 16327918 16327953 16327687 16327722 CAG 35 39 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 2 MONDO:0008458 40741828 False 3 100;0;0 3.208 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 11761482;17923635;8896555;29325606;20301452 False 3 100;0;0 3.208 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599019 CAG 31 35 ATXN3_SCA3_CAG str ATXN3 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 11176969;7574470;7874163;20301375;29325606 False 3 100;0;0 3.208 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 ATXN3_SCA3_CAG str ATXN3 Expert Review Green;Expert List Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Machado-Joseph disease MIM#109150;Spinocerebellar ataxia type 3 20301375;29325606 False 3 100;0;0 3.208 True ENSG00000066427 ENSG00000066427 HGNC:7106 14 92537355 92537396 92071011 92071052 CAG 44 60 ATXN7_SCA7_CAG str ATXN7 Expert Review Green;Expert List Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 7 MIM#164500 29325606;20301433 False 3 100;0;0 3.208 True ENSG00000163635 ENSG00000163635 HGNC:10560 3 63898362 63898391 63912686 63912715 CAG 27 37 ATXN8OS_SCA8_CTG str ATXN8OS Expert Review Green;Expert List Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 20301445 False 3 100;0;0 3.208 True ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139422 CTG 50 80 ATXN8OS_SCA8_CTG str ATXN8OS Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 8 MIM#608768 24285970;20301445;10192387 False 3 100;0;0 3.208 True ENSG00000230223 ENSG00000230223 HGNC:10561 13 70713486 70713560 70139354 70139428 CTG 50 80 BEAN1_SCA31_TGGAA str BEAN1 Expert Review Green;Expert List Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 31 MIM#117210 19878914;31755042 False 3 100;0;0 3.208 True ENSG00000166546 ENSG00000166546 HGNC:24160 16 66524300 66524369 66490397 66490466 TGGAA 22 80 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 26166205;24363131;26187722;25577942;21944779;21944778 False 3 100;0;0 3.208 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 25577942;21944779;21944778;31779815 False 3 100;0;0 3.208 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 CACNA1A_SCA6_CAG str CACNA1A Expert Review Green;Expert List Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 6 MIM#183086;Episodic ataxia, type 2 MIM#108500 20301319;29325606 False 3 100;0;0 3.208 True ENSG00000141837 ENSG00000141837 HGNC:1388 19 13318673 13318691 13207859 13207897 CAG 18 20 CSTB_EPM1_CCCCGCCCCGCG str CSTB Literature;Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg) MIM#254800 29325606;20301321 False 3 100;0;0 3.208 False ENSG00000160213 ENSG00000160213 HGNC:2482 21 45196325 45196360 43776444 43776479 CCCCGCCCCGCG 3 30 DAB1_SCA37_ATTTC str DAB1 Literature;Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 37 MIM#615945 28686858;31145571 False 3 100;0;0 3.208 False ENSG00000173406 ENSG00000173406 HGNC:2661 1 57832716 57832797 57367044 57367121 ATTTC 0 31 FGF14_SCA27B_GAA str FGF14 Literature;Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia type 27B MONDO:0012247;Spinocerebellar ataxia 50;late-onset cerebellar ataxias (LOCAs) 37165652;36516086;36493768 False 3 100;0;0 3.208 False ENSG00000102466 ENSG00000102466 HGNC:3671 13 102813926 102814076 102161576 102161726 GAA 249 300 FMR1_FXTAS_CGG str FMR1 Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 23765048;25227148 False 3 100;0;0 3.208 False ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FMR1_FXTAS_CGG str FMR1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Fragile X tremor/ataxia syndrome MIM#300623 27340021;28176767;20301558;23765048;25227148;11445641 False 3 100;0;0 3.208 True ENSG00000102081 ENSG00000102081 HGNC:3775 X 146993569 146993628 147912051 147912110 CGG 44 55 FXN_FRDA_GAA str FXN Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 20301458 False 3 100;0;0 3.208 False ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 HTT_HD_CAG str HTT Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease MIM#143100 20301482;29325606 False 3 100;0;0 3.208 False ENSG00000197386 ENSG00000197386 HGNC:4851 4 3076604 3076666 3074877 3074939 CAG 26 40 HTT_HD_CAG str HTT Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease MIM#143100 8458085;20301482;29325606 False 3 100;0;0 3.208 False ENSG00000197386 ENSG00000197386 HGNC:4851 4 3076604 3076666 3074877 3074939 CAG 26 40 JPH3_HDL2_CTG str JPH3 Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 11558794;20301701 False 3 100;0;0 3.208 False ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 JPH3_HDL2_CTG str JPH3 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Huntington disease-like 2 MIM#606438 11558794;20301701 False 3 100;0;0 3.208 True ENSG00000154118 ENSG00000154118 HGNC:14203 16 87637894 87637935 87604288 87604329 CTG 28 40 NOP56_SCA36_GGCCTG str NOP56 Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 36 MIM#614153 21683323 False 3 100;0;0 3.208 False ENSG00000101361 ENSG00000101361 HGNC:15911 20 2633380 2633403 2652734 2652757 GGCCTG 14 650 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 3.208 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 PPP2R2B_SCA12_CAG str PPP2R2B Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 27864267;33811808 False 3 100;0;0 3.208 False ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 PPP2R2B_SCA12_CAG str PPP2R2B Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 12 MIM#604326 31286011;27864267;33811808;10581021 False 3 100;0;0 3.208 True ENSG00000156475 ENSG00000156475 HGNC:9305 5 146258292 146258321 146878729 146878758 CAG 32 51 PRNP_CJD_octapeptide str PRNP Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 2159587;20301407 False 3 100;0;0 3.208 False ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 PRNP_CJD_octapeptide str PRNP Literature;Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 2159587;20301407 False 3 100;0;0 3.208 False ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699424 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 PRNP_CJD_octapeptide str PRNP Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Creutzfeldt-Jakob disease MIM#123400;Gerstmann-Straussler disease MIM#137440 2159587;20301407 False 3 100;0;0 3.208 True ENSG00000171867 ENSG00000171867 HGNC:9449 20 4680026 4680073 4699380 4699427 GGTGGTGGCTGGGGGCAGCCTCAT 4 5 RFC1_CANVAS_ANNGN str RFC1 Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease MONDO:0005180 39833204;39152783;38789445;36705320;35013364 False 3 100;0;0 3.208 True ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 RFC1_CANVAS_ANNGN str RFC1 Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972 False 3 100;0;0 3.208 False ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 TAF1_XDP_CCCTCT str TAF1 Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia-Parkinsonism, X-linked MIM#314250 17273961;29229810 False 3 100;0;0 3.208 True ENSG00000147133 ENSG00000147133 HGNC:11535 X 70672905 70672979 71453055 71453129 CCCTCT 13 30 TAF1_XDP_CCCTCT str TAF1 Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Dystonia-Parkinsonism, X-linked MIM#314250 17273961;29229810 False 3 100;0;0 3.208 False ENSG00000147133 ENSG00000147133 HGNC:11535 X 70672905 70672979 71453055 71453129 CCCTCT 13 30 TBP_SCA17_CAG str TBP Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 10484774;20301611;29325606;27172828;14638975;11313753;11914409 False 3 100;0;0 3.208 True ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 TBP_SCA17_CAG str TBP Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 20301611;29325606 False 3 100;0;0 3.208 False ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 TBP_SCA17_CAG str TBP Expert list;Expert Review Green;Expert Review Green;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 17 MIM#607136 10484774;20301611;29325606 False 3 100;0;0 3.208 False ENSG00000112592 ENSG00000112592 HGNC:11588 6 170870996 170871109 170561908 170562021 CAG 40 49 ZFHX3_SCA4_GGC str ZFHX3 Literature;Expert Review Green;Expert Review Green;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 38035881;38197134 False 3 100;0;0 3.208 False ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 THAP11_SCA51_CAG str THAP11 Literature;Expert Review Amber;Expert Review Amber;Literature Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 51 MONDO:0975800 15368101;24677642;34165550;38113319;40459937;39651830;37148549 False 2 0;100;0 3.208 False ENSG00000168286 ENSG00000168286 HGNC:23194 16 67876766 67876853 67842863 67842950 CAG 39 47 ISCA-37404-Loss region Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Angelman syndrome, MIM# 105830;Prader-Willi syndrome, MIM# 176270" 20301323;20301505 False 3 100;0;0 3.208 True 15 22782170 28134729 3 80 cnv_loss Angelman and Prader-Willi syndromes ISCA-37405-Loss region NPHP1 Expert Review Green;Expert list;Expert list Movement Disorders Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Nephronophthisis 1, juvenile, MIM# 256100;Joubert syndrome 4, MIM# 609583;Senior-Loken syndrome 1, MIM# 266900" 29146700 False 3 100;0;0 3.208 True ENSG00000144061 ENSG00000144061 HGNC:7905 2 110122329 110205017 3 80 cnv_loss NPHP1 deletion