Entity Name Entity type Gene Symbol Sources(; separated) Level4 Level3 Level2 Model_Of_Inheritance Phenotypes Omim Orphanet HPO Publications Description Flagged GEL_Status UserRatings_Green_amber_red version ready Mode of pathogenicity EnsemblId(GRch37) EnsemblId(GRch38) HGNC Position Chromosome Position GRCh37 Start Position GRCh37 End Position GRCh38 Start Position GRCh38 End STR Repeated Sequence STR Normal Repeats STR Pathogenic Repeats Region Haploinsufficiency Score Region Triplosensitivity Score Region Required Overlap Percentage Region Variant Type Region Verbose Name AAAS gene AAAS Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Glucocorticoid deficiency with achalasia;Achalasia-addisonianism-alacrimia syndrome, MIM# 231550 False 3 100;0;0 4.430 True ENSG00000094914 ENSG00000094914 HGNC:13666 AARS gene AARS Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot Marie Tooth disease, axonal, type 2N, 613287;HMSN, dHMN/dSMA 20045102;22009580;22206013;30373780;26032230 False 3 100;0;0 4.430 False ENSG00000090861 ENSG00000090861 HGNC:20 AARS2 gene AARS2 Expert Review Green;Other;Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 8 MIM#614096 21549344;25058219 False 3 100;0;0 4.430 True ENSG00000124608 ENSG00000124608 HGNC:21022 ABCA1 gene ABCA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Tangier Disease (MONDO:0008783;MIM#205400) 29582519;4165386;31751110 False 3 50;50;0 4.430 True ENSG00000165029 ENSG00000165029 HGNC:29 ABCD1 gene ABCD1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Adrenoleukodystrophy, MIM# 300100" False 3 100;0;0 4.430 True ENSG00000101986 ENSG00000101986 HGNC:61 ABCD1 gene ABCD1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Adrenomyeloneuropathy, adult (MIM#300100);Adrenomyeloneuropathy, spastic paraparesis, adrenal insufficiency, axonal sensory-motor neuropathy, sphincter disturbance 20301491 False 3 100;0;0 4.430 True ENSG00000101986 ENSG00000101986 HGNC:61 ABHD12 gene ABHD12 Expert Review Green;NHS GMS;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Onset 2nd decade, neuropathy with SNCV, sensory neuronal hearing loss, retinitis pigmentosa, spastic paraplegia, ataxia;Neurodegeneration, childhood-onset, with cerebellar atrophy,612674;HMSN False 3 100;0;0 4.430 False ENSG00000100997 ENSG00000100997 HGNC:15868 ABHD16A gene ABHD16A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 86, autosomal recessive, MIM# 619735;Intellectual Disability;Corpus callosum abnormalities PMID: 34587489 False 3 100;0;0 4.430 True ENSG00000204427 ENSG00000204427 HGNC:13921 ABHD5 gene ABHD5 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dorfman-Chanarin disease MONDO:0010155 31883530 False 3 100;0;0 4.430 True ENSG00000011198 ENSG00000011198 HGNC:21396 ACAD9 gene ACAD9 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex I deficiency due to ACAD9 deficiency 611126 30025539 False 3 100;0;0 4.430 True ENSG00000177646 ENSG00000177646 HGNC:21497 ACADM gene ACADM Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Acyl-CoA dehydrogenase, medium chain, deficiency of 201450;Rhabdomyolysis False 3 100;0;0 4.430 True ENSG00000117054 ENSG00000117054 HGNC:89 ACADVL gene ACADVL Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal VLCAD deficiency 201475 9546340;24263034 False 3 100;0;0 4.430 True ENSG00000072778 ENSG00000072778 HGNC:92 ACOX1 gene ACOX1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Mitchell syndrome, MIM# 618960 32169171 False 3 100;0;0 4.430 True ENSG00000161533 ENSG00000161533 HGNC:119 ACTA1 gene ACTA1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital myopathy 2C, severe infantile, autosomal dominant, MIM# 620278 38666792 False 3 100;0;0 4.430 True ENSG00000143632 ENSG00000143632 HGNC:129 ACTA1 gene ACTA1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nemaline myopathy 3, autosomal dominant or recessive, MIM# 161800 19562689;15236405 False 3 100;0;0 4.430 True ENSG00000143632 ENSG00000143632 HGNC:129 ACTA1 gene ACTA1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Myopathy, scapulohumeroperoneal 616852" 28606400;25938801 False 3 100;0;0 4.430 True ENSG00000143632 ENSG00000143632 HGNC:129 ACTA2 gene ACTA2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Multisystemic smooth muscle dysfunction syndrome, MIM# 613834;Vascular aneurysms & dissections, patent ductus arteriosus, mydriasis 20734336;29300374 False 3 100;0;0 4.430 True ENSG00000107796 ENSG00000107796 HGNC:130 ACTC1 gene ACTC1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted MONDO:0019942 ACTC1 related distal arthrogrypsis PMID: 36945405 False 3 100;0;0 4.430 True ENSG00000159251 ENSG00000159251 HGNC:143 ACTG2 gene ACTG2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Visceral myopathy, 155310;Megacystis-microcolon-intestinal hypoperistalsis syndrome 5, MIM# 619431 24676022;26647307 False 3 100;0;0 4.430 True ENSG00000163017 ENSG00000163017 HGNC:145 ACTN2 gene ACTN2 Expert Review Green;Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Congenital Myopathy 8 (MIM#618654;MONDO: 0032852);ACTN2-related cardiac and skeletal myopathy, MONDO:0700349 30701273 False 3 50;50;0 4.430 True ENSG00000077522 ENSG00000077522 HGNC:164 ACTN2 gene ACTN2 Expert Review Green;Literature;Expert Review Amber Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, distal, 6, adult onset MIM#618655;ACTN2-related cardiac and skeletal myopathy, MONDO:0700349 30900782;34170073;36116040;34471957;34386585 False 3 67;33;0 4.430 True Other ENSG00000077522 ENSG00000077522 HGNC:164 ADAMTS10 gene ADAMTS10 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Weill-Marchesani syndrome 1, recessive, MIM#277600 18567016 False 3 100;0;0 4.430 True ENSG00000142303 ENSG00000142303 HGNC:13201 ADAMTS15 gene ADAMTS15 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, distal, type 12, MIM# 620545 PMID: 35962790 False 3 100;0;0 4.430 True ENSG00000166106 ENSG00000166106 HGNC:16305 ADAR gene ADAR Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 6, 615010 autosomal recessive False 3 100;0;0 4.430 True ENSG00000160710 ENSG00000160710 HGNC:225 ADCY6 gene ADCY6 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 8, OMIM # 616287;MONDO:0014570 PMID: 24319099, 26257172, 31846058;33820833 False 3 100;0;0 4.430 True ENSG00000174233 ENSG00000174233 HGNC:237 ADGRG6 gene ADGRG6 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 9;OMIM #616503;MONDO:0014670 30549416;26004201 False 3 100;0;0 4.430 True ENSG00000112414 ENSG00000112414 HGNC:13841 ADPRHL2 gene ADPRHL2 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, stress-induced, with variable ataxia and seizures (MIM#618170) 30100084;30401461 False 3 100;0;0 4.430 True ENSG00000116863 ENSG00000116863 HGNC:21304 ADSSL1 gene ADSSL1 Expert Review Green;Literature;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal adenylosuccinate synthetase-like 1-related distal myopathy MONDO:0018834 26506222;28268051;34635388;32646962 False 3 100;0;0 4.430 True ENSG00000185100 ENSG00000185100 HGNC:20093 ADSSL1 gene ADSSL1 Expert Review Green;Other;Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy MONDO:0018958 32646962 False 3 100;0;0 4.430 True ENSG00000185100 ENSG00000185100 HGNC:20093 AFG3L2 gene AFG3L2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive, MIM# 614487;Spinocerebellar ataxia 28, MIM# 610246 22022284;20208537;20725928;33075064;32248051;30910913 False 3 100;0;0 4.430 True Other ENSG00000141385 ENSG00000141385 HGNC:315 AFG3L2 gene AFG3L2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 5, autosomal recessive, MIM# 614487, MONDO:0013776;Early-onset spastic paraplegia, later myoclonic epilepsy, sensory-motor axonal neuropathy, ataxia, dystonia 22022284;25401298 False 3 100;0;0 4.430 True ENSG00000141385 ENSG00000141385 HGNC:315 AGK gene AGK Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sengers Syndrome (MIM#212350;MONDO:0008922) 22284826 False 3 100;0;0 4.430 True ENSG00000006530 ENSG00000006530 HGNC:21869 AGL gene AGL Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IIIa 232400;Glycogen storage disease IIIb 232400 20301788 False 3 100;0;0 4.430 True ENSG00000162688 ENSG00000162688 HGNC:321 AGRN gene AGRN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 8, with pre- and postsynaptic defects, 615120 19631309;22205389;32221959 False 3 100;0;0 4.430 True ENSG00000188157 ENSG00000188157 HGNC:329 AGTPBP1 gene AGTPBP1 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, childhood-onset, with cerebellar atrophy, MONDO:0032650 30420557, 28600779, 30976113, 38153683, 28325758 False 3 100;0;0 4.430 True ENSG00000135049 ENSG00000135049 HGNC:17258 AGXT gene AGXT Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperoxaluria, primary, type 1, MIM#259900 False 3 100;0;0 4.430 True ENSG00000172482 ENSG00000172482 HGNC:341 AHCY gene AHCY Expert Review Green;Expert Review Green;Expert list;Expert list;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypermethioninemia with deficiency of S-adenosylhomocysteine hydrolase MIM#613752 28779239;15024124;30121674 False 3 100;0;0 4.430 True ENSG00000101444 ENSG00000101444 HGNC:343 AIFM1 gene AIFM1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Combined oxidative phosphorylation deficiency 6;Cowchock syndrome;HMSN 3856385;22019070;26173962;25583628 False 3 100;0;0 4.430 True ENSG00000156709 ENSG00000156709 HGNC:8768 AIFM1 gene AIFM1 Expert Review Green;Other;Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Combined oxidative phosphorylation deficiency 6 (COXPD6) (MIM#300816);Encephalamyopathy, Mitochondrial, X-Linked 20362274;22019070;26173962 False 3 100;0;0 4.430 True ENSG00000156709 ENSG00000156709 HGNC:8768 AIMP1 gene AIMP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leukodystrophy, hypomyelinating, 3, MIM#260600 21092922;24958424;33402283;32531460;30486714;30477741 False 3 100;0;0 4.430 True ENSG00000164022 ENSG00000164022 HGNC:10648 ALDH18A1 gene ALDH18A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Adolescent-onset and adult-onset spastic paraplegia, dysarthria and motor neuronopathy, cataracts, skeletal abnormalities False 3 100;0;0 4.430 False ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH18A1 gene ALDH18A1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Spastic paraplegia 9B, autosomal recessive, MIM# 616586;Spastic paraplegia 9A, autosomal dominant, MIM# 601162" 26026163;29915212 False 3 100;0;0 4.430 True ENSG00000059573 ENSG00000059573 HGNC:9722 ALDH3A2 gene ALDH3A2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sj gren-Larsson syndrome False 3 100;0;0 4.430 True ENSG00000072210 ENSG00000072210 HGNC:403 ALDOA gene ALDOA Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XII 611881 8598869;25392908;14615364 False 3 100;0;0 4.430 True ENSG00000149925 ENSG00000149925 HGNC:414 ALG14 gene ALG14 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 15, without tubular aggregates 616227;Intellectual developmental disorder with epilepsy, behavioral abnormalities, and coarse facies (IDDEBF), MIM#619031;Myopathy, epilepsy, and progressive cerebral atrophy, MIM# 619036;Disorder of N-glycosylation 30221345, 23404334, 28733338, 33751823, 34971077 False 3 50;50;0 4.430 True ENSG00000172339 ENSG00000172339 HGNC:28287 ALG14 gene ALG14 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 15, without tubular aggregates 616227;Intellectual developmental disorder with epilepsy, behavioral abnormalities, and coarse facies (IDDEBF), MIM#619031;Myopathy, epilepsy, and progressive cerebral atrophy, MIM# 619036;Disorder of N-glycosylation 30221345, 23404334, 28733338, 33751823, 34971077 False 3 50;50;0 4.430 True ENSG00000172339 ENSG00000172339 HGNC:28287 ALG14 gene ALG14 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ALG14-congenital disorder of glycosylation, MONDO:0100559 28733338;34971077 False 3 100;0;0 4.430 True ENSG00000172339 ENSG00000172339 HGNC:28287 ALG2 gene ALG2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 14, with tubular aggregates, 616228 23404334;24461433 False 3 50;50;0 4.430 True ENSG00000119523 ENSG00000119523 HGNC:23159 ALG3 gene ALG3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Id 601110 16006436;26453362;28742265 False 3 100;0;0 4.430 True ENSG00000214160 ENSG00000214160 HGNC:23056 ALS2 gene ALS2 ClinGen;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ALS2-related motor neuron disease, MONDO:0100227 30128655, 33409823, 11586298, 16240357, 23282280, 24562058, 33155358 False 3 100;0;0 4.430 True ENSG00000003393 ENSG00000003393 HGNC:443 ALS2 gene ALS2 ClinGen;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ALS2-related motor neuron disease, MONDO:0100227 30128655, 33409823, 11586298, 16240357, 23282280, 24562058, 33155358 False 3 100;0;0 4.430 True ENSG00000003393 ENSG00000003393 HGNC:443 AMACR gene AMACR Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alpha-methylacyl-CoA racemase deficiency (MIM#614307);Retinopathy, myelopathy, axonal or SNCV neuropathy, elevated phytanic and pristanic acids 36108118;10655068;20821052;18032455 False 3 100;0;0 4.430 True ENSG00000242110 ENSG00000242110 HGNC:451 AMFR gene AMFR Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 89, autosomal recessive, MIM# 620379 37119330 False 3 100;0;0 4.430 True ENSG00000159461 ENSG00000159461 HGNC:463 ANO5 gene ANO5 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2L, 611307;Miyoshi muscular dystrophy 3, 613319 20096397;32399949 False 3 100;0;0 4.430 True ENSG00000171714 ENSG00000171714 HGNC:27337 ANO5 gene ANO5 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Miyoshi muscular dystrophy 3 613319;Muscular dystrophy, limb-girdle, type 2L 611307 23193613 False 3 100;0;0 4.430 True ENSG00000171714 ENSG00000171714 HGNC:27337 ANTXR2 gene ANTXR2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyaline fibromatosis syndrome, MIM# 228600;MONDO:0009229 12973667;14508707 False 3 100;0;0 4.430 True ENSG00000163297 ENSG00000163297 HGNC:21732 ANXA11 gene ANXA11 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amytrophic lateral sclerosis 23 MIM#617839 28469040;29845112;30109997 False 3 100;0;0 4.430 False ENSG00000122359 ENSG00000122359 HGNC:535 AP1S1 gene AP1S1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal MEDNIK Syndrome (MONDO:0012251, MIM#609313);Congenital-onset, Mental retardation, Enteropathy (severe congenital diarrhoea), Deafness, sensory-motor Neuropathy with intermediate conduction velocities, Ichthyosis, Keratoderma 30244301;23423674 False 3 50;50;0 4.430 True ENSG00000106367 ENSG00000106367 HGNC:559 AP4B1 gene AP4B1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 47, autosomal recessive, 614066 21620353;22290197;24700674;24781758;32979048;32171285;32166732;31525725;31525725 False 3 100;0;0 4.430 True ENSG00000134262 ENSG00000134262 HGNC:572 AP4E1 gene AP4E1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 51, autosomal recessive, 613744 20972249;21620353;21937992;32979048;23472171 False 3 100;0;0 4.430 True ENSG00000081014 ENSG00000081014 HGNC:573 AP4M1 gene AP4M1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 50, autosomal recessive, 612936 19559397;21937992;21937992;32979048;31915823;29096665;28464862;25496299 False 3 100;0;0 4.430 True ENSG00000221838 ENSG00000221838 HGNC:574 AP4S1 gene AP4S1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal developmental delay;Spastic paraplegia 52, autosomal recessive, 614067;seizures 21620353;25552650;32979048;32216065;31915823;30283821;27444738 False 3 100;0;0 4.430 True ENSG00000100478 ENSG00000100478 HGNC:575 AP5Z1 gene AP5Z1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 48, autosomal recessive, MIM# 613647" 26085577 False 3 50;50;0 4.430 True ENSG00000242802 ENSG00000242802 HGNC:22197 APOA1 gene APOA1 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyloidosis, 3 or more types 105200;Renal failure, Axonal sensory-motor neuropathy, amyloid nephropathy" False 3 100;0;0 4.430 True ENSG00000118137 ENSG00000118137 HGNC:600 APTX gene APTX Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, early-onset, with oculomotor apraxia and hypoalbuminemia (MIM#208920) 11586299 False 3 100;0;0 4.430 True ENSG00000137074 ENSG00000137074 HGNC:15984 ARG1 gene ARG1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive spastic tetraplegia;Argininaemia, 207800 29726057 False 3 100;0;0 4.430 True ENSG00000118520 ENSG00000118520 HGNC:663 ARHGAP19 gene ARHGAP19 Literature;Literature;Expert Review Green;Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2KK, MIM# 621466 41086021 False 3 100;0;0 4.430 False ENSG00000213390 ENSG00000213390 HGNC:23724 ARL6IP1 gene ARL6IP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 61, autosomal recessive, MIM#615685 24482476;31272422;30980493;28471035 False 3 100;0;0 4.430 True ENSG00000170540 ENSG00000170540 HGNC:697 ARL6IP1 gene ARL6IP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Childhood-onset spastic paraplegia with mutilating, sensory>motor axonal neuropathy False 3 100;0;0 4.430 True ENSG00000170540 ENSG00000170540 HGNC:697 ARSA gene ARSA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metachromatic leukodystrophy, MIM# 250100;Severe late infantile form with mental retardation and severe course. Regression before 30 months;adult-onset, psychiatric symptoms, leukodystrophy on MRI, progressive neuropathy with SNCV, optic atrophy False 3 100;0;0 4.430 True ENSG00000100299 ENSG00000100299 HGNC:713 ASAH1 gene ASAH1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with progressive myoclonic epilepsy;dHMN/dSMA False 3 100;0;0 4.430 False ENSG00000104763 ENSG00000104763 HGNC:735 ASCC1 gene ASCC1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 2 MIM#616867 PMID: 28218388;30327447;26924529 False 3 100;0;0 4.430 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASCC1 gene ASCC1 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spinal muscular atrophy with congenital bone fractures 2 (MONDO:0014807;MIM#616867) 26924529;28218388 False 3 100;0;0 4.430 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASCC1 gene ASCC1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital Myopathy - MONDO:0019952 (PMID: 30327447;35838082;26924529) False 3 100;0;0 4.430 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASCC1 gene ASCC1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 2 26924529 False 3 100;0;0 4.430 True ENSG00000138303 ENSG00000138303 HGNC:24268 ASCC3 gene ASCC3 Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Intellectual developmental disorder, autosomal recessive 81, MIM# 620700 35047834;21937992 False 3 100;0;0 4.430 True ENSG00000112249 ENSG00000112249 HGNC:18697 ASXL1 gene ASXL1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Bohring-Opitz syndrome , MIM#605039 False 3 100;0;0 4.430 True ENSG00000171456 ENSG00000171456 HGNC:18318 ATAD3A gene ATAD3A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Harel-Yoon syndrome, MIM# 617183 28158749;27640307 False 3 100;0;0 4.430 True ENSG00000197785 ENSG00000197785 HGNC:25567 ATAD3A gene ATAD3A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Global developmental delay, optic atrophy, axonal neuropathy, hypertrophic cardiomyopathy False 3 100;0;0 4.430 False ENSG00000197785 ENSG00000197785 HGNC:25567 ATL1 gene ATL1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HSAN/SFN;Neuropathy, hereditary sensory, type ID , MIM#613708;MONDO:0013381 21194679;24604904;22340599 False 3 100;0;0 4.430 False ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 3A, autosomal dominant MIM#182600 16765570 False 3 100;0;0 4.430 False ENSG00000198513 ENSG00000198513 HGNC:11231 ATL1 gene ATL1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Hereditary sensory neuropathy type ID, MIM 613708;Spastic paraplegia 3A, MIM 182600;Hereditary spastic paraplegia, AR 16401858;16537571;17657515;28396731;24473461;26888483 False 3 100;0;0 4.430 True ENSG00000198513 ENSG00000198513 HGNC:11231 ATL3 gene ATL3 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sensory neuropathy type IF;HSAN/SFN 24459106;30666337;30339187;24736309 False 3 100;0;0 4.430 False ENSG00000184743 ENSG00000184743 HGNC:24526 ATN1 gene ATN1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Congenital hypotonia, epilepsy, developmental delay, and digital anomalies, MIM# 618494" 34212383 False 3 100;0;0 4.430 True ENSG00000111676 ENSG00000111676 HGNC:3033 ATP13A2 gene ATP13A2 Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 78, autosomal recessive, 617225;Kufor-Rakeb syndrome, 606693 AR;complicated hereditary spastic paraplegia;Adult-onset lower-limb predominant spastic paraparesis 27217339;28137957 False 3 100;0;0 4.430 False ENSG00000159363 ENSG00000159363 HGNC:30213 ATP1A1 gene ATP1A1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 2DD,MIM# 618036;MONDO:0054833 29499166 False 3 100;0;0 4.430 False ENSG00000163399 ENSG00000163399 HGNC:799 ATP1A2 gene ATP1A2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fetal akinesia, respiratory insufficiency, microcephaly, polymicrogyria, and dysmorphic facies, MIM# 619602;hydrops;arthrogryposis;microcephaly;malformations of cortical development;dysmorphic features;severe respiratory insufficiency 30690204 False 3 100;0;0 4.430 True ENSG00000018625 ENSG00000018625 HGNC:800 ATP2A1 gene ATP2A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brody myopathy 601003 32040565 False 3 100;0;0 4.430 True ENSG00000196296 ENSG00000196296 HGNC:811 ATP2A1 gene ATP2A1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brody myopathy, MIM# 601003 32040565 False 3 50;50;0 4.430 True ENSG00000196296 ENSG00000196296 HGNC:811 ATP5G3 gene ATP5G3 Expert Review Green;Literature;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Dystonia, early-onset, and/or spastic paraplegia, MIM#619681 34636445;34954817 False 3 100;0;0 4.430 True ENSG00000154518 ENSG00000154518 HGNC:843 ATP6V1A gene ATP6V1A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cutis laxa, autosomal recessive, type IID MIM#617403 PMID: 28065471;33320377 False 3 100;0;0 4.430 True ENSG00000114573 ENSG00000114573 HGNC:851 ATP7A gene ATP7A Royal Melbourne Hospital;NHS GMS;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;NHS GMS;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal muscular atrophy, distal, X-linked 3, MIM# 300489;dHMN/dSMA 20170900;33137485;31969342;31558336 False 3 100;0;0 4.430 False ENSG00000165240 ENSG00000165240 HGNC:869 ATRX gene ATRX Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) ATR-X-related syndrome MONDO:0016980 16688741 False 3 100;0;0 4.430 True ENSG00000085224 ENSG00000085224 HGNC:886 B3GALNT2 gene B3GALNT2 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181;MONDO:0014071 23453667;33290285;29791932;29273094;28688748;28303321 False 3 100;0;0 4.430 True ENSG00000162885 ENSG00000162885 HGNC:28596 B3GAT3 gene B3GAT3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple joint dislocations, short stature, craniofacial dysmorphism, with or without congenital heart defects -MIM#245600 35151321;31196143;26086840 False 3 100;0;0 4.430 True ENSG00000149541 ENSG00000149541 HGNC:923 B4GALNT1 gene B4GALNT1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 26, autosomal recessive MIM#609195 False 3 100;0;0 4.430 True ENSG00000135454 ENSG00000135454 HGNC:4117 B4GAT1 gene B4GAT1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13 MIM# 615287 23359570;23877401 False 3 100;0;0 4.430 True ENSG00000174684 ENSG00000174684 HGNC:15685 BAG3 gene BAG3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, myofibrillar, 6 612954 PMID: 25208129;22734908;30061062 False 3 100;0;0 4.430 True ENSG00000151929 ENSG00000151929 HGNC:939 BCAS3 gene BCAS3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hengel-Maroofian-Schols syndrome, MIM# 619641 34022130 False 3 100;0;0 4.430 True ENSG00000141376 ENSG00000141376 HGNC:14347 BCKDHB gene BCKDHB Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Maple Syrup Urine Disease, Metabolic encephalopathy, elevated branched chain amino acids in urine, acute axonal neuropathy False 3 100;0;0 4.430 True ENSG00000083123 ENSG00000083123 HGNC:987 BICD2 gene BICD2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant 615290;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant 618291" PMID: 28635954;27751653 False 3 100;0;0 4.430 True ENSG00000185963 ENSG00000185963 HGNC:17208 BICD2 gene BICD2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM# 615290;MONDO:0014121;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, MIM# 618291;dHMN/dSMA 23664116;23664119;23664120;27751653;28635954;30054298;29528393 False 3 100;0;0 4.430 False ENSG00000185963 ENSG00000185963 HGNC:17208 BICD2 gene BICD2 Expert Review Green;Expert list;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted distal myopathy MONDO:0018949 27784775;28635954;31561939;29306765 False 3 100;0;0 4.430 True ENSG00000185963 ENSG00000185963 HGNC:17208 BIN1 gene BIN1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Centronuclear myopathy 2;OMIM #255200 False 3 100;0;0 4.430 True ENSG00000136717 ENSG00000136717 HGNC:1052 BIN1 gene BIN1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Centronuclear myopathy 2 (MONDO: 0009709;MIM#255200) 17676042;29950440;20476667;20142620;21129173;23754947;25260562;27854204 False 3 100;0;0 4.430 True ENSG00000136717 ENSG00000136717 HGNC:1052 BORCS5 gene BORCS5 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lysosomal storage disease, MONDO:0002561, BORCS5-related 40385417 False 3 100;0;0 4.430 True ENSG00000165714 ENSG00000165714 HGNC:17950 BRAT1 gene BRAT1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Rigidity and multifocal seizure syndrome, lethal neonatal, MIM# 614498" 36599696 False 3 100;0;0 4.430 True ENSG00000106009 ENSG00000106009 HGNC:21701 BSCL2 gene BSCL2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuropathy, distal hereditary motor, type VC, MIM# 619112 14981520;15732094 False 3 100;0;0 4.430 False ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Silver spastic paraplegia syndrome MIM#270685;Neuropathy, distal hereditary motor, type VA MIM#600794 16765570 False 3 100;0;0 4.430 False ENSG00000168000 ENSG00000168000 HGNC:15832 BSCL2 gene BSCL2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Silver spastic paraplegia syndrome MIM#270685;Encephalopathy, progressive, with or without lipodystrophy MIM#615924" False 3 100;0;0 4.430 True ENSG00000168000 ENSG00000168000 HGNC:15832 BVES gene BVES Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 25 616812 26642364 32528171 31119192 False 3 100;0;0 4.430 True ENSG00000112276 ENSG00000112276 HGNC:1152 C12orf65 gene C12orf65 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 55, autosomal recessive, 615035;optic atrophy and spasticity, tibial muscle weakness and atrophy, peripheral neuropathy;Combined oxidative phosphorylation deficiency 7, 613559 23188110;24080142;24198383 False 3 100;0;0 4.430 True ENSG00000130921 ENSG00000130921 HGNC:26784 C12orf65 gene C12orf65 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 55, autosomal recessive, MIM#615035;HMSN 20301682;23188110;3479531;24198383 False 3 100;0;0 4.430 True ENSG00000130921 ENSG00000130921 HGNC:26784 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodegeneration with brain iron accumulation 4, 614298;Spastic paraplegia 43, autosomal recessive, 615043 33688131;21981780;22508347;23269600;31804703;30088953;20039086 False 3 100;0;0 4.430 True ENSG00000131943 ENSG00000131943 HGNC:25443 C19orf12 gene C19orf12 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood-onset spastic paraplegia and sensory-motor axonal neuropathy, NBIA with optic atrophy, extrapyramidal signs False 3 100;0;0 4.430 False ENSG00000131943 ENSG00000131943 HGNC:25443 C1QBP gene C1QBP Expert Review Green;Literature;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive external opthalmoplegia;mitochondrial myopathy 32652806;28942965 False 3 100;0;0 4.430 True ENSG00000108561 ENSG00000108561 HGNC:1243 CACNA1E gene CACNA1E Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Epileptic encephalopathy, early infantile, 69 618285" PMID: 30343943 False 3 0;0;0 4.430 True Other ENSG00000198216 ENSG00000198216 HGNC:1392 CACNA1S gene CACNA1S Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown {Malignant hyperthermia susceptibility 5}, 601887 20301325;28011884 False 3 100;0;0 4.430 True Other ENSG00000081248 ENSG00000081248 HGNC:1397 CACNA1S gene CACNA1S Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Malignant hyperthermia susceptibility type 5;Hypokalemic periodic paralysis, type 1, 170400 8004673;11591859 False 3 100;0;0 4.430 True ENSG00000081248 ENSG00000081248 HGNC:1397 CACNA1S gene CACNA1S Expert Review Green;Expert list;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myopathy MONDO:0019952 28012042;31227654;33060286 False 3 100;0;0 4.430 True ENSG00000081248 ENSG00000081248 HGNC:1397 CACNA1S gene CACNA1S Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 18 due to dihydropyridine receptor defect, OMIM #620246 PMID: 33060286, 31227654, 28012042 False 3 100;0;0 4.430 True ENSG00000081248 ENSG00000081248 HGNC:1397 CADM3 gene CADM3 Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal, type 2FF, MIM# 619519 33889941;38074074 False 3 33;67;0 4.430 False ENSG00000162706 ENSG00000162706 HGNC:17601 CAPN1 gene CAPN1 Expert list;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 76 autosomal recessive, 616907;MONDO:0014827 27153400 False 3 100;0;0 4.430 False ENSG00000014216 ENSG00000014216 HGNC:1476 CAPN3 gene CAPN3 Expert Review Green;Literature;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal dominant 4, MIM# 618129;Muscular dystrophy, limb-girdle, autosomal recessive 1, MIM# 253600 31937337;28881388;32342993;32557990 False 3 100;0;0 4.430 True ENSG00000092529 ENSG00000092529 HGNC:1480 CAPRIN1 gene CAPRIN1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Childhood Dementia;Myoclonus-Ataxia;Sensorimotor Neuropathy;cerebellar atrophy;cortical atrophy 39878554 False 3 100;0;0 4.430 True ENSG00000135387 ENSG00000135387 HGNC:6743 CASP8 gene CASP8 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Autoimmune lymphoproliferative syndrome, type IIB MIM#607271 41026346 False 3 100;0;0 4.430 True ENSG00000064012 ENSG00000064012 HGNC:1509 CASQ1 gene CASQ1 Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, vacuolar, with CASQ1 aggregates 616231 PMID: 26136523;30258016 False 3 100;0;0 4.430 True ENSG00000143318 ENSG00000143318 HGNC:1512 CASQ1 gene CASQ1 Expert Review Green;Expert list;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, vacuolar, with CASQ1 aggregates MIM#616231 30258016 False 3 67;33;0 4.430 True ENSG00000143318 ENSG00000143318 HGNC:1512 CAV3 gene CAV3 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type IC 607801;Rippling muscle disease 606072;Myopathy, distal, Tateyama type 614321 False 3 100;0;0 4.430 True ENSG00000182533 ENSG00000182533 HGNC:1529 CAV3 gene CAV3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, distal, Tateyama type 614321;Rippling muscle disease 2 606072 PMID: 27312022;26185955;32090499 False 3 50;50;0 4.430 True ENSG00000182533 ENSG00000182533 HGNC:1529 CAV3 gene CAV3 Expert Review Green;Literature;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Caveolinopathy MONDO:0016146 38982518;30174172 False 3 100;0;0 4.430 True Other ENSG00000182533 ENSG00000182533 HGNC:1529 CAVIN1 gene CAVIN1 Expert Review Green;Expert list;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipodystrophy, congenital generalized, type 4 (MIM#613327) 19726876;12116229 False 3 100;0;0 4.430 True ENSG00000177469 ENSG00000177469 HGNC:9688 CCDC82 gene CCDC82 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, CCDC82-related 35373332;35118659;27457812 False 3 100;0;0 4.430 True ENSG00000149231 ENSG00000149231 HGNC:26282 CD59 gene CD59 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hemolytic anemia, CD59-mediated, with or without immune-mediated polyneuropathy 612300" 24382084;23149847 False 3 100;0;0 4.430 True ENSG00000085063 ENSG00000085063 HGNC:1689 CD99L2 gene CD99L2 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Neurodevelopmental disorder, MONDO:0700092;CD99L2-related 41690933 False 3 100;0;0 4.430 True ENSG00000102181 ENSG00000102181 HGNC:18237 CFL2 gene CFL2 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 7 (MONDO:0012538;MIM#610687) 17160903;22560515;32160286 False 3 100;0;0 4.430 True ENSG00000165410 ENSG00000165410 HGNC:1875 CHAT gene CHAT Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 6, presynaptic, 254210 11172068;12756141;31192527;29518833;29189923 False 3 100;0;0 4.430 True ENSG00000070748 ENSG00000070748 HGNC:1912 CHAT gene CHAT Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myasthenics syndrome associated with episodic apnea;Myasthenic syndrome, congenital, 6, presynaptic, 254210 11172068;12756141;31192527;29518833;29189923 False 3 100;0;0 4.430 True ENSG00000070748 ENSG00000070748 HGNC:1912 CHCHD10 gene CHCHD10 Expert Review Green;Literature;Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant mitochondrial myopathy with exercise intolerance MONDO:0014532 30874923;29112723;25193783;24934289 False 3 100;0;0 4.430 True Other ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000250479 ENSG00000250479 HGNC:15559 CHCHD10 gene CHCHD10 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, Jokela type: 615048;CMT2;dHMN/dSMA 22535186;27066538 False 3 100;0;0 4.430 False ENSG00000250479 ENSG00000250479 HGNC:15559 CHKB gene CHKB Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, megaconial type, MIM# 602541 21665002;23692895;24997086 False 3 100;0;0 4.430 True ENSG00000100288 ENSG00000100288 HGNC:1938 CHMP2B gene CHMP2B Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 7 (MIM#600795, MONDO:0010936) 20301378;16041373 False 3 100;0;0 4.430 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000083937 ENSG00000083937 HGNC:24537 CHRM3 gene CHRM3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Prune belly syndrome, MIM# 100100;Posterior urethral valves & prune belly syndrome 22077972;31441039 False 3 100;0;0 4.430 True ENSG00000133019 ENSG00000133019 HGNC:1952 CHRNA1 gene CHRNA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 1B, fast-channel, 608930;Myasthenic syndrome, congenital, 1A, slow-channel, 601462 26910802;10195214;12588888;15079006;18806275;7619526;8872460;9158151 False 3 100;0;0 4.430 True ENSG00000138435 ENSG00000138435 HGNC:1955 CHRNA1 gene CHRNA1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal myasthenic syndrome, congenital, 1B, fast-channel MONDO:0012156 36634413 False 3 100;0;0 4.430 True ENSG00000138435 ENSG00000138435 HGNC:1955 CHRNA1 gene CHRNA1 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple pterygium syndrome, lethal type, MIM# 253290 False 3 100;0;0 4.430 True ENSG00000138435 ENSG00000138435 HGNC:1955 CHRNB1 gene CHRNB1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, slow-channel congenital, 601462;Myasthenic syndrome, congenital, 2A, slow-channel, 616313;?Myasthenic syndrome, congenital, 2C, associated with acetylcholine receptor deficiency, 616314 8872460;8651643;27375219;32504635;10562302 False 3 100;0;0 4.430 True ENSG00000170175 ENSG00000170175 HGNC:1961 CHRNB1 gene CHRNB1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, slow-channel congenital, 601462 Myasthenic syndrome, congenital, 2A, slow-channel, 616313;Myasthenic syndrome, congenital, 2C, associated with acetylcholine receptor deficiency, 616314 8872460;8651643;27375219;32504635;10562302 False 3 100;0;0 4.430 True ENSG00000170175 ENSG00000170175 HGNC:1961 CHRND gene CHRND Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 3B, fast-channel, MIM#616322;Myasthenic syndrome, congenital, 3C, associated with acetylcholine receptor deficiency, MIM#616323;Myasthenic syndrome, congenital, 3A, slow-channel, MIM#616321 16916845;11435464;12499478;18398509;11782989 False 3 100;0;0 4.430 True ENSG00000135902 ENSG00000135902 HGNC:1965 CHRND gene CHRND Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple pterygium syndrome, lethal type, MIM# 253290 False 3 100;0;0 4.430 True ENSG00000135902 ENSG00000135902 HGNC:1965 CHRNE gene CHRNE Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 4B, fast-channel, 616324;Myasthenic syndrome, congenital, 4C, associated with acetylcholine receptor deficiency, 608931;Myasthenic syndrome, slow-channel congenital, 601462;Myasthenic syndrome, congenital, 4A, slow-channel, 605809 8755487;8957026;11030414;12417530;32727330;32070632;31773638 False 3 100;0;0 4.430 True ENSG00000108556 ENSG00000108556 HGNC:1966 CHRNG gene CHRNG Literature;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Escobar syndrome, MIM# 265000;Multiple pterygium syndrome, lethal type, MIM# 253290;MONDO:0009668 16826520;16826531;22167768 False 3 100;0;0 4.430 True ENSG00000196811 ENSG00000196811 HGNC:1967 CHRNG gene CHRNG Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple pterygium syndrome, lethal type, MIM# 253290;fetal akinesia deformation sequence syndrome/FADS;Neonatal congenital myasthenia;Escobar syndrome;Myasthenia gravis, neonatal transient 22167768 False 3 100;0;0 4.430 True ENSG00000196811 ENSG00000196811 HGNC:1967 CHST14 gene CHST14 Expert Review Green;Expert list;Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, musculocontractural type 1 MIM# 601776 26373698;20842734;36833362 False 3 50;50;0 4.430 True ENSG00000169105 ENSG00000169105 HGNC:24464 CHST14 gene CHST14 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, musculocontractural type 1 (MIM#601776) 26373698 False 3 100;0;0 4.430 True ENSG00000169105 ENSG00000169105 HGNC:24464 CIAO1 gene CIAO1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 10, MIM#620960 38411040;38196629 False 3 100;0;0 4.430 True ENSG00000144021 ENSG00000144021 HGNC:14280 CLCN1 gene CLCN1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myotonia congenita, dominant, 160800;Hyperkalemic Periodic Paralysis;Myotonia Congenita;Myotonia;Myotonia congenita, recessive, 255700;Myotonia levior, recessive 1379744;7981750;8533761 False 3 100;0;0 4.430 True ENSG00000188037 ENSG00000188037 HGNC:2019 CLMP gene CLMP Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital short bowel syndrome , MIM#615237 22155368 False 3 100;0;0 4.430 True ENSG00000166250 ENSG00000166250 HGNC:24039 CLP1 gene CLP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 10;dHMN/dSMA False 3 100;0;0 4.430 False ENSG00000172409 ENSG00000172409 HGNC:16999 CNTNAP1 gene CNTNAP1 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating neuropathy, congenital, 3, MIM#618186;Lethal congenital contracture syndrome 7, MIM# 616286 28374019;29511323;27668699 False 3 100;0;0 4.430 True ENSG00000108797 ENSG00000108797 HGNC:8011 CNTNAP1 gene CNTNAP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating neuropathy, congenital, 3 (MONDO:0017049;MIM#618186) 29511323;27881385 False 3 100;0;0 4.430 True ENSG00000108797 ENSG00000108797 HGNC:8011 COA7 gene COA7 Expert Review Green;Royal Melbourne Hospital;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 3, 618387;Cerebellar atrophy, leukoencephalopathy and spinal cord atrophy in some patients. Axonal sensory and motor neuropathy False 3 100;0;0 4.430 False ENSG00000162377 ENSG00000162377 HGNC:25716 COASY gene COASY Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia;microcephaly;arthrogryposis 30089828;35499143 False 3 50;50;0 4.430 True ENSG00000068120 ENSG00000068120 HGNC:29932 COG6 gene COG6 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Congenital disorder of glycosylation, type IIl 614576" 32905044;35048409;35068072;38278647;40213872 False 3 100;0;0 4.430 True ENSG00000133103 ENSG00000133103 HGNC:18621 COL12A1 gene COL12A1 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ullrich congenital muscular dystrophy 2 , MIM# 616470 28973083;24334604 False 3 33;67;0 4.430 True ENSG00000111799 ENSG00000111799 HGNC:2188 COL12A1 gene COL12A1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ullrich congenital muscular dystrophy 2 , MIM# 616470 24334604;28973083 False 3 50;50;0 4.430 True ENSG00000111799 ENSG00000111799 HGNC:2188 COL13A1 gene COL13A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 19, 616720 31081514;28369367;20844119 False 3 100;0;0 4.430 True ENSG00000197467 ENSG00000197467 HGNC:2190 COL25A1 gene COL25A1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal arthrogryposis multiplex congenita MONDO:0015168 35077597;26437029 False 3 100;0;0 4.430 True ENSG00000188517 ENSG00000188517 HGNC:18603 COL6A1 gene COL6A1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy MIM#158810;Ullrich congenital muscular dystrophy MIM#254090 20301676;25535305;15955946;23738969;29277723;24443028 False 3 100;0;0 4.430 True ENSG00000142156 ENSG00000142156 HGNC:2211 COL6A1 gene COL6A1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy MIM#158810;Ullrich congenital muscular dystrophy MIM#254090 20301676;25535305;15955946;23738969;29277723;24443028 False 3 100;0;0 4.430 True ENSG00000142156 ENSG00000142156 HGNC:2211 COL6A1 gene COL6A1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy MIM#158810;Ullrich congenital muscular dystrophy MIM#254090 20301676;25535305;15955946;23738969;29277723;24443028 False 3 100;0;0 4.430 True ENSG00000142156 ENSG00000142156 HGNC:2211 COL6A2 gene COL6A2 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090 20301676 False 3 100;0;0 4.430 True ENSG00000142173 ENSG00000142173 HGNC:2212 COL6A2 gene COL6A2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090 20301676 False 3 100;0;0 4.430 True ENSG00000142173 ENSG00000142173 HGNC:2212 COL6A2 gene COL6A2 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000142173 ENSG00000142173 HGNC:2212 COL6A3 gene COL6A3 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Bethlem myopathy, MIM#158810;Ullrich congenital muscular dystrophy, MIM#254090 15689448 False 3 100;0;0 4.430 True ENSG00000163359 ENSG00000163359 HGNC:2213 COL6A3 gene COL6A3 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000163359 ENSG00000163359 HGNC:2213 COL6A3 gene COL6A3 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Bethlem myopathy 1 MIM#158810;Ullrich congenital muscular dystrophy 1 MIM#254090 20301676;26004199;32037012;26872670;32037012 False 3 100;0;0 4.430 True ENSG00000163359 ENSG00000163359 HGNC:2213 COLQ gene COLQ Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 5, MIM# 603034;Congenital myasthenic syndrome with endplate acetylcholinesterase deficiency 9689136;9758617;11865139;32978031;31831253 False 3 100;0;0 4.430 True ENSG00000206561 ENSG00000206561 HGNC:2226 COQ7 gene COQ7 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 9, MIM# 620402 PMID: 36454683;36758993;36759155 False 3 67;33;0 4.430 True ENSG00000167186 ENSG00000167186 HGNC:2244 COQ7 gene COQ7 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, COQ7-related (MONDO#0019064) PMID: 33215859 False 3 50;0;50 4.430 False ENSG00000167186 ENSG00000167186 HGNC:2244 COQ8A gene COQ8A Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Coenzyme Q10 deficiency, primary, 4 MIM#612016 32337771 False 3 100;0;0 4.430 True ENSG00000163050 ENSG00000163050 HGNC:16812 COX18 gene COX18 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 25, MIM# 621487;Charcot-Marie-Tooth disease, axonal, type 2MM, MIM# 621488 37468577;40830826 False 3 100;0;0 4.430 True ENSG00000163626 ENSG00000163626 HGNC:26801 COX20 gene COX20 Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal sensory neuronopathy;sensory neuron disease;ganglionopathy PMID: 33751098 False 3 100;0;0 4.430 False ENSG00000203667 ENSG00000203667 HGNC:26970 COX6A1 gene COX6A1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, recessive intermediate D, 616039;MONDO:0014467;HMSN 25152455;26302975;25152455 False 3 100;0;0 4.430 False ENSG00000111775 ENSG00000111775 HGNC:2277 CPOX gene CPOX Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Coproporphyria, MIM#121300;Harderoporphyria, MIM#121300 False 3 100;0;0 4.430 True ENSG00000080819 ENSG00000080819 HGNC:2321 CPT2 gene CPT2 Expert Review Green;Expert list;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal CPT II deficiency, myopathic, stress-induced (exercise intolerance and rhabdomyolysis, late onset) 255110 False 3 100;0;0 4.430 True ENSG00000157184 ENSG00000157184 HGNC:2330 CRLF1 gene CRLF1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cold-induced sweating syndrome 1, MIM#272430 12509788;17436251;17436252 False 3 100;0;0 4.430 True ENSG00000006016 ENSG00000006016 HGNC:2364 CSMD1 gene CSMD1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038 PMID 38816421 False 3 100;0;0 4.430 True ENSG00000183117 ENSG00000183117 HGNC:14026 CSMD1 gene CSMD1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder MONDO:0100038 PMID 38816421 False 3 0;0;0 4.430 True ENSG00000183117 ENSG00000183117 HGNC:14026 CTDP1 gene CTDP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital cataracts, facial dysmorphism, and neuropathy (MIM#604168) 20301787 False 3 50;50;0 4.430 True ENSG00000060069 ENSG00000060069 HGNC:2498 CYP27A1 gene CYP27A1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Cholestanol storage disease False 3 100;0;0 4.430 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP27A1 gene CYP27A1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrotendinous xanthomatosis, 213700;MONDO:0008948;progressive lower extremity spasticity,often disproportionate to any degree of weakness False 3 100;0;0 4.430 False ENSG00000135929 ENSG00000135929 HGNC:2605 CYP2U1 gene CYP2U1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 56, autosomal recessive, MIM#615030 23176821 False 3 100;0;0 4.430 True ENSG00000155016 ENSG00000155016 HGNC:20582 CYP2U1 gene CYP2U1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 56, autosomal recessive, 615030 23176821;32006740;29034544 False 3 100;0;0 4.430 True ENSG00000155016 ENSG00000155016 HGNC:20582 CYP7B1 gene CYP7B1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 5A, autosomal recessive, MIM# 270800" 19439420;18252231 False 3 100;0;0 4.430 True ENSG00000172817 ENSG00000172817 HGNC:2652 CYP7B1 gene CYP7B1 Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood to adult-onset spastic paraplegia and bladder dysfunction, periventricular white matter abnormalities on MRI, one patient described with SNCV False 3 100;0;0 4.430 False ENSG00000172817 ENSG00000172817 HGNC:2652 DAG1 gene DAG1 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9, 613818;Walker-Warburg syndrome and tectocerebellar dysgraphia 21388311;25934851;24052401;25503980;29337005 False 3 100;0;0 4.430 True ENSG00000173402 ENSG00000173402 HGNC:2666 DAG1 gene DAG1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 9, 613818 21388311;25934851;24052401;25503980 False 3 100;0;0 4.430 True ENSG00000173402 ENSG00000173402 HGNC:2666 DARS gene DARS Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelination with brainstem and spinal cord involvement and leg spasticity, MIM# 615281 25527264;23643384 False 3 100;0;0 4.430 True ENSG00000115866 ENSG00000115866 HGNC:2678 DARS2 gene DARS2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2LL, MIM# 621485 20506600;19592391;33574740;40814755 False 3 50;50;0 4.430 True ENSG00000117593 ENSG00000117593 HGNC:25538 DCTN1 gene DCTN1 Literature;Expert Review Green;Expert Review Amber;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Perry syndrome, MONDO:0008201 20945553, 19136952, 24343258 False 3 100;0;0 4.430 False ENSG00000204843 ENSG00000204843 HGNC:2711 DCTN1 gene DCTN1 Expert Review Green;Literature;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuronopathy, distal hereditary motor, type 7B, MONDO:0011879 12627231;15326253;33443672;32023010;27573046 False 3 100;0;0 4.430 False ENSG00000204843 ENSG00000204843 HGNC:2711 DDHD1 gene DDHD1 ClinGen;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia 28, MONDO:0012256 15786464, 23176821, 24989667, 27216551, 26944165, 28818478, 29980238, 27999540, 33600578 False 3 50;50;0 4.430 True ENSG00000100523 ENSG00000100523 HGNC:19714 DDHD1 gene DDHD1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia 28, MONDO:0012256 15786464, 23176821, 24989667, 27216551, 26944165, 28818478, 29980238, 27999540, 33600578 False 3 100;0;0 4.430 True ENSG00000100523 ENSG00000100523 HGNC:19714 DDHD2 gene DDHD2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 54, autosomal recessive, MIM# 615033;MONDO:0014018" 23486545;24482476;23176823 False 3 100;0;0 4.430 True ENSG00000085788 ENSG00000085788 HGNC:29106 DEGS1 gene DEGS1 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 4.430 True ENSG00000143753 ENSG00000143753 HGNC:13709 DES gene DES Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Myofibrillar myopathy 1, MONDO:0011076 22395865, 20718792 False 3 50;50;0 4.430 True ENSG00000175084 ENSG00000175084 HGNC:2770 DES gene DES Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Myopathy, myofibrillar, 1 , MIM#601419" False 3 100;0;0 4.430 True ENSG00000175084 ENSG00000175084 HGNC:2770 DGUOK gene DGUOK Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070 11687800, 12874104, 15887277, 23043144, 26874653, 18205204, 29137425, 30956829, 35750291, 28215579, 20301766, 28215579, 17073823, 31127938 False 3 100;0;0 4.430 True ENSG00000114956 ENSG00000114956 HGNC:2858 DGUOK gene DGUOK Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 3 (hepatocerebral type), MIM# 251880;Portal hypertension, noncirrhotic, 1, MIM# 617068;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 4, MIM# 617070 11687800;12874104;15887277;23043144;26874653 False 3 50;0;50 4.430 True ENSG00000114956 ENSG00000114956 HGNC:2858 DHCR24 gene DHCR24 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Desmosterolosis, MONDO:0011217 11519011, 33524375, 21671375, 12457401, 29175559, 21559050, 33027564, 38239854, 30891795, 25637936 False 3 100;0;0 4.430 True ENSG00000116133 ENSG00000116133 HGNC:2859 DHH gene DHH Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 46,XY gonadal dysgenesis-motor and sensory neuropathy syndrome, MONDO:0011766 31018998;29471294;11017805 False 3 100;0;0 4.430 True ENSG00000139549 ENSG00000139549 HGNC:2865 DHX16 gene DHX16 Expert Review Green;Other;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuromuscular disease and ocular or auditory anomalies with or without seizures (MIM#618733;MONDO:0032890) 36211162;37664979;37574199;36211162 False 3 33;33;33 4.430 True ENSG00000204560 ENSG00000204560 HGNC:2739 DHX9 gene DHX9 Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, MONDO:0015626, DHX9-related 37467750 False 3 100;0;0 4.430 False ENSG00000135829 ENSG00000135829 HGNC:2750 DMD gene DMD Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Becker muscular dystrophy 300376 20301298 False 3 100;0;0 4.430 True ENSG00000198947 ENSG00000198947 HGNC:2928 DMD gene DMD Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Duchenne muscular dystrophy 310200;Becker muscular dystrophy 300376 20301298 False 3 100;0;0 4.430 True ENSG00000198947 ENSG00000198947 HGNC:2928 DMD gene DMD Expert Review Green;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Duchenne muscular dystrophy (MIM#310200);Becker muscular dystrophy (MIM#300376) False 3 100;0;0 4.430 True ENSG00000198947 ENSG00000198947 HGNC:2928 DMD gene DMD Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Duchenne muscular dystrophy, MIM# 310200" 3380114 False 3 100;0;0 4.430 True ENSG00000198947 ENSG00000198947 HGNC:2928 DNA2 gene DNA2 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 6 MIM#615156 31636600;23352259;25635128;28554558 False 3 50;50;0 4.430 True ENSG00000138346 ENSG00000138346 HGNC:2939 DNAJB2 gene DNAJB2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881) 22522442;25274842;33369814;22522442 False 3 100;0;0 4.430 False ENSG00000135924 ENSG00000135924 HGNC:5228 DNAJB2 gene DNAJB2 Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 5 (MIM#614881) False 3 100;0;0 4.430 True ENSG00000135924 ENSG00000135924 HGNC:5228 DNAJB4 gene DNAJB4 Expert Review Green;Literature;Literature;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal distal myopathy MONDO:0018949;Myopathy, MONDO:0005336, DNAJB4-related 36512060;36264506 False 3 100;0;0 4.430 True ENSG00000162616 ENSG00000162616 HGNC:14886 DNAJB4 gene DNAJB4 Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital Myopathy 21 with early respiratory failure (MIM#620326;MONDO:005336) 36264506 False 3 100;0;0 4.430 True ENSG00000162616 ENSG00000162616 HGNC:14886 DNAJB6 gene DNAJB6 Expert Review Green;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000105993 ENSG00000105993 HGNC:14888 DNAJB6 gene DNAJB6 Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Muscular dystrophy, limb-girdle, type 1E, 603511 26847086;26338452;24170373 False 3 100;0;0 4.430 True ENSG00000105993 ENSG00000105993 HGNC:14888 DNAJC3 gene DNAJC3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia, combined cerebellar and peripheral, with hearing loss and diabetes mellitus, MIM# 616192 25466870;32738013;34654017 False 3 100;0;0 4.430 True ENSG00000102580 ENSG00000102580 HGNC:9439 DNM2 gene DNM2 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted autosomal dominant centronuclear myopathy MONDO:0008048 16227997;33458580;30232666;24465259;23938035 False 3 100;0;0 4.430 True ENSG00000079805 ENSG00000079805 HGNC:2974 DNM2 gene DNM2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal type 2M, MIM# 606482;Charcot-Marie-Tooth disease, dominant intermediate B, MIM# 606482;MONDO:0011674 15731758;17636067;33459893;31628461 False 3 100;0;0 4.430 False ENSG00000079805 ENSG00000079805 HGNC:2974 DNM2 gene DNM2 Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Autosomal dominant centronuclear myopathy MONDO:0008048 17932957;19122038 False 3 100;0;0 4.430 True ENSG00000079805 ENSG00000079805 HGNC:2974 DNMT1 gene DNMT1 Expert Review Green;ClinGen;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hereditary sensory neuropathy-deafness-dementia syndrome, MONDO:0013584 22328086, 23904686, 24727570, 25678562, 23521649, 23365052, 21532572, 27602171, 25033457, 31984424 False 3 100;0;0 4.430 False ENSG00000130816 ENSG00000130816 HGNC:2976 DOK7 gene DOK7 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fetal akinesia deformation sequence 3, MIM# 618389;Myasthenic syndrome, congenital, 10, MIM# 254300 19261599;31880392 False 3 100;0;0 4.430 True ENSG00000175920 ENSG00000175920 HGNC:26594 DOK7 gene DOK7 Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Myasthenic syndrome, congenital, 10 254300" 31453852;32360404;31561939;31449669 False 3 100;0;0 4.430 True ENSG00000175920 ENSG00000175920 HGNC:26594 DOK7 gene DOK7 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 10, 254300;Myasthenia, limb-girdle, familial 16917026;18626973;20147321;16794080;31453852;29395672;32360404 False 3 100;0;0 4.430 True ENSG00000175920 ENSG00000175920 HGNC:26594 DOLK gene DOLK Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal DK1-CDG, MONDO:0012556;Congenital disorder of glycosylation, type Im, MIM# 610768 17273964;22242004;23890587;30653653;28816422;24144945 False 3 100;0;0 4.430 True ENSG00000175283 ENSG00000175283 HGNC:23406 DPAGT1 gene DPAGT1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal tubular aggregate myopathy MONDO:0008051 38982518;38443029;38124360;29356258;24759841 False 3 100;0;0 4.430 True ENSG00000172269 ENSG00000172269 HGNC:2995 DPAGT1 gene DPAGT1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ij;Myasthenic syndrome, congenital, 13, with tubular aggregates 614750 26033833;22786653;30653653;22492991 False 3 100;0;0 4.430 True ENSG00000172269 ENSG00000172269 HGNC:2995 DPAGT1 gene DPAGT1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 13, with tubular aggregates, 614750;Limb girdle congenital myasthenic;Congenital disorder of glycosylation, type Ij, 608093 22742743;29356258;28712839;28662078 False 3 100;0;0 4.430 True ENSG00000172269 ENSG00000172269 HGNC:2995 DPM1 gene DPM1 Expert Review;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 50;50;0 4.430 False ENSG00000000419 ENSG00000000419 HGNC:3005 DPM3 gene DPM3 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 , MIM#612937;Muscular dystrophy-dystroglycanopathy (congenital with impaired intellectual development), type B, 15 618992 31266720;28803818;19576565;31266720;31469168 False 3 100;0;0 4.430 True ENSG00000179085 ENSG00000179085 HGNC:3007 DPM3 gene DPM3 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 15 MIM#612937" 19576565;28803818;31266720 False 3 100;0;0 4.430 True ENSG00000179085 ENSG00000179085 HGNC:3007 DRP2 gene DRP2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot Marie Tooth, intermediate X-linked;HMSN 22764250;26227883;31217940 False 3 100;0;0 4.430 False ENSG00000102385 ENSG00000102385 HGNC:3032 DSE gene DSE Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ehlers-Danlos syndrome, musculocontractural type 2, MIM# 615539" 25703627;32130795;35842784;36902515 False 3 100;0;0 4.430 True ENSG00000111817 ENSG00000111817 HGNC:21144 DST gene DST Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 29 with contractures, MIM# 621510;Lethal congenital contracture syndrome 12, MIM# 621511 PMID: 40497796 False 3 100;0;0 4.430 True ENSG00000151914 ENSG00000151914 HGNC:1090 DST gene DST Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 29 with contractures, MIM# 621510;Lethal congenital contracture syndrome 12, MIM# 621511 PMID: 40497796 False 3 100;0;0 4.430 True ENSG00000151914 ENSG00000151914 HGNC:1090 DST gene DST Literature;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neuropathy, hereditary sensory and autonomic, type VI, MIM# 614653;MONDO:0013839;HSAN/SFN" 22522446;30371979;28468842 False 3 100;0;0 4.430 False ENSG00000151914 ENSG00000151914 HGNC:1090 DTNA gene DTNA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, MONDO:0020121, DTNA-related PMID: 36799992 False 3 100;0;0 4.430 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000134769 ENSG00000134769 HGNC:3057 DTNA gene DTNA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, MONDO:0020121, DTNA-related PMID: 36799992 False 3 50;50;0 4.430 True Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000134769 ENSG00000134769 HGNC:3057 DYNC1H1 gene DYNC1H1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Charcot-Marie-Tooth disease, axonal, type 20, MIM# 614228;Mental retardation, autosomal dominant 13, MIM# 614563;Spinal muscular atrophy, lower extremity-predominant 1, MIM# 158600" 25609763;25512093;28554554 False 3 100;0;0 4.430 True ENSG00000197102 ENSG00000197102 HGNC:2961 DYNC1H1 gene DYNC1H1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, lower extremity-predominant 1, (MIM#158600;MONDO:0008026) PMID: 2245967;25609763 False 3 100;0;0 4.430 True ENSG00000197102 ENSG00000197102 HGNC:2961 DYNC1H1 gene DYNC1H1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 20, MIM# 614228 21820100;32788638;27549087 False 3 100;0;0 4.430 False ENSG00000197102 ENSG00000197102 HGNC:2961 DYSF gene DYSF Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2B 253601;Myopathy, distal, with anterior tibial onset 606768;Miyoshi muscular dystrophy 1 254130 32978841;27602406 False 3 100;0;0 4.430 True ENSG00000135636 ENSG00000135636 HGNC:3097 DYSF gene DYSF Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000135636 ENSG00000135636 HGNC:3097 DYSF gene DYSF Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, distal, with anterior tibial onset, 606768;Miyoshi muscular dystrophy 1, 254130;Muscular dystrophy, limb-girdle, type 2B, 253601 23243261 False 3 100;0;0 4.430 True ENSG00000135636 ENSG00000135636 HGNC:3097 EBP gene EBP Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders Other Chondrodysplasia punctata, X-linked dominant, MIM# 302960 21634086;24704792 False 3 100;0;0 4.430 True ENSG00000147155 ENSG00000147155 HGNC:3133 ECEL1 gene ECEL1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, distal, type 5D, MIM# 615065 23261301;23236030;25099528;24782201 False 3 100;0;0 4.430 True ENSG00000171551 ENSG00000171551 HGNC:3147 EDN3 gene EDN3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Waardenburg syndrome, type 4B, MIM# 613265 False 3 100;0;0 4.430 True ENSG00000124205 ENSG00000124205 HGNC:3178 EDNRB gene EDNRB Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Waardenburg syndrome, type 4A, MIM# 277580 False 3 100;0;0 4.430 True ENSG00000136160 ENSG00000136160 HGNC:3180 EGR2 gene EGR2 Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 1D 607678 AD;Dejerine-Sottas disease 145900 AD, AR;Hypomyelinating neuropathy, congenital, 1 605253 AD, AR 11523566;31852952 False 3 100;0;0 4.430 False Other ENSG00000122877 ENSG00000122877 HGNC:3239 ELOVL1 gene ELOVL1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Ichthyotic keratoderma, spasticity, hypomyelination, and dysmorphic facies, MIM# 618527" 29496980;32123819;30487246 False 3 100;0;0 4.430 True ENSG00000066322 ENSG00000066322 HGNC:14418 ELP1 gene ELP1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dysautonomia, familial, 223900;Riley-Day syndrome MONDO:0009131;Hereditary sensory and autonomic neuropathy 3;HSAN/SFN 11179008;11179021;17644305 False 3 100;0;0 4.430 False ENSG00000070061 ENSG00000070061 HGNC:5959 EMD gene EMD Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Emery-Dreifuss muscular dystrophy 1, X-linked 310300 21697856;31802929 False 3 100;0;0 4.430 True ENSG00000102119 ENSG00000102119 HGNC:3331 EMD gene EMD Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Emery-Dreifuss muscular dystrophy 1, X-linked 310300" PMID: 21697856;31802929 False 3 100;0;0 4.430 True ENSG00000102119 ENSG00000102119 HGNC:3331 EMD gene EMD Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Emery-Dreifuss muscular dystrophy 1, X-linked, MIM#310300 26247046;34026875;35175440;36031908;37257496 False 3 100;0;0 4.430 True ENSG00000102119 ENSG00000102119 HGNC:3331 ENO3 gene ENO3 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XIII 612932 11506403;31741825;25267339 False 3 100;0;0 4.430 True ENSG00000108515 ENSG00000108515 HGNC:3354 ENTPD1 gene ENTPD1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 64, autosomal recessive MIM#615683 24482476;30652007;35471564 False 3 100;0;0 4.430 True ENSG00000138185 ENSG00000138185 HGNC:3363 EPG5 gene EPG5 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Vici Syndrome (MONDO: 0009452;MIM#242840) 23222957 False 3 100;0;0 4.430 True ENSG00000152223 ENSG00000152223 HGNC:29331 ERBB3 gene ERBB3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Visceral neuropathy, familial, 1, autosomal recessive, MIM# 243180;Complex neurocristinopathy 33497358 False 3 100;0;0 4.430 True ENSG00000065361 ENSG00000065361 HGNC:3431 ERBB4 gene ERBB4 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 19 MIM#615515 24119685;28889094 False 3 100;0;0 4.430 True ENSG00000178568 ENSG00000178568 HGNC:3432 ERCC2 gene ERCC2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cerebrooculofacioskeletal syndrome 2, MIM# 610756" 33369099;32557569;25716912 False 3 100;0;0 4.430 True ENSG00000104884 ENSG00000104884 HGNC:3434 ERCC5 gene ERCC5 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrooculofacioskeletal syndrome 3, MIM# 616570 24700531 False 3 100;0;0 4.430 True ENSG00000134899 ENSG00000134899 HGNC:3437 ERCC6 gene ERCC6 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebrooculofacioskeletal syndrome 1, MIM# 214150 False 3 100;0;0 4.430 True ENSG00000225830 ENSG00000225830 HGNC:3438 ERCC6 gene ERCC6 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type B MIM#133540 25453614;20301516 False 3 100;0;0 4.430 True ENSG00000225830 ENSG00000225830 HGNC:3438 ERCC8 gene ERCC8 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type A, MIM# 216400 False 3 100;0;0 4.430 True ENSG00000049167 ENSG00000049167 HGNC:3439 ERCC8 gene ERCC8 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cockayne syndrome, type A MIM#216400 False 3 100;0;0 4.430 True ENSG00000049167 ENSG00000049167 HGNC:3439 ERGIC1 gene ERGIC1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Arthrogryposis multiplex congenita 2, neurogenic type;OMIM # 208100" 28317099;34037256;31230720 False 3 50;50;0 4.430 True ENSG00000113719 ENSG00000113719 HGNC:29205 ERLIN1 gene ERLIN1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 62, 615681;Hereditary spastic paraplegia False 3 100;0;0 4.430 True ENSG00000107566 ENSG00000107566 HGNC:16947 ERLIN2 gene ERLIN2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal hereditary spastic paraplegia 18 MONDO:0012639 38607533;38427163;34734492;32042907 False 3 100;0;0 4.430 True ENSG00000147475 ENSG00000147475 HGNC:1356 ERLIN2 gene ERLIN2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 18, autosomal recessive, MIM# 611225;Spastic paraplegia 18A, autosomal dominant, MIM# 620512 23109145;21330303;32094424;29528531 False 3 100;0;0 4.430 True ENSG00000147475 ENSG00000147475 HGNC:1356 ETFA gene ETFA Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIA 231680 21347544;1430199 False 3 100;0;0 4.430 True ENSG00000140374 ENSG00000140374 HGNC:3481 ETFDH gene ETFDH Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple acyl-CoA dehydrogenase deficiency MONDO:0009282;sensory neuropathy 32608139;35309592;26821934 False 3 100;0;0 4.430 True ENSG00000171503 ENSG00000171503 HGNC:3483 ETFDH gene ETFDH Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIC 231680 17412732;27038534 False 3 100;0;0 4.430 True ENSG00000171503 ENSG00000171503 HGNC:3483 EXOSC8 gene EXOSC8 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dHMN/dSMA;Pontocerebellar hypoplasia, type 1c, MIM# 616081 24989451 False 3 100;0;0 4.430 True ENSG00000120699 ENSG00000120699 HGNC:17035 EXOSC9 gene EXOSC9 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1D, MIM# 618065 30690203;29727687 False 3 100;0;0 4.430 True ENSG00000123737 ENSG00000123737 HGNC:9137 FA2H gene FA2H Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 35, autosomal recessive, MIM# 612319" 20104589;23745665;19068277;20853438;22146942 False 3 100;0;0 4.430 True ENSG00000103089 ENSG00000103089 HGNC:21197 FAH gene FAH Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Tyrosinemia, type I, MIM# 276700" False 3 100;0;0 4.430 True ENSG00000103876 ENSG00000103876 HGNC:3579 FAM111B gene FAM111B Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary sclerosing poikiloderma with tendon and pulmonary involvement MONDO:0014310 27748098 False 3 100;0;0 4.430 True Other ENSG00000189057 ENSG00000189057 HGNC:24200 FAR1 gene FAR1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Cataracts, spastic paraparesis, and speech delay, MIM#619338;Peroxisomal fatty acyl-CoA reductase 1 disorder, MIM# 616154" PMID: 33239752 False 3 100;0;0 4.430 True ENSG00000197601 ENSG00000197601 HGNC:26222 FARS2 gene FARS2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 77, autosomal recessive, 617046 26553276;25851414;29126765 False 3 100;0;0 4.430 True ENSG00000145982 ENSG00000145982 HGNC:21062 FASTKD2 gene FASTKD2 Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 44 (MIM#618855) 31944455;18771761 False 3 50;50;0 4.430 True ENSG00000118246 ENSG00000118246 HGNC:29160 FBLN5 gene FBLN5 Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN;Neuropathy, hereditary, with or without age-related macular degeneration, MIM#608895 32757322;31945625;23328402;28332470 False 3 100;0;0 4.430 False ENSG00000140092 ENSG00000140092 HGNC:3602 FBN2 gene FBN2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Contractural arachnodactyly, congenital, MIM# 121050 33571691 False 3 100;0;0 4.430 True ENSG00000138829 ENSG00000138829 HGNC:3604 FBXO7 gene FBXO7 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Parkinson disease 15, autosomal recessive MIM#260300 18513678;19038853 False 3 100;0;0 4.430 False ENSG00000100225 ENSG00000100225 HGNC:13586 FDX2 gene FDX2 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy MIM#251900 24281368;30010796;28803783 False 3 100;0;0 4.430 True ENSG00000267673 ENSG00000267673 HGNC:30546 FGD4 gene FGD4 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot Marie Tooth disease, type 4H, 609311;MONDO:0012250;HMSN 17564959;31152969;28847448;28543957 False 3 100;0;0 4.430 False ENSG00000139132 ENSG00000139132 HGNC:19125 FGFR2 gene FGFR2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, MIM# 207410 False 3 100;0;0 4.430 True ENSG00000066468 ENSG00000066468 HGNC:3689 FHL1 gene FHL1 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Reducing body myopathy, X-linked 1a, severe, infantile or early childhood onset, MIM# 300717 19716112;20186852;20301609;18179901;25274776;34366191;18274675;19181672 False 3 67;33;0 4.430 True ENSG00000022267 ENSG00000022267 HGNC:3702 FHL1 gene FHL1 Expert Review Green;Expert list;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Reducing body myopathy MONDO:0019948;X-linked Emery-Dreifuss muscular dystrophy MONDO:0010680 19716112;20186852;20301609;18179901;25274776;34366191;18274675;19181672 False 3 67;33;0 4.430 True ENSG00000022267 ENSG00000022267 HGNC:3702 FICD gene FICD Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 92, autosomal recessive, MIM# 620911 36136088 False 3 100;0;0 4.430 False ENSG00000198855 ENSG00000198855 HGNC:18416 FICD gene FICD Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 92, autosomal recessive, MIM# 620911 36136088 False 3 100;0;0 4.430 True ENSG00000198855 ENSG00000198855 HGNC:18416 FIG4 gene FIG4 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4J, MIM# 611228;MONDO:0012640;HMSN 17572665;21705420;24878229 False 3 100;0;0 4.430 False ENSG00000112367 ENSG00000112367 HGNC:16873 FILIP1 gene FILIP1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuromuscular disorder, congenital, with dysmorphic facies, MIM# 620775 36943452 False 3 100;0;0 4.430 True ENSG00000118407 ENSG00000118407 HGNC:21015 FILIP1 gene FILIP1 Expert Review Green;Expert Review;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuromuscular disorder, congenital, with dysmorphic facies, MIM# 620775 36943452;37163662 False 3 50;50;0 4.430 True ENSG00000118407 ENSG00000118407 HGNC:21015 FKBP10 gene FKBP10 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bruck syndrome 1 MIM#259450 False 3 100;0;0 4.430 True ENSG00000141756 ENSG00000141756 HGNC:18169 FKBP14 gene FKBP14 Expert Review Green;Literature;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, kyphoscoliotic and deafness type MONDO:0013800 31132235 False 3 100;0;0 4.430 True ENSG00000106080 ENSG00000106080 HGNC:18625 FKRP gene FKRP Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 607155 27602406;11592034;11741828;14647208;19299310;19155270 False 3 100;0;0 4.430 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKRP gene FKRP Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 5 MIM#613153;Muscular dystrophy-dystroglycanopathy (congenital with or without mental retardation), type B, 5 MIM#606612;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 5 MIM#607155 11592034 False 3 100;0;0 4.430 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKRP gene FKRP Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal myopathy caused by variation in FKRP MONDO:0700066 11592034;11741828;14647208;19299310;19155270 False 3 100;0;0 4.430 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKRP gene FKRP Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Limb-girdle muscular dystrophy;Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type 11592034;11741828;14647208;19299310;19155270 False 3 100;0;0 4.430 True ENSG00000181027 ENSG00000181027 HGNC:17997 FKTN gene FKTN Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy MONDO:0018276 9690476;19017726;20301385;28680109 False 3 100;0;0 4.430 True ENSG00000106692 ENSG00000106692 HGNC:3622 FKTN gene FKTN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (with brain and eye anomalies), 253800;Muscular dystrophy-dystroglycanopathy (without mental retardation), 613152;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 4, 611588;Cardiomyopathy, dilated, 1X, 611615 9690476;19017726;20301385;28680109 False 3 100;0;0 4.430 True ENSG00000106692 ENSG00000106692 HGNC:3622 FKTN gene FKTN Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 4, MIM# 253800 False 3 100;0;0 4.430 True ENSG00000106692 ENSG00000106692 HGNC:3622 FLAD1 gene FLAD1 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipid storage myopathy due to flavin adenine dinucleotide synthetase deficiency MIM#255100 34454814;34718578;31392824;30982706;30311138;30427553;28433476;27259049;25058219 False 3 100;0;0 4.430 True ENSG00000160688 ENSG00000160688 HGNC:24671 FLNA gene FLNA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Intestinal pseudoobstruction, neuronal, MIM# 300048;Congenital short bowel syndrome, MIM# 300048 17357080;23037936;33464596;20871226 False 3 100;0;0 4.430 True ENSG00000196924 ENSG00000196924 HGNC:3754 FLNA gene FLNA Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) FLNA-related disorders;Otopalatodigital syndrome, type I 311300;Otopalatodigital syndrome, type II 304120;Terminal osseous dysplasia 300244 26804200;30561107;20301567 False 3 100;0;0 4.430 True ENSG00000196924 ENSG00000196924 HGNC:3754 FLNB gene FLNB Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal filamin-related bone disorder MONDO:0019690 False 3 100;0;0 4.430 True ENSG00000136068 ENSG00000136068 HGNC:3755 FLNC gene FLNC Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Cardiomyopathy, familial restrictive 5 617047;Myopathy, distal, 4 614065;Myopathy, myofibrillar, 5 609524" PMID: 29858533 False 3 100;0;0 4.430 True Other ENSG00000128591 ENSG00000128591 HGNC:3756 FLNC gene FLNC Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Cardiomyopathy, familial restrictive 5 617047;Myopathy, distal, 4 614065;Myopathy, myofibrillar, 5 609524" PMID: 29858533 False 3 100;0;0 4.430 True Other ENSG00000128591 ENSG00000128591 HGNC:3756 FLVCR1 gene FLVCR1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Ataxia, posterior column, with retinitis pigmentosa, MIM# 609033" 21267618;21070897 False 3 100;0;0 4.430 True ENSG00000162769 ENSG00000162769 HGNC:24682 FLVCR2 gene FLVCR2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome, OMIM #225790 PMID: 20206334, 20014121, 20014121 False 3 100;0;0 4.430 True ENSG00000119686 ENSG00000119686 HGNC:20105 FUS gene FUS Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 6, with or without frontotemporal dementia (MIM#608030) 19251628;19251627 False 3 100;0;0 4.430 True ENSG00000089280 ENSG00000089280 HGNC:4010 FXN gene FXN Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia, 229300 False 3 100;0;0 4.430 False ENSG00000165060 ENSG00000165060 HGNC:3951 FXN gene FXN Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Friedreich ataxia, MIM# 229300" False 3 100;0;0 4.430 True Other ENSG00000165060 ENSG00000165060 HGNC:3951 FXR1 gene FXR1 Expert Review Green;Other;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 9B, proximal, with minicore lesions (MIM#618823;MONDO:0032937) 30770808;35393337 False 3 100;0;0 4.430 True ENSG00000114416 ENSG00000114416 HGNC:4023 GAA gene GAA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease II (MIM#232300) 25103075;27365701 False 3 100;0;0 4.430 True ENSG00000171298 ENSG00000171298 HGNC:4065 GAA gene GAA Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glycogen storage disease II 232300" PMID: 29880332 False 3 100;0;0 4.430 True ENSG00000171298 ENSG00000171298 HGNC:4065 GAD1 gene GAD1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Developmental and epileptic encephalopathy 89, MIM# 619124" 32282878 False 3 100;0;0 4.430 True ENSG00000128683 ENSG00000128683 HGNC:4092 GALC gene GALC Expert list;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe disease MIM#245200 9272171;11971051;22959700;26396125;26915362;28547031;31185936;32064984 False 3 100;0;0 4.430 False ENSG00000054983 ENSG00000054983 HGNC:4115 GAN gene GAN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Giant axonal neuropathy-1, MIM# 256850" 26381321;11062483 False 3 100;0;0 4.430 True ENSG00000261609 ENSG00000261609 HGNC:4137 GAN gene GAN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Giant axonal neuropathy-1, MIM# 256850 11062483 False 3 100;0;0 4.430 True ENSG00000261609 ENSG00000261609 HGNC:4137 GARS gene GARS Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown HMSN, dHMN/dSMA;Spinal muscular atrophy, infantile, James type, MIM# 619042;Neuropathy, distal hereditary motor, type V, 600794;Charcot Marie Tooth disease, type 2D, 601472 17101916;22462675;31985473;32181591;12690580;25168514;26503042;29648643;16982418 False 3 100;0;0 4.430 False ENSG00000106105 ENSG00000106105 HGNC:4162 GBA gene GBA Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Gaucher disease, perinatal lethal,MIM# 608013 31192173 False 3 100;0;0 4.430 True ENSG00000177628 ENSG00000177628 HGNC:4177 GBA2 gene GBA2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 46, autosomal recessive, 614409;SPG46, Spastic paraplegia, cognitive decline, thin corpus callosum, ataxia, cataracts, bulbar dysfunction, axonal sensory-motor neuropathy 20301682;23332917;29524657 False 3 100;0;0 4.430 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBA2 gene GBA2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 46, autosomal recessive, MIM# 614409" 23332916;23332917 False 3 100;0;0 4.430 True ENSG00000070610 ENSG00000070610 HGNC:18986 GBE1 gene GBE1 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IV, MIM# 232500 8613547 False 3 100;0;0 4.430 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease IV, MIM# 232500;Polyglucosan body disease, adult form MIM#263570 8613547;20301758 False 3 100;0;0 4.430 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Polyglucosan body disease, adult form MIM#263570" 20301758;26194201 False 3 100;0;0 4.430 False ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert list;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form MIM#263570 23034915 False 3 100;0;0 4.430 False ENSG00000114480 ENSG00000114480 HGNC:4180 GBE1 gene GBE1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body disease, adult form MIM#263570;Late-onset, cognitive impairment, spasticity, sensory-motor axonal neuropathy, bladder dysfunction, cerebellar and extrapyramidal signs also seen, periventricular white matter abnormalities on MRI 23034915;1763891;8494336;20301758 False 3 100;0;0 4.430 True ENSG00000114480 ENSG00000114480 HGNC:4180 GBF1 gene GBF1 Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, dominant intermediate A, MIM# 606483;Axonal Neuropathy 32937143 False 3 100;0;0 4.430 False ENSG00000107862 ENSG00000107862 HGNC:4181 GCH1 gene GCH1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia MONDO:0019064, GCH1-related 21935284;24509643;33713342 False 3 0;100;0 4.430 True ENSG00000131979 ENSG00000131979 HGNC:4193 GDAP1 gene GDAP1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2K 607831, MIM# Charcot-Marie-Tooth disease, axonal, with vocal cord paresis, MIM# 607706;Charcot-Marie-Tooth disease, recessive intermediate, A, MIM# 608340;Charcot-Marie-Tooth disease, type 4A, MIM# 214400 16172208;21753178;21365284;20232219;11743580 False 3 100;0;0 4.430 False ENSG00000104381 ENSG00000104381 HGNC:15968 GFAP gene GFAP Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alexander disease MONDO:0008752 34146839 False 3 100;0;0 4.430 True ENSG00000131095 ENSG00000131095 HGNC:4235 GFER gene GFER Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, mitochondrial progressive, with congenital cataract and developmental delay (MIM#613076) 28155230;19409522;26018198 False 3 100;0;0 4.430 True ENSG00000127554 ENSG00000127554 HGNC:4236 GFPT1 gene GFPT1 Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenia, congenital, 12, with tubular aggregates MIM#610542;Limb-girdle congenital myasthenic syndrome 28712002;29905857;31449669 False 3 100;0;0 4.430 True ENSG00000198380 ENSG00000198380 HGNC:4241 GFPT1 gene GFPT1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenia, congenital, 12, with tubular aggregates, 610542;Limb-girdle congenital myasthenic syndrome 21310273;30635494 False 3 100;0;0 4.430 True ENSG00000198380 ENSG00000198380 HGNC:4241 GGPS1 gene GGPS1 Expert Review Green;Literature;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital hearing loss, and ovarian insufficiency syndrome, MIM# 619518;Muscular dystrophy;Deafness;Ovarian insufficiency 32403198 False 3 100;0;0 4.430 True ENSG00000152904 ENSG00000152904 HGNC:4249 GJA1 gene GJA1 Expert list;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia;Oculodentodigital dysplasia, 164200, Oculodentodigital dysplasia, autosomal recessive, 257850 31023660 False 3 100;0;0 4.430 False ENSG00000152661 ENSG00000152661 HGNC:4274 GJB1 gene GJB1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Charcot-Marie-Tooth neuropathy, X-linked dominant, 1, MIM# 302800;MONDO:0010549;HMSN 8266101;17100997;17353473 False 3 100;0;0 4.430 False ENSG00000169562 ENSG00000169562 HGNC:4283 GJC2 gene GJC2 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 2, MIM# 608804" False 3 100;0;0 4.430 True ENSG00000198835 ENSG00000198835 HGNC:17494 GLA gene GLA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Cardiomyopathy;HSAN/SFN;Fabry disease 19318041;22497776 False 3 0;100;0 4.430 True ENSG00000102393 ENSG00000102393 HGNC:4296 GLDN gene GLDN Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 11, MIM# 617194;MONDO:0014965 27616481;32812332;28726266 False 3 100;0;0 4.430 True ENSG00000186417 ENSG00000186417 HGNC:29514 GLE1 gene GLE1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 1, MIM# 253310 18204449;22357925 False 3 100;0;0 4.430 True ENSG00000119392 ENSG00000119392 HGNC:4315 GLRX5 gene GLRX5 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spasticity, childhood-onset, with hyperglycinemia 616859" PMID: 24334290;30770271 False 3 50;50;0 4.430 True ENSG00000182512 ENSG00000182512 HGNC:20134 GMPPB gene GMPPB Expert Review;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 with features of congenital myasthenic syndrome False 3 100;0;0 4.430 True ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 14 (MIM# 615350) False 3 100;0;0 4.430 True ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 615352 False 3 100;0;0 4.430 False ENSG00000173540 ENSG00000173540 HGNC:22932 GMPPB gene GMPPB Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 14 MIM#615352;Limb myalgia;exercise intolerance;myoglobinuria" 28456886;27874200;25681410 False 3 100;0;0 4.430 True ENSG00000173540 ENSG00000173540 HGNC:22932 GNB4 gene GNB4 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, dominant intermediate F, MIM# 615185;MONDO:0014074;HMSN 23434117;28642160;27908631 False 3 100;0;0 4.430 False ENSG00000114450 ENSG00000114450 HGNC:20731 GNE gene GNE Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nonaka myopathy (MIM#605820) 22883483;20301439 False 3 50;50;0 4.430 True ENSG00000159921 ENSG00000159921 HGNC:23657 GOLGA2 gene GOLGA2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Developmental delay with hypotonia, myopathy, and brain abnormalities, MIM 620240 PMID: 30237576;26742501;34424553 False 3 50;50;0 4.430 True ENSG00000167110 ENSG00000167110 HGNC:4425 GOSR2 gene GOSR2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, with or without seizures, MIM# 620166 PMID: 30363482;29855340 False 3 67;0;33 4.430 True ENSG00000108433 ENSG00000108433 HGNC:4431 GPT2 gene GPT2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly and spastic paraplegia, MIM# 616281 29882329;31471722;27601654 False 3 100;0;0 4.430 True ENSG00000166123 ENSG00000166123 HGNC:18062 GRN gene GRN Expert Review Green;ClinGen Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted frontotemporal dementia and/or amyotrophic lateral sclerosis MONDO:0030923 18184915;23596077 False 3 100;0;0 4.430 True ENSG00000030582 ENSG00000030582 HGNC:4601 GSN gene GSN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amyloidosis, Finnish type MIM#105120 8684801;228009;3513049 False 3 0;100;0 4.430 True ENSG00000148180 ENSG00000148180 HGNC:4620 GUK1 gene GUK1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 21, MIM# 621071 39230499 False 3 100;0;0 4.430 True ENSG00000143774 ENSG00000143774 HGNC:4693 GYG1 gene GYG1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Glycogen storage disease XV 613507;Polyglucosan body myopathy 2 616199 25272951;26652229 False 3 100;0;0 4.430 True ENSG00000163754 ENSG00000163754 HGNC:4699 GYG1 gene GYG1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body myopathy 2, MIM# 616199;Glycogen storage disease XV , MIM# 613507 29422440;32477874;32528171 False 3 100;0;0 4.430 True ENSG00000163754 ENSG00000163754 HGNC:4699 GYS1 gene GYS1 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease 0, muscle 611556 17928598;19699667;18358695;21958591 False 3 100;0;0 4.430 True ENSG00000104812 ENSG00000104812 HGNC:4706 HACD1 gene HACD1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 11 (MIM#619967;MONDO:0019952) 32426512;27939133;33354762;23933735 False 3 50;50;0 4.430 True ENSG00000165996 ENSG00000165996 HGNC:9639 HACE1 gene HACE1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia and psychomotor retardation with or without seizures, 616756;MONDO:0014764;Spastic paraplegia;psychomotor retardation 26424145;26437029;31321300 False 3 100;0;0 4.430 True ENSG00000085382 ENSG00000085382 HGNC:21033 HADHA gene HADHA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal LCHAD deficiency MIM#609016;Mitochondrial trifunctional protein deficiency MIM#609015 8871579;23868323;33744096;12838198;36063482 False 3 0;100;0 4.430 True ENSG00000084754 ENSG00000084754 HGNC:4801 HADHA gene HADHA Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal LCHAD deficiency MIM#609016;Trifunctional protein deficiency MIM#609015 25778941;7811722;29459657 False 3 100;0;0 4.430 True ENSG00000084754 ENSG00000084754 HGNC:4801 HADHB gene HADHB Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Trifunctional protein deficiency MIM#609015 25778941;30682426;9259266;29956646 False 3 100;0;0 4.430 True ENSG00000138029 ENSG00000138029 HGNC:4803 HARS gene HARS Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, axonal, type 2W, MIM# 616625;MONDO:0014711;HMSN 26072516 False 3 100;0;0 4.430 False ENSG00000170445 ENSG00000170445 HGNC:4816 HEXA gene HEXA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal GM2-gangliosidosis, several forms or Tay-Sachs disease MIM#272800 31995250;31076878 False 3 100;0;0 4.430 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXA gene HEXA Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Usually infantile-onset, developmental delay and cognitive decline, visual loss ( cherry red spot ), motor>sensory neuronopathy, hypometric saccades, adult-onset (second decade) cases described;Tay-Sachs disease 17015493;18642377;3159334;1838393 False 3 100;0;0 4.430 True ENSG00000213614 ENSG00000213614 HGNC:4878 HEXB gene HEXB Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Sandhoff disease, infantile, juvenile, and adult forms MIM#268800 31995250;24263030 False 3 100;0;0 4.430 True ENSG00000049860 ENSG00000049860 HGNC:4879 HEXB gene HEXB Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Usually infantile-onset, developmental delay and cognitive decline, visual loss ( cherry red spot ), motor>sensory neuronopathy, hypometric saccades, adult-onset (second decade) cases described;Tay-Sachs disease False 3 100;0;0 4.430 False ENSG00000049860 ENSG00000049860 HGNC:4879 HINT1 gene HINT1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuromyotonia and axonal neuropathy, autosomal recessive, MIM# 137200;Gamstorp-Wohlfart syndrome, MONDO:0007646;HMSN, dHMN/dSMA 22961002;33663550;33404983;31848916 False 3 100;0;0 4.430 False ENSG00000169567 ENSG00000169567 HGNC:4912 HK1 gene HK1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Neuropathy, hereditary motor and sensory, Russe type, 605285 19536174;26822750 False 3 100;0;0 4.430 False ENSG00000156515 ENSG00000156515 HGNC:4922 HMBS gene HMBS Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Porphyria, acute intermittent MIM#176000 25389600;18647325 False 3 100;0;0 4.430 True ENSG00000256269 ENSG00000256269 HGNC:4982 HMBS gene HMBS Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Porphyria, acute intermittent MIM#176000;MONDO:0008294 31205461;20301372;8563760 False 3 50;50;0 4.430 True ENSG00000256269 ENSG00000256269 HGNC:4982 HMGCR gene HMGCR Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive limb-girdle muscular dystrophy (MONDO:0015152), HMGCR-related PMID: 37167966;36745799 False 3 50;0;50 4.430 True ENSG00000113161 ENSG00000113161 HGNC:5006 HMGCS1 gene HMGCS1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 28 with rigid spine, MIM# 621433 39531736 False 3 100;0;0 4.430 True ENSG00000112972 ENSG00000112972 HGNC:5007 HNRNPA1 gene HNRNPA1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 20 MIM#615426 23455423;34291734 False 3 100;0;0 4.430 True ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA1 gene HNRNPA1 Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, distal, 3, MIM# 610099;inclusion body myopathy with early-onset Paget disease with or without frontotemporal dementia 3 MONDO:0014179 23455423;27066560;34291734;34722876 False 3 100;0;0 4.430 True Other ENSG00000135486 ENSG00000135486 HGNC:5031 HNRNPA2B1 gene HNRNPA2B1 Expert Review Green;Literature;Literature;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted oculopharyngeal muscular dystrophy, MONDO:0008116, OMIM#620460 23455423;30279180;29358076;26744327;23635965;35484142 False 3 33;67;0 4.430 True ENSG00000122566 ENSG00000122566 HGNC:5033 HNRNPDL gene HNRNPDL Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Muscular dystrophy, limb-girdle, type 1G 609115 24647604;31267206;31995753;32407983;32904822;32367994 False 3 100;0;0 4.430 True ENSG00000152795 ENSG00000152795 HGNC:5037 HPDL gene HPDL Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with progressive spasticity and brain white matter abnormalities (NEDSWMA), MIM#619026;Progressive neurological disorder;Leigh-like syndrome 32707086 False 3 100;0;0 4.430 True ENSG00000186603 ENSG00000186603 HGNC:28242 HSPB1 gene HSPB1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease axonal type 2F MONDO:0011687 21785432;15122254;18832141;32639100;32334137;33943041;35328016 False 3 100;0;0 4.430 False ENSG00000106211 ENSG00000106211 HGNC:5246 HSPB8 gene HSPB8 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN, dHMN/dSMA;Neuropathy, distal hereditary motor, type IIA, 158590;Charcot Marie Tooth disease, axonal, type 2L, 608673 15122253;15565283;29029362;28780615;28144995;26718575 False 3 100;0;0 4.430 False ENSG00000152137 ENSG00000152137 HGNC:30171 HSPB8 gene HSPB8 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, myofibrillar, 13, with rimmed vacuoles, MIM# 621078;autosomal dominant distal axonal motor neuropathy-myofibrillar myopathy syndrome MONDO:0018773 32165108;26718575;31403083;28780615 False 3 100;0;0 4.430 True Other ENSG00000152137 ENSG00000152137 HGNC:30171 HSPD1 gene HSPD1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal "Leukodystrophy, hypomyelinating, 4, MIM# 612233;Spastic paraplegia 13, autosomal dominant, MIM# 605280" False 3 100;0;0 4.430 True ENSG00000144381 ENSG00000144381 HGNC:5261 HSPG2 gene HSPG2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Schwartz-Jampel syndrome, type 1, MIM# 255800;MONDO:0009717 11101850;16927315 False 3 100;0;0 4.430 True ENSG00000142798 ENSG00000142798 HGNC:5273 IARS2 gene IARS2 Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Cataracts, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia, MIM# 616007" 28328135;30419932;25130867;30041933 False 3 100;0;0 4.430 True ENSG00000067704 ENSG00000067704 HGNC:29685 IBA57 gene IBA57 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 74, autosomal recessive MIM#616451 25609768;30258207 False 3 100;0;0 4.430 True ENSG00000181873 ENSG00000181873 HGNC:27302 IDS gene IDS Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Mucopolysaccharidosis II, MIM# 309900" False 3 100;0;0 4.430 False ENSG00000010404 ENSG00000010404 HGNC:5389 IFIH1 gene IFIH1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Aicardi-Goutieres syndrome 7 MIM#615846 25243380;31427910;24686847;24995871 False 3 100;0;0 4.430 True ENSG00000115267 ENSG00000115267 HGNC:18873 IGHMBP2 gene IGHMBP2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neuronopathy, distal hereditary motor, autosomal recessive 1, MIM# 604320" 10521314;27570397 False 3 100;0;0 4.430 True ENSG00000132740 ENSG00000132740 HGNC:5542 IGHMBP2 gene IGHMBP2 Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN, dHMN/dSMA;Charcot-Marie-Tooth disease, axonal, type 2S 616155;Neuronopathy, distal hereditary motor, type VI, 604320 25439726 False 3 100;0;0 4.430 False ENSG00000132740 ENSG00000132740 HGNC:5542 INF2 gene INF2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot Marie Tooth disease, dominant intermediate E, 614455;HMSN 22187985;30680856;25943269 False 3 100;0;0 4.430 False ENSG00000203485 ENSG00000203485 HGNC:23791 INPP4A gene INPP4A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354 PMID: 39315527 False 3 100;0;0 4.430 True ENSG00000040933 ENSG00000040933 HGNC:6074 INPP4A gene INPP4A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with growth impairment, quadriparesis, and poor or absent speech, MIM# 621354 PMID: 39315527 False 3 100;0;0 4.430 True ENSG00000040933 ENSG00000040933 HGNC:6074 INPP5K gene INPP5K Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, with cataracts and intellectual disability MIM#617404 28190456;28190459;28940338;31630891;33193651;33792664 False 3 100;0;0 4.430 True ENSG00000132376 ENSG00000132376 HGNC:33882 IRF6 gene IRF6 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Popliteal pterygium syndrome 1MIM#119500 False 3 100;0;0 4.430 True ENSG00000117595 ENSG00000117595 HGNC:6121 ISCU gene ISCU Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy with lactic acidosis, hereditary, MIM# 255125 29079705;18304497;18296749;19567699 False 3 100;0;0 4.430 True ENSG00000136003 ENSG00000136003 HGNC:29882 ISPD gene ISPD Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 22522421;23217329;23390185;30060766;28688748;26404900 False 3 100;0;0 4.430 True ENSG00000214960 ENSG00000214960 HGNC:37276 ISPD gene ISPD Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 7, MIM# 614643;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, MIM# 616052 22522421;23217329;23390185;30060766;28688748;26404900 False 3 100;0;0 4.430 True ENSG00000214960 ENSG00000214960 HGNC:37276 ISPD gene ISPD Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 7, 616052 23390185;30060766;28688748;26404900 False 3 100;0;0 4.430 True ENSG00000214960 ENSG00000214960 HGNC:37276 ITGA7 gene ITGA7 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, due to ITGA7 deficiency, MIM# 613204 34552617;9590299 False 3 100;0;0 4.430 True ENSG00000135424 ENSG00000135424 HGNC:6143 ITPR3 gene ITPR3 Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, demyelinating, type 1J, MIM# 620111;Immunodeficiency 133 with ectodermal dysplasia with or without peripheral neuropathy, MIM# 621254 32949214;24627108;36302985;39270020;39560673 False 3 100;0;0 4.430 False Other ENSG00000096433 ENSG00000096433 HGNC:6182 JAG1 gene JAG1 Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Peripheral neuropathy 32065591;25707699 False 3 100;0;0 4.430 False ENSG00000101384 ENSG00000101384 HGNC:6188 JAG2 gene JAG2 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 27, MIM# 619566;muscular dystrophy 33861953 False 3 100;0;0 4.430 True ENSG00000184916 ENSG00000184916 HGNC:6189 JAG2 gene JAG2 Expert Review Green;Other;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal muscular dystrophy, limb-girdle, autosomal recessive 27 MONDO:0030456 33861953 False 3 100;0;0 4.430 True ENSG00000184916 ENSG00000184916 HGNC:6189 JPH1 gene JPH1 Expert Review Green;Other Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 25, MIM# 620964 39209426 False 3 100;0;0 4.430 True ENSG00000104369 ENSG00000104369 HGNC:14201 KAT6B gene KAT6B Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted KAT6B-related multiple congenital anomalies syndrome MONDO:0036042 22715153 False 3 100;0;0 4.430 True ENSG00000156650 ENSG00000156650 HGNC:17582 KBTBD13 gene KBTBD13 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Nemaline myopathy 6, autosomal dominant (MIM# 609273;MONDO:0012237) 21104864;11731279;21109227 False 3 100;0;0 4.430 True ENSG00000234438 ENSG00000234438 HGNC:37227 KCNA1 gene KCNA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted EA1;Episodic ataxia/myokymia syndrome, 160120;Myokymia;Episodic Ataxia;Episodic Ataxia, Type 1 11026449 False 3 100;0;0 4.430 True Other ENSG00000111262 ENSG00000111262 HGNC:6218 KCNA2 gene KCNA2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia and ataxia False 3 100;0;0 4.430 False ENSG00000177301 ENSG00000177301 HGNC:6220 KCNJ2 gene KCNJ2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypokalemic Periodic Paralysis, Type 2;Periodic paralysis;Andersen syndrome, MIM# 170390;Episodic weakness;Andersen syndrome 11371347;12796536 False 3 100;0;0 4.430 True ENSG00000123700 ENSG00000123700 HGNC:6263 KCNK3 gene KCNK3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, KCNK3-related;developmental delay with sleep apnoea (DDSA) 36195757 False 3 100;0;0 4.430 True ENSG00000171303 ENSG00000171303 HGNC:6278 KDM5C gene KDM5C Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Intellectual developmental disorder, X-linked syndromic, Claes-Jensen type MIM# 300534;MONDO:0010355 15586325;32279304 False 3 100;0;0 4.430 True ENSG00000126012 ENSG00000126012 HGNC:11114 KIAA1109 gene KIAA1109 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alkuraya-Kucinskas syndrome, MIM# 617822 29290337;30906834 False 3 100;0;0 4.430 True ENSG00000138688 ENSG00000138688 HGNC:26953 KIDINS220 gene KIDINS220 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia, intellectual disability, nystagmus, and obesity, MIM# 617296;MONDO:0015007 27005418;29667355 False 3 100;0;0 4.430 True ENSG00000134313 ENSG00000134313 HGNC:29508 KIDINS220 gene KIDINS220 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ventriculomegaly and arthrogryposis, MIM# 619501;cerebral ventriculomegaly;limb contractures 33205811;28934391;28934391;32909676 False 3 100;0;0 4.430 True ENSG00000134313 ENSG00000134313 HGNC:29508 KIF1A gene KIF1A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Neuropathy, hereditary sensory, type IIC, 614213 21820098;28708278 False 3 100;0;0 4.430 False ENSG00000130294 ENSG00000130294 HGNC:888 KIF1A gene KIF1A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 30, autosomal dominant MIM# 610357;Spastic paraplegia 30, autosomal recessive 620607 26410750;21487076;22258533;32096284;31488895;29159194;25585697 False 3 100;0;0 4.430 True ENSG00000130294 ENSG00000130294 HGNC:888 KIF1C gene KIF1C Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 2, autosomal recessive, 611302;Spastic ataxia 2, autosomal recessive 24482476;24319291;31413903;29544888 False 3 100;0;0 4.430 True ENSG00000129250 ENSG00000129250 HGNC:6317 KIF21A gene KIF21A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita, MONDO:0015168, KIF21A-related 37921537;34740919;32686171 False 3 50;50;0 4.430 True ENSG00000139116 ENSG00000139116 HGNC:19349 KIF21A gene KIF21A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fibrosis of extraocular muscles, congenital, 1/3B, MIM#135700 37921537;39643435;41282472;32141982;24715754;36494820;22699964 False 3 100;0;0 4.430 True ENSG00000139116 ENSG00000139116 HGNC:19349 KIF5A gene KIF5A Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Amyotrophic lateral sclerosis, susceptibility to, 25} MIM#617921 29342275;30301576;29566793 False 3 100;0;0 4.430 False ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary Neuropathies;HMSN 30057544;29892902;28902413;26403765;25695920;25008398 False 3 100;0;0 4.430 False ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5A gene KIF5A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 10, autosomal dominant, MIM# 604187" 16489470;21623771;15452312;18853458;16476820 False 3 100;0;0 4.430 True ENSG00000155980 ENSG00000155980 HGNC:6323 KIF5C gene KIF5C Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Cortical dysplasia, complex, with other brain malformations 2, OMIM #615282 False 3 100;0;0 4.430 True ENSG00000168280 ENSG00000168280 HGNC:6325 KLC2 gene KLC2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia, optic atrophy, and neuropathy MIM#609541 26385635 False 3 100;0;0 4.430 True ENSG00000174996 ENSG00000174996 HGNC:20716 KLC2 gene KLC2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia, optic atrophy, and neuropathy, MIM#609541 False 3 50;0;50 4.430 True ENSG00000174996 ENSG00000174996 HGNC:20716 KLHL40 gene KLHL40 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 8, autosomal recessive, MIM# 615348 23746549 False 3 100;0;0 4.430 True ENSG00000157119 ENSG00000157119 HGNC:30372 KLHL40 gene KLHL40 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 8, autosomal recessive, MIM# 615348 23746549;24960163;32352246;31908664;27528495 False 3 100;0;0 4.430 True ENSG00000157119 ENSG00000157119 HGNC:30372 KLHL41 gene KLHL41 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 9, MIM# 615731 24268659;30986853;28939701;28826497 False 3 100;0;0 4.430 True ENSG00000239474 ENSG00000239474 HGNC:16905 KLHL41 gene KLHL41 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline Myopathy 9 (MIM#615731;MONDO:0014326) 24268659 False 3 100;0;0 4.430 True ENSG00000239474 ENSG00000239474 HGNC:16905 KLHL7 gene KLHL7 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal PERCHING syndrome, MIM# 617055 27392078;30142437;29074562 False 3 100;0;0 4.430 True ENSG00000122550 ENSG00000122550 HGNC:15646 KPNA3 gene KPNA3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia-88 (SPG88), MIM#620106 34564892 False 3 100;0;0 4.430 True ENSG00000102753 ENSG00000102753 HGNC:6396 KY gene KY Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 7, OMIM #617114 PMID: 27484770, 27485408, 30591934, 35752288 False 3 100;0;0 4.430 True ENSG00000174611 ENSG00000174611 HGNC:26576 KY gene KY Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 7 (MIM#617114) 27484770;27485408;30591934;11136708 False 3 100;0;0 4.430 True ENSG00000174611 ENSG00000174611 HGNC:26576 L1CAM gene L1CAM Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Hydrocephalus with Hirschsprung disease or congenital idiopathic intestinal pseudoobstruction MIM#307000 9279760;11857550;15148591;15368500;22354677 False 3 100;0;0 4.430 True ENSG00000198910 ENSG00000198910 HGNC:6470 L1CAM gene L1CAM Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Hereditary spastic paraplegia, 308840;MASA syndrome, 303350;X-linked hydrocephalus, 307000 False 3 100;0;0 4.430 True ENSG00000198910 ENSG00000198910 HGNC:6470 LAMA2 gene LAMA2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 30055037 False 3 100;0;0 4.430 True ENSG00000196569 ENSG00000196569 HGNC:6482 LAMA2 gene LAMA2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 30055037 False 3 100;0;0 4.430 True ENSG00000196569 ENSG00000196569 HGNC:6482 LAMA2 gene LAMA2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, merosin deficient or partially deficient, MIM# 607855;Muscular dystrophy, limb-girdle, autosomal recessive 23, MIM# 618138 30055037 False 3 100;0;0 4.430 True ENSG00000196569 ENSG00000196569 HGNC:6482 LAMP2 gene LAMP2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Danon disease, MIM# 300257;MONDO:0010281 False 3 100;0;0 4.430 True ENSG00000005893 ENSG00000005893 HGNC:6501 LARGE1 gene LARGE1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000133424 ENSG00000133424 HGNC:6511 LARGE1 gene LARGE1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 6, MIM# 613154 False 3 100;0;0 4.430 True ENSG00000133424 ENSG00000133424 HGNC:6511 LDB3 gene LDB3 Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted myofibrillar myopathy 4 MONDO:0012277 24668811;27546599;25911362 False 3 100;0;0 4.430 True Other ENSG00000122367 ENSG00000122367 HGNC:15710 LDHA gene LDHA Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease XI, MIM# 612933 2334430;1959923;8327147 False 3 100;0;0 4.430 True ENSG00000134333 ENSG00000134333 HGNC:6535 LGI4 gene LGI4 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita, neurogenic, with myelin defect, MIM#617468 28318499;34288120 False 3 100;0;0 4.430 True ENSG00000153902 ENSG00000153902 HGNC:18712 LIFR gene LIFR Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Stuve-Wiedemann syndrome/Schwartz-Jampel type 2 syndrome, OMIM #601559 PMID: 9674905, 9674906, 14740318, 24988918, 35663789 False 3 100;0;0 4.430 True ENSG00000113594 ENSG00000113594 HGNC:6597 LIG3 gene LIG3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 20 (MNGIE type), MIM# 619780 33855352 False 3 100;0;0 4.430 True ENSG00000005156 ENSG00000005156 HGNC:6600 LITAF gene LITAF Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 1C, MIM# 601098;MONDO:0010995 12525712;19541485;23359569;32665875;28211240 False 3 100;0;0 4.430 False ENSG00000189067 ENSG00000189067 HGNC:16841 LMNA gene LMNA Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Emery-Dreifuss muscular dystrophy 2, autosomal dominant (MIM#181350)" 27220833;23746545;17377071 False 3 0;100;0 4.430 True Other ENSG00000160789 ENSG00000160789 HGNC:6636 LMNA gene LMNA Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular dystrophy, congenital, OMIM #613205 PMID:18551513 False 3 100;0;0 4.430 True ENSG00000160789 ENSG00000160789 HGNC:6636 LMNA gene LMNA Expert Review Green;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000160789 ENSG00000160789 HGNC:6636 LMOD3 gene LMOD3 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 10, MIM# 616165 29331079;25250574;30291184;28815944;30642739 False 3 100;0;0 4.430 True ENSG00000163380 ENSG00000163380 HGNC:6649 LMOD3 gene LMOD3 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 10 (MIM# 616165;MONDO:0014513) 25250574;28815944;30291184 False 3 100;0;0 4.430 True ENSG00000163380 ENSG00000163380 HGNC:6649 LMX1B gene LMX1B Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Nail-patella syndrome, MIM# 161200, MONDO:0008061" False 3 100;0;0 4.430 True ENSG00000136944 ENSG00000136944 HGNC:6654 LPIN1 gene LPIN1 Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myoglobinuria, acute recurrent, autosomal recessive 268200 22481384;28649549;18817903;32410653 False 3 100;0;0 4.430 True ENSG00000134324 ENSG00000134324 HGNC:13345 LRP4 gene LRP4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 17, 616304 24234652;26052878;24200689 False 3 100;0;0 4.430 True ENSG00000134569 ENSG00000134569 HGNC:6696 LRSAM1 gene LRSAM1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2P, MIM# 614436;MONDO:0013753;HMSN 20865121;22012984;22781092;27686364;33568173;33414056;30996334 False 3 100;0;0 4.430 False ENSG00000148356 ENSG00000148356 HGNC:25135 LYST gene LYST Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chediak-Higashi syndrome MIM#214500;MONDO:0008963 24521565;15790783;20301751 False 3 0;100;0 4.430 True ENSG00000143669 ENSG00000143669 HGNC:1968 MADD gene MADD Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "DEEAH syndrome, MIM# 619004" 33723354 False 3 100;0;0 4.430 True ENSG00000110514 ENSG00000110514 HGNC:6766 MAG gene MAG Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 75, autosomal recessive, 616680;Cerebellar ataxia 31402626;24482476;26179919;32629324 False 3 100;0;0 4.430 True ENSG00000105695 ENSG00000105695 HGNC:6783 MAGEL2 gene MAGEL2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, maternally imprinted (paternal allele expressed) Schaaf-Yang syndrome 24076603;27195816;26365340;33820833;34128869 False 3 100;0;0 4.430 True ENSG00000254585 ENSG00000254585 HGNC:6814 MAN2B1 gene MAN2B1 Expert Review Green;Expert list;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Alpha-mannosidosis MONDO:0009561 20301570 False 3 100;0;0 4.430 True ENSG00000104774 ENSG00000104774 HGNC:6826 MAP3K20 gene MAP3K20 Expert Review Green;Other;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Centronuclear myopathy 6 with fiber-type disproportion (MIM#617760;MONDO:0054695) 27816943 False 3 100;0;0 4.430 True ENSG00000091436 ENSG00000091436 HGNC:17797 MAPK8IP3 gene MAPK8IP3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Neurodevelopmental disorder with or without variable brain abnormalities 618443" PMID: 30612693;30945334 False 3 100;0;0 4.430 True ENSG00000138834 ENSG00000138834 HGNC:6884 MARS2 gene MARS2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 3, autosomal recessive MIM#611390 16672289;22448145 False 3 100;0;0 4.430 True ENSG00000247626 ENSG00000247626 HGNC:25133 MATR3 gene MATR3 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted distal myopathy with vocal cord weakness MONDO:0018951 19344878;34659085;25154462;31056746 False 3 100;0;0 4.430 True Other ENSG00000015479 ENSG00000015479 HGNC:6912 MATR3 gene MATR3 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 19344878;24686783;35205163;34659085;34173818;26493020 False 3 100;0;0 4.430 False ENSG00000015479 ENSG00000015479 HGNC:6912 MB gene MB Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, sarcoplasmic body MIM#620286 35527200;30918256 False 3 100;0;0 4.430 True ENSG00000198125 ENSG00000198125 HGNC:6915 MCM3AP gene MCM3AP Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development, 618124 24123876;28633435;28969388;29982295;32202298 False 3 100;0;0 4.430 True ENSG00000160294 ENSG00000160294 HGNC:6946 MED11 gene MED11 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration with developmental delay, early respiratory failure, myoclonic seizures, and brain abnormalities, MIM# 620327 36001086 False 3 100;0;0 4.430 True ENSG00000161920 ENSG00000161920 HGNC:32687 MED12 gene MED12 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females MED12-related disorders 20301719 False 3 100;0;0 4.430 True ENSG00000184634 ENSG00000184634 HGNC:11957 MED27 gene MED27 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity, cataracts, and cerebellar hypoplasia, MIM# 619286 33443317 False 3 100;0;0 4.430 True ENSG00000160563 ENSG00000160563 HGNC:2377 MEGF10 gene MEGF10 Expert Review Green;Expert list;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal MEGF10-Related Myopathy MONDO:0013731 22101682;22371254;23453856;27460346 False 3 100;0;0 4.430 True ENSG00000145794 ENSG00000145794 HGNC:29634 MFN2 gene MFN2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2A2A 609260;Charcot-Marie-Tooth disease, axonal, type 2A2B, MIM# 617087;Hereditary motor and sensory neuropathy VIA, MIM# 601152 15064763;15549395;16437557;20008656 False 3 100;0;0 4.430 False ENSG00000116688 ENSG00000116688 HGNC:16877 MGME1 gene MGME1 Expert Review Green;Other;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial DNA depletion syndrome 11 MONDO:0014039 23313956;29572490;28711739 False 3 100;0;0 4.430 True ENSG00000125871 ENSG00000125871 HGNC:16205 MICU1 gene MICU1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy with extrapyramidal signs, MIM# 615673 24336167;29721912;32395406 False 3 100;0;0 4.430 True ENSG00000107745 ENSG00000107745 HGNC:1530 MLIP gene MLIP Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy with myalgia, increased serum creatine kinase, and with or without episodic rhabdomyolysis, MIM# 620138 34581780 False 3 100;0;0 4.430 True ENSG00000146147 ENSG00000146147 HGNC:21355 MME gene MME GeneReviews;Royal Melbourne Hospital;Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2T, MIM# 617017;MONDO:0014866 26991897;27588448;33144514;31429185 False 3 100;0;0 4.430 False ENSG00000196549 ENSG00000196549 HGNC:7154 MORC2 gene MORC2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Developmental delay, impaired growth, dysmorphic facies, and axonal neuropathy, MIM# 619090 32693025;26497905;26659848 False 3 100;0;0 4.430 True ENSG00000133422 ENSG00000133422 HGNC:23573 MPDU1 gene MPDU1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type If, MIM# 609180;MPDU1-CDG, MONDO:0012211 11733564;11733556;31741824;29721919 False 3 100;0;0 4.430 True ENSG00000129255 ENSG00000129255 HGNC:7207 MPV17 gene MPV17 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Charcot-Marie-Tooth disease, axonal, type 2EE, MIM# 618400 22508010;26437932;30298599 False 3 100;0;0 4.430 False ENSG00000115204 ENSG00000115204 HGNC:7224 MPV17 gene MPV17 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) MIM#256810 22964873;28673863;22593919 False 3 100;0;0 4.430 True ENSG00000115204 ENSG00000115204 HGNC:7224 MPZ gene MPZ Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot Marie Tooth disease, dominant intermediate D, 60779;Neuropathy, congenital hypomyelinating, 605253;Charcot Marie Tooth disease, type 2J, 607736;Dejerine Sottas disease, 145900;Charcot Marie Tooth disease, type 1B, 118200;Charcot Marie Tooth disease, type 2I, 607677;HMSN 19293842 False 3 100;0;0 4.430 False ENSG00000158887 ENSG00000158887 HGNC:7225 MSTO1 gene MSTO1 Expert Review Green;Expert Review;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myopathy, mitochondrial, and ataxia (MIM#617675) 28554942;28544275;31604776 False 3 100;0;0 4.430 True ENSG00000125459 ENSG00000125459 HGNC:29678 MT-CO2 gene MT-CO2 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial respiratory chain complex deficiency, MONDO:0000066, MT-CO2-related 34325999;30315213;28521807;10205264;10486321;11558799;18245391;23616164;31167410;23965802;30030519 False 3 100;0;0 4.430 True ENSG00000198712 ENSG00000198712 HGNC:7421 MT-CO3 gene MT-CO3 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease MONDO:0044970, MT-CO3-related 20525945;11063732;33863631;34054915;8630495;9634511;12414820;21163656;16288875;8630495;9634511 False 3 100;0;0 4.430 True ENSG00000198938 ENSG00000198938 HGNC:7422 MTM1 gene MTM1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal X-linked myotubular myopathy MONDO:0010683 False 3 100;0;0 4.430 True ENSG00000171100 ENSG00000171100 HGNC:7448 MTM1 gene MTM1 Expert Review Green;Literature;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) X-linked myotubular myopathy MONDO:0010683 30232666;38982518;10790201 False 3 100;0;0 4.430 True ENSG00000171100 ENSG00000171100 HGNC:7448 MTM1 gene MTM1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Myotubular myopathy, X-linked, 310400 False 3 100;0;0 4.430 False ENSG00000171100 ENSG00000171100 HGNC:7448 MTMR2 gene MTMR2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B1, 601382;HMSN;MONDO:0011066 10802647;16249189;33653949;32586600;32488727;31680794 False 3 100;0;0 4.430 False ENSG00000087053 ENSG00000087053 HGNC:7450 MT-ND2 gene MT-ND2 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND2-related 26258512;16738010;15781840;12192017 False 3 100;0;0 4.430 True ENSG00000198763 ENSG00000198763 HGNC:7456 MT-ND4 gene MT-ND4 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND4-related 12707444;16120329;15576045;20502985;27761019;32445240;32659360;3201231 False 3 100;0;0 4.430 True ENSG00000198886 ENSG00000198886 HGNC:7459 MT-ND5 gene MT-ND5 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-ND5-related 17400793;11938446;12624137;18495510;23918514;17535832;29506874;23034978;16816025;9299505;18977334 False 3 100;0;0 4.430 True ENSG00000198786 ENSG00000198786 HGNC:7461 MT-TA gene MT-TA Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TA-related 11715067;17825557;14569122;27014581;20813205;25873012;16476954 False 3 100;0;0 4.430 True ENSG00000210127 ENSG00000210127 HGNC:7475 MT-TD gene MT-TD Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TD-related 9811342;10488907;16059939;18676632;23696415;25447692;27536005;30030363;3054486;19535463 False 3 100;0;0 4.430 True ENSG00000210154 ENSG00000210154 HGNC:7478 MT-TE gene MT-TE Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TE-related 8155739;21194154;17715279;23334599;7726155;7726154;9353617;15048886;15670724;23847141;23334599;17266923;17056256 False 3 100;0;0 4.430 True ENSG00000210194 ENSG00000210194 HGNC:7479 MT-TF gene MT-TF Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TF-related 14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334 False 3 100;0;0 4.430 True ENSG00000210049 ENSG00000210049 HGNC:7481 MT-TF gene MT-TF Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TF-related 14659412;9771776;16806928;21060018;31463198;32419253;34607911;21424749;15184630;20142618;28267784;31722346;35472031;9636664;21882289;16769874;21914246;31009750;18977334 False 3 100;0;0 4.430 True ENSG00000210049 ENSG00000210049 HGNC:7481 MT-TG gene MT-TG Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 4.430 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TG gene MT-TG Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TG-related 8079988;9199564;11971101;16120360;32337339;35432167;10090480 False 3 100;0;0 4.430 True ENSG00000210164 ENSG00000210164 HGNC:7486 MT-TL2 gene MT-TL2 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TL2-related 8923013;12398839;19718780;18977334;21819490;15649400;15591266;23847141;20022607;29052516 False 3 100;0;0 4.430 True ENSG00000210191 ENSG00000210191 HGNC:7491 MT-TL2 gene MT-TL2 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TL2-related 8923013;12398839;19718780;18977334;21819490;15649400;15591266;23847141;20022607;29052516 False 3 100;0;0 4.430 True ENSG00000210191 ENSG00000210191 HGNC:7491 MT-TM gene MT-TM Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial disease (MONDO:0044970), MT-TM-related 9633749;24711008;25468263;30739820;11335700;31488384;31022467;29174468 False 3 100;0;0 4.430 True ENSG00000210112 ENSG00000210112 HGNC:7492 MTTP gene MTTP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Abetalipoproteinemia (MIM#200100);Young onset;Abetalipoproteinaemia;hypocholesterloaemia leading to malabsorption of fat-soluble vitamins (vitamin E), acanthocytes, retinitis pigmentosa, progressive sensory axonal neuropathy 33994405 False 3 100;0;0 4.430 True ENSG00000138823 ENSG00000138823 HGNC:7467 MT-TP gene MT-TP Expert list;Expert Review Green;Expert Review Red;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TP-related 7689388;11196116;19223931;23696415;19273760;27536729;27816331;32305257;32419253 False 3 100;0;0 4.430 False ENSG00000210196 ENSG00000210196 HGNC:7494 MT-TR gene MT-TR Expert list;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial disease (MONDO:0044970), MT-TR-related 15286228;17588757;19809478;22781096 False 3 100;0;0 4.430 False ENSG00000210174 ENSG00000210174 HGNC:7496 MT-TS1 gene MT-TS1 Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TS1-related 7669057;9778262;14605505;23696415;33279600;7581383 False 3 100;0;0 4.430 True ENSG00000210151 ENSG00000210151 HGNC:7497 MT-TT gene MT-TT Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TT-related 32083134;8769114;9367299;1645537;8511015;22638997;29760464;30236074;28187756;35808913 False 3 50;50;0 4.430 True ENSG00000210195 ENSG00000210195 HGNC:7499 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 4.430 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TV gene MT-TV Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TV-related 9450773;12056939;19252805;15320572;18314141;24691472;39468830 False 3 100;0;0 4.430 True ENSG00000210077 ENSG00000210077 HGNC:7500 MT-TW gene MT-TW Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TW-related 7695240;9266739;9673981;12776230;15054399;18337306;19809478;26524491;23841600;30937556 False 3 100;0;0 4.430 True ENSG00000210117 ENSG00000210117 HGNC:7501 MT-TY gene MT-TY Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 4.430 True ENSG00000210144 ENSG00000210144 HGNC:7502 MT-TY gene MT-TY Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TY-related 11071502;11756614;11594340;33279411;30643656;32684384;32485333;33279411 False 3 100;0;0 4.430 True ENSG00000210144 ENSG00000210144 HGNC:7502 MUSK gene MUSK Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 9, associated with acetylcholine receptor deficiency, 616325 15496425;19949040;20371544;32253145 False 3 100;0;0 4.430 True ENSG00000030304 ENSG00000030304 HGNC:7525 MUSK gene MUSK Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fetal akinesia deformation sequence 1, MIM# 208150;MONDO:0100101 25537362;25612909;8653786;31750350 False 3 100;0;0 4.430 True ENSG00000030304 ENSG00000030304 HGNC:7525 MYBPC1 gene MYBPC1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arthrogryposis, distal, type 1B 614335;Lethal congenital contracture syndrome 4, MIM# 614915 20045868;22610851;23873045;26661508;31264822 False 3 100;0;0 4.430 True ENSG00000196091 ENSG00000196091 HGNC:7549 MYBPC1 gene MYBPC1 Expert Review Green;Other;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital Myopathy 16 (MIM#618524) 31264822;31025394 False 3 100;0;0 4.430 True ENSG00000196091 ENSG00000196091 HGNC:7549 MYH11 gene MYH11 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Visceral myopathy 2, MIM# 619350;Megacystis-microcolon-intestinal hypoperistalsis syndrome 2, MIM# 619351;Dominant smooth muscle dysmotility syndrome" 31044419;31427716;25407000;31944481 False 3 100;0;0 4.430 True ENSG00000133392 ENSG00000133392 HGNC:7569 MYH14 gene MYH14 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Peripheral neuropathy, myopathy, hoarseness, and hearing loss MIM#614369 21480433;35274842;31231018;27875632 False 3 100;0;0 4.430 True ENSG00000105357 ENSG00000105357 HGNC:23212 MYH2 gene MYH2 Expert Review Green;Expert list;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Myopathy, proximal, and ophthalmoplegia MONDO:0011577 20418530;15548556;24193343;11114175;23489661;32578970;29934118;28729039;27490141;27177998 False 3 100;0;0 4.430 True ENSG00000125414 ENSG00000125414 HGNC:7572 MYH2 gene MYH2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Proximal myopathy and ophthalmoplegia, MIM# 605637 20418530;15548556;24193343;11114175;23489661;32578970;29934118;28729039;27490141;27177998;17434305 False 3 100;0;0 4.430 True ENSG00000125414 ENSG00000125414 HGNC:7572 MYH3 gene MYH3 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arthrogryposis, distal, type 2A (Freeman-Sheldon) 193700;Arthrogryposis, distal, type 2B3 (Sheldon-Hall) 618436;Contractures, pterygia, and spondylocarpostarsal fusion syndrome 1A 178110;Contractures, pterygia, and spondylocarpotarsal fusion syndrome 1B 618469 25957469;26544689;21531865;18695058 False 3 100;0;0 4.430 True ENSG00000109063 ENSG00000109063 HGNC:7573 MYH7 gene MYH7 Expert Review Green;Expert Review;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Laing distal myopathy (MIM#160500);Scapuloperoneal syndrome, myopathic type (MIM#181430) 27387980;20733148 False 3 50;50;0 4.430 True Other ENSG00000092054 ENSG00000092054 HGNC:7577 MYH7 gene MYH7 Expert Review Green;Literature;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted MYH7-related skeletal myopathy MONDO:0008050 38982518;15322983 False 3 100;0;0 4.430 True ENSG00000092054 ENSG00000092054 HGNC:7577 MYH8 gene MYH8 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Trismus-pseudocamptodactyly syndrome (MIM#158300) 20949528;17041932;15282353 False 3 100;0;0 4.430 True ENSG00000133020 ENSG00000133020 HGNC:7578 MYL1 gene MYL1 Expert Review Green;Other;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, congenital, with fast-twitch (type II) fiber atrophy MIM#618414 30215711;40488356 False 3 33;67;0 4.430 True ENSG00000168530 ENSG00000168530 HGNC:7582 MYL2 gene MYL2 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 12, infantile-onset, with cardiomyopathy (MIM#619424) 23365102;9673982 False 3 100;0;0 4.430 True ENSG00000111245 ENSG00000111245 HGNC:7583 MYL9 gene MYL9 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Megacystis-microcolon-intestinal hypoperistalsis syndrome, MIM#619365 29453416;33031641;32621347 False 3 50;0;50 4.430 True ENSG00000101335 ENSG00000101335 HGNC:15754 MYMK gene MYMK Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Carey-Fineman-Ziter syndrome 254940" 28681861 False 3 100;0;0 4.430 True ENSG00000187616 ENSG00000187616 HGNC:33778 MYMK gene MYMK Expert Review Green;Other;Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carey-Fineman-Ziter syndrome MONDO:0009700 32333597;30065953 False 3 100;0;0 4.430 True ENSG00000187616 ENSG00000187616 HGNC:33778 MYMX gene MYMX Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carey-Fineman-Ziter syndrome MONDO:0009700 35642635 False 3 50;50;0 4.430 True ENSG00000262179 ENSG00000262179 HGNC:52391 MYO18B gene MYO18B Expert Review Green;Expert list;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Klippel-Feil anomaly-myopathy-facial dysmorphism syndrome MONDO:0014689 25748484;27858739;32637634;32184166;27879346 False 3 100;0;0 4.430 True ENSG00000133454 ENSG00000133454 HGNC:18150 MYO18B gene MYO18B Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Klippel-Feil syndrome 4, autosomal recessive, with myopathy and facial dysmorphism, MIM# 616549" 33179433 False 3 100;0;0 4.430 True ENSG00000133454 ENSG00000133454 HGNC:18150 MYOD1 gene MYOD1 Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital Myopathy 17 (MIM#618975) 26733463;31260566;30403323 False 3 100;0;0 4.430 True ENSG00000129152 ENSG00000129152 HGNC:7611 MYOT gene MYOT Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Myopathy, myofibrillar, 3 (MIM#609200)" 30055862;21336781;15947064;10958653;15111675;16380616;33250842;32509353;29924655 False 3 0;100;0 4.430 True ENSG00000120729 ENSG00000120729 HGNC:12399 MYPN gene MYPN Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline Myopathy (MIM#617336;MONDO:0018958) 28017374 False 3 100;0;0 4.430 True ENSG00000138347 ENSG00000138347 HGNC:23246 NAGA gene NAGA Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Kanzaki disease, MIM#609242 False 3 100;0;0 4.430 True ENSG00000198951 ENSG00000198951 HGNC:7631 NALCN gene NALCN Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital contractures of the limbs and face, hypotonia, and developmental delay, MIM# 616266 25683120 False 3 100;0;0 4.430 True ENSG00000102452 ENSG00000102452 HGNC:19082 NARS gene NARS Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, impaired language, and gait abnormalities (NEDMILG), MIM#619091;Neurodevelopmental disorder with microcephaly, impaired language, epilepsy, and gait abnormalities (NEDMILEG), MIM#619092;Abnormal muscle tone;Microcephaly;Global developmental delay;Intellectual disability;Seizures;Ataxia;Abnormality of the face;Demyelinating peripheral neuropathy 32738225 False 3 100;0;0 4.430 True ENSG00000134440 ENSG00000134440 HGNC:7643 NDC1 gene NDC1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with achalasia, polyneuropathy, and alacrima, MIM# 621328 39003500;19782045 False 3 100;0;0 4.430 True ENSG00000058804 ENSG00000058804 HGNC:25525 NDRG1 gene NDRG1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Charcot Marie Tooth disease, type 4D, 601455;MONDO:0011085 10831399;24136616;33334662;29724652;29174527;28776325 False 3 100;0;0 4.430 False ENSG00000104419 ENSG00000104419 HGNC:7679 NEB gene NEB Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal distal myopathy MONDO:0018949 21724397;17525139;33458580;25205138 False 3 75;25;0 4.430 True ENSG00000183091 ENSG00000183091 HGNC:7720 NEB gene NEB Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita 6, MIM# 619334 10051637;22367672;26578207;33376055 False 3 100;0;0 4.430 True ENSG00000183091 ENSG00000183091 HGNC:7720 NEB gene NEB Expert Review Green;Other;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline Myopathy 2 (MIM#256030;MONDO: 0009725) 25205138 False 3 100;0;0 4.430 True ENSG00000183091 ENSG00000183091 HGNC:7720 NEFH gene NEFH Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease, axonal, type 2CC, 616924;HMSN 30992180;27040688;28709447 False 3 100;0;0 4.430 False ENSG00000100285 ENSG00000100285 HGNC:7737 NEFL gene NEFL Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot Marie Tooth disease, type 2E, 607684;Charcot-Marie-Tooth disease, dominant intermediate G, 617882;HMSN;Charcot Marie Tooth disease, type 1F, 607734 10841809;12393795;14733962;24887401;25877835;20039262;12566280;29191368;28902413 False 3 100;0;0 4.430 False ENSG00000104725 ENSG00000277586 HGNC:7739 NEK1 gene NEK1 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis, susceptibility to, 24 MIM#617892 31768050;26945885;27455347;29929116 False 3 100;0;0 4.430 True ENSG00000137601 ENSG00000137601 HGNC:7744 NEK9 gene NEK9 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 10, MIM# 617022;Arthrogryposis, Perthes disease, and upward gaze palsy, MIM# 614262 26908619;21271645;36712877 False 3 100;0;0 4.430 True ENSG00000119638 ENSG00000119638 HGNC:18591 NEMF gene NEMF Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Intellectual developmental disorder with speech delay and axonal peripheral neuropathy, MIM# 619099;Intellectual disability;neuropathy 32934225 False 3 100;0;0 4.430 True ENSG00000165525 ENSG00000165525 HGNC:10663 NFU1 gene NFU1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Multiple mitochondrial dysfunctions syndrome 1 (MIM#605711);Spastic paraplegia 93, autosomal recessive, MIM# 620938 36256512 False 3 100;0;0 4.430 True ENSG00000169599 ENSG00000169599 HGNC:16287 NGF gene NGF Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Neuropathy, hereditary sensory and autonomic, type V, MIM# 608654;MONDO:0012092 14976160;20978020;33884296;32693191;31685654;30296891 False 3 100;0;0 4.430 False ENSG00000134259 ENSG00000134259 HGNC:7808 NGLY1 gene NGLY1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of deglycosylation 1 (CDDG1) (MIM#615273);Developmental delay, choreoathetosis, alacrimia, seizures, microcephaly, transaminitis, neuropathy 22581936;27388694;29419975 False 3 100;0;0 4.430 True ENSG00000151092 ENSG00000151092 HGNC:17646 NIPA1 gene NIPA1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 6, autosomal dominant, MIM# 600363" 14508710;15711826 False 3 100;0;0 4.430 True ENSG00000170113 ENSG00000170113 HGNC:17043 NIPA1 gene NIPA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 6 21419568 False 3 100;0;0 4.430 True ENSG00000170113 ENSG00000170113 HGNC:17043 NKAP gene NKAP Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Intellectual developmental disorder, X-linked syndromic, Hackman-Di Donato type, MIM# 301039" 31587868 False 3 100;0;0 4.430 True ENSG00000101882 ENSG00000101882 HGNC:29873 NKX6-2 gene NKX6-2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 8, autosomal recessive, with hypomyelinating leukodystrophy, 617560;MONDO:0033043 28575651;15601927;32246862;32004679 False 3 100;0;0 4.430 True ENSG00000148826 ENSG00000148826 HGNC:19321 NOTCH1 gene NOTCH1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic cerebral small vessel disease (MONDO:0018787), NOTCH1-related 35947102 False 3 100;0;0 4.430 True Other ENSG00000148400 ENSG00000148400 HGNC:7881 NRDC gene NRDC Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, NRDC-related 41449824;28017472;34582790;19935654 False 3 50;50;0 4.430 True ENSG00000078618 ENSG00000078618 HGNC:7995 NT5C2 gene NT5C2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 45, autosomal recessive, MIM# 613162;MONDO:0013165 24482476;32153630;29123918;28884889;28327087 False 3 100;0;0 4.430 True ENSG00000076685 ENSG00000076685 HGNC:8022 NTRK1 gene NTRK1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary sensory and autonomic neuropathy type 4 MONDO:0009746 20301726;11310631 False 3 100;0;0 4.430 True ENSG00000198400 ENSG00000198400 HGNC:8031 NUDT2 gene NUDT2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular hypotonia;Global developmental delay;Intellectual disability;Polyneuropathy 33058507;27431290;30059600;33058507 False 3 100;0;0 4.430 True ENSG00000164978 ENSG00000164978 HGNC:8049 NUP88 gene NUP88 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Fetal akinesia deformation sequence 4, MIM# 618393" 30543681 False 3 100;0;0 4.430 True ENSG00000108559 ENSG00000108559 HGNC:8067 OBSCN gene OBSCN Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Rhabdomyolysis, MONDO:0005290, OBSCN-related PMID: 34957489 False 3 33;0;67 4.430 True ENSG00000154358 ENSG00000154358 HGNC:15719 OPA1 gene OPA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Optic atrophy plus syndrome (MIM#125250) 16240368;18065439;20157015;21112924 False 3 100;0;0 4.430 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA1 gene OPA1 Expert Review Green;Literature;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted optic atrophy with or without deafness, ophthalmoplegia, myopathy, ataxia, and neuropathy MONDO:0007429 30165240;20301426 False 3 50;50;0 4.430 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA3 gene OPA3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Optic atrophy 3 MONDO:0008133 31119193;28050599 False 3 100;0;0 4.430 True Other ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "3-methylglutaconic aciduria, type III, MIM# 258501" False 3 100;0;0 4.430 True ENSG00000125741 ENSG00000125741 HGNC:8142 OPA3 gene OPA3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Optic atrophy 3 MONDO:0008133 31119193 False 3 100;0;0 4.430 True Other ENSG00000125741 ENSG00000125741 HGNC:8142 OPTN gene OPTN Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Amyotrophic lateral sclerosis 12 with or without frontotemporal dementia (MONDO: 0013264, MIM#613435) 20428114;31838784;27493188 False 3 100;0;0 4.430 True ENSG00000123240 ENSG00000123240 HGNC:17142 ORAI1 gene ORAI1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted tubular aggregate myopathy MONDO:0008051 31448844;38982518 False 3 100;0;0 4.430 True Other ENSG00000182500 ENSG00000276045 HGNC:25896 ORAI1 gene ORAI1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, tubular aggregate, 2 (MIM#615883) 31448844 False 3 33;67;0 4.430 True ENSG00000182500 ENSG00000276045 HGNC:25896 ORAI1 gene ORAI1 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, tubular aggregate, 2, MIM# 615883 31448844;25227914 False 3 100;0;0 4.430 True ENSG00000182500 ENSG00000276045 HGNC:25896 PABPN1 gene PABPN1 Expert Review Green;Other Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal oculopharyngeal muscular dystrophy MONDO:0008116 19080757;33805441;16648376 False 3 100;0;0 4.430 True ENSG00000100836 ENSG00000100836 HGNC:8565 PAX7 gene PAX7 Expert Review Green;Other;Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 19 (MIM#618578) 31092906 False 3 100;0;0 4.430 True ENSG00000009709 ENSG00000009709 HGNC:8621 PCYT2 gene PCYT2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal global developmental delay;regression;spastic parapesis or tetraparesis;epilepsy;progressive cerebral and cerebellar atrophy 31637422 False 3 100;0;0 4.430 True ENSG00000185813 ENSG00000185813 HGNC:8756 PDHA1 gene PDHA1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Primary Pyruvate Dehydrogenase Complex Deficiency MIM 312170 36693417;33661577 False 3 100;0;0 4.430 True ENSG00000131828 ENSG00000131828 HGNC:8806 PDK3 gene PDK3 Expert list;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Charcot-Marie-Tooth disease, X-linked dominant, 6 MIM#300905;HMSN 23297365;26801680;27388934;28902413 False 3 100;0;0 4.430 False ENSG00000067992 ENSG00000067992 HGNC:8811 PDXK gene PDXK Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Axonal polyneuropathy;optic atrophy 32522499;31187503;27604308 False 3 50;50;0 4.430 True ENSG00000160209 ENSG00000160209 HGNC:8819 PDYN gene PDYN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spinocerebellar ataxia 23 (MIM#610245);Cerebellar ataxia, sensory-motor axonal neuropathy;Spinocerebellar ataxia 23 21035104 False 3 50;50;0 4.430 True ENSG00000101327 ENSG00000101327 HGNC:8820 PEX1 gene PEX1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 1A (Zellweger) MIM#214100 False 3 100;0;0 4.430 True ENSG00000127980 ENSG00000127980 HGNC:8850 PEX10 gene PEX10 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 6A (Zellweger) MIM#614870 False 3 100;0;0 4.430 True ENSG00000157911 ENSG00000157911 HGNC:8851 PEX10 gene PEX10 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Failure to thrive, facial dimorphism, agenesis of the corpus callosum, death in first year of life, axonal motor neuropathy, progressive ataxia and sensory-motor axonal neuropathy in adulthood described 27230853;20695019 False 3 100;0;0 4.430 True ENSG00000157911 ENSG00000157911 HGNC:8851 PEX12 gene PEX12 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 3A (Zellweger), 614859;HMSN 24627108;33123925 False 3 100;0;0 4.430 True ENSG00000108733 ENSG00000108733 HGNC:8854 PEX19 gene PEX19 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 12A (Zellweger) MIM#614886 36931687 False 3 100;0;0 4.430 True ENSG00000162735 ENSG00000162735 HGNC:9713 PEX7 gene PEX7 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Rhizomelic chondrodysplasia punctata, type 1, MIM# 215100 11781871 False 3 100;0;0 4.430 True ENSG00000112357 ENSG00000112357 HGNC:8860 PFKM gene PFKM Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease VII, MIM# 232800 2140573;8444874;7513946;7550225 False 3 100;0;0 4.430 True ENSG00000152556 ENSG00000152556 HGNC:8877 PFKM gene PFKM Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease VII (MIM#232800) 7794557 False 3 100;0;0 4.430 True ENSG00000152556 ENSG00000152556 HGNC:8877 PFN1 gene PFN1 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 67;33;0 4.430 False ENSG00000108518 ENSG00000108518 HGNC:8881 PGAM2 gene PGAM2 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease X, MIM# 261670 8447317;34237446;30310767 False 3 100;0;0 4.430 True ENSG00000164708 ENSG00000164708 HGNC:8889 PGBD5 gene PGBD5 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with seizures, hypotonia, and variable spasticity, MIM# 621482" 41533792 False 3 100;0;0 4.430 True ENSG00000177614 ENSG00000177614 HGNC:19405 PGK1 gene PGK1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Phosphoglycerate kinase 1 deficiency 300653;MONDO:0010392 6933565;1547346;7577653;9512313 False 3 100;0;0 4.430 True ENSG00000102144 ENSG00000102144 HGNC:8896 PGM1 gene PGM1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type It, MIM# 614921 31563034;26303607;24878975;27206562;29858906;32681750;19625727;24499211 False 3 100;0;0 4.430 True ENSG00000079739 ENSG00000079739 HGNC:8905 PHGDH gene PHGDH Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neu-Laxova syndrome 1, MIM# 256520" 25913727 False 3 100;0;0 4.430 True ENSG00000092621 ENSG00000092621 HGNC:8923 PHKA1 gene PHKA1 Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Muscle glycogenosis, MIM# 300559 7874115;12825073;9731190 False 3 100;0;0 4.430 True ENSG00000067177 ENSG00000067177 HGNC:8925 PHYH gene PHYH Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum Disease MIM#266500 2433405;20301527 False 3 50;50;0 4.430 True ENSG00000107537 ENSG00000107537 HGNC:8940 PI4KA gene PI4KA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental syndrome with hypomyelinating leukodystrophy;Spastic paraplegia 84, autosomal recessive, MIM# 619621 PMID: 34415322 False 3 100;0;0 4.430 True ENSG00000241973 ENSG00000241973 HGNC:8983 PIEZO2 gene PIEZO2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Arthrogryposis, distal, type 3 (MIM#114300);Arthrogryposis, distal, type 5 (MIM#108145);Arthrogryposis, distal, with impaired proprioception and touch, MIM# 617146 30941898;27653382;27607563;27843126;27974811;24726473 False 3 100;0;0 4.430 True ENSG00000154864 ENSG00000154864 HGNC:26270 PIGS gene PIGS Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycosylphosphatidylinositol biosynthesis defect 18, MIM# 618143 30269814 False 3 100;0;0 4.430 True ENSG00000087111 ENSG00000087111 HGNC:14937 PIP5K1C gene PIP5K1C Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lethal congenital contractural syndrome 3, MIM# 611369 17701898;38491417 False 3 50;50;0 4.430 True ENSG00000186111 ENSG00000186111 HGNC:8996 PLA2G16 gene PLA2G16 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lipodystrophy, familial partial, type 9, MIM# 620683 PMID: 37919452 False 3 100;0;0 4.430 True ENSG00000176485 ENSG00000176485 HGNC:17825 PLA2G6 gene PLA2G6 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile neuroaxonal dystrophy 1 (MIM#256600);Neurodegeneration with brain iron accumulation 2B (MIM#610217) 29859652 False 3 100;0;0 4.430 True ENSG00000184381 ENSG00000184381 HGNC:9039 PLEC gene PLEC Expert Review Green;Expert Review;Expert Review Green;Expert Review;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy with epidermolysis bullosa simplex, 226670 22144912 False 3 100;0;0 4.430 True ENSG00000178209 ENSG00000178209 HGNC:9069 PLEC gene PLEC Expert Review Green;Expert Review;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 17 (MIM#613723) 20624679;21109228;28824526 False 3 100;0;0 4.430 True ENSG00000178209 ENSG00000178209 HGNC:9069 PLEC gene PLEC Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal epidermolysis bullosa;congenital myasthenic syndrome 31509265;21263134;20624679 False 3 100;0;0 4.430 True ENSG00000178209 ENSG00000178209 HGNC:9069 PLEKHG5 gene PLEKHG5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary peripheral neuropathy MONDO:0020127, PLEKHG5-related 17564964;23777631;23844677;33492783;33275839;33220101;23777631 False 3 100;0;0 4.430 False ENSG00000171680 ENSG00000171680 HGNC:29105 PLOD2 gene PLOD2 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Bruck syndrome 2, MIM# 609220 22689593;12881513;33664768;33778323;29178448 False 3 100;0;0 4.430 True ENSG00000152952 ENSG00000152952 HGNC:9082 PLP1 gene PLP1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females "Spastic paraplegia 2, X-linked, MIM# 312920" 15627202;8012387 False 3 100;0;0 4.430 True ENSG00000123560 ENSG00000123560 HGNC:9086 PMM2 gene PMM2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Ia, OMIM #212065 False 3 100;0;0 4.430 True ENSG00000140650 ENSG00000140650 HGNC:9115 PMM2 gene PMM2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neonatal-onset, leukodystrophy, abnormal serum glycoproteins, mental retardation, hypotonia, ataxia, retinitis pigmentosa, seizures, slowly progressive neuropathy with SNCV, severe infections, hepatic insufficiency and cardiomyopathy 20301507;20301289 False 3 100;0;0 4.430 True ENSG00000140650 ENSG00000140650 HGNC:9115 PMP2 gene PMP2 Expert Review Green;Royal Melbourne Hospital;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN;Charcot-Marie-Tooth disease, demyelinating, type 1G, 618279 26257172;26828946;27009151 False 3 67;33;0 4.430 False Loss-of-function variants (as defined in pop up message) DO NOT cause this phenotype - please provide details in the comments ENSG00000147588 ENSG00000147588 HGNC:9117 PMP22 gene PMP22 Expert Review Green;Victorian Clinical Genetics Services;Royal Melbourne Hospital;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 1A, MIM# 118220;Charcot-Marie-Tooth disease, type 1E, MIM# 118300;Dejerine-Sottas disease, MIM# 145900;Neuropathy, recurrent, with pressure palsies 162500;Roussy-Levy syndrome 180800 32412171;31777123;32719652;32356557 False 3 100;0;0 4.430 True ENSG00000109099 ENSG00000109099 HGNC:9118 PNKP gene PNKP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, axonal, type 2B2 (MIM#605589);Ataxia-oculomotor apraxia 4 (MIM#616267) 30039206;27066567;25728773 False 3 100;0;0 4.430 True ENSG00000039650 ENSG00000039650 HGNC:9154 PNPLA2 gene PNPLA2 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neutral lipid storage disease with myopathy 610717" PMID: 32269696;21544567 False 3 100;0;0 4.430 True ENSG00000177666 ENSG00000177666 HGNC:30802 PNPLA2 gene PNPLA2 Expert list;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neutral lipid storage disease with myopathy MIM#610717" 18952067;25287355;25956450 False 3 67;0;33 4.430 True ENSG00000177666 ENSG00000177666 HGNC:30802 PNPLA6 gene PNPLA6 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Laurence-Moon Syndrome (LMS) MIM#245800;Spastic Paraplegia Type 39 MIM#612020 25299038;18313024 False 3 100;0;0 4.430 True ENSG00000032444 ENSG00000032444 HGNC:16268 PNPLA8 gene PNPLA8 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder, MONDO:0100038, PNPLA8-related PMID: 39082157 False 3 100;0;0 4.430 True ENSG00000135241 ENSG00000135241 HGNC:28900 POGLUT1 gene POGLUT1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 21 (MIM#617232) 27807076;29034878;31897643 False 3 67;33;0 4.430 True ENSG00000163389 ENSG00000163389 HGNC:22954 POLG gene POLG Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4A (Alpers type), MIM# 203700 22006280 False 3 100;0;0 4.430 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 4B (MNGIE type) 613662;Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459;Progressive external ophthalmoplegia, autosomal dominant 1 157640;Mitochondrial DNA depletion syndrome 4A (Alpers type) 203700;Progressive external ophthalmoplegia, autosomal recessive 1 258450 30451971 False 3 100;0;0 4.430 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG gene POLG Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial recessive ataxia syndrome (includes SANDO and SCAE) 607459 20301791 False 3 100;0;0 4.430 True ENSG00000140521 ENSG00000140521 HGNC:9179 POLG2 gene POLG2 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4, MIM# 610131 16685652;21555342;27592148;31778857 False 3 50;50;0 4.430 True ENSG00000256525 ENSG00000256525 HGNC:9180 POLR3A gene POLR3A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic ataxia 31637490 False 3 100;0;0 4.430 False ENSG00000148606 ENSG00000148606 HGNC:30074 POLR3B gene POLR3B Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, demyelinating, type 1I, MIM# 619742 PMID: 33417887 False 3 100;0;0 4.430 True ENSG00000013503 ENSG00000013503 HGNC:30348 POMGNT1 gene POMGNT1 Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle) type C, 8 MIM#618135 27391550;26908613;30961548;30937090 False 3 100;0;0 4.430 True ENSG00000085998 ENSG00000085998 HGNC:19139 POMGNT1 gene POMGNT1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 3 MIM#613157 False 3 100;0;0 4.430 True ENSG00000085998 ENSG00000085998 HGNC:19139 POMGNT1 gene POMGNT1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000085998 ENSG00000085998 HGNC:19139 POMGNT2 gene POMGNT2 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 8, 614830 False 3 100;0;0 4.430 False ENSG00000144647 ENSG00000144647 HGNC:25902 POMGNT2 gene POMGNT2 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000144647 ENSG00000144647 HGNC:25902 POMK gene POMK Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12 MIM#615249 False 3 100;0;0 4.430 True ENSG00000185900 ENSG00000185900 HGNC:26267 POMK gene POMK Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12, MIM# 615249;Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 12, MIM# 616094 32907597;31833209;29910097;28109637;24925318;24556084 False 3 100;0;0 4.430 True ENSG00000185900 ENSG00000185900 HGNC:26267 POMT1 gene POMT1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000130714 ENSG00000130714 HGNC:9202 POMT1 gene POMT1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle), type C, 1, MIM# 609308 False 3 100;0;0 4.430 True ENSG00000130714 ENSG00000130714 HGNC:9202 POMT1 gene POMT1 Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type False 3 100;0;0 4.430 False ENSG00000130714 ENSG00000130714 HGNC:9202 POMT2 gene POMT2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 2, MIM# 613150 19138766 False 3 100;0;0 4.430 True ENSG00000009830 ENSG00000009830 HGNC:19743 POMT2 gene POMT2 Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type False 3 100;0;0 4.430 False ENSG00000009830 ENSG00000009830 HGNC:19743 POMT2 gene POMT2 Expert Review Green;Expert Review;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000009830 ENSG00000009830 HGNC:19743 POPDC3 gene POPDC3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy, limb-girdle, autosomal recessive 26, MIM# 618848" 31610034 False 3 100;0;0 4.430 True ENSG00000132429 ENSG00000132429 HGNC:17649 POR gene POR Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis, MIM#201750 False 3 100;0;0 4.430 True ENSG00000127948 ENSG00000127948 HGNC:9208 PPOX gene PPOX Expert Review Green;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal "Porphyria variegata, MIM# 176200;Variegate porphyria, childhood-onset, MIM# 620483" 9811936;11286631;33159949 False 3 100;0;0 4.430 True ENSG00000143224 ENSG00000143224 HGNC:9280 PPP3CA gene PPP3CA Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arthrogryposis, cleft palate, craniosynostosis, and impaired intellectual development, OMIM #618265 PMID: 29432562 False 3 100;0;0 4.430 True ENSG00000138814 ENSG00000138814 HGNC:9314 PRDM12 gene PRDM12 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VIII, MIM# 616488;MONDO:0014662;HSAN/SFN 26005867;33789102;33010785;32828702 False 3 100;0;0 4.430 False ENSG00000130711 ENSG00000130711 HGNC:13997 PRG4 gene PRG4 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Camptodactyly-arthropathy-coxa vara-pericarditis syndrome, MIM# 208250 10545950;29397575 False 3 100;0;0 4.430 True ENSG00000116690 ENSG00000116690 HGNC:9364 PRKAG2 gene PRKAG2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Wolff-Parkinson-White syndrome 194200;Cardiomyopathy, hypertrophic 6 600858;Glycogen storage disease of heart, lethal congenital 261740 15766830;31049239 False 3 100;0;0 4.430 True ENSG00000106617 ENSG00000106617 HGNC:9386 PRNP gene PRNP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Prion diseases;peripheral neuropathy;chronic diarrhea;dementia 31953922;31907995;29928661;27716661;26926995;24224623;26768678 False 3 50;0;50 4.430 True ENSG00000171867 ENSG00000171867 HGNC:9449 PRPS1 gene PRPS1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Charcot Marie Tooth disease, X linked recessive, 5, 311070;HMSN 17701900;24285972;25491489;25182139 False 3 100;0;0 4.430 False ENSG00000147224 ENSG00000147224 HGNC:9462 PRUNE1 gene PRUNE1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with microcephaly, hypotonia, and variable brain anomalies, MIM#617481 28334956 False 3 100;0;0 4.430 True ENSG00000143363 ENSG00000143363 HGNC:13420 PRX gene PRX Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease type 4 MONDO:0018995 11133365;11157804;15197604;21079185;22847150;10839370;32460404;31523542;31426691 False 3 100;0;0 4.430 False ENSG00000105227 ENSG00000105227 HGNC:13797 PSAT1 gene PSAT1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neu-Laxova syndrome 2, MIM# 616038" 38278647 False 3 100;0;0 4.430 True ENSG00000135069 ENSG00000135069 HGNC:19129 PSEN1 gene PSEN1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Alzheimer disease, type 3, with spastic paraparesis and apraxia, MIM# 607822 33274538 False 3 100;0;0 4.430 False ENSG00000080815 ENSG00000080815 HGNC:9508 PSMF1 gene PSMF1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complex neurodevelopmental disorder with motor features, MONDO:0100516, PSMF1-related https://www.medrxiv.org/content/10.1101/2024.06.19.24308302v1 False 3 100;0;0 4.430 True ENSG00000125818 ENSG00000125818 HGNC:9571 PTRH2 gene PTRH2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infantile multisystem neurologic, endocrine, and pancreatic disease (IMNPED) (MIM#616263);Infantile-onset multisystem disease with intellectual disability, microcephaly, progressive ataxia, sensory neuronal hearing loss, hepatomegaly, pancreatic insufficiency, proximal placement of thumb, SNCV neuropathy 25574476;27129381;28328138 False 3 100;0;0 4.430 True ENSG00000141378 ENSG00000141378 HGNC:24265 PURA gene PURA Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder with neonatal respiratory insufficiency, hypotonia, and feeding difficulties (OMIM 616158) 36768582 False 3 100;0;0 4.430 True ENSG00000185129 ENSG00000185129 HGNC:9701 PUS1 gene PUS1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal myopathy, lactic acidosis, and sideroblastic anemia 1 MONDO:0024553 25227147;17056637;15108122;32287105;31641589;28832011 False 3 100;0;0 4.430 True ENSG00000177192 ENSG00000177192 HGNC:15508 PYGM gene PYGM Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease V McArdle disease 232600 AR 32386344 False 3 100;0;0 4.430 True ENSG00000068976 ENSG00000068976 HGNC:9726 PYROXD1 gene PYROXD1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, myofibrillar, 8, 617258;adult-onset limb girdle muscular dystrophy 30345904;30515627;27745833 False 3 0;100;0 4.430 True ENSG00000121350 ENSG00000121350 HGNC:26162 PYROXD1 gene PYROXD1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myofibrillar myopathy 8 MONDO:0014993 30345904;30515627;27745833 False 3 100;0;0 4.430 True ENSG00000121350 ENSG00000121350 HGNC:26162 RAB1A gene RAB1A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092, RAB1A-related 37924809 False 3 100;0;0 4.430 False ENSG00000138069 ENSG00000138069 HGNC:9758 RAB3A gene RAB3A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted neurodevelopmental disorder MONDO:0700092 40166812 False 3 100;0;0 4.430 True ENSG00000105649 ENSG00000105649 HGNC:9777 RAB3GAP2 gene RAB3GAP2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Martsolf syndrome 212720" PMID: 32376645 False 3 100;0;0 4.430 True ENSG00000118873 ENSG00000118873 HGNC:17168 RAB7A gene RAB7A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 2B, MIM# 600882;MONDO:0010949 12545426;17060578;32326241;29130394;25614874 False 3 100;0;0 4.430 False ENSG00000075785 ENSG00000075785 HGNC:9788 RAD21 gene RAD21 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mungan syndrome, MIM# 611376: Barrett esophagus, megaduodenum, cardiac abnormalities 14638363;32193685;25575569 False 3 100;0;0 4.430 True ENSG00000164754 ENSG00000164754 HGNC:9811 RAPSN gene RAPSN Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Fetal akinesia deformation sequence 2 MIM# 618388;AChR deficiency;fetal akinesia;IUGR;micrognathia;hypokinesia;contractures;muscular hypotonia;feeding difficulties;severe respiratory insufficiency;history of miscarriage 18179903;18252226;28495245;22482962 False 3 100;0;0 4.430 True ENSG00000165917 ENSG00000165917 HGNC:9863 RAPSN gene RAPSN Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 11, associated with acetylcholine receptor deficiency, 616326;acute respiratory crises;late and early onset 11791205;14504330;20930056;25194721 False 3 100;0;0 4.430 True ENSG00000165917 ENSG00000165917 HGNC:9863 RBCK1 gene RBCK1 Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polyglucosan body myopathy 1 with or without immunodeficiency 615895 29260357;29695863 False 3 100;0;0 4.430 True ENSG00000125826 ENSG00000125826 HGNC:15864 RCC1 gene RCC1 Expert list;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Infection-induced acute-onset axonal neuropathy, MIM# 621333 40683276 False 3 100;0;0 4.430 False ENSG00000180198 ENSG00000180198 HGNC:1913 REEP1 gene REEP1 Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 31, autosomal dominant MIM#610250 23108492;22703882 False 3 100;0;0 4.430 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP1 gene REEP1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic (but BIALLELIC mutations cause a more SEVERE disease form), autosomal or pseudoautosomal Spinal muscular atrophy, distal, autosomal recessive, 6, MIM#620011;Neuronopathy, distal hereditary motor, type VB MIM#614751;Spastic paraplegia 31, autosomal dominant MIM#610250 27066569;31872057;22703882;29124833 False 3 100;0;0 4.430 False Other ENSG00000068615 ENSG00000068615 HGNC:25786 REEP1 gene REEP1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 31, autosomal dominant, MIM# 610250" 16826527;19034539 False 3 100;0;0 4.430 True ENSG00000068615 ENSG00000068615 HGNC:25786 REEP2 gene REEP2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 72, dominant and recessive, MIM# 615625;MONDO:0014282 33526816;28491902;24388663 False 3 100;0;0 4.430 True ENSG00000132563 ENSG00000132563 HGNC:17975 RET gene RET Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Central hypoventilation syndrome, congenital, MIM# 209880;Multiple endocrine neoplasia IIA, MIM# 171400;Multiple endocrine neoplasia IIB, MIM# 162300 False 3 100;0;0 4.430 True ENSG00000165731 ENSG00000165731 HGNC:9967 RETREG1 gene RETREG1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type IIB, 613115;HSAN/SFN 19838196;24327336;31737055;31596031 False 3 100;0;0 4.430 False ENSG00000154153 ENSG00000154153 HGNC:25964 RFC1 gene RFC1 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome OMIM 614575 30926972;33103729;35883251;36478048;36289003 False 3 67;33;0 4.430 True Other ENSG00000035928 ENSG00000035928 HGNC:9969 RFC4 gene RFC4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Morimoto-Ryu-Malicdan neuromuscular syndrome, MIM# 621010 PMID: 39106866 False 3 100;0;0 4.430 True ENSG00000163918 ENSG00000163918 HGNC:9972 RINT1 gene RINT1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, MONDO:0019064, RINT1-related 37463447;38990652 False 3 50;50;0 4.430 True ENSG00000135249 ENSG00000135249 HGNC:21876 RIPK4 gene RIPK4 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Popliteal pterygium syndrome, Bartsocas-Papas type, MIM# 263650 28940926;22197489;22197488 False 3 100;0;0 4.430 True ENSG00000183421 ENSG00000183421 HGNC:496 RMND1 gene RMND1 Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation defect type 11 MONDO:0013969 23022099;25604853;27843092 False 3 100;0;0 4.430 False ENSG00000155906 ENSG00000155906 HGNC:21176 RNASEH2B gene RNASEH2B Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi Goutieres syndrome 2, MIM# 610181 29691679;30223285;29239743;28762473 False 3 100;0;0 4.430 True ENSG00000136104 ENSG00000136104 HGNC:25671 RNF170 gene RNF170 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 85, autosomal recessive, MIM# 619686 31636353 False 3 100;0;0 4.430 True ENSG00000120925 ENSG00000120925 HGNC:25358 RNU7-1 gene RNU7-1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi-Goutieres syndrome 9, MIM# 619487 33230297 False 3 100;0;0 4.430 True ENSG00000238923 ENSG00000238923 HGNC:34033 RPS6KC1 gene RPS6KC1 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with spasticity, thin corpus callosum, and decreased brain white matter, MIM# 621460 41130203 False 3 100;0;0 4.430 True ENSG00000136643 ENSG00000136643 HGNC:10439 RRM2B gene RRM2B Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 8A (encephalomyopathic type with renal tubulopathy), 612075;Mitochondrial DNA depletion syndrome 8B (MNGIE type), 612075;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 5, 613077 32827185;24741716 False 3 100;0;0 4.430 True ENSG00000048392 ENSG00000048392 HGNC:17296 RRM2B gene RRM2B Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 8B (MNGIE type) MIM#612075;Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 5 MIM#613077 19667227;23107649 False 3 100;0;0 4.430 True ENSG00000048392 ENSG00000048392 HGNC:17296 RTN2 gene RTN2 Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 11, with spasticity, MIM# 620854 38527963 False 3 100;0;0 4.430 False ENSG00000125744 ENSG00000125744 HGNC:10468 RTN2 gene RTN2 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 12, autosomal dominant, 604805;MONDO:0011489 22232211;27165006 False 3 100;0;0 4.430 True ENSG00000125744 ENSG00000125744 HGNC:10468 RYR1 gene RYR1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myopathy 1A, autosomal dominant, with susceptibility to malignant hyperthermia, MIM# 117000;Congenital myopathy 1B, autosomal recessive, MIM# 255320 38520674 False 3 100;0;0 4.430 True ENSG00000196218 ENSG00000196218 HGNC:10483 RYR1 gene RYR1 Expert Review Green;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal calf predominant distal myopathy;distal myopathy MONDO:0018949 30842289;33458580 False 3 100;0;0 4.430 True ENSG00000196218 ENSG00000196218 HGNC:10483 RYR1 gene RYR1 Expert Review Green;Expert list;Royal Melbourne Hospital;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Malignant hyperthermia False 3 100;0;0 4.430 False ENSG00000196218 ENSG00000196218 HGNC:10483 RYR1 gene RYR1 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Malignant hyperthermia susceptibility 1}, 145600;Central core disease, 117000;King-Denborough syndrome, 145600;Neuromuscular disease, congenital, with uniform type 1 fiber, 117000;Minicore myopathy with external ophthalmoplegia, 255320 20301325;23553484 False 3 67;33;0 4.430 True ENSG00000196218 ENSG00000196218 HGNC:10483 RYR1 gene RYR1 Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Central core disease (MIM#117000);Minicore myopathy with external ophthalmoplegia (MIM#255320);Neuromuscular disease, congenital, with uniform type 1 fiber (MIM#117000) 23553484 False 3 33;33;33 4.430 True ENSG00000196218 ENSG00000196218 HGNC:10483 SACS gene SACS Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic ataxia, Charlevoix-Saguenay type, MIM@ 270550" False 3 100;0;0 4.430 True ENSG00000151835 ENSG00000151835 HGNC:10519 SACS gene SACS Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charlevoix-Saguenay spastic ataxia (MONDO:0010041;MIM#270550) 20301432;20876471 False 3 100;0;0 4.430 True ENSG00000151835 ENSG00000151835 HGNC:10519 SAMD9 gene SAMD9 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted MIRAGE syndrome, MIM# 617053 27182967 False 3 100;0;0 4.430 True ENSG00000205413 ENSG00000205413 HGNC:1348 SAMHD1 gene SAMHD1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Aicardi Goutieres syndrome 5, MIM# 612952 False 3 100;0;0 4.430 True ENSG00000101347 ENSG00000101347 HGNC:15925 SARS gene SARS Literature;Expert Review Green;Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Genetic peripheral neuropathy MONDO#0020127, SARS1-related 36088542 False 3 100;0;0 4.430 False ENSG00000031698 ENSG00000031698 HGNC:10537 SBF1 gene SBF1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 4B3 , MIM#615284;MONDO:0014117 23749797;23749797;32444983;30039846;28005197 False 3 100;0;0 4.430 True ENSG00000100241 ENSG00000100241 HGNC:10542 SBF2 gene SBF2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Charcot Marie Tooth disease, type 4B2, MIM#604563 12554688;15477569;12687498;15304601;31772832;31070812 False 3 100;0;0 4.430 False ENSG00000133812 ENSG00000133812 HGNC:2135 SCARF2 gene SCARF2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Van den Ende-Gupta syndrome, MIM# 600920 20887961;23808541;24478002;27375131;24478002 False 3 100;0;0 4.430 True ENSG00000244486 ENSG00000244486 HGNC:19869 SCN10A gene SCN10A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown HSAN/SFN;Episodic pain syndrome, familial, 2, 615551 23115331;33775738;30731422;30554136 False 3 100;0;0 4.430 False ENSG00000185313 ENSG00000185313 HGNC:10582 SCN11A gene SCN11A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuropathy, hereditary sensory and autonomic, type VII, MIM# 615548;MONDO:0014244 24036948;25118027;30395542;33884296;32831372;30046661 False 3 100;0;0 4.430 False ENSG00000168356 ENSG00000168356 HGNC:10583 SCN11A gene SCN11A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Neuropathy, hereditary sensory and autonomic, type VII, MIM# 615548" 27503742;25118027 False 3 100;0;0 4.430 True ENSG00000168356 ENSG00000168356 HGNC:10583 SCN1A gene SCN1A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arthrogryposis multiplex congenita;Dravet syndrome, MIM# 607208 32928894;29543227 False 3 100;0;0 4.430 True ENSG00000144285 ENSG00000144285 HGNC:10585 SCN4A gene SCN4A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Paramyotonia congenita, 168300;Myotonia congenita, atypical, acetazolamide-responsive, 608390;Hypokalemic periodic paralysis, type 2, 613345;Myasthenic syndrome, congenital, 16, 614198;Hyperkalemic periodic paralysis, type 2, 170500 23801527;28779239;32978841 False 3 100;0;0 4.430 True ENSG00000007314 ENSG00000007314 HGNC:10591 SCN4A gene SCN4A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hyperkalemic Periodic Paralysis;Hypokalemic periodic paralysis, type 2, 613;Thyrotoxic Periodic Paralysis, Susceptibility To, 2;Hypokalemic Periodic Paralysis;Episodic weakness;Myotonia;Potassium-Aggravated Myotonia;Hyperkalemic periodic paralysis, type 2, 170500;Myasthenic syndrome, acetazolamide-responsive, 614198 8385748;11591859 False 3 100;0;0 4.430 True ENSG00000007314 ENSG00000007314 HGNC:10591 SCN4A gene SCN4A Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 16, 614198 12766226;25707578;32849172 False 3 100;0;0 4.430 True ENSG00000007314 ENSG00000007314 HGNC:10591 SCN9A gene SCN9A Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Erythermalgia, primary, MIM# 133020;Insensitivity to pain, congenital, MIM# 243000;Neuropathy, hereditary sensory and autonomic, type IID, MIM# 243000;Paroxysmal extreme pain disorder, MIM# 167400;Small fiber neuropathy,MIM# 133020 False 3 100;0;0 4.430 False ENSG00000169432 ENSG00000169432 HGNC:10597 SCO2 gene SCO2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal autosomal recessive axonal charcot-marie-tooth disease due to copper metabolism defect MONDO:0033850 29351582;31844624;35112411 False 3 100;0;0 4.430 False ENSG00000130489 ENSG00000130489 HGNC:10604 SCO2 gene SCO2 Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal cardioencephalomyopathy, fatal infantile, due to cytochrome c oxidase deficiency 1 MONDO:0011451 23719228 False 3 100;0;0 4.430 True ENSG00000130489 ENSG00000130489 HGNC:10604 SCYL1 gene SCYL1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 21 (MIM#616719);acute infantile liver failure-cerebellar ataxia-peripheral sensory motor neuropathy syndrome (MONDO:0014744);Spinocerebellar ataxia, autosomal recessive 21;Early-onset ataxia (<1 year) with recurrent episodes of liver failure, sensory-motor axonal neuropathy, cerebellar atrophy 26581903;30531813 False 3 100;0;0 4.430 True ENSG00000142186 ENSG00000142186 HGNC:14372 SCYL2 gene SCYL2 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita 4, neurogenic, with agenesis of the corpus callosum, MIM# 618766 31960134;26203146;40243816;39169672 False 3 50;50;0 4.430 True ENSG00000136021 ENSG00000136021 HGNC:19286 SEC31A gene SEC31A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Halperin-Birk syndrome, MIM# 618651" 30464055;40508110;39725565 False 3 100;0;0 4.430 True ENSG00000138674 ENSG00000138674 HGNC:17052 SEC31A gene SEC31A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neurodevelopmental disorder with spastic quadriplegia, optic atrophy, seizures, and structural brain anomalies, MIM# 618651;congenital neurodevelopmental syndrome;spastic paraplegia;multiple contractures;profound developmental delay;epilepsy;failure to thrive" 30464055;40508110;39725565 False 3 100;0;0 4.430 True ENSG00000138674 ENSG00000138674 HGNC:17052 SELENOI gene SELENOI Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 81, autosomal recessive 618768 28052917;29500230;39806532;33454747 False 3 100;0;0 4.430 True ENSG00000138018 ENSG00000138018 HGNC:29361 SELENON gene SELENON Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 3 with rigid spine, MIM# 602771 30642275 False 3 100;0;0 4.430 True ENSG00000162430 ENSG00000162430 HGNC:15999 SELENON gene SELENON Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, rigid spine, 1 (MIM#602771) 11528383 False 3 100;0;0 4.430 True ENSG00000162430 ENSG00000162430 HGNC:15999 SENP7 gene SENP7 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita, MONDO:0015168, SENP7-related 37460201;39763084;38972567 False 3 50;50;0 4.430 True ENSG00000138468 ENSG00000138468 HGNC:30402 SEPT9 gene SEPT9 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophy, hereditary neuralgic, MIM# 162100;HMSN 16186812;19451530;19939853;19139049 False 3 100;0;0 4.430 False ENSG00000184640 ENSG00000184640 HGNC:7323 SERAC1 gene SERAC1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome, MIM# 614739 False 3 100;0;0 4.430 True ENSG00000122335 ENSG00000122335 HGNC:21061 SETX gene SETX Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal dHMN/dSMA;Amyotrophic lateral sclerosis 4, juvenile MIM# 602433;Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 2 23129421;16644229;30052327 False 3 100;0;0 4.430 True ENSG00000107290 ENSG00000107290 HGNC:445 SETX gene SETX Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis 4, juvenile (MIM#602433) 15106121;9497266 False 3 100;0;0 4.430 True ENSG00000107290 ENSG00000107290 HGNC:445 SGCA gene SGCA Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 3 MIM#608099 27297959;26453141;23989969 False 3 100;0;0 4.430 True ENSG00000108823 ENSG00000108823 HGNC:10805 SGCA gene SGCA Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Limb-girdle muscular dystrophy;Muscular dystrophy, limb-girdle, type 2D, 608099;autosomal recessive limb-girdle muscular dystrophy, MONDO:0015152 30007747;9192266;34404573 False 3 100;0;0 4.430 True ENSG00000108823 ENSG00000108823 HGNC:10805 SGCB gene SGCB Expert Review;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2E, 604286 False 3 100;0;0 4.430 False ENSG00000163069 ENSG00000163069 HGNC:10806 SGCD gene SGCD Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2F, 601287 False 3 67;0;33 4.430 False ENSG00000170624 ENSG00000170624 HGNC:10807 SGCG gene SGCG Expert Review Green;Expert Review;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2C, 253700 30838351;25802879 False 3 100;0;0 4.430 True ENSG00000102683 ENSG00000102683 HGNC:10809 SH3TC2 gene SH3TC2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal HMSN;Charcot Marie Tooth disease, type 4C, 601596;Mononeuropathy of the median nerve, mild, 613353 19744956;20220177;19744956;20028792 False 3 100;0;0 4.430 False ENSG00000169247 ENSG00000169247 HGNC:29427 SHMT2 gene SHMT2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with cardiomyopathy, spasticity, and brain abnormalities (NEDCASB), MIM#619121;Congenital microcephaly;Infantile axial hypotonia;Spastic paraparesis;Global developmental delay;Intellectual disability;Abnormality of the corpus callosum;Abnormal cortical gyration;Hypertrophic cardiomyopathy;Abnormality of the face;Proximal placement of thumb;2-3 toe syndactyly 33015733 False 3 100;0;0 4.430 True ENSG00000182199 ENSG00000182199 HGNC:10852 SIGMAR1 gene SIGMAR1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Distal spinal muscular atrophy, autosomal recessive 2;dHMN/dSMA;Distal hereditary motor neuropathy of Jerash type (HMNJ) 31511340 False 3 100;0;0 4.430 False ENSG00000147955 ENSG00000147955 HGNC:8157 SIGMAR1 gene SIGMAR1 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 67;33;0 4.430 False ENSG00000147955 ENSG00000147955 HGNC:8157 SIL1 gene SIL1 Expert Review Green;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Marinesco-Sjogren syndrome 248800 False 3 100;0;0 4.430 False ENSG00000120725 ENSG00000120725 HGNC:24624 SIL1 gene SIL1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Marinesco-Sjogren syndrome (MIM#248800)" 16282977;24176978 False 3 100;0;0 4.430 True ENSG00000120725 ENSG00000120725 HGNC:24624 SKI gene SKI Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Shprintzen-Goldberg syndrome, MIM# 182212 20301454 False 3 100;0;0 4.430 True ENSG00000157933 ENSG00000157933 HGNC:10896 SLC12A6 gene SLC12A6 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Andermann syndrome;Hereditary Motor and Sensory Neuropathy with Agenesis of the Corpus Callosum;Charcot-Marie-Tooth disease, axonal, type 2II , MIM#620068 31439721 False 3 100;0;0 4.430 True ENSG00000140199 ENSG00000140199 HGNC:10914 SLC16A2 gene SLC16A2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Allan-Herndon-Dudley syndrome, 300523, XL 15980113;31410843;20301789 False 3 100;0;0 4.430 True ENSG00000147100 ENSG00000147100 HGNC:10923 SLC18A3 gene SLC18A3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ophthalmopleggia and apnea;Myasthenic syndrome, congenital, 21, presynaptic, 617239 27590285;20123977;28188302;31059209 False 3 100;0;0 4.430 True ENSG00000187714 ENSG00000187714 HGNC:10936 SLC1A4 gene SLC1A4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic tetraplegia, thin corpus callosum, and progressive microcephaly, 616657;MONDO:0014725 25930971;26138499;26041762;27193218;29989513 False 3 100;0;0 4.430 True ENSG00000115902 ENSG00000115902 HGNC:10942 SLC22A5 gene SLC22A5 Expert Review Green;Literature;NHS GMS;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine deficiency, systemic primary 212140 9916797;10072434;10051646;10425211;10480371;10679939;9837751;23379544;31399326 False 3 100;0;0 4.430 True ENSG00000197375 ENSG00000197375 HGNC:10969 SLC25A1 gene SLC25A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Myasthenic syndrome, congenital, 23, presynaptic;618197 26870663;31527857 False 3 100;0;0 4.430 True ENSG00000100075 ENSG00000100075 HGNC:10979 SLC25A15 gene SLC25A15 Expert list;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome MIM#238970 16376511;22465082;28592010 False 3 100;0;0 4.430 False ENSG00000102743 ENSG00000102743 HGNC:10985 SLC25A19 gene SLC25A19 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive demyelinating neuropathy with bilateral striatal necrosis MONDO:0013382 20301539 False 3 100;0;0 4.430 True ENSG00000125454 ENSG00000125454 HGNC:14409 SLC25A20 gene SLC25A20 Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine-acylcarnitine translocase deficiency MIM#212138 24088670 False 3 100;0;0 4.430 True ENSG00000178537 ENSG00000178537 HGNC:1421 SLC25A32 gene SLC25A32 Expert Review Green;Literature;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Exercise intolerance, riboflavin-responsive MONDO:0014795 26933868;35727412;34764427;28443623 False 3 100;0;0 4.430 True ENSG00000164933 ENSG00000164933 HGNC:29683 SLC25A4 gene SLC25A4 Expert Review Green;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 12B (cardiomyopathic type) AR MIM#615418 28823815 False 3 100;0;0 4.430 True ENSG00000151729 ENSG00000151729 HGNC:10990 SLC25A46 gene SLC25A46 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neuropathy, hereditary motor and sensory, type VIB, MIM# 616505;Pontocerebellar hypoplasia, type 1E, MIM# 619303" 26168012;27543974 False 3 100;0;0 4.430 True ENSG00000164209 ENSG00000164209 HGNC:25198 SLC29A3 gene SLC29A3 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Histiocytosis-lymphadenopathy plus syndrome, MIM# 602782" 18940313;19336477;22238637 False 3 100;0;0 4.430 True ENSG00000198246 ENSG00000198246 HGNC:23096 SLC2A1 gene SLC2A1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal GLUT1 deficiency syndrome 1, infantile onset, severe, MIM# 606777;Developmental delay;autosomal dominant, complicated hereditary spastic paraplegia (HSP);paroxysmal choreoathetosis;spastic paraplegia;seizure False 3 100;0;0 4.430 True ENSG00000117394 ENSG00000117394 HGNC:11005 SLC35A3 gene SLC35A3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, impaired intellectual development, and seizures, OMIM #615553 PMID: 28777481, 24031089, 28328131, 33416188 False 3 100;0;0 4.430 True ENSG00000117620 ENSG00000117620 HGNC:11023 SLC4A10 gene SLC4A10 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia and characteristic brain abnormalities, MIM# 620746 PMID: 37459438 False 3 100;0;0 4.430 True ENSG00000144290 ENSG00000144290 HGNC:13811 SLC52A2 gene SLC52A2 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-van Laere syndrome 2 MONDO:0013867 29193829;31868069;29053833;26072523 False 3 100;0;0 4.430 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-van Laere syndrome 2 (BVVLS2) (MONDO:0013867) 22740598;24253200 False 3 100;0;0 4.430 True ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A2 gene SLC52A2 Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000185803 ENSG00000185803 HGNC:30224 SLC52A3 gene SLC52A3 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-van Laere syndrome 1 MONDO:0024537 29193829;31868069;29053833;26072523 False 3 100;0;0 4.430 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC52A3 gene SLC52A3 Expert Review Green;Expert Review Green;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amytrophic Lateral Sclerosis (ALS);Brown-Vialetto-van Laere syndrome 1 (MIM# 211530) 26072523 False 3 100;0;0 4.430 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC52A3 gene SLC52A3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Brown-Vialetto-Van Laere syndrome 1 (MIM#211530);dHMN;Brown-Vialetto-Van Laere syndrome 1;Fazio-Londe disease 20206331 False 3 100;0;0 4.430 True ENSG00000101276 ENSG00000101276 HGNC:16187 SLC5A6 gene SLC5A6 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peripheral motor neuropathy, childhood-onset, biotin-responsive, MIM# 619903 35013551 False 3 100;0;0 4.430 True ENSG00000138074 ENSG00000138074 HGNC:11041 SLC5A7 gene SLC5A7 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 20, presynaptic, MIM# 617143 27569547;29189923;30172469 False 3 100;0;0 4.430 True ENSG00000115665 ENSG00000115665 HGNC:14025 SLC5A7 gene SLC5A7 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, type VIIA, MIM# 158580;MONDO:0008024 23141292;15173594;29782645;29582019 False 3 100;0;0 4.430 False ENSG00000115665 ENSG00000115665 HGNC:14025 SLC5A7 gene SLC5A7 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 20, presynaptic, 617143;Hereditory motor neuropathy 27569547;29189923;30172469 False 3 100;0;0 4.430 True ENSG00000115665 ENSG00000115665 HGNC:14025 SLC6A9 gene SLC6A9 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycine encephalopathy with normal serum glycine, MIM#617301;arthrogryposis 27773429;27481395;31875334;32712301;33269555 False 3 100;0;0 4.430 True ENSG00000196517 ENSG00000196517 HGNC:11056 SMAD4 gene SMAD4 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myhre syndrome, MIM# 139210 False 3 100;0;0 4.430 True ENSG00000141646 ENSG00000141646 HGNC:6770 SMCHD1 gene SMCHD1 Expert Review Green;Expert list;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Facioscapulohumeral muscular dystrophy MONDO:0001347 20301616 False 3 100;0;0 4.430 True ENSG00000101596 ENSG00000101596 HGNC:29090 SMN1 gene SMN1 Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy-1, MIM# 253300 20301623 False 3 100;0;0 4.430 True ENSG00000172062 ENSG00000172062 HGNC:11117 SMN1 gene SMN1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy-1, MIM# 253300;Spinal muscular atrophy-2, MIM# 253550;Spinal muscular atrophy-3, MIM# 253400;Spinal muscular atrophy-4, MIM# 271150 False 3 100;0;0 4.430 False ENSG00000172062 ENSG00000172062 HGNC:11117 SMN1 gene SMN1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy, type 0 False 3 100;0;0 4.430 True ENSG00000172062 ENSG00000172062 HGNC:11117 SMPD4 gene SMPD4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Microcephaly;congenital arthrogryposis, intellectual disability 31495489 False 3 100;0;0 4.430 True ENSG00000136699 ENSG00000136699 HGNC:32949 SMPX gene SMPX Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Myopathy, distal, 7, adult-onset, X-linked, MIM# 301075 33974137 False 3 100;0;0 4.430 True Other ENSG00000091482 ENSG00000091482 HGNC:11122 SNAP29 gene SNAP29 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebral dysgenesis, neuropathy, ichthyosis, and palmoplantar keratoderma syndrome (CEDNIK) Syndrome (MONDO:0012290) (MIM#609528);Cerebral Dysgenesis and severe psychomotor retardation, axonal sensory-motor Neuropathy, Ichthyosis, palmoplantar Keratoderma, fatal by second decade of life 33977139 False 3 0;100;0 4.430 True ENSG00000099940 ENSG00000099940 HGNC:11133 SNAPC4 gene SNAPC4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with motor regression, progressive spastic paraplegia, and oromotor dysfunction, MIM# 620515 36965478 False 3 100;0;0 4.430 True ENSG00000165684 ENSG00000165684 HGNC:11137 SNUPN gene SNUPN Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 29, MIM# 620793 PMID: 38413582;PMID: 38366623 False 3 100;0;0 4.430 True ENSG00000169371 ENSG00000169371 HGNC:14245 SNUPN gene SNUPN Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 29, MIM# 620793 PMID: 38413582;PMID: 38366623 False 3 100;0;0 4.430 True ENSG00000169371 ENSG00000169371 HGNC:14245 SOD1 gene SOD1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 1 (105400 AD, AR);Spastic tetraplegia and axial hypotonia, progressive (618598 AR) 8625408;21545237;16503123 False 3 100;0;0 4.430 True ENSG00000142168 ENSG00000142168 HGNC:11179 SOD1 gene SOD1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic tetraplegia and axial hypotonia, progressive, MIM#618598 PMID: 31314961;31332433;34788402 False 3 100;0;0 4.430 True ENSG00000142168 ENSG00000142168 HGNC:11179 SOD1 gene SOD1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary peripheral neuropathy, MONDO:0020127, SOD1-related 39932579 False 3 100;0;0 4.430 False ENSG00000142168 ENSG00000142168 HGNC:11179 SORD gene SORD Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal isolated hereditary neuropathy;Sorbitol dehydrogenase deficiency with peripheral neuropathy (SORDDPN), MIM#618912 32367058 False 3 100;0;0 4.430 False ENSG00000140263 ENSG00000140263 HGNC:11184 SOX10 gene SOX10 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted PCWH syndrome, MIM# 609136 10762540;10482261;15004559 False 3 100;0;0 4.430 True ENSG00000100146 ENSG00000100146 HGNC:11190 SOX10 gene SOX10 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown PCWH Syndrome (MIM#609136;MONDO:0012198);Waardenburg syndrome, type 4C, 613266;Hypopigmentation of the hair and skin, sensory hearing loss, demyelinating neuropathy, dysmyelinating leukodystrophy, developmental delay, spasticity, ataxia, Hirschsprung disease;Waardenburg syndrome, type 2E, with or without neurologic involvement, 611584;HMSN 15004559 False 3 0;100;0 4.430 True ENSG00000100146 ENSG00000100146 HGNC:11190 SPART gene SPART Expert Review Green;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 3 100;0;0 4.430 False ENSG00000133104 ENSG00000133104 HGNC:18514 SPART gene SPART Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Troyer syndrome, MIM# 275900;SPG20;MONDO:0010156 12134148;20437587;26003402;27112432;31535723;31535723;28875386;28679690 False 3 100;0;0 4.430 True ENSG00000133104 ENSG00000133104 HGNC:18514 SPAST gene SPAST Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spastic paraplegia 4, autosomal dominant;Spasticity;Hereditary Neuropathies False 3 100;0;0 4.430 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPAST gene SPAST Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted 16765570;19364936 False 3 100;0;0 4.430 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPAST gene SPAST Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 4, autosomal dominant, MIM# 182601;Cerebral Palsy MONDO:0006497, SPAST-related, AR 41000004 False 3 100;0;0 4.430 True ENSG00000021574 ENSG00000021574 HGNC:11233 SPEG gene SPEG Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Centronuclear myopathy 5, MIM# 615959 25087613;30412272 False 3 100;0;0 4.430 True ENSG00000072195 ENSG00000072195 HGNC:16901 SPG11 gene SPG11 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Hereditary Neuropathies;axonal Charcot-Marie-Tooth disease type 2X;MONDO:0014726 26556829;33581793 False 3 100;0;0 4.430 False ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 11, autosomal recessive, MIM# 604360" 18067136 False 3 100;0;0 4.430 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG11 gene SPG11 Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 5, juvenile, MIM# 602099 20110243 False 3 100;0;0 4.430 True ENSG00000104133 ENSG00000104133 HGNC:11226 SPG21 gene SPG21 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mast syndrome, 248900;Spastic Paraplegia, autosomal recessive 14564668;24451228;28752238;26978163 False 3 100;0;0 4.430 False ENSG00000090487 ENSG00000090487 HGNC:20373 SPG7 gene SPG7 Expert Review Green;Expert Review Green;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 7, autosomal recessive MIM#607259 16765570;19364936 False 3 100;0;0 4.430 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPG7 gene SPG7 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 7, autosomal recessive, MIM# 607259" 22571692 False 3 100;0;0 4.430 True ENSG00000197912 ENSG00000197912 HGNC:11237 SPTAN1 gene SPTAN1 Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, 11, autosomal dominant, MIM# 620528 33578420;31332438 False 3 100;0;0 4.430 False ENSG00000197694 ENSG00000197694 HGNC:11273 SPTAN1 gene SPTAN1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic Paraplegia MONDO:0019064, SPTAN1-related;Autosomal dominant spastic paraplegia-91, with or without cerebellar ataxia (SPG91), MIM#620538 PMID: 35150594;34526651;31515523 False 3 100;0;0 4.430 True ENSG00000197694 ENSG00000197694 HGNC:11273 SPTAN1 gene SPTAN1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted distal myopathy MONDO:0018949 40023774 False 3 100;0;0 4.430 True ENSG00000197694 ENSG00000197694 HGNC:11273 SPTBN4 gene SPTBN4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with hypotonia, neuropathy, and deafness MIM#617519 28540413;29861105 False 3 100;0;0 4.430 False ENSG00000160460 ENSG00000160460 HGNC:14896 SPTLC1 gene SPTLC1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Juvenile amyotrophic lateral sclerosis-27, MIM#620285;HSAN/SFN;Hereditary Sensory and Autonomic Neuropathy, Type II;Neuropathy, hereditary sensory and autonomic, type IA, 162400 11242114;11242106;15037712;26681808 False 3 100;0;0 4.430 False ENSG00000090054 ENSG00000090054 HGNC:11277 SPTLC1 gene SPTLC1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted juvenile amyotrophic lateral sclerosis MONDO:0017593 34059824;35900868;34459874 False 3 100;0;0 4.430 True Other ENSG00000090054 ENSG00000090054 HGNC:11277 SPTLC2 gene SPTLC2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuropathy, hereditary sensory and autonomic, type IC, 613640;MONDO:0013337;HSAN/SFN 20920666;23658386;31509666;30866134 False 3 100;0;0 4.430 False ENSG00000100596 ENSG00000100596 HGNC:11278 SRPK3 gene SRPK3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Myopathy, MONDO:0005336, digenic SRPK3- and TTN-related 38429495 False 3 100;0;0 4.430 True ENSG00000184343 ENSG00000184343 HGNC:11402 STAC3 gene STAC3 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Myopathy, congenital, Baily-Bloch, MIM# 255995" 23736855;30168660;28777491 False 3 100;0;0 4.430 True ENSG00000185482 ENSG00000185482 HGNC:28423 STAC3 gene STAC3 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 13 (MIM#255995) 28411587;28777491 False 3 100;0;0 4.430 True ENSG00000185482 ENSG00000185482 HGNC:28423 STIM1 gene STIM1 Expert Review Green;Literature;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted tubular aggregate myopathy MONDO:0008051 38982518;31448844 False 3 100;0;0 4.430 True Other ENSG00000167323 ENSG00000167323 HGNC:11386 STIM1 gene STIM1 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Myopathy, tubular aggregate, 1 (MIM#160565);Stormorken syndrome (MIM#185070)" 31448844 False 3 67;33;0 4.430 True Other ENSG00000167323 ENSG00000167323 HGNC:11386 STIM1 gene STIM1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, tubular aggregate, 1 160565;Stormorken syndrome 185070 23332920;31448844 False 3 100;0;0 4.430 True ENSG00000167323 ENSG00000167323 HGNC:11386 STUB1 gene STUB1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spinocerebellar ataxia, autosomal recessive 16, MIM# 615768" 32342324;32337344 False 3 100;0;0 4.430 False ENSG00000103266 ENSG00000103266 HGNC:11427 SUCLA2 gene SUCLA2 Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria) 612073 15877282;17287286;17301081;23759946;33231368;33230181;28243576;27913098;27651038 False 3 100;0;0 4.430 True ENSG00000136143 ENSG00000136143 HGNC:11448 SUCLG1 gene SUCLG1 Expert Review Green;Other;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial DNA depletion syndrome 9 MONDO:0009504 30560055;29217198 False 3 100;0;0 4.430 True ENSG00000163541 ENSG00000163541 HGNC:11449 SURF1 gene SURF1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Leigh syndrome, due to COX IV deficiency, 256000;HMSN;Leigh syndrome (early onset progressive neurodegeneration of the brain stem, basal ganglia and spinal cord), neuropathy with SNCV False 3 100;0;0 4.430 False ENSG00000148290 ENSG00000148290 HGNC:11474 SYNE1 gene SYNE1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Distal arthrogryposis 27782104 False 3 100;0;0 4.430 True ENSG00000131018 ENSG00000131018 HGNC:17089 SYNE1 gene SYNE1 Expert Review;Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Emery-Dreifuss muscular dystrophy 4, autosomal dominant 612998 False 3 100;0;0 4.430 False ENSG00000131018 ENSG00000131018 HGNC:17089 SYNE1 gene SYNE1 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Emery-Dreifuss muscular dystrophy 4, autosomal dominant 612998 27782104;19542096 False 3 100;0;0 4.430 True ENSG00000131018 ENSG00000131018 HGNC:17089 SYT2 gene SYT2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 7, presynaptic, MIM# 616040;Myasthenic syndrome, congenital, 7B, presynaptic, autosomal recessive MIM#619461 25192047;32776697;32250532;30533528 False 3 100;0;0 4.430 True ENSG00000143858 ENSG00000143858 HGNC:11510 SYT2 gene SYT2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myasthenic syndrome, congenital, 7, presynaptic;HMSN 25192047;30533528;26519543 False 3 100;0;0 4.430 False ENSG00000143858 ENSG00000143858 HGNC:11510 TAF1C gene TAF1C Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal complex neurodevelopmental disorder, TAF1C-related, MONDO:0100038 40371665;32779182 False 3 100;0;0 4.430 True ENSG00000103168 ENSG00000103168 HGNC:11534 TAMM41 gene TAMM41 Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency-56 (COXPD56), MIM#620139 35321494;29253589 False 3 100;0;0 4.430 True ENSG00000144559 ENSG00000144559 HGNC:25187 TANGO2 gene TANGO2 Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration, 616878 26805781 False 3 100;0;0 4.430 True ENSG00000183597 ENSG00000183597 HGNC:25439 TARDBP gene TARDBP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 10, with or without FTD;Frontotemporal lobar degeneration, TARDBP-related (MIM#612069;MONDO: 0012790) 20301761;18309045;19609911 False 3 100;0;0 4.430 True ENSG00000120948 ENSG00000120948 HGNC:11571 TAZ gene TAZ Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Barth syndrome MIM#302060 26845103 False 3 100;0;0 4.430 True ENSG00000102125 ENSG00000102125 HGNC:11577 TBCD gene TBCD Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ENCEPHALOPATHY, PROGRESSIVE, EARLY-ONSET, WITH BRAIN ATROPHY AND THIN CORPUS CALLOSUM 27666370;27666374 False 3 100;0;0 4.430 True ENSG00000141556 ENSG00000141556 HGNC:11581 TBCE gene TBCE Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Encephalopathy, progressive, with amyotrophy and optic atrophy 617207" PMID: 27666369 False 3 100;0;0 4.430 True ENSG00000116957 ENSG00000116957 HGNC:11582 TBK1 gene TBK1 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 4 (MIM#616439;MONDO:0011223) 20301623;25803835 False 3 100;0;0 4.430 True ENSG00000183735 ENSG00000183735 HGNC:11584 TCAP gene TCAP Expert Review Green;Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2G, 601954 25055047;22029105;18948002 False 3 100;0;0 4.430 True ENSG00000173991 ENSG00000173991 HGNC:11610 TECPR2 gene TECPR2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 49, autosomal recessive;HSAN/SFN False 3 100;0;0 4.430 False ENSG00000196663 ENSG00000196663 HGNC:19957 TECPR2 gene TECPR2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 49, autosomal recessive, 615031;Autonomic-sensory neuropathy 23176824;26542466 False 3 100;0;0 4.430 True ENSG00000196663 ENSG00000196663 HGNC:19957 TFG gene TFG Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary motor and sensory neuropathy, Okinawa type, MIM# 604484 25098539;23553329;22883144;31449671;31111683 False 3 100;0;0 4.430 False ENSG00000114354 ENSG00000114354 HGNC:11758 TFG gene TFG Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 57, autosomal recessive, MIM# 615658 30467354;30157421;28124177;27601211;27492651;23479643 False 3 100;0;0 4.430 True ENSG00000114354 ENSG00000114354 HGNC:11758 TGFB2 gene TGFB2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Loeys-Dietz syndrome 4, MIM# 614816 False 3 100;0;0 4.430 True ENSG00000092969 ENSG00000092969 HGNC:11768 TGFB3 gene TGFB3 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Loeys-Dietz syndrome 5, MI# 615582 23824657 False 3 100;0;0 4.430 True ENSG00000119699 ENSG00000119699 HGNC:11769 TGFBR1 gene TGFBR1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Loeys-Dietz syndrome 1, MIM# 609192 35668506 False 3 100;0;0 4.430 True ENSG00000106799 ENSG00000106799 HGNC:11772 TGFBR2 gene TGFBR2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Loeys-Dietz syndrome 2, MIM# 610168 28163941 False 3 100;0;0 4.430 True ENSG00000163513 ENSG00000163513 HGNC:11773 TK2 gene TK2 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 2 (myopathic type), 609560 33457207 False 3 100;0;0 4.430 True ENSG00000166548 ENSG00000166548 HGNC:11831 TMEM126B gene TMEM126B Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal mitochondrial complex 1 deficiency, nuclear type 29 MONDO:0032633 27374774;27374773 False 3 100;0;0 4.430 True ENSG00000171204 ENSG00000171204 HGNC:30883 TMEM251 gene TMEM251 Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dysostosis multiplex, Ain-Naz type 619345 33252156;40171858 False 3 50;50;0 4.430 True ENSG00000153485 ENSG00000153485 HGNC:20218 TMEM5 gene TMEM5 Expert Review Green;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 23217329;23519211 False 3 100;0;0 4.430 True ENSG00000118600 ENSG00000118600 HGNC:13530 TMEM63C gene TMEM63C Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 87, autosomal recessive, MIM# 619966 PMID: 35718349 False 3 100;0;0 4.430 True ENSG00000165548 ENSG00000165548 HGNC:23787 TNNI2 gene TNNI2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arthrogryposis, distal, type 2B1, MIM# 601680 17194691;25340332;12592607 False 3 100;0;0 4.430 True Other ENSG00000130598 ENSG00000130598 HGNC:11946 TNNT1 gene TNNT1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy 5, Amish type, MIM# 605355 10952871;32994279;32819427;31970803;31604653;29931346;31680123 False 3 100;0;0 4.430 True ENSG00000105048 ENSG00000105048 HGNC:11948 TNNT1 gene TNNT1 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Nemaline myopathy 5 MONDO:0011539;Nemaline myopathy MONDO:0018958 10952871;32994279;32819427;31970803;31604653;29931346;29178646 False 3 100;0;0 4.430 True ENSG00000105048 ENSG00000105048 HGNC:11948 TNNT3 gene TNNT3 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arthrogryposis, distal, type 2B2, MIM# 618435 12865991;19142688;21402185;25337069;17194691 False 3 100;0;0 4.430 True Other ENSG00000130595 ENSG00000130595 HGNC:11950 TNNT3 gene TNNT3 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Nemaline myopathy MONDO:0018958 33977145;29266598;23775847 False 3 100;0;0 4.430 True ENSG00000130595 ENSG00000130595 HGNC:11950 TNPO3 gene TNPO3 Expert Review Green;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Muscular dystrophy, limb-girdle, autosomal dominant 2, 608423 23667635;23543484;31071488;31192305 False 3 100;0;0 4.430 True Other ENSG00000064419 ENSG00000064419 HGNC:17103 TOR1A gene TOR1A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita, MIM#618947 PMID: 30244176 False 3 100;0;0 4.430 True ENSG00000136827 ENSG00000136827 HGNC:3098 TOR1AIP1 gene TOR1AIP1 Expert Review Green;Literature;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, autosomal recessive, with rigid spine and distal joint contractures MIM#617072;Progeroid appearance;Cataracts;Microcephaly;Deafness;Contractures 24856141;31299614;30723199;27342937;32055997 False 3 100;0;0 4.430 True ENSG00000143337 ENSG00000143337 HGNC:29456 TOR1AIP1 gene TOR1AIP1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, autosomal recessive, with rigid spine and distal joint contractures MIM#617072;Progeroid appearance;Cataracts;Microcephaly;Deafness;Contractures 24856141;31299614;30723199;27342937;32055997 False 3 100;0;0 4.430 True ENSG00000143337 ENSG00000143337 HGNC:29456 TPM2 gene TPM2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arthrogryposis, distal, type 1A/2B4 (MIM#108120) 30285720;27726070;24692096 False 3 100;0;0 4.430 True ENSG00000198467 ENSG00000198467 HGNC:12011 TPM2 gene TPM2 Expert Review Green;Other Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Nemaline myopathy 4, autosomal dominant (MIM#609285) 17846275;23378224 False 3 100;0;0 4.430 True ENSG00000198467 ENSG00000198467 HGNC:12011 TPM3 gene TPM3 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 4B, autosomal recessive, MIM# 609284 False 3 100;0;0 4.430 True ENSG00000143549 ENSG00000143549 HGNC:12012 TPM3 gene TPM3 Expert Review Green;Other;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myopathy 4A, autosomal dominant (MIM#255310);Congenital myopathy 4B, autosomal recessive (MIM#609284) 26418456;18300303;10619715;12196661;18382475 False 3 100;0;0 4.430 True ENSG00000143549 ENSG00000143549 HGNC:12012 TRAPPC11 gene TRAPPC11 Expert Review Green;Expert Review Green;Expert Review;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2S, 615356 23830518;26322222;29855340;30105108 False 3 100;0;0 4.430 True ENSG00000168538 ENSG00000168538 HGNC:25751 TRAPPC11 gene TRAPPC11 Expert Review Green;Expert Review Green;Expert list;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 18 (MIM#615356) 23830518;26322222;29855340;30105108 False 3 100;0;0 4.430 True ENSG00000168538 ENSG00000168538 HGNC:25751 TRDN gene TRDN Expert Review Green;Other Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ventricular tachycardia, catecholaminergic polymorphic, 5, with or without muscle weakness, MIM# 615441 28202702;30649896;34415104 False 3 0;0;0 4.430 True ENSG00000186439 ENSG00000186439 HGNC:12261 TRIM2 gene TRIM2 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 2R, MIM# 615490;MONDO:0014208;HMSN 23562820;25893792;18687884;32815244;32205255;25893792 False 3 100;0;0 4.430 False ENSG00000109654 ENSG00000109654 HGNC:15974 TRIM32 gene TRIM32 Expert Review Green;Expert list;Expert Review Green;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, type 2H, 254110 False 3 50;0;50 4.430 False ENSG00000119401 ENSG00000119401 HGNC:16380 TRIP4 gene TRIP4 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 1, MIM# 616866 26924529 False 3 100;0;0 4.430 True ENSG00000103671 ENSG00000103671 HGNC:12310 TRIP4 gene TRIP4 Expert Review Green;Other;NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Muscular dystrophy, congenital, Davignon-Chauveau type (MIM#617066) 27008887;31794073 False 3 100;0;0 4.430 True ENSG00000103671 ENSG00000103671 HGNC:12310 TRIP4 gene TRIP4 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 1, MIM# 616866 26924529 False 3 100;0;0 4.430 True ENSG00000103671 ENSG00000103671 HGNC:12310 TRPV4 gene TRPV4 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, autosomal dominant 8, MIM# 600175 False 3 100;0;0 4.430 True ENSG00000111199 ENSG00000111199 HGNC:18083 TRPV4 gene TRPV4 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN, dHMN/dSMA;Hereditary motor and sensory neuropathy, type IIc, MIM# 606071;Neuronopathy, distal hereditary motor, type VIII, MIM# 600175 False 3 100;0;0 4.430 False ENSG00000111199 ENSG00000111199 HGNC:18083 TSEN54 gene TSEN54 Expert Review Green;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia type 2A, MIM# 277470;Pontocerebellar hypoplasia type 4, MIM# 225753 18711368;20956791;20952379;20301773 False 3 100;0;0 4.430 True ENSG00000182173 ENSG00000182173 HGNC:27561 TSFM gene TSFM Expert Review Green;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Combined oxidative phosphorylation deficiency 3 610505 31267352;17033963 False 3 100;0;0 4.430 True ENSG00000123297 ENSG00000123297 HGNC:12367 TSPOAP1 gene TSPOAP1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Dystonia, intellectual disability and cerebellar atrophy 33539324 False 3 100;0;0 4.430 True ENSG00000005379 ENSG00000005379 HGNC:16831 TTC19 gene TTC19 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex III deficiency, nuclear type 2, MIM#615157 40946707;37927170;25652355 False 3 100;0;0 4.430 True ENSG00000011295 ENSG00000011295 HGNC:26006 TTN gene TTN Expert Review Green;Expert Review;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal dilated cardiomyopathy;Distal myopathy;HMERF;Myofibrillar myopathy;Congenital myopathy;Muscular dystrophy, limb-girdle, type 2J, 608807;arthrogryposis False 3 100;0;0 4.430 False ENSG00000155657 ENSG00000155657 HGNC:12403 TTN gene TTN Expert Review Green;Literature;Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal TTN-related myopathy MONDO:0100175 38429495;38982518 False 3 100;0;0 4.430 True ENSG00000155657 ENSG00000155657 HGNC:12403 TTN gene TTN Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Salih myopathy;Muscular dystrophy, limb-girdle, autosomal recessive 10 24105469;31660661;29575618;28040389 False 3 100;0;0 4.430 True ENSG00000155657 ENSG00000155657 HGNC:12403 TTPA gene TTPA Expert Review Green;NHS GMS;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia with vitamin E deficiency;Early-onset ataxia and sensory axonal neuropathy similar to Friedreich s ataxia, head titubation, normal fat absorption unlike abetalipoproteinemia, rarely retinitis pigmentosa False 3 100;0;0 4.430 False ENSG00000137561 ENSG00000137561 HGNC:12404 TTR gene TTR Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyloidosis, hereditary, transthyretin-related MIM#105210;Cardiomyopathy;Amyloidogenic transthyretin amyloidosis;HSAN/SFN 20301373;8071954;19180884;24101130 False 3 100;0;0 4.430 True ENSG00000118271 ENSG00000118271 HGNC:12405 TUBA4A gene TUBA4A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary ataxia MONDO:0100309, TUBA4A-related 38884572;37418012 False 3 100;0;0 4.430 True Other ENSG00000127824 ENSG00000127824 HGNC:12407 TUBA4A gene TUBA4A Expert Review Green;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 22 with or without frontotemporal dementia, MIM# 616208 25374358;25893256;28069311;38463699;38884572;26675813 False 3 50;50;0 4.430 True ENSG00000127824 ENSG00000127824 HGNC:12407 TUBB3 gene TUBB3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fibrosis of extraocular muscles, congenital, 3A (MIM#600638);Neuropathy 20074521;34652576 False 3 50;50;0 4.430 True ENSG00000258947 ENSG00000258947 HGNC:20772 TUBB3 gene TUBB3 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Fibrosis of extraocular muscles, congenital, 3A (MIM#600638);Neuropathy 20074521;34652576 False 3 100;0;0 4.430 True ENSG00000258947 ENSG00000258947 HGNC:20772 TUBB4A gene TUBB4A Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Leukodystrophy, hypomyelinating, 6, MIM# 612438" 23582646;24850488 False 3 100;0;0 4.430 True ENSG00000104833 ENSG00000104833 HGNC:20774 TWNK gene TWNK Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Perrault syndrome (MIM#616138);Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3, MIM# 609286 25254289;25355836;27650058;28178980;35011763 False 3 100;0;0 4.430 True ENSG00000107815 ENSG00000107815 HGNC:1160 TWNK gene TWNK Expert Review Green;Expert Review Green;Expert list;Victorian Clinical Genetics Services;Australian Genomics Health Alliance Mitochondrial Flagship Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 3 MIM#609286 20880070 False 3 100;0;0 4.430 True ENSG00000107815 ENSG00000107815 HGNC:1160 TYMP gene TYMP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 1 (MNGIE type);HMSN False 3 0;100;0 4.430 True ENSG00000025708 ENSG00000025708 HGNC:3148 TYMP gene TYMP Expert Review Green;Expert Review Green;Expert list;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 1 (MNGIE type), MIM# 603041;MNGIE: ptosis, ophthalmoplegia & ophthalmoparesis, hearing loss, neuropathy 9924029;14757860 False 3 100;0;0 4.430 True ENSG00000025708 ENSG00000025708 HGNC:3148 UBA1 gene UBA1 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal muscular atrophy, X-linked 2, infantile, MIM# 301830 18179898;32181232;31932168;29034082;27699224;26028276;23518311 False 3 100;0;0 4.430 True ENSG00000130985 ENSG00000130985 HGNC:12469 UBA1 gene UBA1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females dHMN/dSMA;Spinal muscular atrophy, X-linked 2, MIM# 301830 18179898;32181232;31932168;29034082;27699224;26028276;23518311 False 3 100;0;0 4.430 False ENSG00000130985 ENSG00000130985 HGNC:12469 UBAP1 gene UBAP1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Childhood-onset hereditary spastic paraplegia;Spastic paraplegia 80, autosomal dominant 618418" 31696996 False 3 100;0;0 4.430 True Other ENSG00000165006 ENSG00000165006 HGNC:12461 UBQLN2 gene UBQLN2 Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Amyotrophic lateral sclerosis type 15 (MONDO:0010459;MIM#300857) 20301623;21857683 False 3 100;0;0 4.430 True ENSG00000188021 ENSG00000188021 HGNC:12509 UCHL1 gene UCHL1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodegenerative disease, MONDO:0005559, UCHL1-related 35986737 False 3 100;0;0 4.430 True ENSG00000154277 ENSG00000154277 HGNC:12513 UCHL1 gene UCHL1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 79A, autosomal dominant, MIM# 620221;Spastic paraplegia 79, autosomal recessive, 615491;MONDO:0014209;Neurodegenerative disease, MONDO:0005559, UCHL1-related 23359680;3340629;28007905;32656641;29735986;28007905;35986737 False 3 100;0;0 4.430 True ENSG00000154277 ENSG00000154277 HGNC:12513 UNC45B gene UNC45B Expert Review Green;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myofibrillar myopathy 11 (MIM#619178) 33217308;31852522 False 3 100;0;0 4.430 True ENSG00000141161 ENSG00000141161 HGNC:14304 UNC45B gene UNC45B Expert Review Green;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal False 3 100;0;0 4.430 True ENSG00000141161 ENSG00000141161 HGNC:14304 VAMP1 gene VAMP1 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal presynaptic CMS;Myasthenic syndrome, congenital, 25, MIM# 618323 28168212;28253535;28600779;17102983 False 3 100;0;0 4.430 True ENSG00000139190 ENSG00000139190 HGNC:12642 VAMP1 gene VAMP1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Myasthenic syndrome, congenital, 25, MIM# 618323" 28253535 False 3 100;0;0 4.430 True ENSG00000139190 ENSG00000139190 HGNC:12642 VAPB gene VAPB Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, late-onset, Finkel type (MIM# 182980);Amyotrophic lateral sclerosis 8 20301623;15372378 False 3 100;0;0 4.430 True ENSG00000124164 ENSG00000124164 HGNC:12649 VAPB gene VAPB Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Adult proximal spinal muscular atrophy, autosomal dominant;dHMN/dSMA;Spinal muscular atrophy, late-onset, Finkel type, MIM# 182980 15372378;32162544;28993872;28173107;26566915 False 3 100;0;0 4.430 False ENSG00000124164 ENSG00000124164 HGNC:12649 VCP gene VCP Expert Review Green;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 6 (ALS) (MIM#613954) 20301649;20301623;21145000 False 3 100;0;0 4.430 True ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy with early-onset Paget disease and frontotemporal dementia 1 167320 False 3 0;0;0 4.430 False ENSG00000165280 ENSG00000165280 HGNC:12666 VCP gene VCP Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, type 2Y, MIM# 616687 25125609;25878907;32165109 False 3 50;50;0 4.430 False Other ENSG00000165280 ENSG00000165280 HGNC:12666 VIPAS39 gene VIPAS39 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, renal dysfunction, and cholestasis 2, MIM#613404 20190753;35151346 False 3 100;0;0 4.430 True ENSG00000151445 ENSG00000151445 HGNC:20347 VMA21 gene VMA21 Expert Review Green;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Myopathy, X-linked, with excessive autophagy (MIM#310440) 27916343;25809233;23315026 False 3 0;100;0 4.430 True ENSG00000160131 ENSG00000160131 HGNC:22082 VPS13A gene VPS13A Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal chorea-acanthocytosis MONDO:0008695 33652783;20301561 False 3 100;0;0 4.430 True ENSG00000197969 ENSG00000197969 HGNC:1908 VPS33B gene VPS33B Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis, renal dysfunction, and cholestasis 1 (MIM#208085) 31240160;31777725;24415890;15052268 False 3 100;0;0 4.430 True ENSG00000184056 ENSG00000184056 HGNC:12712 VRK1 gene VRK1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, autosomal recessive 10, MIM# 620542 31560180;32242460;31178479;31837156;30847374 False 3 100;0;0 4.430 False ENSG00000100749 ENSG00000100749 HGNC:12718 VWA1 gene VWA1 Literature;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary motor neuropathy 33459760;33693694;33559681 False 3 0;0;0 4.430 False ENSG00000179403 ENSG00000179403 HGNC:30910 WASHC5 gene WASHC5 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 8, autosomal dominant, 603563;MONDO:0011339 23455931;17160902;31814071;26572744 False 3 100;0;0 4.430 False ENSG00000164961 ENSG00000164961 HGNC:28984 WDR45B gene WDR45B Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Profound developmental delay, early-onset refractory epilepsy, progressive spastic quadriplegia and contractures, and brain malformations;Neurodevelopmental disorder with spastic quadriplegia and brain abnormalities with or without seizures, MIM#617977 21937992;28503735;27431290 False 3 100;0;0 4.430 True ENSG00000141580 ENSG00000141580 HGNC:25072 WNK1 gene WNK1 Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HSAN/SFN;Neuropathy, hereditary sensory and autonomic, type II, MIM# 201300;MONDO:0024309 15060842;15911806;15455397;16534117 False 3 100;0;0 4.430 False ENSG00000060237 ENSG00000060237 HGNC:14540 WSB2 gene WSB2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Luo-Agrawal neurodevelopmental syndrome, MIM# 621552 PMID: 40374945 False 3 100;0;0 4.430 True ENSG00000176871 ENSG00000176871 HGNC:19222 XK gene XK Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females McLeod syndrome with or without chronic granulomatous disease (MIM#300842) 11761473 False 3 100;0;0 4.430 True ENSG00000047597 ENSG00000047597 HGNC:12811 XRCC1 gene XRCC1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive 26 MIM#617633 28002403;29472272 False 3 100;0;0 4.430 False ENSG00000073050 ENSG00000073050 HGNC:12828 YARS gene YARS Royal Melbourne Hospital;Expert Review Green;Expert Review Green Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, dominant intermediate C, MIM# 608323;MONDO:0012012 16429158;24354524;31587308;26725087 False 3 100;0;0 4.430 False ENSG00000134684 ENSG00000134684 HGNC:12840 YARS2 gene YARS2 Expert Review Green;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, lactic acidosis, and sideroblastic anemia 2 MIM#613561 28395030 False 3 100;0;0 4.430 True ENSG00000139131 ENSG00000139131 HGNC:24249 ZC4H2 gene ZC4H2 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Wieacker-Wolff syndrome (MIM#314580) 23623388;34322088;33949289;31885220;31206972 False 3 100;0;0 4.430 True ENSG00000126970 ENSG00000126970 HGNC:24931 ZFYVE26 gene ZFYVE26 Expert Review Green;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 15 MIM#270700 17661097;19438933 False 3 100;0;0 4.430 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZFYVE26 gene ZFYVE26 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 15, autosomal recessive, MIM# 270700" False 3 100;0;0 4.430 True ENSG00000072121 ENSG00000072121 HGNC:20761 ZMPSTE24 gene ZMPSTE24 Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mandibuloacral dysplasia with type B lipodystrophy, MIM# 608612;MONDO:0012074;Restrictive dermopathy, lethal, MIM# 275210;MONDO:0010143 11923874;22718200;29794150;29208544;12913070;27410998;27409638;15937076;16671095;22718200;29794150;24169522 False 3 100;0;0 4.430 True ENSG00000084073 ENSG00000084073 HGNC:12877 AAAS gene AAAS Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Achalasia-addisonianism-alacrimia syndrome MIM#231550;complicated hereditary spastic paraplegia 30381913 False 2 0;100;0 4.430 True ENSG00000094914 ENSG00000094914 HGNC:13666 ACADVL gene ACADVL Expert Review Amber;Expert list;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "VLCAD deficiency 201475" PMID: 9546340;32558070;22097235;24305961 False 2 50;50;0 4.430 True ENSG00000072778 ENSG00000072778 HGNC:92 ACTB gene ACTB Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Baraitser-Winter syndrome 1 (MIM#243310) 32588558;27625340 False 2 0;100;0 4.430 True ENSG00000075624 ENSG00000075624 HGNC:132 ALK gene ALK Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic-dystonic diplegia PMID: 32989326 False 2 0;100;0 4.430 True ENSG00000171094 ENSG00000171094 HGNC:427 ANG gene ANG Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis 9 (MONDO: 0012753;MIM#611895) 17886298;16501576;18087731;20301623 False 2 100;0;0 4.430 True ENSG00000214274 ENSG00000214274 HGNC:483 ANXA11 gene ANXA11 Expert Review Amber;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Inclusion body myopathy and brain white matter abnormalities, MIM# 619733 34048612 False 2 0;100;0 4.430 True ENSG00000122359 ENSG00000122359 HGNC:535 ARHGEF10 gene ARHGEF10 Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?Slowed nerve conduction velocity, AD, 608236;HMSN 14508709;21719701;25025039;25275565;25091364 False 2 50;50;0 4.430 False ENSG00000104728 ENSG00000104728 HGNC:14103 ARPC3 gene ARPC3 Literature;Expert Review Amber;Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease MONDO:0015626 36928819;26166300;40011789 False 2 0;100;0 4.430 False ENSG00000111229 ENSG00000111229 HGNC:706 ARX gene ARX Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Epileptic encephalopathy, early infantile, 1 308350;Hydranencephaly with abnormal genitalia 300215;Lissencephaly, X-linked 2 300215;Mental retardation, X-linked 29 and others 300419;Partington syndrome 309510;Proud syndrome 300004 21416597 False 2 0;100;0 4.430 True ENSG00000004848 ENSG00000004848 HGNC:18060 ASAH1 gene ASAH1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Farber lipogranulomatosis, MIM# 228000" 31022067 False 2 0;100;0 4.430 True ENSG00000104763 ENSG00000104763 HGNC:735 ASPH gene ASPH Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Exertional heat illness;malignant hyperthermia susceptibility, MONDO:0018493, ASPH-related 35697689 False 2 50;50;0 4.430 True ENSG00000198363 ENSG00000198363 HGNC:757 ATAD1 gene ATAD1 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Hyperekplexia 4, MIM# 618011" 29659736;29390050;28180185 False 2 0;100;0 4.430 True ENSG00000138138 ENSG00000138138 HGNC:25903 ATM gene ATM Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ataxia-telangiectasia, MIM#208900;Childhood-onset progressive ataxia, conjunctival telangiectasia, sensory axonal neuropathy, chorea and dystonia, immunodeficiency and increased risk of malignancy, elevated -fetoprotein;Ataxia-telangiectasia syndrome 32259893;20301790 False 2 0;50;50 4.430 True ENSG00000149311 ENSG00000149311 HGNC:795 ATP2A2 gene ATP2A2 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital myopathy, MONDO:0019952, ATP2A2-related;{Rhabdomyolysis, susceptibility to, 2}, MIM# 621236 39970126 False 2 0;100;0 4.430 True ENSG00000174437 ENSG00000174437 HGNC:812 ATP2B4 gene ATP2B4 Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Pure and complicated hereditary spastic paraplegia 29691679;25798335;25119969 False 2 0;100;0 4.430 False ENSG00000058668 ENSG00000058668 HGNC:817 ATRX gene ATRX Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Alpha-thalassemia/mental retardation syndrome, MIM# 301040 20301622 False 2 0;100;0 4.430 True ENSG00000085224 ENSG00000085224 HGNC:886 B3GALT6 gene B3GALT6 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Al-Gazali syndrome, OMIM #609465 PMID: 29443383, 25149931 False 2 0;100;0 4.430 True ENSG00000176022 ENSG00000176022 HGNC:17978 B3GNT2 gene B3GNT2 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy 23359570;23877401 False 2 0;100;0 4.430 True ENSG00000170340 ENSG00000170340 HGNC:15629 B4GALNT1 gene B4GALNT1 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 26, autosomal recessive (MIM#609195;MONDO:0012213) 20301682;23746551 False 2 0;100;0 4.430 True ENSG00000135454 ENSG00000135454 HGNC:4117 BAG3 gene BAG3 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, myofibrillar, 6 (MIM#612954;MONDO:0013061) 19085932 False 2 0;100;0 4.430 True ENSG00000151929 ENSG00000151929 HGNC:939 BBOX1 gene BBOX1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Carnitine deficiency, MONDO:0017716, BBOX1-related 41022783 False 2 0;100;0 4.430 True ENSG00000129151 ENSG00000129151 HGNC:964 BET1 gene BET1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, congenital, with rapid progression, MIM# 254100 34779586 False 2 0;100;0 4.430 True ENSG00000105829 ENSG00000105829 HGNC:14562 BICD2 gene BICD2 Expert list;Expert Review Amber;Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, MIM#615290;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, MIM#618291 23664120;25497877;24482476 False 2 0;100;0 4.430 False ENSG00000185963 ENSG00000185963 HGNC:17208 C1orf194 gene C1orf194 Literature;Literature;Expert Review Amber;Expert Review Amber;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, intermediate or demyelinating 31199454;32592472 False 2 0;100;0 4.430 False ENSG00000179902 ENSG00000179902 HGNC:32331 CACNB1 gene CACNB1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital muscular dystrophy MONDO:0020121, CACNB1-related 41023410 False 2 0;100;0 4.430 True ENSG00000067191 ENSG00000067191 HGNC:1401 CAPN3 gene CAPN3 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Muscular dystrophy, limb-girdle, autosomal recessive 1 253600" PMID: 31937337 False 2 50;50;0 4.430 True ENSG00000092529 ENSG00000092529 HGNC:1480 CASQ1 gene CASQ1 Expert Review Amber;Literature;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted tubular aggregate myopathy MONDO:0008051 38982518 False 2 0;100;0 4.430 True Other ENSG00000143318 ENSG00000143318 HGNC:1512 CCDC78 gene CCDC78 Expert Review Amber;Other;Expert Review Amber;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Centronuclear Myopathy (MIM#614807;MONDO: 0018947) 22818856 False 2 0;100;0 4.430 True ENSG00000162004 ENSG00000162004 HGNC:14153 CCDC88C gene CCDC88C Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Early-onset pure hereditary spastic paraplegia 33602173 False 2 0;100;0 4.430 True ENSG00000015133 ENSG00000015133 HGNC:19967 CCNF gene CCNF Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 5, MIM# 619141 29102476;31577344;27080313;28105640;31445393;28852778 False 2 0;100;0 4.430 True ENSG00000162063 ENSG00000162063 HGNC:1591 CCT5 gene CCT5 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory, with spastic paraplegia, 256840;HMSN 16399879;25124038;25345891;33076433;37237456 False 2 0;100;0 4.430 True ENSG00000150753 ENSG00000150753 HGNC:1618 CHKB gene CHKB Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal megaconial type congenital muscular dystrophy MONDO:0011246;CHKB-Related Muscular Dystrophy 37011121 False 2 50;50;0 4.430 True ENSG00000100288 ENSG00000100288 HGNC:1938 CHKB gene CHKB Expert Review Amber;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal megaconial type congenital muscular dystrophy MONDO:0011246;recurrent rhabdomyolysis;CHKB-Related Muscular Dystrophy 26782016;37011121;21665002;23692895;24997086 False 2 50;50;0 4.430 True ENSG00000100288 ENSG00000100288 HGNC:1938 CHMP3 gene CHMP3 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia (MONDO:0019064), CHMP3-related PMID: 35710109 False 2 0;100;0 4.430 True ENSG00000115561 ENSG00000115561 HGNC:29865 CHRNA1 gene CHRNA1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Congenital myopathy MONDO:0019952 36634413;38982518 False 2 0;100;0 4.430 True ENSG00000138435 ENSG00000138435 HGNC:1955 CHRNE gene CHRNE Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myasthenic syndrome 4, MONDO:1040021 33193787 False 2 0;100;0 4.430 True ENSG00000108556 ENSG00000108556 HGNC:1966 CNTN1 gene CNTN1 Expert Review Amber;Other;Expert Review Amber;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital Myopathy 12, Compton-North myopathy (MONDO:0012929;MIM#612540) 10926398 False 2 0;100;0 4.430 True ENSG00000018236 ENSG00000018236 HGNC:2171 CNTN1 gene CNTN1 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 12, OMIM #612540 PMID:19026398 False 2 0;50;50 4.430 True ENSG00000018236 ENSG00000018236 HGNC:2171 COL4A1 gene COL4A1 Expert Review Green;Expert Review Amber;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Angiopathy, hereditary, with nephropathy, aneurysms, and muscle cramps MIM#611773;Brain small vessel disease with or without ocular anomalies MIM#175780;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant MIM#618564 23065703;20818663;25719457;21625620;23225343 False 2 50;50;0 4.430 True Other ENSG00000187498 ENSG00000187498 HGNC:2202 COL9A2 gene COL9A2 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epiphyseal dysplasia, multiple, 2 MIM#600204" 20508815;20358595 False 2 0;100;0 4.430 True ENSG00000049089 ENSG00000049089 HGNC:2218 COL9A3 gene COL9A3 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epiphyseal dysplasia, multiple, 3, with or without myopathy MIM#600969" 10655510 False 2 0;100;0 4.430 True ENSG00000092758 ENSG00000092758 HGNC:2219 COLQ gene COLQ Expert Review Amber;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 5, MIM# 603034 9689136;9758617;11865139;32978031;31831253 False 2 0;100;0 4.430 True ENSG00000206561 ENSG00000206561 HGNC:2226 COMP gene COMP Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Epiphyseal dysplasia, multiple, 1 MIM#132400" 20508815;14684695;15880723 False 2 0;100;0 4.430 True ENSG00000105664 ENSG00000105664 HGNC:2227 COX10 gene COX10 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex IV deficiency, nuclear type 3 (MIM#619046) 10767350 False 2 0;100;0 4.430 True ENSG00000006695 ENSG00000006695 HGNC:2260 CPT1C gene CPT1C Expert Review Amber;Royal Melbourne Hospital;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 73, autosomal dominant, MIM#616282;MONDO:0014568 25751282;30911584;30564185;23973755;41312619 False 2 50;50;0 4.430 True ENSG00000169169 ENSG00000169169 HGNC:18540 CRYAB gene CRYAB Expert Review Green;Expert Review Amber;Expert list;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myopathy, myofibrillar, 2, MIM# 608810 PMID: 21337604;32420686 False 2 25;75;0 4.430 True ENSG00000109846 ENSG00000109846 HGNC:2389 CYLD gene CYLD Expert Review Amber;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amytrophic lateral sclerosis 8, MIM# 619132 32666117;32666099;32185393 False 2 25;50;25 4.430 True Other ENSG00000083799 ENSG00000083799 HGNC:2584 DCAF8 gene DCAF8 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?Giant axonal neuropathy 2, autosomal dominant, 610100;HMSN 24500646 False 2 0;100;0 4.430 True ENSG00000132716 ENSG00000132716 HGNC:24891 DGAT2 gene DGAT2 Royal Melbourne Hospital;Expert Review;Expert Review Amber;Expert Review Amber;Expert Review Amber;Expert Review Amber;Expert Review;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease, MONDO:0015626, DGAT2-related 26786738 False 2 0;100;0 4.430 False ENSG00000062282 ENSG00000062282 HGNC:16940 DHTKD1 gene DHTKD1 NHS GMS;Expert Review Amber;Expert Review Green;Literature;Expert Review Amber Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot-Marie-Tooth disease axonal type 2Q MONDO:0014012 23141294, 29661920, 28902413 False 2 0;100;0 4.430 False ENSG00000181192 ENSG00000181192 HGNC:23537 DNAJA3 gene DNAJA3 Expert Review Amber;Literature;Literature;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970, DNAJA3-related 34750646;30770860;41354729 False 2 0;100;0 4.430 True ENSG00000103423 ENSG00000103423 HGNC:11808 DNAJC7 gene DNAJC7 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown amyotrophic lateral sclerosis 31768050;40802071;35039179;34233860;32897108;37870677;35456894 False 2 33;67;0 4.430 True ENSG00000168259 ENSG00000168259 HGNC:12392 DNMT3B gene DNMT3B Expert Review Amber;Literature;Expert Review Green;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Facioscapulohumeral muscular dystrophy MONDO:0001347 27153398;33004076 False 2 50;50;0 4.430 True ENSG00000088305 ENSG00000088305 HGNC:2979 DPM2 gene DPM2 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Iu, MIM# 615042 23109149 False 2 0;100;0 4.430 True ENSG00000136908 ENSG00000136908 HGNC:3006 DPM2 gene DPM2 Expert Review Amber;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation, type Iu, MIM# 615042 23109149 False 2 0;100;0 4.430 True ENSG00000136908 ENSG00000136908 HGNC:3006 DSTYK gene DSTYK Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 23, MIM#270750 28157540;23862974 False 2 0;100;0 4.430 True ENSG00000133059 ENSG00000133059 HGNC:29043 ELMSAN1 gene ELMSAN1 Expert Review Amber;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092, ELMSAN1-related False 2 0;100;0 4.430 True ENSG00000156030 ENSG00000156030 HGNC:19853 EMILIN1 gene EMILIN1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, type X, MIM# 620080;Peripheral neuropathy;aortic aneurysm 31978608;26462740 False 2 50;50;0 4.430 True ENSG00000138080 ENSG00000138080 HGNC:19880 ERBB3 gene ERBB3 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lethal congenital contractural syndrome 2, MIM# 607598 17701904;31752936 False 2 0;100;0 4.430 True ENSG00000065361 ENSG00000065361 HGNC:3431 ETFB gene ETFB Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glutaric acidemia IIB 231680 12815589;7912128 False 2 0;100;0 4.430 True ENSG00000105379 ENSG00000105379 HGNC:3482 ETFDH gene ETFDH Expert Review Green;Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Glutaric acidemia IIC 231680" PMID: 19592060;17412732 False 2 50;50;0 4.430 True ENSG00000171503 ENSG00000171503 HGNC:3483 EXOSC3 gene EXOSC3 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1b;Complicated hereditary spastic paraplegia 25149867;23975261 False 2 0;100;0 4.430 True ENSG00000107371 ENSG00000107371 HGNC:17944 EXOSC3 gene EXOSC3 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1b;dHMN/dSMA False 2 0;100;0 4.430 True ENSG00000107371 ENSG00000107371 HGNC:17944 FAM126A gene FAM126A Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal HMSN;Congenital cataracts, global developmental delay from 1 year, diffuse cerebral hypomyelination on MRI, neuropathy with SNCV;Leukodystrophy, hypomyelinating, 5, 610532 False 2 0;0;100 4.430 True ENSG00000122591 ENSG00000122591 HGNC:24587 FAM20C gene FAM20C Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Raine syndrome, MIM# 259775 False 2 0;100;0 4.430 True ENSG00000177706 ENSG00000177706 HGNC:22140 FBXO38 gene FBXO38 Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, type IID, 615575;dHMN/dSMA False 2 0;100;0 4.430 False ENSG00000145868 ENSG00000145868 HGNC:28844 FDX2 gene FDX2 Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Mitochondrial myopathy, episodic, with optic atrophy and reversible leukoencephalopathy (MIM#251900)" 30010796;24281368;28803783 False 2 0;100;0 4.430 True ENSG00000267673 ENSG00000267673 HGNC:30546 FIG4 gene FIG4 Expert Review Amber;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis Type 11 (MONDO: 0012945;MIM#612577) False 2 100;0;0 4.430 True ENSG00000112367 ENSG00000112367 HGNC:16873 GALC gene GALC Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Krabbe Disease MIM#245200 20301416;21070211 False 2 0;100;0 4.430 True ENSG00000054983 ENSG00000054983 HGNC:4115 GJC2 gene GJC2 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 44, autosomal recessive, MIM# 613206" 19056803;31431325;25059390 False 2 0;100;0 4.430 True ENSG00000198835 ENSG00000198835 HGNC:17494 GLT8D1 gene GLT8D1 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 30811981 False 2 50;50;0 4.430 True ENSG00000016864 ENSG00000016864 HGNC:24870 HADHB gene HADHB Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial Trifunctional Protein Deficiency 2 with Myopathy and Neuropathy MIM#320300 37388542;36063482;24664533 False 2 0;50;50 4.430 True ENSG00000138029 ENSG00000138029 HGNC:4803 HNRNPA2B1 gene HNRNPA2B1 Expert Review Amber;ClinGen Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis MONDO:0004976 25299611 False 2 0;0;100 4.430 True ENSG00000122566 ENSG00000122566 HGNC:5033 HRAS gene HRAS Expert Review Amber;Other;Expert Review Amber Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Congenital myopathy with excess of muscle spindles (MIM#218040) 17412879 False 2 0;100;0 4.430 True ENSG00000174775 ENSG00000174775 HGNC:5173 HS2ST1 gene HS2ST1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurofacioskeletal syndrome with or without renal agenesis, MIM#619194;Intellectual disability;dysmorphic features;congenital anomalies;arthrogryposis 33159882 False 2 0;100;0 4.430 True ENSG00000153936 ENSG00000153936 HGNC:5193 IRF2BPL gene IRF2BPL Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures 618088" PMID: 30057031;30166628 False 2 0;100;0 4.430 True ENSG00000119669 ENSG00000119669 HGNC:14282 ISLR2 gene ISLR2 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hydrocephalus;arthrogryposis;abdominal distension 30483960 False 2 0;0;0 4.430 True ENSG00000167178 ENSG00000167178 HGNC:29286 KARS gene KARS Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, recessive intermediate, B (MIM#613641;MONDO:0013338) 20920668 False 2 0;100;0 4.430 True ENSG00000065427 ENSG00000065427 HGNC:6215 KLHL9 gene KLHL9 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted distal myopathy MONDO:0018949 20554658;40818927;33458580 False 2 0;100;0 4.430 True ENSG00000198642 ENSG00000198642 HGNC:18732 LAMP2 gene LAMP2 Expert Review Green;Expert Review Amber;Expert Review;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Danon disease (MIM#300257) 27179547;22541782 False 2 50;50;0 4.430 True ENSG00000005893 ENSG00000005893 HGNC:6501 LGALSL gene LGALSL Expert Review Amber;ClinGen Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown amyotrophic lateral sclerosis MONDO:0004976 30940688 False 2 0;100;0 4.430 True ENSG00000119862 ENSG00000119862 HGNC:25012 LMNA gene LMNA Royal Melbourne Hospital;Expert Review Amber;Expert Review Amber Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease, type 2B1 , MIM#605588 11799477;28902413 False 2 0;100;0 4.430 False ENSG00000160789 ENSG00000160789 HGNC:6636 LMOD1 gene LMOD1 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Megacystis-microcolon-intestinal hypoperistalsis syndrome 3, MIM# 619362 28292896 False 2 0;100;0 4.430 True ENSG00000163431 ENSG00000163431 HGNC:6647 LPIN1 gene LPIN1 Expert Review Green;Expert Review Amber;Expert Review;Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myoglobinuria, acute recurrent, autosomal recessive (MIM#268200) 28649549;18817903;32410653 False 2 67;33;0 4.430 True ENSG00000134324 ENSG00000134324 HGNC:13345 LRIF1 gene LRIF1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Facioscapulohumeral muscular dystrophy MONDO:0001347 32467133 False 2 0;100;0 4.430 True ENSG00000121931 ENSG00000121931 HGNC:30299 LYST gene LYST Royal Melbourne Hospital;Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal spastic paraplegia;Spastic paraplegia;Chediak-Higashi syndrome, 214500 26307451;24521565 False 2 0;100;0 4.430 False ENSG00000143669 ENSG00000143669 HGNC:1968 MACF1 gene MACF1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myasthenic syndrome, MONDO:0018940, MACF1-related 37721175;30842214 False 2 0;100;0 4.430 True ENSG00000127603 ENSG00000127603 HGNC:13664 MAMDC2 gene MAMDC2 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular Dystrophy MONDO:0020121, MAMDC2-related 37503746 False 2 0;100;0 4.430 True ENSG00000165072 ENSG00000165072 HGNC:23673 MAMDC2 gene MAMDC2 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Muscular Dystrophy MONDO:0020121, MAMDC2-related 37503746 False 2 0;100;0 4.430 True ENSG00000165072 ENSG00000165072 HGNC:23673 MARS gene MARS Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 70, autosomal recessive, MIM# 620323 24482476;34585293 False 2 0;50;50 4.430 True ENSG00000166986 ENSG00000166986 HGNC:6898 MET gene MET Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown ?Arthrogryposis, distal, type 11 (MIM#620019), AD 30777867 False 2 33;67;0 4.430 True ENSG00000105976 ENSG00000105976 HGNC:7029 MFF gene MFF Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy due to defective mitochondrial and peroxisomal fission 2 MIM# 617086 26783368 False 2 0;0;100 4.430 True ENSG00000168958 ENSG00000168958 HGNC:24858 MT-ATP8 gene MT-ATP8 Expert Review Amber;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease MONDO:0044970, MT-ATP8 related 24153443;20207608;32858252;33340416;32858252;19759059;22919063 False 2 0;100;0 4.430 True ENSG00000228253 ENSG00000228253 HGNC:7415 MTMR14 gene MTMR14 Expert Review Amber;Other;Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Centronuclear myopathy, autosomal, modifier of} (MIM#160150) 20400459;20817957;19465920;17008356 False 2 0;100;0 4.430 True ENSG00000163719 ENSG00000163719 HGNC:26190 MT-TC gene MT-TC Expert Review Amber;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TC-related 8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363 False 2 0;100;0 4.430 True ENSG00000210140 ENSG00000210140 HGNC:7477 MT-TC gene MT-TC Expert Review Amber;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TC-related 8829635;9185178;17241783;11453453;16955414;32169613;36039763;17724295;35252560;34433719;30030363 False 2 0;100;0 4.430 True ENSG00000210140 ENSG00000210140 HGNC:7477 MT-TQ gene MT-TQ Expert Review Amber;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL Mitochondrial disease (MONDO:0044970), MT-TQ-related 11171912;10996779;17003408;11335700 False 2 0;100;0 4.430 True ENSG00000210107 ENSG00000210107 HGNC:7495 MYLK gene MYLK Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Megacystis-microcolon-intestinal hypoperistalsis syndrome, 249210 28602422 False 2 0;100;0 4.430 True ENSG00000065534 ENSG00000065534 HGNC:7590 MYLPF gene MYLPF Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Distal arthrogryposis type 1C (DA1C), MIM#619110 32707087 False 2 50;50;0 4.430 True ENSG00000180209 ENSG00000180209 HGNC:29824 MYO9A gene MYO9A Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 24, presynaptic, MIM# 618198 26752647;27259756 False 2 50;50;0 4.430 True ENSG00000066933 ENSG00000066933 HGNC:7608 MYO9A gene MYO9A Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myasthenic syndrome 24, presynaptic 618198 26752647;27259756 False 2 50;50;0 4.430 True ENSG00000066933 ENSG00000066933 HGNC:7608 MYO9B gene MYO9B Literature;Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Charcot-Marie-Tooth disease type 2 (MONDO:0018993), MYO9B-related PMID: 36260368;40382695 False 2 0;100;0 4.430 False ENSG00000099331 ENSG00000099331 HGNC:7609 NAGLU gene NAGLU Victorian Clinical Genetics Services;Royal Melbourne Hospital;Expert Review Amber;Expert Review Green;Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?Charcot-Marie-Tooth disease, axonal, type 2V, 616491;HSAN/SFN False 2 0;100;0 4.430 False ENSG00000108784 ENSG00000108784 HGNC:7632 NRG1 gene NRG1 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hirschsprung disease 22574178;21706185;28190554 False 2 0;100;0 4.430 True ENSG00000157168 ENSG00000157168 HGNC:7997 NUBP2 gene NUBP2 Literature;Expert Review Amber;Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092 39867373 False 2 0;100;0 4.430 False ENSG00000095906 ENSG00000095906 HGNC:8042 PACSIN3 gene PACSIN3 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 27, MIM# 621343 38637313 False 2 0;100;0 4.430 True ENSG00000165912 ENSG00000165912 HGNC:8572 PACSIN3 gene PACSIN3 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myopathy 27, MIM# 621343 38637313 False 2 0;100;0 4.430 True ENSG00000165912 ENSG00000165912 HGNC:8572 PCDHA9 gene PCDHA9 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal amyotrophic lateral sclerosis MONDO:0004976 38467605 False 2 0;100;0 4.430 True ENSG00000204961 ENSG00000204961 HGNC:8675 PCK2 gene PCK2 Literature;Expert Review Amber;Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peripheral neuropathy (MONDO#0005244), PCK2-related 36845668 False 2 0;33;67 4.430 False ENSG00000100889 ENSG00000100889 HGNC:8725 PDCL3 gene PDCL3 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal megacystis-microcolon PMID: 32621347 False 2 0;100;0 4.430 True ENSG00000115539 ENSG00000115539 HGNC:28860 PEX11B gene PEX11B Expert Review Amber;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 14B - MIM#614920 20301621;22581968 False 2 50;50;0 4.430 True ENSG00000131779 ENSG00000131779 HGNC:8853 PEX12 gene PEX12 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 3A (Zellweger) - MIM#614859 False 2 0;100;0 4.430 True ENSG00000108733 ENSG00000108733 HGNC:8854 PEX13 gene PEX13 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 11A (Zellweger) (MIM#614883) False 2 0;100;0 4.430 True ENSG00000162928 ENSG00000162928 HGNC:8855 PEX14 gene PEX14 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876 False 2 0;100;0 4.430 True ENSG00000142655 ENSG00000142655 HGNC:8856 PEX16 gene PEX16 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 8A (Zellweger) MIM#614876 False 2 0;100;0 4.430 True ENSG00000121680 ENSG00000121680 HGNC:8857 PEX2 gene PEX2 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 5A (Zellweger) - MIM#614866 False 2 0;100;0 4.430 True ENSG00000164751 ENSG00000164751 HGNC:9717 PEX26 gene PEX26 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 7A (Zellweger) MIM#614872 False 2 0;100;0 4.430 True ENSG00000215193 ENSG00000215193 HGNC:22965 PEX3 gene PEX3 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 10A (Zellweger) MIM#614882 False 2 0;100;0 4.430 True ENSG00000034693 ENSG00000034693 HGNC:8858 PEX5 gene PEX5 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 2A (Zellweger) (MIM#214110) False 2 0;100;0 4.430 True ENSG00000139197 ENSG00000139197 HGNC:9719 PEX6 gene PEX6 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peroxisome biogenesis disorder 4A (Zellweger) (MIM#614862) False 2 0;100;0 4.430 True ENSG00000124587 ENSG00000124587 HGNC:8859 PFKM gene PFKM Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Glycogen storage disease VII (MIM#232800) 24427140;27066546;30792690 False 2 0;100;0 4.430 True ENSG00000152556 ENSG00000152556 HGNC:8877 PI4KA gene PI4KA Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Polymicrogyria, perisylvian, with cerebellar hypoplasia and arthrogryposis, MIM# 616531 PMID: 25855803 False 2 0;100;0 4.430 True ENSG00000241973 ENSG00000241973 HGNC:8983 PLP1 gene PLP1 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Pelizaeus-Merzbacher disease (MIM#312080) 20301361;11872612 False 2 0;100;0 4.430 True ENSG00000123560 ENSG00000123560 HGNC:9086 PNPLA6 gene PNPLA6 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 39, autosomal recessive, MIM# 612020" 18313024 False 2 0;100;0 4.430 True ENSG00000032444 ENSG00000032444 HGNC:16268 POGLUT1 gene POGLUT1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, MONDO:0020121, POGLUT1-related 33861953 False 2 0;100;0 4.430 True ENSG00000163389 ENSG00000163389 HGNC:22954 POMGNT2 gene POMGNT2 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (limb-girdle) type C, 8, MIM# 618135 False 2 0;100;0 4.430 True ENSG00000144647 ENSG00000144647 HGNC:25902 POMK gene POMK Expert Review Green;Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Muscular dystrophy-dystroglycanopathy (limb-girdle) type C, 12, 616094;Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 12, 615249 24556084;24925318;29910097 False 2 50;50;0 4.430 True ENSG00000185900 ENSG00000185900 HGNC:26267 PREPL gene PREPL Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal congenital myasthenic syndrome with pre- and postsynaptic features and growth hormone deficiency;?Myasthenic syndrome, congenital, 22, 616224 29483676;28726805;24610330;27472506 False 2 0;100;0 4.430 True ENSG00000138078 ENSG00000138078 HGNC:30228 PRPH gene PRPH Victorian Clinical Genetics Services;Expert Review Amber Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary motor and sensory neuropathy MONDO:0015358, PRPH-related 20363051;15322088;15446584;30992453;32638105 False 2 0;100;0 4.430 False ENSG00000135406 ENSG00000135406 HGNC:9461 PRPH gene PRPH Expert Review Amber;Expert Review Amber;Expert list;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal {Amyotrophic lateral sclerosis, susceptibility to}, 105400 20363051;15322088;15446584 False 2 0;100;0 4.430 True ENSG00000135406 ENSG00000135406 HGNC:9461 PSMC3 gene PSMC3 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Deafness, cataract, impaired intellectual development, and polyneuropathy, MIM#619354 32500975 False 2 0;100;0 4.430 True ENSG00000165916 ENSG00000165916 HGNC:9549 PYGM gene PYGM Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal McArdle disease (MIM#232600) 29143597;25914343 False 2 0;100;0 4.430 True ENSG00000068976 ENSG00000068976 HGNC:9726 RBMX gene RBMX Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Amyotrophic lateral sclerosis MONDO:0004976, RBMX-related 39263607 False 2 0;100;0 4.430 True ENSG00000147274 ENSG00000147274 HGNC:9910 RNF13 gene RNF13 Expert Review Amber;Literature;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis PMID: 35879052 False 2 50;50;0 4.430 True ENSG00000082996 ENSG00000082996 HGNC:10057 SGO1 gene SGO1 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Chronic atrial and intestinal dysrhythmia, MIM# 616201 25282101 False 2 0;100;0 4.430 True ENSG00000129810 ENSG00000129810 HGNC:25088 SGPL1 gene SGPL1 Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal RENI syndrome (MIM#617575) 28077491;28165339;30274713;28165343 False 2 0;100;0 4.430 True ENSG00000166224 ENSG00000166224 HGNC:10817 SLC18A3 gene SLC18A3 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myasthenic syndrome, congenital, 21, presynaptic, 617239;arthrogryposis 28188302;27590285;31059209 False 2 0;100;0 4.430 True ENSG00000187714 ENSG00000187714 HGNC:10936 SLC52A1 gene SLC52A1 Expert Review Amber;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Maternal riboflavin deficiency MONDO:0014013" 37510312;29122468;21089064 False 2 0;50;50 4.430 True ENSG00000132517 ENSG00000132517 HGNC:30225 SLC9A6 gene SLC9A6 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Mental retardation, X-linked syndromic, Christianson type, MIM# 300243 False 2 0;100;0 4.430 True ENSG00000198689 ENSG00000198689 HGNC:11079 SMAD3 gene SMAD3 Expert Review Amber;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Loeys-Dietz syndrome 3, MIM# 613795 False 2 0;100;0 4.430 True ENSG00000166949 ENSG00000166949 HGNC:6769 SMDT1 gene SMDT1 Expert Review Amber;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial disease, MONDO:0044970, SMDT1-related 37454773 False 2 0;100;0 4.430 True ENSG00000183172 ENSG00000183172 HGNC:25055 SOX10 gene SOX10 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurocristopathy;PCWH syndrome, MIM#609136;Complicated hereditary spastic paraplegia 28534044 False 2 0;100;0 4.430 True ENSG00000100146 ENSG00000100146 HGNC:11190 SPTSSA gene SPTSSA Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Spastic paraplegia 90B, autosomal recessive , MIM# 620417;Spastic paraplegia 90A, autosomal dominant, MIM# 620416 36718090;40533086 False 2 50;50;0 4.430 True ENSG00000165389 ENSG00000165389 HGNC:20361 SQSTM1 gene SQSTM1 Expert Review Amber;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 MONDO:0014640" False 2 100;0;0 4.430 True ENSG00000161011 ENSG00000161011 HGNC:11280 SQSTM1 gene SQSTM1 Expert Review Amber;Literature;Expert list;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted myopathy, distal, with rimmed vacuoles MONDO:0014945;multisystem proteinopathy 29599744;26208961;29457785 False 2 33;33;33 4.430 True Other ENSG00000161011 ENSG00000161011 HGNC:11280 SREBF2 gene SREBF2 Expert Review Amber;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary spastic paraplegia, MONDO:0019064, SREBF2-related 39814172 False 2 0;100;0 4.430 True ENSG00000198911 ENSG00000198911 HGNC:11290 SS18L1 gene SS18L1 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis (MONDO:0004976) 25888396;24360741;23708140;30976389 False 2 50;50;0 4.430 True ENSG00000184402 ENSG00000184402 HGNC:15592 SUCLA2 gene SUCLA2 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria) (MONDO:0012791;MIM#612073); Leigh -like syndrome, deafness, progressive dystonia, mild methylmaolnic acidaemia, peripheral neuropathy 20301762;35235001 False 2 0;50;50 4.430 True ENSG00000136143 ENSG00000136143 HGNC:11448 SVBP gene SVBP Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Spastic paraplegia 94, autosomal recessive, MIM# 621150" 39412222 False 2 0;100;0 4.430 True ENSG00000177868 ENSG00000177868 HGNC:29204 SVIL gene SVIL Expert Review Amber;Other;Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myofibrillar myopathy 10 (MIM#619040) 32779703 False 2 0;100;0 4.430 True ENSG00000197321 ENSG00000197321 HGNC:11480 SVIL gene SVIL Expert Review Amber;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myofibrillar myopathy, MIM#619040 32779703 False 2 0;100;0 4.430 True ENSG00000197321 ENSG00000197321 HGNC:11480 TAF15 gene TAF15 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 21438137;22065782;27810362;28889094 False 2 0;100;0 4.430 True ENSG00000172660 ENSG00000270647 HGNC:11547 TBCB gene TBCB Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder with behavioural abnormalities and childhood onset spastic paraplegia, MIM# 621382 PMID: 40856104 False 2 0;100;0 4.430 True ENSG00000105254 ENSG00000105254 HGNC:1989 TDP1 gene TDP1 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinocerebellar ataxia, autosomal recessive, with axonal neuropathy 1 , MIM# 607250 31182267;12244316;39576382 False 2 0;100;0 4.430 True ENSG00000042088 ENSG00000042088 HGNC:18884 THOC2 gene THOC2 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Arthrogryposis (MONDO:0008779), THOC2-related PMID: 34976470;37945483 False 2 0;100;0 4.430 True ENSG00000125676 ENSG00000125676 HGNC:19073 TIA1 gene TIA1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal distal myopathy, Welander type MONDO:0011466 23401021 False 2 0;100;0 4.430 True Other ENSG00000116001 ENSG00000116001 HGNC:11802 TIA1 gene TIA1 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyotrophic lateral sclerosis 26 with or without frontotemporal dementia 619133" 29235362;29886022;29773329;29699721;29216908;24659297;29457785;28817800 False 2 0;100;0 4.430 True ENSG00000116001 ENSG00000116001 HGNC:11802 TMEM43 gene TMEM43 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Emery-Dreifuss muscular dystrophy 7, autosomal dominant MONDO:0013677 21391237;30311943 False 2 0;100;0 4.430 True ENSG00000170876 ENSG00000170876 HGNC:28472 TNNC2 gene TNNC2 Expert Review Amber;Other;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital Myopathy 15 (MIM#62016) 33755597 False 2 50;50;0 4.430 True ENSG00000101470 ENSG00000101470 HGNC:11944 TNNI1 gene TNNI1 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Arthrogryposis MONDO:0008779, TNNI1-related 34934811 False 2 0;100;0 4.430 True ENSG00000159173 ENSG00000159173 HGNC:11945 TNNT1 gene TNNT1 Expert Review Green;Expert Review Amber;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Nemaline myopathy 5, Amish type MIM#605355" 31970803 False 2 50;50;0 4.430 True ENSG00000105048 ENSG00000105048 HGNC:11948 TOR1AIP1 gene TOR1AIP1 Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital myasthenic syndrome PMID: 34164833 False 2 0;100;0 4.430 True ENSG00000143337 ENSG00000143337 HGNC:29456 TRPV1 gene TRPV1 Expert Review Amber;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Exertional heat stroke;rhabdomyolysis 32471784 False 2 0;33;67 4.430 True ENSG00000196689 ENSG00000196689 HGNC:12716 TUBA4A gene TUBA4A Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Congenital myopathy 26, MIM# 621225 PMID: 38413182 False 2 0;100;0 4.430 True ENSG00000127824 ENSG00000127824 HGNC:12407 UBA5 gene UBA5 Literature;Expert Review Amber;Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypomyelinating neuropathy 32179706;26872069 False 2 0;100;0 4.430 False ENSG00000081307 ENSG00000081307 HGNC:23230 UBQLN4 gene UBQLN4 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 28463112;30804504 False 2 0;100;0 4.430 False ENSG00000160803 ENSG00000160803 HGNC:1237 UNC50 gene UNC50 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Arthrogryposis multiplex congenita MONDO:0015168 29016857;33820833;40219868 False 2 0;100;0 4.430 True ENSG00000115446 ENSG00000115446 HGNC:16046 UNC50 gene UNC50 Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal arthrogryposis multiplex congenita MONDO:0015168;congenital myasthenic syndrome MONDO:0018940 33820833;29016857;40219868 False 2 0;100;0 4.430 True ENSG00000115446 ENSG00000115446 HGNC:16046 UNC80 gene UNC80 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 27513830 False 2 0;100;0 4.430 True ENSG00000144406 ENSG00000144406 HGNC:26582 USP8 gene USP8 Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complicated hereditary spastic paraplegia 24482476 False 2 0;100;0 4.430 True ENSG00000138592 ENSG00000138592 HGNC:12631 VAMP1 gene VAMP1 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic ataxia 1, autosomal dominant, MIM# 108600" 22958904 False 2 0;100;0 4.430 True ENSG00000139190 ENSG00000139190 HGNC:12642 VPS37A gene VPS37A Expert Review Amber;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 53, autosomal recessive, MIM# 614898, AR 22717650 False 2 0;100;0 4.430 True ENSG00000155975 ENSG00000155975 HGNC:24928 VRK1 gene VRK1 Expert Review Amber;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Adult-onset spinal muscular atrophy without pontocerebellar hypoplasia;Distal hereditary motor neuropathy;dHMN/dSMA 31560180;32242460;31178479;31837156;30847374;34169149;26583493 False 2 0;50;50 4.430 True ENSG00000100749 ENSG00000100749 HGNC:12718 VRK1 gene VRK1 Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Pontocerebellar hypoplasia type 1A, OMIM# 607596" PMID: 21937992, 21937992 False 2 0;100;0 4.430 True ENSG00000100749 ENSG00000100749 HGNC:12718 WARS gene WARS Royal Melbourne Hospital;Literature;Expert Review Amber;Expert Review Amber;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronopathy, distal hereditary motor, type IX, MIM#617721 28369220;31321409;31069783 False 2 50;50;0 4.430 False ENSG00000140105 ENSG00000140105 HGNC:12729 ZBTB42 gene ZBTB42 Expert Review Amber;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 6, MIM# 616248 25055871 False 2 0;100;0 4.430 True ENSG00000179627 ENSG00000179627 HGNC:32550 ACOX1 gene ACOX1 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pseudoneonatal adrenoleukodystrophy 18536048 False 1 0;0;100 4.430 True ENSG00000161533 ENSG00000161533 HGNC:119 AIFM1 gene AIFM1 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 1 50;0;50 4.430 False ENSG00000156709 ENSG00000156709 HGNC:8768 AMACR gene AMACR Expert Review Green;Expert Review Red;Literature;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal rhabdomyolysis 20921516 False 1 50;0;50 4.430 True ENSG00000242110 ENSG00000242110 HGNC:451 AMPD1 gene AMPD1 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy due to myoadenylate deaminase deficiency 615511;Rhabdomyolysis False 1 0;0;100 4.430 True ENSG00000116748 ENSG00000116748 HGNC:468 AMPD2 gene AMPD2 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Global developmental delay, spasticity, seizures, dysmorphic facies, axonal neuropathy, agenesis of the corpus callosum and cerebellar hypoplasia on MRI 27066553 False 1 0;0;100 4.430 True ENSG00000116337 ENSG00000116337 HGNC:469 AMPD2 gene AMPD2 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 63 MIM#615686 24482476;30089829;29463858 False 1 0;0;100 4.430 True ENSG00000116337 ENSG00000116337 HGNC:469 AP1S2 gene AP1S2 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Pettigrew syndrome, MIM# 304340 30714330 False 1 0;0;100 4.430 True ENSG00000182287 ENSG00000182287 HGNC:560 ARPP21 gene ARPP21 ClinGen Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis MONDO:0004976 30811981;31653410;35525134 False 1 0;0;100 4.430 False ENSG00000172995 ENSG00000172995 HGNC:16968 ARSI gene ARSI Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Childhood onset spastic paraplegia 24482476 False 1 0;0;100 4.430 True ENSG00000183876 ENSG00000183876 HGNC:32521 ASAH1 gene ASAH1 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with progressive myoclonic epilepsy, 159950 False 1 50;0;50 4.430 True ENSG00000104763 ENSG00000104763 HGNC:735 ATP1A1 gene ATP1A1 Expert Review Red;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary spastic paraplegia 31705535 False 1 0;0;100 4.430 True ENSG00000163399 ENSG00000163399 HGNC:799 ATP1A2 gene ATP1A2 Expert Review Red;Expert list;Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypokalaemic periodic paralysis 30423015 False 1 0;0;100 4.430 True ENSG00000018625 ENSG00000018625 HGNC:800 ATP7A gene ATP7A Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal muscular atrophy, distal, X-linked 3, 300489 False 1 67;0;33 4.430 True ENSG00000165240 ENSG00000165240 HGNC:869 B3GALNT2 gene B3GALNT2 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies, type A, 11, MIM# 615181 False 1 0;0;100 4.430 True ENSG00000162885 ENSG00000162885 HGNC:28596 B3GNT2 gene B3GNT2 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy 23359570;23877401 False 1 0;0;100 4.430 True ENSG00000170340 ENSG00000170340 HGNC:15629 B3GNT4 gene B3GNT4 Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary neurological disease, MONDO:0100545, B3GNT4-related 41444428 False 1 0;0;100 4.430 False ENSG00000176383 ENSG00000176383 HGNC:15683 B3GNT4 gene B3GNT4 Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hereditary neurological disease, MONDO:0100545, B3GNT4-related 41444428 False 1 0;0;100 4.430 False ENSG00000176383 ENSG00000176383 HGNC:15683 B4GAT1 gene B4GAT1 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 13 MIM# 615287 23359570;23877401;23359570;23217742 False 1 50;0;50 4.430 True ENSG00000174684 ENSG00000174684 HGNC:15685 BANF1 gene BANF1 Literature;Expert Review Red;Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary peripheral neuropathy, MONDO:0020127, BANF1-related 36980188 False 1 0;0;100 4.430 False ENSG00000175334 ENSG00000175334 HGNC:17397 BICD2 gene BICD2 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, lower extremity-predominant, 2A, autosomal dominant, 615290;Spinal muscular atrophy, lower extremity-predominant, 2B, autosomal dominant, 618291 False 1 67;0;33 4.430 True ENSG00000185963 ENSG00000185963 HGNC:17208 CACNB1 gene CACNB1 Expert Review Red;Expert list;Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders ?Malignant hyperthermia susceptibility 27832566;8943043;29212769 False 1 0;0;100 4.430 True ENSG00000067191 ENSG00000067191 HGNC:1401 CAMLG gene CAMLG Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital disorder of glycosylation type IIz, OMIM #: 620201 35262690 False 1 0;0;100 4.430 True ENSG00000164615 ENSG00000164615 HGNC:1471 CASK gene CASK Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females FG syndrome 4, MIM# 300422;Mental retardation, with or without nystagmus, MIM# 300422 24278995 False 1 0;0;100 4.430 True ENSG00000147044 ENSG00000147044 HGNC:1497 CASQ1 gene CASQ1 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, vacuolar, with CASQ1 aggregates, MIM# 616231 False 1 0;0;100 4.430 True ENSG00000143318 ENSG00000143318 HGNC:1512 CCT5 gene CCT5 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory, with spastic paraplegia;Sensory Neuropathy with Spastic Paraplegia 16399879 False 1 0;0;100 4.430 True ENSG00000150753 ENSG00000150753 HGNC:1618 CHD8 gene CHD8 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Complex neurodevelopmental disorder MONDO:0100038" 20301347;32267004;36835142 False 1 0;50;50 4.430 True ENSG00000100888 ENSG00000100888 HGNC:20153 CHRND gene CHRND Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted congenital myopathy MONDO:0019952 38982518 False 1 0;0;100 4.430 True ENSG00000135902 ENSG00000135902 HGNC:1965 CLPP gene CLPP Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 3 MIM#614129 22037954 False 1 0;0;100 4.430 True ENSG00000125656 ENSG00000125656 HGNC:2084 COG8 gene COG8 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Congenital disorder of glycosylation, type IIh 611182" PMID: 30690882 False 1 0;0;100 4.430 True ENSG00000213380 ENSG00000213380 HGNC:18623 COL4A1 gene COL4A1 Expert Review Green;Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Recurrent rhabdomyolysis;infections;hypertrophic cardiomyopathy. 31540749 False 1 50;25;25 4.430 True ENSG00000187498 ENSG00000187498 HGNC:2202 COL4A2 gene COL4A2 Expert Review Green;Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown "Brain small vessel disease 2 614483" PMID: 25719457;30315939 False 1 50;0;50 4.430 True Other ENSG00000134871 ENSG00000134871 HGNC:2203 DAG1 gene DAG1 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 9 (MIM#616538) False 1 0;0;100 4.430 True ENSG00000173402 ENSG00000173402 HGNC:2666 DAO gene DAO Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic Lateral Sclerosis 29274788;29895397;20368421;29194436 False 1 0;0;100 4.430 True ENSG00000110887 ENSG00000110887 HGNC:2671 DCX gene DCX Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Lissencephaly, X-linked, MIM# 300067 20301364 False 1 0;0;100 4.430 True ENSG00000077279 ENSG00000077279 HGNC:2714 DNM2 gene DNM2 Royal Melbourne Hospital;Expert Review Red;Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Complicated hereditary spastic paraplegia 26517984 False 1 0;0;100 4.430 False ENSG00000079805 ENSG00000079805 HGNC:2974 DNM2 gene DNM2 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Lethal congenital contracture syndrome 5, MIM# 615368 23092955 False 1 0;0;100 4.430 True ENSG00000079805 ENSG00000079805 HGNC:2974 DYNC1H1 gene DYNC1H1 Expert Review Red;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, lower extremity-predominant 1, AD, MIM# 158600 False 1 50;0;50 4.430 True ENSG00000197102 ENSG00000197102 HGNC:2961 ECE1 gene ECE1 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?Hirschsprung disease, cardiac defects, and autonomic dysfunction MIM#613870 9915973 False 1 0;0;100 4.430 True ENSG00000117298 ENSG00000117298 HGNC:3146 EIF2S3 gene EIF2S3 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females MEHMO syndrome, MIM# 300148 23063529;27333055;28055140 False 1 0;0;100 4.430 True ENSG00000130741 ENSG00000130741 HGNC:3267 ERLIN1 gene ERLIN1 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 29453415 False 1 0;0;100 4.430 True ENSG00000107566 ENSG00000107566 HGNC:16947 EWSR1 gene EWSR1 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Amyotrophic lateral sclerosis 29731676;22454397 False 1 0;100;0 4.430 True ENSG00000182944 ENSG00000182944 HGNC:3508 EXOSC3 gene EXOSC3 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1B, MIM# 614678 23284067 False 1 0;0;100 4.430 True ENSG00000107371 ENSG00000107371 HGNC:17944 EXOSC3 gene EXOSC3 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal congenital myopathy MONDO:0019952 30025162;38982518 False 1 0;0;100 4.430 True ENSG00000107371 ENSG00000107371 HGNC:17944 EXOSC8 gene EXOSC8 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pontocerebellar hypoplasia, type 1C, MIM# 616081 24989451 False 1 0;0;100 4.430 True ENSG00000120699 ENSG00000120699 HGNC:17035 FGD1 gene FGD1 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Aarskog-Scott syndrome, MIM# 305400;Mental retardation, X-linked syndromic 16, MIM# 305400 27551683 False 1 0;0;100 4.430 True ENSG00000102302 ENSG00000102302 HGNC:3663 FGFR3 gene FGFR3 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown False 1 0;0;100 4.430 True ENSG00000068078 ENSG00000068078 HGNC:3690 FHL1 gene FHL1 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Emery-Dreifuss muscular dystrophy 6, X-linked, MIM# 300696;Myopathy, X-linked, with postural muscle atrophy, MIM# 300696;Reducing body myopathy, X-linked 1a, severe, infantile or early childhood onset, MIM# 300717;Reducing body myopathy, X-linked 1b, with late childhood or adult onset, MIM# 300718;Scapuloperoneal myopathy, X-linked dominant, MIM# 300695 False 1 0;0;100 4.430 True ENSG00000022267 ENSG00000022267 HGNC:3702 FKTN gene FKTN Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 4 253800;Fukuyama congenital muscular dystrophy False 1 0;0;100 4.430 True ENSG00000106692 ENSG00000106692 HGNC:3622 FOXG1 gene FOXG1 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Rett syndrome False 1 0;0;100 4.430 True ENSG00000176165 ENSG00000176165 HGNC:3811 FOXK2 gene FOXK2 Expert Review Red;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Myopathy, MONDO:0005336, FOXK2-related 40410591 False 1 0;0;100 4.430 True ENSG00000141568 ENSG00000141568 HGNC:6036 FOXP3 gene FOXP3 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females congenital myopathy MONDO:0019952 38982518 False 1 0;0;100 4.430 True ENSG00000049768 ENSG00000049768 HGNC:6106 GAD1 gene GAD1 Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebralpalsy, spasticquadriplegic,1, 603513 15571623 False 1 0;0;100 4.430 True ENSG00000128683 ENSG00000128683 HGNC:4092 GDNF gene GDNF Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted {Hirschsprung disease, susceptibility to, 3} MIM#613711 18276829;8896568;8657308;11973622 False 1 0;0;100 4.430 True ENSG00000168621 ENSG00000168621 HGNC:4232 GJB3 gene GJB3 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders HMSN;erythrokeratodermia variabilis, hearing impairment and peripheral neuropathy False 1 0;0;100 4.430 True ENSG00000188910 ENSG00000188910 HGNC:4285 GNE gene GNE Expert Review Green;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Amyotrophic lateral sclerosis 29086072 False 1 50;0;50 4.430 False ENSG00000159921 ENSG00000159921 HGNC:23657 GPC3 gene GPC3 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Simpson-Golabi-Behmel syndrome, type 1, MIM# 312870 20301398 False 1 0;0;100 4.430 True ENSG00000147257 ENSG00000147257 HGNC:4451 GRID2 gene GRID2 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Complicated spastic paraplegia 24122788 False 1 0;0;100 4.430 True ENSG00000152208 ENSG00000152208 HGNC:4576 HARS2 gene HARS2 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 2, MIM#614926 False 1 0;0;100 4.430 True ENSG00000112855 ENSG00000112855 HGNC:4817 HSPB3 gene HSPB3 Royal Melbourne Hospital;Expert Review Red;Expert Review Red Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown HMSN, dHMN/dSMA;?Neuronopathy, distal hereditary motor, type IIC, 613376 20142617;27549087 False 1 0;0;100 4.430 False ENSG00000169271 ENSG00000169271 HGNC:5248 IDUA gene IDUA Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal congenital myopathy MONDO:0019952 38982518 False 1 0;0;100 4.430 True ENSG00000127415 ENSG00000127415 HGNC:5391 IFRD1 gene IFRD1 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hereditary spastic paraplegia MONDO:0019064, IFRD1-related 29362493 False 1 0;0;100 4.430 True ENSG00000006652 ENSG00000006652 HGNC:5456 IFRD1 gene IFRD1 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Hereditary spastic paraplegia MONDO:0019064, IFRD1-related 29362493;19409521 False 1 0;0;100 4.430 True ENSG00000006652 ENSG00000006652 HGNC:5456 IGHMBP2 gene IGHMBP2 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuronopathy, distal hereditary motor, type VI 604320 False 1 50;0;50 4.430 True ENSG00000132740 ENSG00000132740 HGNC:5542 IQGAP3 gene IQGAP3 Literature;Expert Review Red;Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hereditary neuropathy 32341455 False 1 0;0;100 4.430 False ENSG00000183856 ENSG00000183856 HGNC:20669 KCNE3 gene KCNE3 Expert Review Red;Expert list;Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Periodic paralysis 14504341;11207363;16449802;15037716;20051516;28356343 False 1 0;0;100 4.430 True ENSG00000175538 ENSG00000175538 HGNC:6243 KCNJ11 gene KCNJ11 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hyperinsulinemic hypoglycemia, familial, 2 MIM#601820 False 1 50;0;50 4.430 True ENSG00000187486 ENSG00000187486 HGNC:6257 KCNJ18 gene KCNJ18 Expert Review Red;Expert list;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hypokalemic periodic paralysis;{Thyrotoxic periodic paralysis, susceptibility to, 2}, MIM# 613239 25882930;27178871;20074522;27008341 False 1 0;0;100 4.430 True - ENSG00000260458 HGNC:39080 KCNJ5 gene KCNJ5 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Andersen-Tawil Syndrome;periodic muscle paralysis 24574546 False 1 0;0;100 4.430 True ENSG00000120457 ENSG00000120457 HGNC:6266 KIF1B gene KIF1B Royal Melbourne Hospital;Expert Review Red;Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Charcot Marie Tooth disease, type 2A1, 118210;HMSN 11389829;30126838;25802885 False 1 0;33;67 4.430 False ENSG00000054523 ENSG00000054523 HGNC:16636 KIF26B gene KIF26B Expert Review Red;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Multiple congenital anomalies MONDO:0019042, KIF26B-related 30151950 False 1 0;0;100 4.430 True ENSG00000162849 ENSG00000162849 HGNC:25484 KLC4 gene KLC4 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegeneration, early-childhood-onset, with retinitis pigmentosa, sensorineural hearing loss, and demyelinating peripheral neuropathy, MIM# 621129 26423925 False 1 0;0;100 4.430 True ENSG00000137171 ENSG00000137171 HGNC:21624 KLHL13 gene KLHL13 Royal Melbourne Hospital;Expert Review Red;Expert Review;Expert Review Red;Expert Review Red;Expert Review;Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females HMSN 24627108 False 1 0;0;100 4.430 False ENSG00000003096 ENSG00000003096 HGNC:22931 L1CAM gene L1CAM Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Hydrocephalus due to aqueductal stenosis 307000 31504653 False 1 0;0;100 4.430 True ENSG00000198910 ENSG00000198910 HGNC:6470 LAMA5 gene LAMA5 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Presynaptic congenital myasthenic syndrome 28544784;29377152 False 1 0;0;100 4.430 True ENSG00000130702 ENSG00000130702 HGNC:6485 LAMB2 gene LAMB2 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Pierson syndrome, MIM# 609049;congenital myasthenic syndrome (CMS) associated with congenital nephrosis and ocular malformations 19251977 False 1 0;0;100 4.430 True ENSG00000172037 ENSG00000172037 HGNC:6487 LARS2 gene LARS2 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Perrault syndrome 4 MIM#615300 False 1 0;0;100 4.430 True ENSG00000011376 ENSG00000011376 HGNC:17095 LAS1L gene LAS1L Expert Review Green;Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females congenital lethal motor neuron disease 24647030 False 1 50;0;50 4.430 True ENSG00000001497 ENSG00000001497 HGNC:25726 LAS1L gene LAS1L Expert Review;Expert Review Red;Expert Review Green;Expert Review Red;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females congenital lethal motor neuron disease 24647030 False 1 0;0;100 4.430 False ENSG00000001497 ENSG00000001497 HGNC:25726 MARS gene MARS Royal Melbourne Hospital;Expert Review Red;Expert Review Red Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN;Charcot-Marie-Tooth disease, axonal, type 2U, 616280 23729695;24354524;29655802 False 1 0;50;50 4.430 False ENSG00000166986 ENSG00000166986 HGNC:6898 MED25 gene MED25 Victorian Clinical Genetics Services;Expert list;Expert Review Red;Expert Review Green;Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Charcot-Marie-Tooth disease, type 2B2 MIM#605589" 19290556;30039206 False 1 0;0;100 4.430 False ENSG00000104973 ENSG00000104973 HGNC:28845 MIR145 gene MIR145 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown multisystemic smooth muscle dysfunction syndrome (MONDO:0013452) 36649075 False 1 0;0;100 4.430 True - - HGNC:31532 MMS19 gene MMS19 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodegenerative disease, MONDO:0005559, MMS19-related 38411040 False 1 0;0;100 4.430 True ENSG00000155229 ENSG00000155229 HGNC:13824 MTPAP gene MTPAP Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Spastic ataxia 4, autosomal recessive, 613672;Ataxia, spastic, 4;Spastic ataxia 4, autosomal recessive 27391121;20970105 False 1 0;0;100 4.430 True ENSG00000107951 ENSG00000107951 HGNC:25532 MT-RNR2 gene MT-RNR2 Expert Review Red;Expert Review;Literature;Literature;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders MITOCHONDRIAL mitochondrial disease MONDO:0044970, MT-RNR2-related 29233888;17761147;24367055 False 1 0;0;100 4.430 True ENSG00000210082 ENSG00000210082 HGNC:7471 MYBPC3 gene MYBPC3 Expert Review Red;Expert list;Expert Review Amber;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cardiomyopathy with myopathy PMID: 19858127 False 1 0;50;50 4.430 True ENSG00000134571 ENSG00000134571 HGNC:7551 MYH1 gene MYH1 Expert Review Red;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal rhabdomyolysis, MONDO:0005290 33755318 False 1 0;0;100 4.430 True ENSG00000109061 ENSG00000109061 HGNC:7567 MYH3 gene MYH3 Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted paresthesia;rhabdomyolysis 28779239 False 1 50;0;50 4.430 True ENSG00000109063 ENSG00000109063 HGNC:7573 MYH7 gene MYH7 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Laing distal myopathy 160500;Myopathy, myosin storage, autosomal dominant 608358;Myopathy, myosin storage, autosomal recessive 255160;Scapuloperoneal syndrome, myopathic type 181430 29300372;30924982;24714796;30623132;27519903 False 1 50;0;50 4.430 True ENSG00000092054 ENSG00000092054 HGNC:7577 MYL1 gene MYL1 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Myopathy, congenital, with fast-twitch (type II) fiber atrophy, MIM# 618414 30215711 False 1 0;0;100 4.430 True ENSG00000168530 ENSG00000168530 HGNC:7582 NAMPT gene NAMPT Literature;Expert Review Red;Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal hereditary motor and sensory neuropathy MONDO:0015358 41004591 False 1 0;0;100 4.430 False ENSG00000105835 ENSG00000105835 HGNC:30092 NEFH gene NEFH Expert Review Red;ClinGen Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted amyotrophic lateral sclerosis MONDO:0004976 False 1 0;0;100 4.430 True ENSG00000100285 ENSG00000100285 HGNC:7737 NFATC2 gene NFATC2 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Skeletal system disorder MONDO:0005172 35789258 False 1 0;0;100 4.430 True ENSG00000101096 ENSG00000101096 HGNC:7776 NRG1 gene NRG1 Expert list;Expert Review;Expert Review Red;Expert Review Red;Expert Review Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Peripheral neuropathy MONDO:0005244 35485770 False 1 0;0;100 4.430 False ENSG00000157168 ENSG00000157168 HGNC:7997 NRG3 gene NRG3 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Hirschsprung disease 23315268 False 1 0;0;100 4.430 True ENSG00000185737 ENSG00000185737 HGNC:7999 NRTN gene NRTN Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown Hirschsprung disease 21206993;10069332;9700200 False 1 0;0;100 4.430 True ENSG00000171119 ENSG00000171119 HGNC:8007 OFD1 gene OFD1 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, monoallelic mutations in females may cause disease (may be less severe, later onset than males) Joubert syndrome 10, MIM# 300804;Orofaciodigital syndrome I, MIM# 311200;Simpson-Golabi-Behmel syndrome, type 2, MIM# 300209 20301367 False 1 0;0;100 4.430 True ENSG00000046651 ENSG00000046651 HGNC:2567 OPA1 gene OPA1 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted gastrointestinal pseudo-obstruction 30395865 False 1 50;0;50 4.430 True ENSG00000198836 ENSG00000198836 HGNC:8140 OPA1 gene OPA1 Expert Review Red;Literature;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal congenital myopathy MONDO:0019952 38982518 False 1 0;50;50 4.430 True ENSG00000198836 ENSG00000198836 HGNC:8140 PCP4 gene PCP4 Expert Review Red;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Familial amyotrophic lateral sclerosis, MONDO:0005144, PCP4-related 39852553 False 1 0;0;100 4.430 True ENSG00000183036 ENSG00000183036 HGNC:8742 PEX7 gene PEX7 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Refsum disease;Phytanic acid storage disease 20301447;12325024 False 1 0;0;100 4.430 True ENSG00000112357 ENSG00000112357 HGNC:8860 PGAP1 gene PGAP1 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mental retardation, autosomal recessive 42 24482476 False 1 0;0;100 4.430 True ENSG00000197121 ENSG00000197121 HGNC:25712 PHKB gene PHKB Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Phosphorylase kinase deficiency of liver and muscle, autosomal recessive 261750 9215682;30397902 False 1 50;0;50 4.430 True ENSG00000102893 ENSG00000102893 HGNC:8927 PLEKHG5 gene PLEKHG5 Expert Review Red;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy, distal, autosomal recessive, 4, MIM# 611067 17564964 False 1 0;0;100 4.430 True ENSG00000171680 ENSG00000171680 HGNC:29105 PLOD1 gene PLOD1 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ehlers-Danlos syndrome, kyphoscoliotic type, MIM# 225400 False 1 0;0;100 4.430 True ENSG00000083444 ENSG00000083444 HGNC:9081 POLG2 gene POLG2 Expert Review Green;Expert Review Red;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 4 MIM#610131 21555342;27775730 False 1 50;0;50 4.430 True ENSG00000256525 ENSG00000256525 HGNC:9180 RAPGEF2 gene RAPGEF2 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neurodevelopmental disorder, MONDO:0700092;amyotrophic lateral sclerosis MONDO:0004976 41556274;30636905 False 1 0;0;100 4.430 True ENSG00000109756 ENSG00000109756 HGNC:16854 RBM10 gene RBM10 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females TARP syndrome, MIM# 311900 False 1 0;0;100 4.430 True ENSG00000182872 ENSG00000182872 HGNC:9896 RBM7 gene RBM7 Expert Review Red;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal SMA-like spinal motor neuropathy;dHMN/dSMA 27193168 False 1 0;0;100 4.430 False ENSG00000076053 ENSG00000076053 HGNC:9904 RPH3A gene RPH3A Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Presynaptic congenital myasthenic syndrome with altered synaptic vesicle homeostasis 29441694 False 1 0;0;100 4.430 True ENSG00000089169 ENSG00000089169 HGNC:17056 SARS2 gene SARS2 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Progressive spastic paraplegia 27279129 False 1 0;0;100 4.430 True ENSG00000104835 ENSG00000104835 HGNC:17697 SEMA3C gene SEMA3C Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown Hirschsprung disease 25839327 False 1 0;0;100 4.430 True ENSG00000075223 ENSG00000075223 HGNC:10725 SEMA3D gene SEMA3D Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown Hirschsprung disease 28334784;25839327 False 1 0;0;100 4.430 True ENSG00000153993 ENSG00000153993 HGNC:10726 SH3BP4 gene SH3BP4 Royal Melbourne Hospital;Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted HMSN 24627108 False 1 0;0;100 4.430 False ENSG00000130147 ENSG00000130147 HGNC:10826 SLC19A3 gene SLC19A3 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Biotin-thiamine-responsive basal ganglia disease, MIM#607483 False 1 0;0;100 4.430 True ENSG00000135917 ENSG00000135917 HGNC:16266 SLC33A1 gene SLC33A1 Expert Review Red;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Spastic paraplegia 42, autosomal dominant, MIM# 612539" 19061983;20461110 False 1 0;0;100 4.430 True ENSG00000169359 ENSG00000169359 HGNC:95 SLC52A1 gene SLC52A1 Expert Review Red;Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Riboflavin deficiency, MIM#615026 29122468;17689999 False 1 0;0;100 4.430 True ENSG00000132517 ENSG00000132517 HGNC:30225 SNAP25 gene SNAP25 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted ?Myasthenic syndrome, congenital, 18, 616330 25381298 False 1 0;0;100 4.430 True ENSG00000132639 ENSG00000132639 HGNC:11132 SOX8 gene SOX8 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder (MONDO:0700092), SOX8-related https://www.neurology.org/doi/full/10.1212/NXG.0000000000200088 False 1 0;0;100 4.430 True ENSG00000005513 ENSG00000005513 HGNC:11203 STXBP1 gene STXBP1 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Spasticity;Early infantile epileptic encephalopathy 4 32815282 False 1 0;0;100 4.430 True ENSG00000136854 ENSG00000136854 HGNC:11444 TBX22 gene TBX22 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders Unknown Cleft palate with ankyloglossia, MIM# 303400 False 1 0;0;100 4.430 True ENSG00000122145 ENSG00000122145 HGNC:11600 TCAP gene TCAP Expert Review Green;Expert Review Red;Victorian Clinical Genetics Services;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy, limb-girdle, autosomal recessive 7 (MIM#601954) 25055047;22029105;18948002 False 1 50;0;50 4.430 True ENSG00000173991 ENSG00000173991 HGNC:11610 TMEM5 gene TMEM5 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 10, MIM# 615041 False 1 0;0;100 4.430 True ENSG00000118600 ENSG00000118600 HGNC:13530 TMEM70 gene TMEM70 NHS GMS Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial complex V (ATP synthase) deficiency, nuclear type 2 MIM#614052 21147908 False 1 0;100;0 4.430 False ENSG00000175606 ENSG00000175606 HGNC:26050 TPP1 gene TPP1 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Ceroid lipofuscinosis neuronal 2, MIM#204500 27217339 False 1 0;0;100 4.430 True ENSG00000166340 ENSG00000166340 HGNC:2073 TRAPPC2L gene TRAPPC2L Expert Review Red;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Encephalopathy, progressive, early-onset, with episodic rhabdomyolysis, 618331 30120216;32843486 False 1 0;50;50 4.430 True ENSG00000167515 ENSG00000167515 HGNC:30887 TRIM72 gene TRIM72 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Limb girdle muscular dystrophy MONDO:0016971, TRIM72-related 40804694 False 1 0;0;100 4.430 True ENSG00000177238 ENSG00000177238 HGNC:32671 TRIP4 gene TRIP4 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spinal muscular atrophy with congenital bone fractures 1, MIM# 616866 26924529 False 1 0;0;100 4.430 True ENSG00000103671 ENSG00000103671 HGNC:12310 TRMT1L gene TRMT1L Expert Review Red;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, TRMT1L-related 39786990 False 1 0;0;100 4.430 True ENSG00000121486 ENSG00000121486 HGNC:16782 TRMT1L gene TRMT1L Expert Review Red;Literature;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neurodevelopmental disorder, MONDO:0700092, TRMT1L-related 39786990 False 1 0;0;100 4.430 True ENSG00000121486 ENSG00000121486 HGNC:16782 TRPA1 gene TRPA1 Royal Melbourne Hospital;Expert Review Red;Expert Review Red Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Episodic pain syndrome, familial, 1;HSAN/SFN 20547126 False 1 0;0;100 4.430 False ENSG00000104321 ENSG00000104321 HGNC:497 TRPV4 gene TRPV4 Expert Review Red;Expert list;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinal muscular atrophy, distal, congenital nonprogressive, 600175 False 1 50;0;50 4.430 True ENSG00000111199 ENSG00000111199 HGNC:18083 TSEN54 gene TSEN54 Expert Review Red;Expert Review Green;Royal Melbourne Hospital;Expert list;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal ?Pontocerebellar hypoplasia type 5 610204;Pontocerebellar hypoplasia type 4 225753;Pontocerebellar hypoplasia type 2A 277470 23177318 False 1 50;0;50 4.430 True ENSG00000182173 ENSG00000182173 HGNC:27561 TTN gene TTN Expert Review Green;Expert Review Red;Expert Review;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Congenital titinopathy;exercise intolerance 31353864 False 1 33;0;67 4.430 True ENSG00000155657 ENSG00000155657 HGNC:12403 TTR gene TTR Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Amyloidosis, hereditary, transthyretin-related, MIM# 105210 8960746 False 1 0;0;100 4.430 True ENSG00000118271 ENSG00000118271 HGNC:12405 TYMP gene TYMP Expert Review Green;Expert Review Red;Royal Melbourne Hospital;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Mitochondrial DNA depletion syndrome 5 (encephalomyopathic with or without methylmalonic aciduria) 612073 24199812 False 1 67;0;33 4.430 True ENSG00000025708 ENSG00000025708 HGNC:3148 UBA1 gene UBA1 Expert Review Red;Expert Review Green;Expert list;Royal Melbourne Hospital;Melbourne Genomics Health Alliance Complex Neurology Flagship;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal muscular atrophy, X-linked 2, infantile, MIM# 301830 18179898;32181232;31932168;29034082;27699224;26028276;23518311 False 1 50;0;50 4.430 True ENSG00000130985 ENSG00000130985 HGNC:12469 UNC13A gene UNC13A Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal microcephaly, cortical hyperexcitability, and fatal myasthenia;dyskinesia;autism;developmental delay 19558619;27648472 False 1 0;0;100 4.430 True ENSG00000130477 ENSG00000130477 HGNC:23150 UNC80 gene UNC80 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Hypotonia, infantile, with psychomotor retardation and characteristic facies 2, MIM# 616801 26545877;26708753;26708751 False 1 0;0;100 4.430 True ENSG00000144406 ENSG00000144406 HGNC:26582 USP14 gene USP14 Expert Review Red;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Syndromic disease MONDO:0002254, USP14-related;Distal arthrogryposis, corpus callosum anomalies, and dysmorphic features PMID: 35066879 False 1 0;0;100 4.430 True ENSG00000101557 ENSG00000101557 HGNC:12612 WDR48 gene WDR48 Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Spastic paraplegia 24482476 False 1 0;0;100 4.430 True ENSG00000114742 ENSG00000114742 HGNC:30914 ZFR gene ZFR Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Complicated hereditary spastic paraplegia 24482476 False 1 0;0;100 4.430 True ENSG00000056097 ENSG00000056097 HGNC:17277 ZFYVE27 gene ZFYVE27 Royal Melbourne Hospital;Expert Review Red;Royal Melbourne Hospital Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spastic paraplegia 33, autosomal dominant, MIM#610244 29980238;18606302;16826525 False 1 0;0;100 4.430 False ENSG00000155256 ENSG00000155256 HGNC:26559 ZIC3 gene ZIC3 Expert Review Red;Victorian Clinical Genetics Services Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Heterotaxy, visceral, 1, X-linked, MIM# 306955;VACTERL association, X-linked, MIM# 314390 False 1 0;0;100 4.430 True ENSG00000156925 ENSG00000156925 HGNC:12874 ABCD3_OPDM_GCC str ABCD3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 5, MIM# 621446 39068203 False 3 100;0;0 4.430 True ENSG00000117528 ENSG00000117528 HGNC:67 1 94883977 94883998 94418421 94418442 GCC 50 118 AR_SBMA_CAG str AR Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders X-LINKED: hemizygous mutation in males, biallelic mutations in females Spinal and bulbar muscular atrophy of Kennedy MIM#313200 20301508;29325606 False 3 100;0;0 4.430 True ENSG00000169083 ENSG00000169083 HGNC:644 X 66765160 66765225 67545318 67545383 CAG 34 38 ATXN2_SCA2_CAG str ATXN2 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Spinocerebellar ataxia 2 MIM#183090 20301452 False 3 100;0;0 4.430 True ENSG00000204842 ENSG00000204842 HGNC:10555 12 112036755 112036823 111598951 111599016 CAG 31 35 C9orf72_FTDALS_GGGGCC str C9orf72 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 MIM#105550 25577942;21944779;21944778 False 3 100;0;0 4.430 True ENSG00000147894 ENSG00000147894 HGNC:28337 9 27573427 27573544 27573529 27573546 GGGGCC 25 60 CNBP_DM2_CCTG str CNBP Expert list;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 2 MIM#602668 20301639;11486088 False 3 100;0;0 4.430 False ENSG00000169714 ENSG00000169714 HGNC:13164 3 128891420 128891499 129172577 129172656 CCTG 26 75 CNBP_DM2_CCTG str CNBP Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 2 MIM#602668 20301639;11486088 False 3 100;0;0 4.430 True ENSG00000169714 ENSG00000169714 HGNC:13164 3 128891420 128891499 129172577 129172656 CCTG 26 75 DMPK_DM1_CTG str DMPK Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 1 MIM#160900 20301344;29325606 False 3 100;0;0 4.430 True ENSG00000104936 ENSG00000104936 HGNC:2933 19 46273463 46273522 45770205 45770264 CTG 34 50 DMPK_DM1_CTG str DMPK Expert list;Expert Review Green;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Myotonic dystrophy 1 MIM#160900 20301344;29325606;1546325 False 3 100;0;0 4.430 False ENSG00000104936 ENSG00000104936 HGNC:2933 19 46273463 46273522 45770205 45770264 CTG 34 50 FXN_FRDA_GAA str FXN Expert Review Green;Expert List Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 20301458;8596916 False 3 100;0;0 4.430 True ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037301 GAA 33 66 FXN_FRDA_GAA str FXN Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Friedreich ataxia MIM#229300 20301458;8596916 False 3 100;0;0 4.430 True ENSG00000165060 ENSG00000165060 HGNC:3951 9 71652203 71652220 69037287 69037304 GAA 33 66 GIPC1_OPDM2_CGG str GIPC1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 2 MIM#618940 32413282;33374016 False 3 100;0;0 4.430 True ENSG00000123159 ENSG00000123159 HGNC:1226 19 14606854 14606886 14496042 14496074 CGG 32 70 LRP12_ALS_CGG str LRP12 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted "Amyotrophic lateral sclerosis MONDO:0004976;Amyotrophic lateral sclerosis 28, MIM# 620452" 37339631 False 3 100;0;0 4.430 True ENSG00000147650 ENSG00000147650 HGNC:31708 8 105601201 105601227 104588973 104588999 CGG 50 61 LRP12_OPDM1_CGG str LRP12 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy 1 MIM#164310 31332380;34047774 False 3 100;0;0 4.430 True ENSG00000147650 ENSG00000147650 HGNC:31708 8 105601201 105601227 104588973 104588999 CGG 45 85 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 4.430 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 NOTCH2NLC_NIID_GGC str NOTCH2NLC Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Neuronal intranuclear inclusion disease MIM#603472;Oculopharyngodistal myopathy 3 MIM#619473;Tremor, hereditary essential, 6 MIM#618866 31178126;31332381;31819945;33887199;33943039;32250060;31332380;32852534;32989102;34333668 False 3 100;0;0 4.430 True ENSG00000286219 ENSG00000286219 HGNC:53924 1 145209324 145209344 149390803 149390829 GGC 40 60 NUTM2B-AS1_OPDM_CCG str NUTM2B-AS1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 31332380;37923380;39308795;38159879 False 3 100;0;0 4.430 True ENSG00000225484 ENSG00000225484 HGNC:51204 10 81586142 81586159 79826386 79826403 CCG 16 35 PABPN1_OPMD_GCN str PABPN1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BOTH monoallelic and biallelic, autosomal or pseudoautosomal Oculopharyngeal muscular dystrophy MIM#164300 9462747;20301305 False 3 100;0;0 4.430 True ENSG00000100836 ENSG00000100836 HGNC:8565 14 23790682 23790711 23321473 23321502 GCN 10 11 PLIN4_MRUPAV_33-mer str PLIN4 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted myopathy, distal, with rimmed vacuoles MONDO:0014945 32451610;37145156;36151849;35499779 False 3 100;0;0 4.430 True ENSG00000167676 ENSG00000167676 HGNC:29393 19 4510975 4511073 4510963 4511061 ACTGAAGACAGTGTCCTTGGTACCCATAAGCACAGCCTTGGAGGCGTCCACGCCGGTCTGCACGGTTCCTTTGGCCACATTCACTGCCCCCGTGACTCC 31 39 PRDM12_HSAN8_GCC str PRDM12 Literature;Expert Review Green;Expert Review Green;Literature;Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Neuropathy, hereditary sensory and autonomic, type VIII MIM#616488 26005867 False 3 100;0;0 4.430 False ENSG00000130711 ENSG00000130711 HGNC:13997 9 133556993 133557026 130681606 130681639 GCC 14 18 RFC1_CANVAS_ANNGN str RFC1 Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome MIM#614575 30926972 False 3 100;0;0 4.430 True ENSG00000035928 ENSG00000035928 HGNC:9969 4 39350045 39350103 39348425 39348483 ANNGN 0 400 RILPL1_OPDM4_CGG str RILPL1 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted Oculopharyngodistal myopathy MONDO:0025193 35148830 False 3 100;0;0 4.430 True ENSG00000188026 ENSG00000188026 HGNC:26814 12 124018270 124018296 123533723 123533749 CGG 16 139 VWA1_HMNMYO_GCGCGGAGCG str VWA1 Literature;Expert Review Green;Expert Review Green;Literature;Literature;Expert Review Green;Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders BIALLELIC, autosomal or pseudoautosomal "Neuropathy, hereditary motor, with myopathic features MIM#619216" 33559681;33459760 False 3 100;0;0 4.430 False ENSG00000179403 ENSG00000179403 HGNC:30910 1 1371179 1371198 1435799 1435818 GCGCGGAGCG 2 3 ZFHX3_SCA4_GGC str ZFHX3 Expert Review Green;Literature Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, NOT imprinted spinocerebellar ataxia type 4 MONDO:0010847 38035881;38197134 False 3 100;0;0 4.430 True ENSG00000140836 ENSG00000140836 HGNC:777 16 72821594 72821657 72787695 72787758 GGC 30 48 ISCA-37436-Gain region Expert list;Expert Review Green;Expert list;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Charcot-Marie-Tooth disease type 1A, MIM#118220 PMID: 32648354 False 3 100;0;0 4.430 False 17 14194598 15567587 3 80 cnv_gain Charcot-Marie-Tooth disease type 1A ISCA-37436-Loss region Expert list;Expert Review Green;Expert Review Green;Expert list;Expert Review Green;Expert list Neuromuscular Superpanel Neurology and neurodevelopmental disorders MONOALLELIC, autosomal or pseudoautosomal, imprinted status unknown Neuropathy, recurrent, with pressure palsies, MIM# 162500 PMID: 32356557;31118906;24726093 False 3 100;0;0 4.430 False 17 14194598 15567587 3 80 cnv_loss Hereditary neuropathy with liability to pressure palsies